EP1554307A2

EP1554307A2 - Antagonists il-15

Info

Publication number: EP1554307A2
Application number: EP03750224A
Authority: EP
Inventors: Ingeborg Dreher; Thomas Moll
Original assignee: F Hoffmann La Roche AG
Current assignee: F Hoffmann La Roche AG
Priority date: 2002-10-14
Filing date: 2003-10-13
Publication date: 2005-07-20
Also published as: KR20050049545A; US20060236411A1; CA2502316A1; PL376509A1; CN1703423A; BR0315327A; WO2004035622A2; RU2005114526A; AU2003269659A1; WO2004035622A3; MXPA05003887A; JP2006518583A

Abstract

The invention relates to fusion proteins consisting of a wild-type IL-15 and a IgG-Fc fragment, apart from a mouse IgG2b fragment, nucleic acids encoding said proteins, vectors, modified cells, and also to the use thereof for preparing drugs which are used, for example for preventing and/or curing disorders resulting from a transplantation and/or autoimmune diseases.

Description

IL-15 antagonists

The invention relates to fusion proteins from a wild-type E -15 and an IgG-Fc fragment and to their production and use for inhibiting immune reactions and for the prophylaxis and / or therapy of secondary transplant and / or autoimmune diseases.

An effective immune response is initiated by the activation of T cells in the immune system, which is triggered by an antigen or mitogen. The activation of the T cells requires numerous cellular changes, these include e.g. the expression of cytokines and their receptors. These cytokines include IL-15 and E -2.

IL-15 and IL-2 are known growth factors that play a significant role in the proliferation and differentiation of human and murine T cells, macrophages, natural killer (NK) cells, cytotoxic T cells (CTL), lymphocyte-activated Killer (LAK) cells and in the costimulation of B cells that have been activated, for example, by anti-immunoglobulin (anti-IgM) or phorbol esters. The proliferation of these cells increases an organism's immune response.

LL-15 was first described as a secretory cytokine that induces the proliferation of IL-2 dependent murine cytotoxic T cells (CTLL-2). IL-15 has been characterized as a 162 amino acid precursor protein with a leader sequence of 48 amino acids, ie a mature protein of 114 amino acids in length (Grabstein et al., (1994) Science 264 (5161): 965-8).

IL-15 is produced in epithelial and fibroblast cell lines as well as peripheral blood monocytes. Its specific mRNA was also found in the placenta, skeletal muscles and kidneys (Grabstein et al., Supra)

In addition to the common biological properties, IL-15 and IL-2 also have homologous structures. Both molecules bind to at least three separated receptor subunits on the membrane of T cells, the beta and gamma subunit complexes via which the signal transduction is the same, while the alpha subunit is specific for the binding of IL-15 and IL-2, respectively , It was found that antibodies directed against the alpha subunit of the IL-2 receptor had no effect on the IL-15 binding to its specific alpha subunit (Grabstein et al., Supra), whereas antibodies directed against the beta Subunit of the IL-2 receptor were directed to block the activity of IL-15 (Giri et al, (1994) EMBO J., 13: 2822). Signal transduction takes place via the beta and gamma subunits of IL-15.

For numerous diseases, for therapeutic reasons, it is necessary to suppress a response from the patient's immune system. These include, for example, autoimmune diseases, in particular type I diabetes mellitus (Bottazzo, GF, et al, (1985) N Engl J Med 113: 353), rheumatoid arthritis, multiple sclerosis, chronic liver diseases, inflammatory bowel diseases, transplant-anti- Graft versus host disease (GVHD) and graft rejection (Sakai et al., (1998) Gastroenterology, 114 (6): 1237-1243; Kivakakk et al., (1998) Clin Exp Immunol, 111 (1): 193197).

If inimun-competent cells are transmitted from a genetically non-identical organism, these cells react to the recipient organism (GVHD) (Janeway CA and Travers P., Spectrum Verlag, German edition 1995 p. 467).

For many life-threatening diseases, organ or tissue transplantation has become the standard method and in many cases the only life-saving treatment. However, there are difficulties with regard to rejection reactions of the recipient organism, which are caused by immune responses to the foreign cell surface antigens of the graft. _t In the case of a transplant, the degree of graft rejection depends on the extent of the histogenetic difference between donor and recipient (histocompatibility). Differences in the antigen pattern of the donor and recipient organisms in the latter cause an immune reaction, resulting in a rejection reaction, against the graft. Rejection of a graft occurs through both humoral and cellular reactions. Humoral effectors are antibodies of different specificity, such as, for example, antibody-dependent cell-mediated cytotoxicity and antibodies against structures of the donor HLA system. Cellular effectors are in particular cytotoxic T cells in connection with macrophages (Immunologie, Janeway CA and Travers P., Spectrum Verlag, German edition 1995, pp. 522-8).

One therapeutic approach is to suppress the humoral or cellular immune response by immunosuppressia, in particular antagonistic IL-15 or IL-2 antibodies or IL-15 or IL-2 antagonists.

Various therapies using antibodies against IL-15 and IL-2 molecules have been described. For example, the prolonged survival of an allografted primate heart could be achieved by administering the monoclonal antibody anti-IL-2R.beta (Mik.beta-1) (Tinubu et al., (1994) J Immunol. 153: 4330). Furthermore, blocking of graft rejection by monoclonal antibodies directed against the T cell-specific antigen CD3 has been described (Mackie et al., (1990) Transplantation 49: 1150).

Furthermore, numerous IL-15 antagonists have been described which change the binding behavior of IL-15 to its receptor. These antagonists were obtained by introducing mutation (s) into the wild-type IL-15 sequence. For example, a mutation at amino acid position 56 (aspartate) [position 8 after cleavage of the leader sequence] has been described, through which binding to the alpha subunit of the IL-15 receptor took place, however binding to the beta subunit was prevented (WO 96/26274). In another approach, the interaction with the gamma subunit was inhibited by a mutation at amino acid position 156 (glutamine) [position 108 after cleavage of the leader sequence] (WO 96/26274; WO 97/41232). Furthermore, binding to the alpha subunit was made possible by PEGylated IL-15. For steric reasons, however, binding to the beta subunit was no longer possible (Pettit et al., (1997) J Biol Chem, 272 4: 2312-2318).

The IL-15 antagonists described are mutated IL-15 (mut-IL-15) sequences which have antagonistic effects either by themselves or as a fusion protein. Such fusion proteins are polypeptides consisting of an N-terminal mut-IL-15 fragment and a C-terminal Fc fragment, in particular a murine IgG2a or human IgGl (WO 97/41232; Kim et al., (1998) J Immunol ., 160: 5742-5748).

An Fc (fragment crystallizable) fragment is to be understood as the fragment of an antibody that does not bind any antigens. The two other identical Fab (fragment antigen binding) fragments of an antibody have antigen binding activity (Immunology, Janeway CA and Travers P., German edition (1995), p. 117 and the following).

However, a disadvantage of these mutated IL-15 molecules is that they have a changed primary, secondary and tertiary structure compared to the wild-type IL-15 and therefore have different degradation points, so that degradation products occur which do not occur naturally in the cells, and can have a toxic effect on the organism. The nature and extent of such and other side effects cannot be foreseen in detail.

Another disadvantage is that patients who carry grafts usually keep them for the rest of their lives so that they can continue to take them for life

Immunosuppressants are dependent. Mostly because that is inadequate Knowledge of the side effects of long-term use of such immunosuppressive agents is urgently needed to rule out or at least limit these side effects.

When immunosuppressive components such as cyclosporins A, FK506 and rapamycin were administered, it was demonstrated that these agents inhibit the proliferation of T cells as a whole (Penn, (1991) Transplant Proc, 23: 1101; Beveridge et al., (1984) Lancet 1 : 788).

A major disadvantage is that the generally systemic administration of such immunosuppressants leads to their distribution throughout the organism and does not ensure the local presence at the site of the transplanted cells, tissue or organ. However, inhibiting T cell proliferation throughout the organism can cause infections, toxic breakdown products or even cancer.

The object of the present invention is therefore to produce an immunosuppressant which has no or hardly any side effects in an organism in which an immune response is to be inhibited.

It is known that mutated IL-15 molecules or fusion proteins, consisting of a mut-IL-15 and an Fc fragment, have an antagonistic effect on IL-15 by inhibiting or changing the receptor binding behavior.

However, it was completely surprising that a fusion protein, consisting of an N-terminal wild-type IL-15 and a C-terminal Fc fragment, in particular a murine IgG2a, also has an antagonistic effect, although an agonistic effect would be expected in itself , Only by attaching an Fc fragment to a naturally occurring, normally an immunostimulating IL-15 molecule, the mechanism of action could be reversed, i.e. the inhibition of an immune response. This finding was surprising precisely because, assuming a natural folding of the wild-type IL-15 section of the fusion protein, it could not be assumed that the receptor binding behavior can be changed by the added Fc fragment in such a way that the entire wild-type molecule -IL- 15-Fc antagonistic effect on wild-type IL-15 unfolds.

The invention therefore relates to a fusion protein composed of a wild-type IL-15 on the one hand and an IgG-Fc fragment on the other hand, with the exception of a murine IgG2b-Fc fragment.

A fusion protein according to the present invention is to be understood as the expression product of a fused gene. A fused gene is created by linking two or more genes or gene fragments, which creates a new combination.

A wild-type IL-15 according to the present invention is understood to mean the naturally occurring IL-15, as described, for example, in Grabstein et al, (1994) Science 264 (5161): 965-8 or allelic variants thereof.

An Fc (fragment crystallizable) fragment is to be understood as the fragment of an antibody which does not bind any antigens, for example an antibody molecule which lacks the variable domains, or also partially or completely the first constant domain of the heavy and light chains. The Fc fragment can come from a natural source, can be produced recombinantly and / or can be synthesized. Appropriate methods are known to the person skilled in the art.

The Fc fragment of the fusion protein according to the invention is an immunoglobulinG (IgG), specifically a human or murine IgGl, a human IgG2, a murine IgG2a, a human or murine IgG3 or a human IgG4, preferably a human IgGl or a murine IgG2a, especially especially an IgGl. The IgGs were preferably used from the hinge region. The flexible region in the Ig molecule is referred to as the hinge region.

^Λ under inventive IgG s example, the following described IGCS to understand: human IgGl (Paterson, T. et al, (1998), Immunotechnology 4 (l): 37-47, murine IgG2a (Sikorav, JL, (1980), Nuleic Acids Res. 8 (14): 3143-3155), murine IgGl (French et al., (1991), J. Immunol. 146 (6): 2010-2016, human IgG2 (Krainkel, U. and Rabbitts, TH ., (1982), EMBO J. l (4): 403-407; Wang et al., (1980), J. Immunol. 125 (3): 1048-1054), murine IgG2b (Schlomchik, MJ, (1987 ), Nature 328, 805-811), human IgG3 (Huck, S. et al., (1986), Nucleic Acids Res. 14 (4): 1779-1789), murine IgG3 (Wels et al., (1984) , EMBO J., 3 (9): 2041-2046) and human IgG4 (Pink et al., (1970), Biochem. J., 117 (1): 33-47).

The fusion protein according to the invention is preferably a chimeric fusion protein, for example containing a wild-type IL-15 and a heterologous IgGl -Fc fragment or a heterologous IgG2a-Fc fragment.

In preferred embodiments, the fusion protein according to the invention comprises the amino acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 SEQ ID NO: 4 or SEQ ID NO: 5.

The invention further relates to a nucleic acid which codes for a fusion protein which on the one hand contains a wild-type IL-15 and on the other hand an IgG-Fc fragment, with the exception of a murine IgG2b-Fc fragment.

The nucleic acid according to the invention preferably codes for a wild-type IL-15 and a human or murine IgGl, a human IgG2, a murine IgG2a, a human or murine IgG3 or a human IgG4, particularly preferably for a human IgGl or a murine IgG2a, most preferably for an IgGl. The nucleic acid according to the invention preferably encodes a fusion protein with one of the amino acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

In preferred embodiments, the nucleic acid according to the invention contains the DNA sequences SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

A nucleic acid in the sense of the present invention means an RNA or DNA, in particular genomic DNA, cDNA or synthetic DNA, which was synthesized, for example, at the phosphoramidation level. Combinations and or modifications of nucleotides of these nucleic acids are also included. This term also includes single and double-stranded nucleic acids.

Also included are nucleic acids which contain functionally linked components, for example one or more fused genes or active parts thereof coding for one or more fusion proteins according to the invention, and regulatable elements and / or regulative nucleotide sequences which influence the expression of the gene (s) in terms of quantity and / or as a function of time ,

Regulable elements are, for example, promoters for constitutive or cell-specific or tissue-specific expression.

Regulatory nucleotide sequences include, for example, leader sequences, polyadenylation sequences, e.g. an SV40 polyadenylation signal, enhancer sequences, IRES sequences and introns.

Preferred leader sequences of the present inventions are, for example, those listed below: Igk leader:

5 ^Λ -ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCC AGGTTCCACTGGTGAC -3 \

CD5 leader:

5 'ATGCCC ATGGGGTCTCTGCAACCGCTGGCC ACCTTGTACCTGCTGGG

GATGCTGGTCGCTTCCTGCCTCGGA-3 ^Λ ,

CD4 Leader:

S'-ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACT GGCGCTCCTCCC AGC AGCCACTC AGGGA-3 ',

IL-2 leader:

5'-ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACT

TGTCACAAACAGT-3 ^λ ,

MCP-Leader:

5 '-TGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGC AGCC ACC TTC ATTCCCC AAGGGCTCGCT-3 ^v ,

short native IL-15 leader: 5 ^, -ATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAA-3 ^,

long native IL-15 leader:

ATGAGAATTTCGAAACCACATTTGAGAAGTATTTCCATCCAGTGCTACTTGTGTT TACTTCTAAACAGTCATTTTCTAACTGAAGCTGGCATTCATGTCTTCATTTTGGG CTGTTTCAGTGCAGGGCTTCCTAAAACAGAAGCC The components are functionally linked if they are linked in such a way that the sequence (s) of the genes or genes contained are or will be transcribed under the influence of the transcription regulation.

The invention further relates to a vector which contains at least one nucleic acid according to the invention.

Vectors in the sense of the present invention can be plasmids, shuttle vectors, phagemids, cosmids, adenoviral vectors, retroviral vectors, expression vectors and vectors with gene therapy effects.

Expression vectors in the sense of the present invention include at least one nucleic acid according to the invention, at least one translation initiation signal, a translation termination signal and / or a polyadenylation signal for expression in eukaryotes.

Commercially available expression vectors, in particular for expression in mammalian cells, for example pIRES (from Clontech, Palo Alto, USA), pCI-neo vector (from Promega, Madison, USA), pCMV-Script (from Stratagene, La Jolla, USA) and pCDNA vector (Invitrogen, Paisley, UK) are suitable for incorporating the NS according to the invention.

Gene-therapeutic vectors according to the invention are, for example, virus vectors, for example adenovirus vectors, retroviral vectors or vectors which are based on replicons of RNA viruses (Lindemann et al., 1997, Mol. Med. 3: 466-76; Springer et al. , 1998, Mol. Cell. 2: 549-58; Khromykh, 2000, Curr. Opin. Mol. Ther .; 2: 555-69). Vectors with gene therapy effects can also be obtained by complexing the nucleic acid fragments according to the invention with liposomes. In lipofection, small unilamellar vesicles are made from cationic lipids by ultrasound treatment of the liposome suspension. The DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the plasmid DNA is 100% complexed by the liposomes. In addition to the lipid mixtures DOTMA (1,2-dioleyloxypropyl-3-trimethylammonium bromide) and DPOE (dioloxylphosphatidylethanolamine), numerous new lipid formulations have now been synthesized and tested for their transfection efficiency in various cell lines. (Behr et al. 1989, Proc. Natl. Acad. Sci. USA 86: 6982-6986; Gao and Huang, 1991, Biochem. Biophys. Acta 1189, 195-203; Feigner et al. 1994, J. Biol. Chem . 269, 2550-2561). Examples of the new lipid formulations are DOTAP N- [1 - (2,3-dioleoyloxy) propyl] -N, N, N-trimethyl-ammoniumethyl-sulfate or DOGS (TRANSFECTAM; diocta-decylamidoglycylspermin). Excipients that increase the transport of nucleic acids into the cells can be, for example, proteins or peptides that are bound to DNA or synthetic peptide-DNA molecules that enable the transport of the nucleic acid into the nucleus of the cell (Schwartz et al., 1999, Gene Therapy 6: 282; Branden et al. 1999, Nature Biotechs. 17: 784). Auxiliaries also include molecules that enable the release of nucleic acids into the cytoplasm of the cell (Planck et al., 1994, J. Biol. Chem. 269, 12918; Kichler et al., 1997, Bioconj. Chem. 8, 213) or for example liposomes (Uhlmann and Peimann, 1990, Chem. Rev. 90, 544).

The invention relates to a cell which contains at least one nucleic acid according to the invention and / or at least one vector according to the invention. This cell is preferably a precursor cell, an immortalized cell or a stem cell, in particular a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell. Such pluripotent embryonic stem cells or cell lines can be obtained from the inner cell mass of blastocytes (Robertson, Embryo-derived stem cell lines, in Teratocarcinomas and embryonic stem cells: a practical approach, Robertson, editor, IRL Press, Washington DC, 1987) , Particularly preferred stem cells derived from adult tissue include, for example, neuronal stem cells, stem cells from the bone marrow, mesenchymal stem cells, hematopoietic stem cells, epithelial stem cells, stem cells from the digestive tract and duct stem cells.

Cells according to the invention are, for example, epithelial cells, vascular cells, liver cells, heart cells, skin cells, muscle cells, nerve cells, bone marrow cells, CHO cells (ovary cells) and cells from the pancreas, from the kidney, from the eye or from the lungs.

The cell according to the invention is in particular a mammalian cell, including a human cell. This cell can originate, for example, from a human, a mouse, a rat, a guinea pig, a rabbit, a cow, a goat, a sheep, a horse, a pig, a dog, a cat or a monkey, preferably from a human ,

The cells of the invention can also be used to express a heterologous gene.

The cell according to the invention is preferably in the form of a cell line. A cell line according to the invention can be produced by transfection, transformation or infection of a cell line with a nucleic acid according to the invention or a vector according to the invention with the aid of methods which Those skilled in the art are familiar, for example transfection, transformation, electroporation, microinjection or infection.

The invention further relates to a medicament comprising at least one fusion protein according to the invention, at least one nucleic acid according to the invention, at least one vector according to the invention and / or at least one cell according to the invention and, if appropriate, suitable auxiliaries and / or additives.

Suitable auxiliaries and / or additives, which are used, for example, to stabilize or preserve the medicament or diagnostic agent, are generally known to the person skilled in the art. Examples of such auxiliaries and / or additives are physiological saline solutions, Ringer's dextrose, dextrose, Ringer's lactate, demineralized water, stabilizers, antioxidants, complexing agents, antimicrobial compounds, proteinase inhibitors and / or inert gases.

The medicament according to the invention can e.g. for prophylaxis, therapy or diagnosis of diseases. These diseases include, for example: rheumatic diseases, for example rheumatic arthritis, Sjogren's syndrome, scleroderma, dermatomyositis, polymyositis., Reiter's

Syndrome or Behcef's disease,

Type I or type II diabetes,

Autoimmune diseases of the thyroid gland, for example Graves' disease, Hashimoto's thyroiditis, ^• Autoimmune diseases of the central nervous system, for example multiple sclerosis,

Skin diseases, for example psoriasis, neurodermatitis, inflammatory bowel diseases, for example Crohn's disease, Immune disorders, such as AIDS

vascular diseases,

Post-transplant diseases, for example graft rejection reactions and ^• tumor diseases.

The medicament according to the invention is administered by the methods familiar to the person skilled in the art, for example intravenously, intraperitoneally, intramuscularly, subcutaneously, intracranially, intraorbitally, intracapsularly, intraspinally, transmuscularly, topically or orally. Other methods of administration are, for example, systemic or local injection, perfusion or catheter-based administration.

The medicament according to the invention can, for example, be administered orally, e.g. Tablets or capsules, over the mucous membrane, e.g. the nose or oral cavity, in the form of sprays implanted in the lungs or in the form of disposers under the skin. Trans-dermal therapeutic systems (TTS) are e.g. known from EP 0 944 398-A1, EP 0 916 336-A1, EP 0 889 723-A1 or EP 0 852 493-A1.

The drug can be introduced into the organism either using an ex vivo approach in which the cells are removed from the patient, genetically modified, for example by DNA transfection, and then reintroduced into the patient or using an in vivo approach, in which vectors according to the invention having gene therapy effects are introduced into the patient's body, as naked DNA or using viral or non-viral vectors according to the invention or cells according to the invention. It is known in the prior art that the dosage of drugs depends on several factors, for example on the body weight, the general state of health, the extent of the body surface, the age of the patient and the interaction with other drugs. Dosage also depends on the type of administration. The dosage must therefore be determined by the specialist in each individual case for each patient. The drug can be administered once or several times a day and over several days, and this can also be determined by a person skilled in the art.

Another object of the invention relates to a human or animal organ-specific tissue and / or a human or animal mammalian organ, containing at least one fusion protein, at least one nucleic acid coding for said fusion protein, containing at least one vector containing at least one nucleic acid and / or at least one cell at least one said nucleic acid and / or at least one said vector, the fusion protein containing a wild-type IL-15 and an Fc fragment.

The fusion protein of the human or animal organ-specific tissue according to the invention and / or the human or animal mammalian organ according to the invention preferably contains on the one hand a wild-type IL-15 and on the other hand a human or murine IgGl, a human IgG2, a murine IgG2a, a murine IgG2b, a human or murine IgG3 or a human IgG4, preferably a human IgGl or a murine IgG2a, in particular an IgGl, particularly preferably no murine IgG2b.

Human or animal organ-specific tissue of the present invention can include, for example, tissue from the pancreas, including, for example, the Langerhan islet cells, as well as heart, heart muscle, kidney, liver, lung, spleen, cartilage, ligament, retina, cornea -, bone marrow, skin, nerve and / or muscle tissue. Human or animal mammalian organs of the present invention can be, for example, the pancreas, the heart, the pancreas, the kidney, the liver, the lungs, the spleen, the eye and / or the skin.

The invention further relates to a transgenic non-human mammal which contains at least one fusion protein, at least one nucleic acid which codes for the fusion protein mentioned, at least one vector which contains at least one nucleic acid and or at least one cell which has at least one contains said nucleic acid and / or at least one vector, the fusion protein containing a wild-type IL-15 and an Fc fragment.

The fusion protein of the transgenic non-human mammal according to the invention preferably contains on the one hand a wild-type IL-15 and on the other hand a human or murine IgGl, a human IgG2, a murine IgG2a, a murine IgG2b, a human or murine IgG3 or a human IgG4, preferably a human IgGl or a murine IgG2a, in particular an IgGl, particularly preferably no murine IgG2b.

Trahsgenic animals generally show a tissue-specific increased expression of nucleic acids and are therefore very suitable for the analysis of, for example, immune reactions. Transgenic mice are preferably used.

A non-human mammal according to the invention is, for example, a mouse, a rat, a guinea pig, a rabbit, a cow, a goat, a sheep, a horse, a pig, a dog, a cat or a monkey.

The invention also relates to the uses of a fusion protein, a nucleic acid coding for the said fusion protein _; a vector containing at least one named nucleic acid and or a cell containing either at least one named nucleic acid and / or a named vector containing at least one nucleic acid mentioned, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, or a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention: to inhibit an IL-15 mediated cellular event, for inhibiting the interaction of an IL-15 with its receptor and / or for the prophylaxis and / or therapy of secondary transplant diseases, in particular transplant rejection reactions and / or autoimmune diseases.

Another object of the invention is the use of a fusion protein, a nucleic acid coding for said fusion protein, a vector containing at least one named nucleic acid and / or a cell containing at least one named nucleic acid and / or said vector, the fusion protein being a wild-type Contains IL-15 and an Fc fragment, for the lysis of cells which express an IL-15 receptor.

The fusion protein of the uses according to the invention preferably contains, on the one hand, a wild-type IL-15 and, on the other hand, a human or murine IgGl, a human IgG2, a murine IgG2a, a murine IgG2b, a human or murine IgG3 or a human IgG4, preferably a human IgGl or murine IgG2a, in particular an IgGl, particularly preferably no murine IgG2b.

The uses according to the invention are preferably carried out in or in a human or animal mammal. A human mammal in the sense of the present invention is a human, an animal mammal in the sense of the present invention is, for example, a mouse, a rat, a guinea pig, a rabbit, a cow, a goat, a sheep, a horse, to understand a pig, a dog, a cat or a monkey. ₍ The present invention furthermore relates to the use of the human or animal organ-specific tissue according to the invention and / or the human or animal mammalian organ according to the invention for transplantation into a human or animal mammal. It is preferably an auto, allo or xenograft.

The transplant is the transfer of living material, e.g. of cells, tissues or organs, from one part of the body to another (autogenous transplantation) or from one individual to another (allogeneic, syngeneic and xenogeneic transplantation) (Klein, J. S, (1991) Immunologie, 1st edition, VHC Verlagsgesellschaft, Weinheim, p. 483) according to methods generally known to the person skilled in the art. A distinction is made between transplantation into another organism

Synotransplantation, in which donors and recipients belong to the same species and are genetically completely or largely identical,

Allotransplantation, in which donors and recipients belong to the same species, but are immunogenetically different and

Xenotransplantation, in which the donor and recipient do not belong to the same species and are therefore immunologically completely different.

Another aspect of the invention is a method for producing a fusion protein according to the invention, which contains the following steps: a. Introducing at least one nucleic acid according to the invention and / or at least one vector according to the invention into a cell, and b. Expression of the nucleic acid under suitable conditions.

Methods for introducing nucleic acids, vectors and genes, for example differentiation marker genes or transfection marker genes, into cells are well known to the person skilled in the art and comprise the methods customary in the prior art, for example electroporation, injection, transfection and / or transformation. These methods are particularly preferred when the substance is naked nucleic acids, in particular DNA.

Suitable conditions for the expression of the nucleic acid can be created, for example, by expression vectors, for example by the aforementioned expression vectors and regulatable elements, for example promoters or regulative nucleic acid sequences. In general, expression vectors also contain promoters suitable for the respective cell or the gene to be transcribed in each case.

Examples of regulatable elements which enable constitutive expression in eukaryotes are promoters which are recognized by RNA polymerase II. Such promoters for constitutive expression in all cell and tissue types are e.g. the CDl lc promoter, pGk (phosphoglycerate kinase) promoter, the CMV (cytomegalovirus) promoter, the TK (thymidine kinase) promoter, the EFl (elongation factor l-alpha) promoter, the SV40 (Simian Virus) promoter, the RSV (Rous Sarcoma Virus) promoter and the pUB (Ubiquitin) promoter.

Examples of regulatable elements which enable cell-specific or tissue-specific expression in eukaryotes are promoters or activator sequences from promoters or enhancers of those genes which code for proteins which are only expressed in certain cell types. Such promoters are for example the insulin promoter for beta cells of the pancreas, the Sox-2 promoter for nerve cells, the albumin promoter for liver cells, the myosin heavy chain promoter for muscle cells, the VE-cadherin promoter for endo- thel cells and the keratin promoter for epithelial cells.

More examples of regulatable elements that a regulatable expression in

Enable eukaryotes, RU486 inducible promoters and the tetra- cyclinoperator in combination with a corresponding repressor (Gossen M. et al., (1994) Curr. Opin. Biotechnol. 5, 516-20).

Expression can also be controlled via regulatory nucleotide sequences that influence expression in terms of quantity and / or time. These include, for example, enhancer sequences, leader sequences, polyadenylation sequences, IRES sequences and introns.

Another object of the invention is an in vitro method for producing a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention, which contains the following steps: a. Introducing into at least one stem cell, a precursor cell and / or an immortalized cell of a human or animal organ-specific tissue and / or a human or animal mammalian organ on the one hand encoding at least one nucleic acid for a fusion protein and / or at least one vector containing at least one named nucleic acid, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, and on the other hand at least one suitable differentiation marker gene, b. Differentiation of the cell from step a., C. Selection of the differentiated cell from step b. and d. Introduce the selected cell from step c. in at least one human or animal organ-specific tissue and / or in at least one human or animal mammalian organ.

In a preferred embodiment, in the method according to the invention described above, after, before or simultaneously with step a. at least one suitable transfection marker gene is introduced and after step a. preferably the transfected cell from step a. selected. Suitable conditions for the differentiation of the cells can be created, for example, by adding growth factors which initiate the desired cell differentiation.

Numerous methods for the selection of cells are known to the person skilled in the art.

For the selection of the differentiated cells from other cells, the method according to the invention preferably contains a positive selection scheme. Here, a marker gene, for example a gene which transmits antibiotic resistance, is introduced into the cell before, during or after the differentiation step and is expressed under suitable conditions. Such conditions can consist, for example, in that the expression of the marker gene is under the control of a promoter which is only active in the desired cells.

The expression of the marker gene confers resistance to the antibiotic to the successfully differentiated cells. The selection of the cells following the differentiation can therefore easily be carried out, for example, by bringing the cells into contact with the corresponding antibiotic. Cells that do not contain the appropriate antibiotic resistance die, so that only the differentiated cells survive. For the purposes of this invention, contacting can take place, for example, by adding the active substances into the nutrient medium of a cell culture.

An antibiotic according to the invention means an antibiotic against which the antibiotic resistance gene (s) used as the selection cassette according to the invention produces resistance. After the antibiotic has been added to the cultured stem cells, only those stem cells which contain the reporter gene expression vector essentially survive and differentiate. A second marker gene is preferably introduced into the cells, as a result of which a selection of the cells in which the introduction of the nucleic acid and / or the vector according to step a. the procedure was successful, can be carried out. This double selection makes it possible to obtain an approximately 90%, preferably approximately 95-100% pure cell population of the desired cells.

Differentiation marker genes and transfection marker genes can be used for such selections, for example. As such, genes are predominantly used which impart resistance to certain toxic substances, for example antibiotics. The most common antibiotics used in this context are neomycin, hygromycin (hph), zeocin (Sh ble) and puromycin (pacA).

Further genes suitable for selection, in particular for the selection of stem cells, are, for example, genes which express the expression of surface molecules or of fluorescent markers, e.g. Regulate GFP, with the help of which the cells to be selected can be cleaned by cell sorting. Further examples are genes which code for an enzyme activity which convert a precursor of a toxic substance, so-called "prodrug", into a toxic substance. In this case, a negative selection can take place, i.e. only those cells that do not express the promoter upstream of the gene survive.

Another object of the invention is a method for producing a transgenic non-human mammal according to the invention, which contains the following steps: a. Introduction into at least one oocyte, a stem cell, a precursor cell and / or an immortalized cell of a non-human mammal, on the one hand at least one nucleic acid coding for a fusion protein and / or at least one vector containing at least one said nucleic acid, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, and on the other hand at least one suitable transfection marker gene, b. Selection of the transfected cell from step a., C. Introduce the after step b. selected cell into at least one non-human mammalian blastocyte, d. Introduce the blastocyte from step c. into a non-human, preferably pregnant woman, mammal foster mother and e. Identification of the transgenic non-human mammal developed from said blastocyte.

The methods for introducing blastocytes are known to the person skilled in the art. It can be done, for example, by injection (Hogan, B., Beddington, R., Constantini, F. and Lacy, E., A laboratory Manual (1994), Cold Spring ^" Harbor Laboratory Press).

A transgenic non-human mammal can be identified, for example, by extracting genomic DNA from the transgenic non-human mammal, e.g. from the tail of a mouse. In a subsequent PCR (polymerase chain reaction), primers are used which specifically recognize the transgene for the nucleic acid according to the invention. Integration of the transgene can be demonstrated in this way.

Another way of identification can be done using Southern blot. Here, genomic DNA is transferred to a membrane and detected by means of DNA probes, for example radioactively labeled DNA probes, which are specific for the transgene sought.

Process for producing a transgenic non-human according to the invention

Mammals by regenerating a non-human stem cell, oocyte, vrufler cell or immortalized cell to a transgenic non-human animal, in particular from transgenic mice, are known to those skilled in the art from DE 196 25 049 and U.S. 4,736,866; US 5,625,122; US 5,698,765; US 5,583,278 and US 5,750,825 are known and comprise transgenic animals which can be generated, for example, by direct injection of expression vectors according to the invention into embryos or sperm cells or via the transfection of expression vectors into embryonic stem cells (Polites and Pinkert: DNA microinjection and transgenic animal production, page 15-68 in Pinkert, 1994: Transgenic A- nimal Technology: A Laboratory Handbook, Academic Press, San Diego, USA; Houdebine 1997, Harwood Academic Publishers, Amsterdam, The Netherlands; Doetschman: Gene Transfer in Embryonic Stem Cells, page 115- 146 in Pinkert, 1994, supra; Wood: Retrovirus-Mediated Gene Transfer, pages 147-176 in Pinkert, 1994, supra; Monastersky: Gene Transfer Technology: Alternative Technologies and Applications, pages 177-220 in Pinkert, 1994, supra ).

A transgenic non-human mammal according to the invention can also be produced by direct injection of a nucleic acid according to the invention into the pronucleus (pronucleus) of a non-human mammal.

Numerous processes for the production of transgenic animals, in particular transgenic mice, are also known to the person skilled in the art, inter alia. known from WO 98/36052, WO 01/32855, DE 196 25 049, US 4,736,866, US 5,625,122, US 5,698,765, US 5,583,278 and US 5,750,825 and include transgenic animals which are used, for example, via direct injection of vectors according to the invention into embryos or spermatocytes or can be generated via the transfection of vectors or nucleic acids in embryonic stem cells (Polites and Pinkert, in Pinkert, (1994) Transgenic animal technology, A Laboratory Handbook, Academic Press, London, UK, pages 15 to 68; Doetschman, in Pinkert, 1994 , supra, pages 115 to 146).

Another object of the invention relates to a transgenic non-human mammal produced according to the method according to the invention described above and to its progeny. In further embodiments, the stem cell is involved, which in the in-vitro method according to the invention mentioned for producing a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention and in the method for producing a transgenic non-inventive human mammal is used to generate a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

An object of the invention is the use of a transgenic non-human according to the invention for the production of a cell, an organ-specific tissue and / or a mammalian organ for allo- and / or xenotransplantation.

In the case of cell transplantation, this can take place, for example, by means of an implantation method or by means of a catheter injection method through the blood vessel wall.

For the purposes of the present invention, extraction means the removal of the cell, tissue and / or organ mentioned from the organism of a transgenic non-human mammal according to the invention. Appropriate methods of removal are generally known to the person skilled in the art.

The invention also relates to the use of a transgenic non-human mammal according to the invention, a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention for finding pharmacologically active substances and / or for identifying toxic substances.

For example, one such method could be to sow cells of the present invention on a 96-well microtiter plate, then to test one Add appropriate pharmacologically active or toxic substance and then analyze by cell count whether the substance has caused an increased death of the cells.

The terms pharmacologically active substance and toxic substance in the sense of the invention are understood to mean all those molecules, compounds and / or compositions and substance mixtures which, under suitable conditions, have a pharmacological or toxic influence on individual cells, individual tissues, individual organs or the whole Exercise organism of an animal or human mammal. Possible pharmacologically active substances and toxic substances can be simple chemical (organic or inorganic) molecules or compounds, nucleic acids or analogs of nucleic acids, anti-sense sequences of nucleic acids, peptides, proteins or complexes and antibodies. Examples are organic molecules that come from substance libraries and that are examined for their pharmacological or toxic activity.

Pharmacologically active substances are, for example, active substances which exert an influence on: ^• the ability of cells to divide and / or survive, the secretion of proteins, eg insulin from beta cells of the pancreas, dopamine from nerve cells, muscle cell contraction and / or the migration behavior of cells. When applied to the entire organism of an animal or human mammal, this is to be understood as influencing, for example, the cardiovascular system, the nervous system and the metabolic activities. Toxic substances are, for example, active substances that

After certain signals, for example stress, stimulate cells to apoptosis, ^{• influence} the cardiovascular system, influence the nervous system and / or influence metabolic activities.

The identified pharmacologically active substances and toxic substances can optionally be combined or used together with suitable additives and / or auxiliary substances for the production of a diagnostic agent or a medicament for the diagnosis, prophylaxis and or therapy of secondary transplant diseases and / or autoimmune diseases, as exemplified above.

The following figures and examples are intended to illustrate the present invention without, however, restricting it.

FIG. 1 a is an illustration of the amino acid sequence WT-IL-15-hIgG1, FIG. 1 b is an illustration of the amino acid sequence WT-IL-15-mIgG2a,

Figure 2a is an illustration of the amino acid sequence WT-IL-15.

Figure 2b is an illustration of the hlgGl amino acid sequence,

2c is an illustration of the amino acid sequence mIgG2a,

Figure 3a is a picture of the amino acid sequence Igk8, Figure 3b is a picture of the amino acid sequence 149-Fc

4 is an illustration of the nucleic acid sequence WT-IL-15-hIgGl,

5 is an illustration of the nucleic acid sequence WT-IL-15-mIgG2a,

6a is an illustration of the nucleic acid sequence WT-IL-15,

6b is an illustration of the nucleic acid sequence hlgGl, FIG. 7 is an illustration of the nucleic acid sequence mIgG2a, 8a is an illustration of the nucleic acid sequence of murine IgK leaders, FIG. 8b is an illustration of the nucleic acid sequence of human CD5 leaders, FIG. 8c is an illustration of the nucleic acid sequence of human CD4 leaders, FIG. 8d is an illustration of the nucleic acid sequence of human IL5 leaders 2-leader, Figure 9a is an illustration of the nucleic acid sequence of human MCP leaders,

Figure 9b is an illustration of the nucleic acid sequence of the short native human

IL-15 leader,

Figure 9c is an illustration of the nucleic acid sequence of the long native human

IL-15 leaders, FIG. 10 is an illustration of the nucleic acid sequence Igk8, FIG. 11 is an illustration of the nucleic acid sequence 149-Fc, FIG. 12 is an illustration of the inhibitory or proliferation-promoting effect of different protein constructs on the IL-15 mediated Proliferation of CTLL-2 cells.

Explanation: hlgGl stands for human IgGl and mIgG2a stands for murine IgG2a.

Further objects of the present invention relate to:

(i) Fusion protein from a wild-type IL-15 and an IgG-Fc fragment, with the exception of a murine IgG2b-Fc fragment.

(ii) Fusion protein according to (i), characterized in that the IgG-Fc fragment is a human or murine IgGl, a human IgG2, a murine IgG2a, a human or murine IgG3 or a human IgG4.

(iii) Fusion protein according to (i) or (ii) containing the amino acid sequence SEQ ID NO: 1 or an allelic variant thereof. . (iv) Fusion protein according to (i) or (ii) containing the amino acid sequence SEQ ID NO: 2 or an allelic variant thereof.

(v) Fusion protein according to (i) or (ii) containing the amino acid sequence SEQ ID NO: 3 or an allelic variant thereof.

(vi) Fusion protein according to (i) or (ii) containing the amino acid sequence SEQ ID NO: 4 or an allelic variant thereof.

(vii) fusion protein according to (i) or (ii) containing the amino acid sequence

SEQ ID NO: 5 or an allelic variant thereof.

(viii) nucleic acid coding for a fusion protein according to at least one

(i) to (vii).

(ix) nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 6. or an allelic variant of it.

(x) Nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 7. or an allelic variant of it.

(xi) nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 8 or an allelic variant thereof.

(xii) nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 9. or an allelic variant of it.

(xiii) nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 10 or an allelic variant thereof.

(xiv) Fusion protein encoded by a nucleic acid after an (ix) - (xiii). (xv) vector containing at least one nucleic acid after at least one (viii) to (xiv).

(xvi) cell containing at least one nucleic acid after at least one

(xiii) to (xiv) and / or at least one vector according to (xv).

(xvii) cell according to (xvi), characterized in that the cell is a stem cell, a precursor cell and / or an immortalized cell.

(xviii) cell according to (xvii), characterized in that it is a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

(xix) cell after at least one (xvi) to (xviii) in the form of a cell line.

(xx) Medicaments containing at least one fusion protein according to one (i) to (vii) and (xiv), at least one nucleic acid according to one (viii) to (xiii), at least one vector according to (xv) and / or at least one cell according to one (xvi) to (xviii) and suitable auxiliaries and / or additives.

(xxi) human or animal organ-specific tissue and / or human or animal mammalian organ containing at least one fusion protein, in particular according to one (i) - (vii) and (xiv), at least one nucleic acid coding for said fusion protein, in particular after one (viii) - (xiii), at least one vector containing at least one named nucleic acid, in particular according to (xv), and / or at least one cell, in particular after (xvi) - (xviii), containing at least one named nucleic acid and / or at least one NEN vector, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment.

(xxii) transgenic non-human mammal containing at least one fusion protein, in particular for one (i) - (vii) and (xiv), at least one nucleic acid coding for said fusion protein, in particular for one (viii) - (xiii), at least one vector, in particular according to (xv), containing at least one nucleic acid and or at least one cell, in particular after (xvi) - (xviii), containing at least one nucleic acid and / or at least one vector, the fusion protein contains a wild-type IL-15 and an Fc fragment.

(xxiii) Use of a fusion protein, in particular for a (i) - (vii) and (xiv), a nucleic acid, in particular for a (viii) - (xiii), a vector, in particular for a (xv), and / or one Cell, in particular according to a (xvi) - (xviii), the fusion protein containing a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to (xxi) for the production of a Medicines to inhibit an IL-15 mediated cellular event.

(xxiv) Use of a fusion protein, in particular for a (i) - (vii) and (xiv), a nucleic acid, in particular for a (viii) - (xiii), a vector, in particular for (xv), and / or a cell , in particular according to a (xvi) - (xviii), the fusion protein containing a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to (xxi), for the manufacture of a medicament to inhibit the interaction of an IL-15 with its receptor. (xxv) Use of a fusion protein, in particular after (i) - (vii) and (xiv), a nucleic acid, in particular after (viii) - (xiii), a vector, in particular after (xv), and / or one Cell, in particular according to an (xvi) - (xviii), wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, for the manufacture of a medicament for the lysis of cells which express an IL-15 receptor.

(xxvi) Use of a fusion protein, in particular for a (i) - (vii) and (xiv), a nucleic acid, in particular for a (viii) - (xiii), a vector, in particular for (xv), and / or a cell , in particular according to a (xvi) - (xviii), the fusion protein containing a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to (xxi), for the manufacture of a medicament to

Prophylaxis and / or therapy of secondary transplant diseases and / or autoimmune diseases.

(xxvii) Use of a human or animal organ-specific tissue and / or human or animal mammalian organ according to (xxi) for

Transplantation into a human or animal mammal.

(xxviii) Use according to (xxvii), characterized in that it is an auto, allo or xenograft.

(xxix) Method for producing a fusion protein according to at least one (i) to (vii) and (xiv) comprising the following steps: a. Introducing at least one nucleic acid according to one (viii) to (xiii) and / or at least one vector according to (xv) into a cell, and ₍ b. Expression of the nucleic acid under suitable conditions. I \ l / UI | WJ ^■ v ^w - "

- 33 -

(xxx) In vftro processes for producing a human or animal organ-specific tissue and / or human or animal mammalian organ according to (xxi), comprising the following steps: a. Introduction into at least one stem cell, a precursor cell and / or an immortalized cell of a human or animal organ-specific tissue and / or human or animal mammalian organ on the one hand encoding at least one nucleic acid for a fusion protein, the fusion protein being a wild-type IL-15 and an Fc fragment contains and / or at least one vector containing at least one named nucleic acid, in particular after a (viii) - (xiii), and on the other hand at least one suitable differentiation marker gene, b. Differentiation of the cell from step a., C. Selection of the differentiated cell from step b. and d. Introduce the selected cell from step c. into a human or animal organ-specific tissue and / or into a human or animal

Mammalian organ.

(xxxi) Method according to (xxx), characterized in that after, before or simultaneously with step a. at least one suitable transfection marker gene is introduced and after step a. preferably the transferred cell from step a. is selected.

(xxxii) Method according to one (xxx) or (xxxi), characterized in that it is a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

(xxxiii) Process for the production of transgenic non-human mammals

(xxii) comprising the following steps: a. Introduction into at least one oocyte, a stem cell, a precursor cell and / or an immortalized cell of a non-human mammal, on the one hand at least one nucleic acid, in particular after one (vii) - (xiii), coding for a fusion protein and / or at least one vector, in particular according to (xv), containing at least one named nucleic acid, the fusion protein containing a wild-type IL-15 and an Fc fragment, and on the other hand at least a suitable transfection marker gene, b. Selection of the transferred cell from step a., C. Introduce the after step b. selected cell into at least one non-human mammalian blastocyte, d. Introduce the blastocyte from step c. into a non-human mammal foster mother and e. Identification of the transgenic non-human mammal developed from said blastocyte.

(xxxiv) Method according to (xxxiii), characterized in that it is a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

(xxxv) Transgenic non-human mammal, characterized in that it was generated by the method according to (xxxiii) or (xxxiv).

(xxxvi) Transgenic non-human mammal, characterized in that it is a descendant of the mammal according to (xxxv).

(xxxvii) Use of a transgenic non-human mammal after at least one (xxii), (xxxv) or (xxxvi) to obtain a cell, an organ-specific tissue and / or a mammalian organ for allo- and / or xenotransplantation.

(xxxviii) Use of a transgenic non-human mammal according to a (xxii), (xxxv) or (xxxvi), a human or animal organ-specific tissue and / or a human or animal mammal animal organ according to (xxi) to find pharmacologically active substances and / or to identify toxic substances.

Examples

reagents

Unless otherwise noted, reagents such as cell culture media, enzymes, etc. were obtained from Invitrogen (formerly Gibco BRL / Life Technologies), Paisley, UK, and laboratory chemicals from Roth (Karlsruhe, DE).

Example 1: Exchange of the signal sequence

The starting point was a plasmid which in the vector pSecTagA (Invitrogen, Paisley, UK) the cDNA of a fusion protein from a mutated human IL-15 and a murine IgG2a-Fc part (Hinge-C2-C3, Kim et al. 1998, supra ) included. The fusion of IL-15 with the Fc part took place via a BamHI site, whereby an additional amino acid (aspartate) was inserted at the transition.

At positions 149 and 156 (corresponds to positions 101 and 108 after splitting off the signal sequence) in IL-15, two glutamine residues had been mutated to aspartate in order to allow binding of the protein to the alpha subunit of the IL-15 receptor, but signal transduction to prevent over the beta and gamma subunit. The native, inefficient signal sequence had been removed from the human IL-15 and the truncated cDNA had been cloned into the pSecTagA vector via the interfaces Hindlll and Xbal, so that the Ig kappa leader present in the plasmid could be used as a secretion signal. Due to the cloning, 10 additional amino acids were present between the Ig kappa leader present in the plasmid and the beginning of the IL15 sequence. In order to remove these and possibly the secretion of the To improve protein, the Ig kappa leader was exchanged for signal sequences of various other proteins. In addition to the original Ig kappa leader from which only the additional amino acids have been removed, the leader sequences of human IL-2, MCP-1, CD4 and CD5 can alternatively be cloned in.

Example 2: Preparation of the pSecTagA plasmid

Since the signal sequence was to be cloned via a singular Nhel interface, which lies in the 5 'direction of the ATG start codon of the leader sequence, and a BglII interface lying in the 5' region of the IL-15 sequence, another was initially carried out Bglll interface removed from the vector pSecTagA. For this, the vector pSecTagA was cut without insert with BglII (approach: 9 μg DNA, 4 μl 10X buffer 2, 26 μl water, 4 μl BglII (40 units) in a total of 40 μl, incubation for 2 h at 37 ° C.).

The DNA was purified from enzyme and buffer on a Pharmacia S400 microspin column (Amersham-Pharmacia, Freiburg). 40 μl of the batch were mixed with 5 μl 10 × PCR buffer (Taq-Core-Kit, Qiagen, Hilden), 2 μl dNTPs (10 mM each, Taq-Core-Kit, Qiagen), 2 μl water and 1 μl (4 units ) DNA polymerase I (Klenow fragment) were added and incubated for 1 h at 37 ° C. in order to fill up the BglII site. The plasmid was then applied to a 1% agarose gel and the band eluted from the gel using the Concert Rapid-Gel-Extraction System. The entire batch was taken up in 100 μl of water. 7.5 μl thereof were ligated together with 7.5 μl water, 4 μl 5 × T4 ligase buffer and 1 μl T4 ligase (1U) for 1 h at room temperature. Half of the ligation approach was transformed into E.coli XL1 Blue (Stratagene, La Jolla, USA) according to the manufacturer's instructions. The entire insert of the above-mentioned plasmid: Ig-kappa leader + 10 additional amino acid mutIL-15-mIgG2a was cloned into the resulting plasmid again via the interfaces Nhel and Xbal. The original Ig-kappa leader + 10 amino acids + 5'-IL-15 part was then removed via an Nhel / BglII cut and replaced by an oligonucleotide cloning with the above-mentioned signal sequences.

Example 3: Cloning of the Ig kappa leader

The fragment was as follows: 5'-NheI-Leader-IL-15-3 'with a BglII interface in the 5' section of the IL-15. Since this fragment was too long to be covered by a single oligonucleotide, two overlapping oligos and their complementary strands (4 oligonucleotides in total) were obtained from MWG-Biotech (Ebersberg) (sequence of the oligonucleotides see below). The single-stranded oligonucleotides were chosen so that overhanging ends were already available for cloning into the corresponding restriction sites (Nhel, Bglll). The oligonucleotides were first phosphorylated. To this end, 10 μg of each oligo were incubated in a 20 μl mixture with 2 μl 10 × forward buffer and 1 μl T4 polynucleotide kinase (10 U) for 1 h at 37 ° C. Subsequently, equimolar amounts of each strand and counter-strand oligo were annealed by heating to 95 ° C. and slowly cooling to room temperature. The double-stranded oligonucleotides were ligated overnight before cloning into the vector. In each case 5 μl of the 5 ′ and 3 ′ double-stranded oligos + 4 μl 5 × T4 ligase buffer + 5 μl water + 1 μl T4 ligase (1 U) were incubated overnight at 4 ° C. The ligation mixture was then separated on a 2% agarose gel and oligodimers were eluted from the gel using the Concert Rapid Gel Extraction System and taken up in the final volume of 40 μl. The oligodimers were then used in the cloning: ligating overnight at 12 ° C. (10 μl oligodimer, 4 μl 5 × T4 ligase buffer, 4 μl water, 1 μl Nhel / BglII cut plasmid, 1 μl T4 ligase ( 1 U)). 5 μl of a 20 μl ligation mixture were the transformation of E.coli-XLIO-Gold (Stratagene, according to the manufacturer's instructions) was used.

Sequences of the Ig kappa oligonucleotides: 5 '- Ig kappa fwd ctagccaccatggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggtgacaa

complementary Ig-kappa rev: ccagttgtcaccagtggaacctggaacccagagcagcagtacccatagcaggagtgtgtctgtctccatggtgg

second forward oligo 3'-IL-15 fwd 1.1: ctgggtgaatgtaataagtgatttgaaaaaaattga

complementary IL-15 rev 1.1 gatcttcaatttttttcaaatcacttattacattcac

After annealing and ligation, the following fragment results:

5'-Nhel-Ig-kappa-Leader-Il-15-BglII-3 'with the sequence (double-stranded) 5' - TAGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGG TTCCAGGTTCCACTGGTGACAACTGGGTGAATTGATAAAAAAGATT

complementary: 3 '-GGTGGTACCTCTGTCTGTGTGAGGAGCATACCCATGACGACGAGACCCAAGG TCCAAGGTGACCACTGAAGACCCACTTACATTATTCACTAAACTTTTTTTAACTT CTÄG-5' Explanation: italic + underlined: interfaces Nehlll or Bglll; printed in bold: Ig-kappa leader.

The clones obtained were examined for their restriction pattern in the Miniprep (QIAamp DNA Mini Kit, Qiagen, Hilden). For this purpose, a triple digestion with Nhel / Bglll (restriction enzymes which directly cut out the leader used) and Xbal (cuts 3 'of the Fc part) was carried out.

The DNA positive clones were isolated using the Qiagen Endofree Maxi kit according to the manufacturer's instructions and sequenced at GATC (Constance). The resulting plasmid (mutIL-15 101/108) -mIgG2a with purified Ig kappa leader was called Igk8.

The same procedure was followed for the other leaders as for the Ig kappa construct described.

Example 4 Preparation of the Constructs: WT-Fc and 149-Fc:

Starting from the plasmid Igk8 described above, PCR was carried out using a forward primer with a BglII cleavage site at the 5 'end (IL-15fw3.1: 5'-attgaagatcttattcaatctatgc-3') and corresponding 3 'reverse primer (WT: 5'- ggatccgaagtgttgatgaacatttggacaatatgtacaaaactctgcaaaaattc-3 '), (149: 5' - gggatcc- gaagtgttgatgaacatttgga-3 ') produced the individual mutants.

As a template for the PCR reaction, 10 ng mutlL-15 (101, 108) murine Fc plasmid and 25 pmole primers, 0.5 μl dNTPs (Taq-Core-Kit, Qiagen) and 2 , 5 μl 10 × PCR buffer, 0.9 U Taq polymerase (expand high fidelity system, Röche, Mannheim). The DNA was amplified in 30 cycles under the conditions: 45 seconds denaturation at 95 ° C, 60 seconds annealing at 60 ° C and 45 seconds synthesis at 72 ° C, then purified using an agarose gel, the PCR band from the gel eluted and taken up in 50 ul TE buffer. 25 μl of the mixture were mixed with 3 μl 10X buffer 3 and 15 U BamHI and BglII each and added for 1 hour Incubated at 37 ° C. The DNA was purified on a Pharmacia Microspin S400 column. The IL-15 part with a double mutation was also cut out of the plasmid Igk8 by a double digest BglII / BamHI and replaced by the IL-15 part with a single mutation or wild-type sequence. The identity of the plasmids was verified by sequencing.

Example 5: Production of protein:

By transient transfection of HEK293 cells (ATCC, Manassas, USA) the proteins of the single mutants were prepared: To this was added per 150cm ² plate 60 .mu.l lipofectamine2000 in 2 ml Optimem 1 medium and 30 ug plasmid DNA (IgK8, WT-Fc , 149-Fc) also diluted in 2 ml Optimem 1 medium. The two solutions were mixed and incubated for 30 minutes at room temperature. The DNA / liposome mixture was then added to approximately 80% confluent 150 cm ² HEK-293 plates in the cell culture medium (Dulbecco's MEM + Glutamax + 10% FCS + 1% Pen / Strep). After one day, the medium was changed to ultraculture medium (Biowhittaker, Verviers, Belgium) and the cell culture medium was then left on the cells for 4 days. The cell culture supernatant was collected, passed through a folded filter (Schleicher and Schüll, Dassel) to remove the coarse cell components, then sterile filtered through a 2 μm bottle top filter (Nalgene-Nunc, Wiesbaden) and the IL-15-Fc - Fusion protein isolated by purification via Protein A Sepharose. For this, 0.4 ml of protein A-Sepharose (Amersham-Pharmacia, 50% ov / v in washing buffer) swollen in liter buffer (20 mM Tris / HCl, pH 8.5, 130 mM NaCl) were added per liter cell culture supernatant and the mixture was added Shaken 4 ° C overnight in an overhead shaker. The ProteinA-Sepharose was collected in an empty chromatography column and washed with at least 150 ml wash buffer. The protein was eluted from the column with 0.1 M glycine pH 2.5 in 1 ml fractions and immediately neutralized with 60 μl IM Tris / HCl, pH 9.5. The protein was dialyzed against PBS buffer and sterile filtered. The concentration of the protein was determined in the BCA assay (Pierce, Rockford, USA) and using silver gel and Western blot (first antibody: monoclonal mouse anti-human IL-15, BD Biosciences Pharmingen, San Diego USA, second antibody: POD-Goat anti mouse, Dianova, Hamburg), purity and identity checked. The functionality of the protein was then examined in the proliferation assay.

Example 6: Proliferation Assay:

CTLL-2 cells (ATCC) are murine cytotoxic T cells whose proliferation is dependent on IL-15 or IL-2 and which can therefore serve as indicators for the proliferation-inhibiting effect of antagonistic proteins. The cells were cultured in a medium consisting of RPMI1640 medium + 10% heat-activated fetal calf serum (FCS) + 1% Pen Strep + 20% advises T-Stim with ConA (Becton Dickinson Labware, Bedford, USA), a mixture different growth factors. For the preparation of a proliferation assay, the cells were freed of the remaining growth factors necessary for the culture of the cells by washing twice with cell culture medium (RPMI 1640 + 10% FCS + 1% Peπ / Strep) and then also being taken up in this medium. For this, the cells were centrifuged at 349 g for 5 min, the supernatant was discarded and the pellet was taken up again in cell culture medium. The centrifugation step was repeated.

The assay was carried out in flat bottom 96-well plates and 150 .mu.l of medium with 3 × 10 ⁴ cell wells were used per well. For the negative control, the cells received only medium with 10% FCS, without additional factors. The positive control additionally contained recombinant human IL-15 (R&D Systems, Minneapolis, USA) in a concentration which allows a half-maximal proliferation of the cells (eg 12.5 pg / well). Negative and positive controls were pipetted in 6-fold batches.

To determine the proliferation-inhibiting effect of the above-mentioned new IL-15-Fc variants, the cells were determined as for the positive control. wrote with recombinant IL-15 and received additionally purified protein of the double mutant 101/108 starting from Igk8, the wild-type protein (WT-Fc) or the single mutant (149-Fc). The highest concentration used was 2 μg per well and further 1: 2 dilutions (1 μg, 0.5 μg, 0.25 μg, 0.125 μg, etc.). As a control, the following related proteins were used in the same concentrations: mIgG2a (BD Biosciences Pharmingen, San Diego, USA) was used as non-specific antibody, and IL-2-Fc, which contains a non-mutated cytokine component and thus the proliferation, was also used of the cells should stimulate and use CTLA4-Fc, also a structurally related fusion protein, which, however, should not influence the proliferation. Both of the latter proteins were obtained from Chimerigen (Allston, USA). All batches were pipetted in triplicate.

The cells were incubated for 44 + 2 hours at 37 ° C. in the CO ₂ incubator and then the proliferation was determined using the XTT-Cell Proliferation Kit (Röche) according to the manufacturer's instructions. For this purpose, the two components of the kit were mixed in a ratio of 1:50 (ie, 75 μl XTT labeling reagent + 1.5 μl electron coupling reagent). 75 μl of the mixture were added per well and the plate was measured after an incubation for 4 hours at 37 ° C. in a CO ₂ incubator in an ELISA reader at 490 against 690 nm.

The result is shown in FIG. 23:

WT-Fc, 149-Fc and protein of the double mutant 101/108 (plasmid Igkδ) show an inhibitory effect on the IL-15 mediated proliferation of CTLL-2 cells. IL-2-Fc and IgG2a show a rather proliferation-promoting effect. Neg: the cells were cultured without recombinant human IL-15.

Pos: the cells received 12.5 pg / well recombinant human IL-15.

All cells of the further batches received 12.5 pg / well of recombinant human IL-15 + the specified protein in the concentrations (from left to right): 2 ug, 1 ug, 0.5 ug, 0.25 ug, 0.125 ug, 0.0625 ug. CTLA4-Fc showed no effect, all values were in the positive control range (data not shown).

Claims

claims

1. Fusion protein from a wild-type IL-15 and an IgG-Fc fragment, with the exception of a murine IgG2b-Fc fragment.

2. Fusion protein according to claim 1, characterized in that the IgG-Fc fragment is a human or murine IgGl, a human IgG2, a murine IgG2a, a human or murine IgG3 or a human IgG4.

3. Fusion protein according to claim 1 or 2 containing the amino acid sequence SEQ ID NO: 1 or an allelic variant thereof.

4. Fusion protein according to claim 1 or 2 containing the amino acid sequence SEQ ID NO: 2 or an allelic variant thereof.

5. Fusion protein according to claim 1 or 2 containing the amino acid sequence SEQ ID NO: 3 or an allelic variant thereof.

6. Fusion protein according to claim 1 or 2 containing the amino acid sequence

SEQ ID NO: 4 or an allelic variant thereof.

7. Fusion protein according to claim 1 or 2 containing the amino acid sequence SEQ ID NO: 5 or an allelic variant thereof.

8. Nucleic acid coding for a fusion protein according to at least one of claims 1 to 7.

9. A nucleic acid according to claim 8 containing the DNA sequence SEQ ID NO: 6 or an allelic variant thereof.

10. Nucleic acid according to claim 8 containing the DNA sequence SEQ ID NO: 7. or an allelic variant of it.

11. A nucleic acid according to claim 8 containing the DNA sequence SEQ ID NO: 8 or an allelic variant thereof.

12. Nucleic acid according to claim 8 containing the DNA sequence SEQ ID NO: 9 or an allelic variant thereof.

13. Nucleic acid according to claim 8 containing the DNA sequence SEQ ID

NO: 10th or an allelic variant of it.

14. Fusion protein encoded by a nucleic acid according to any one of claims 9-13.

15. Vector contains at least one nucleic acid according to at least one of claims 8 to 14.

16. Cell containing at least one nucleic acid according to at least one of claims 8 to 14 and / or at least one vector according to claim 15.

17. Cell according to claim 16, characterized in that the cell is a stem cell, a precursor cell and / or an immortalized cell.

18. Cell according to claim 17, characterized in that it is a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

I 19. Cell according to at least one of claims 16 to 18 in the form of a cell line.

20. Medicament containing at least one fusion protein according to one of claims 1 to 7 and 14, at least one nucleic acid according to one of claims 8 to 13, at least one vector according to claim 15 and / or at least one cell according to one of claims 16 to 18 and suitable

Auxiliaries and / or additives.

21. Human or animal organ-specific tissue and / or human or animal mammalian organ containing at least one fusion protein, in particular according to one of claims 1-7 and 14, at least one

Nucleic acid coding for said fusion protein, in particular according to one of claims 8-13, at least one vector containing at least one said nucleic acid, in particular according to claim 15, and or at least one cell, in particular according to one of claims 16-18, containing at least one said nucleic acid and / or at least one vector mentioned, the fusion protein containing a wild-type IL-15 and an Fc fragment.

22. Transgenic non-human mammal containing at least one fusion protein, in particular according to one of claims 1-7 and 14, at least one nucleic acid coding for said fusion protein, in particular according to one of claims 8-13, at least one vector, in particular according to

Claim 15, containing at least one said nucleic acid and / or at least one cell, in particular according to one of claims 16-18, containing at least one said nucleic acid and / or at least one vector, the fusion protein being a wild-type IL-15 and an Fc- Contains fragment.

23. Use of a fusion protein, in particular according to one of claims 1-7 and 14, a nucleic acid, in particular according to one of the claims. ehe 8-13, a vector, in particular according to claim 15, and / or a cell, in particular according to one of claims 16-18, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment or a human or animal organ-specific Tissue and / or a human or animal mammalian organ according to claim 21 for the manufacture of a medicament for inhibiting an IL-15 mediated cellular event.

24. Use of a fusion protein, in particular according to one of claims 1-7 and 14, a nucleic acid, in particular according to one of claims 8-13, a vector, in particular according to claim 15, and / or a cell, in particular according to one of the claims 16-18, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to claim 21, for the production of a

Medicament to inhibit the interaction of an IL-15 with its receptor.

25. Use of a fusion protein, in particular according to one of claims 1-7 and 14, a nucleic acid, in particular according to one of claims 8-13, a vector, in particular according to claim 15, and / or a cell, in particular according to one of the Claims 16-18, wherein the fusion protein contains a wild type IL-15 and an Fc fragment for the manufacture of a medicament for the lysis of cells which express an IL-15 receptor.

26. Use of a fusion protein, in particular according to one of claims 1-7 and 14, a nucleic acid, in particular according to one of claims 8-13, a vector, in particular according to claim 15, and / or, a cell, in particular according to one of claims 16 -18, the fusion protein containing a wild-type IL-15 and an Fc fragment or a human NEN or animal organ-specific tissue and / or a human or animal mammalian organ according to claim 21, for the manufacture of a medicament for the prophylaxis and / or therapy of secondary transplant diseases and / or autoimmune diseases.

27. Use of a human or animal organ-specific tissue and / or human or animal mammalian organ according to claim 21 for transplantation into a human or animal mammal.

28. Use according to claim 27, characterized in that it is an auto, allo or xenograft.

29. A method for producing a fusion protein according to at least one of claims 1 to 7 and 14, comprising the following steps: a. Introducing at least one nucleic acid according to one of claims 8 to

13 and / or at least one vector according to claim 15 in a cell, and b. Expression of the nucleic acid under suitable conditions.

30. In the vz ^' tro method for producing a human or animal organ-specific tissue and / or human or animal mammalian organ according to claim 21, comprising the following steps: a. Introduction into at least one stem cell, a precursor cell and / or an immortalized cell of a human or animal organ-specific tissue and / or human or animal mammalian organ on the one hand encoding at least one nucleic acid for a fusion protein, the fusion protein being a wild-type IL-15 and an Fc fragment contains and or at least one vector containing at least one said nucleic acid, in particular according to one of claims 8-13, and on the other hand at least one suitable differentiation marker gene,, b. Differentiation of the cell from step a., C. Selection of the differentiated cell from step b. and d. Introduce the selected cell from step c. in a human or animal organ-specific tissue and / or in a human or animal mammalian organ.

31, according to claim 30, characterized in that after, before or simultaneously with step a. at least one suitable transfection marker gene is introduced and after step a. preferably the transfected cell from step a. is selected.

32. The method according to any one of claims 30 or 31, characterized in that it is a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

33. A method for producing transgenic non-human mammals according to claim 22, comprising the following steps: a. Introducing into at least one oocyte, a stem cell, a precursor cell and or an immortalized cell of a non-human mammal, on the one hand, at least one nucleic acid, in particular according to one of claims 8-13, coding for a fusion protein and / or at least one vector, in particular according to claim 15 , containing at least one named nucleic acid, the fusion protein containing a wild-type IL-15 and an Fc fragment, and on the other hand at least one suitable transfection marker gene, b. Selection of the transferred cell from step a., C. Introduce the after step b. selected cell into at least one non-human mammalian blastocyte, d. Introduce the blastocyte from step c. into a non-human mammal foster mother and e. Identification of the transgenic non-human mammal developed from said blastocyte.

34. The method according to claim 33, characterized in that it is a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.

35. Transgenic non-human mammal, characterized in that it was generated by the method according to one of claims 33 or 34.

36. Transgenic non-human mammal, characterized in that it is a progeny of the mammal according to claim 35.

37. Use of a transgenic non-human mammal according to at least one of claims 22, 35 or 36 for obtaining a cell, an organ-specific tissue and / or a mammalian organ for allo- and / or xenotransplantation.

38. Use of a transgenic non-human mammal according to one of claims 22, 35 or 36, a human or animal organ-specific tissue and or a human or animal mammalian organ according to claim 21 for finding pharmacologically active substances and / or for identifying toxic ones substances.