EP1399545A2 - Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite mehtode - Google Patents

Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite mehtode

Info

Publication number
EP1399545A2
EP1399545A2 EP02755089A EP02755089A EP1399545A2 EP 1399545 A2 EP1399545 A2 EP 1399545A2 EP 02755089 A EP02755089 A EP 02755089A EP 02755089 A EP02755089 A EP 02755089A EP 1399545 A2 EP1399545 A2 EP 1399545A2
Authority
EP
European Patent Office
Prior art keywords
calpaine
peptide
isoform
calpain
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02755089A
Other languages
German (de)
English (en)
French (fr)
Inventor
Isabelle Richard
Guillaume Sillon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Genethon
Original Assignee
Centre National de la Recherche Scientifique CNRS
Genethon
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Genethon filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP1399545A2 publication Critical patent/EP1399545A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6472—Cysteine endopeptidases (3.4.22)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the invention relates to a method for detecting the activity of calpaine 3 in a biological sample consisting of either cells, cell lines or tissues. It also relates to the peptides intended to be used in said method. The invention also relates to the use of said peptides for the in vitro diagnosis of dystrophy of type 2A belts (LGMD 2A). It also relates to a method for analyzing the efficiency of the transfer of the calpaine 3 gene in animal or human cells in vitro but also in animals in vivo. It also relates to a method of screening for inhibiting or activating substances of calpain 3. The method of detecting the activity of calpaine 3 finally constitutes a means of studying the function of calpaine 3.
  • Calpains are a family of non-lysosomal calcium-activated cysteine proteases [Sorimachi, 1997]. This family currently includes 11 members including 2 ubiquitous proteins. The physiological functions of calpains are still largely unknown. As regulatory proteases, they are likely to regulate important cellular functions. In particular, ubiquitous calpains have been implicated in apoptosis [Squier, 1994], myogenic differentiation [Kwak, 1993], cell division and fusion [Yamaguchi, 1994]; [Schollmeyer, 1986]; [Balcerzak, 1995].
  • Calpaine 3 also known under the name p94, is a calcium cysteine-dependent enzyme belonging to the calpain family expressing itself specifically in skeletal muscle [Sorimachi, 1989]. She is involved in an autosomal recessive genetic disorder called type 2A belt dystrophy [Richard, 1995]. This myopathy is characterized by atrophy and progressive weakness of the muscles of the pelvic and shoulder girdles and an aspect of necrosis regeneration on muscle biopsies [Fardeau, 1996]. The gene located on chromosome 15 in humans codes for a 3.5kb transcript, itself coding for a 94kDa protein.
  • Calpain 3 has been shown to be able to bind to sarcomere elastic protein titin via the IS 2 region and to undergo autolytic degradation immediately after translation when expressed in Cos7 cells. [Sorimachi, 1993] [Sorimachi, 1995]. This region contains a nuclear localization signal suggesting that the calpain can be localized either in the cytoplasm or in the nucleus. It has also been shown that calpaine 3 is under-expressed in transgenic mice overexpressing interleukin 6, these mice having muscle atrophy. Calpaine 3 also seems to be under-expressed in different conditions including an atrophic component of the muscle (cachexia, etc.).
  • LGMD2A is due to mutations appearing on the calpain 3 gene, mutations leading to an inhibition of the proteolysis of calpaine 3 present in skeletal muscle.
  • the clinical diagnosis of LGMD 2 A is very difficult since patients present clinical signs similar to at least ten other pathologies. Molecular diagnosis can be carried out using different methods.
  • the first possibility is to search for a mutation on the calpain gene.
  • search for a mutation on the calpain gene is very cumbersome insofar as the gene is relatively large, that there are therefore a large number of different mutations and that there is no preferential mutation.
  • Another technique is to detect the presence of the protein using specific antibodies.
  • calpaine 3 is present in the sample, this does not mean that the individual is not sick since the mutation on the calpaine gene can make the protein present but that the autolysis phenomenon does not exist.
  • the calpain is absent or diminished, it may be a secondary calpainopathy due to mutations on a gene other than that of calpain.
  • the problem which the invention proposes to solve is not so much to detect the presence of calpaine 3 in a biological sample but rather that of detecting its activity.
  • Guttman et al. describe in the document Methods in molecular biology vol 144, ch 18, a method for measuring the activity of ubiquitous calpain consisting in bringing a purified calpain in contact with a non-specific fluorescent peptide (Succ-LLVY-AMC), then measure the variation in fluorescence appearing when the molecule is cleaved.
  • the calpaine is brought into contact with the whole TAU protein, then a Western blot is carried out.
  • the substrates are either non-specific (substrate of m-calpaine and ⁇ -calpaine), or whole proteins.
  • the problem which the invention proposes to solve is to develop a new specific substrate for calpain 3 which can be used to detect the activity of calpaine 3 in a biological sample.
  • the invention relates first of all to a peptide coupled to at least one fluorogenic or colorogenic reporter molecule, said peptide being characterized in that it contains at least one amino acid sequence capable of being cleaved by calpain 3 or an isoform of calpain 3.
  • calpain 3 isoform any protein produced by the calpaine 3 gene, resulting from an alternative event of the alternative promoter or alternative splicing type.
  • the peptide of the invention advantageously contains at least one autolysis site of calpaine 3 or of an isoform of calpaine 3, the number of which d amino acids is less than 10.
  • autolysis site denotes an amino acid sequence contained in calpaine 3 or one of its isoforms capable of being cleaved by calpaine 3 or one of its isoforms in at least two peptides as well as any derived sequence.
  • amino acid sequence of the autolysis site of calpaine 3 is chosen from the following sequences NMTYGTS (SEQ ID1), NMDNSLL (SEQ ID2), PVQYETR (SEQ ID3) called in the following description respectively site 1, site 2 and site 3. These sites are identical in all the species for which the sequence of calpaine 3 is known to date (man, mouse, rat,).
  • the amino acid sequence of the calpain 3 autolysis site can also be chosen from the following human sequences VAPRTA AEPRSP (SEQ ID4), QSKATE AGGGNP (SEQ LD5), and the following murine sequences NAPRTG AEPRSP (SEQ ID6), QGKTTE AGGGHP (SEQ ID7).
  • the amino acid sequence of the autolysis site comes from an isoform of calpaine 3 called Lp82 present in rodents, rats, mice and is chosen from the following amino acid sequences: ⁇ PYLLPGFFC (SEQ ID8) and TISNDRPVP (SEQ ID9).
  • the amino acid sequence cleavable by calpaine 3 or an isoform of calpaine 3 comes from a substrate protein of the type for example calpastatin, filamine, taline, ubiquitous calpains, crystalline, heat shock protein, etc.
  • the substrate proteins have the following sequences:
  • REVTIPP YRELL (SEQ LD10) (human calpastatin)
  • KEGTIPPEYRKLL (SEQ ID11) (mouse and rat calpastatin)
  • PVSREEKPTSAPSS (SEQ ID12) (human alpha-A-crystalline)
  • PVSREEKPSSAPSS (SEQ ID13) (alpha-A-crystalline mouse and rat)
  • KSTNLQQQYNR SEQ ID14
  • the peptide containing a sequence cleavable by calpaine 3 or an isoform of calpaine 3, is obtained by screening a library of peptides by calpaine 3 or an isoform of calpaine 3.
  • the peptide of the invention is coupled to a colorogenic or fluorogenic reporter molecule.
  • the reporter molecule When the reporter molecule is a colorogenic molecule, the cleavage of the amino acid sequence by calpaine 3 will be detected with a spectrophotometer by the appearance of a colored compound.
  • the colored compound used is paranitroanilide. It can also be thioesters.
  • the cleavage is detected by a change in the fluorescent emission.
  • the fluorogenic compound used is methyl 4 coumarilamide 7 (MCA) or naphthilamide.
  • MCA methyl 4 coumarilamide 7
  • Naphthilamide and amino 7 fluoromethylcoumarylamide 3 can be used as a colorogenic or fluorogenic substrate.
  • the peptide cleavable by calpaine 3 is coupled at its two ends by two fluorogenic compounds, the cleavage being detected by a change in the fluorescent emission of a first compound (donor molecule) due to the distancing, secondarily upon cutting, of a second compound (acceptor molecule) located on the other side of the peptide and which absorbs the fluorescence of the first when these are close.
  • FRET Fluorescence Resonance Energy Transfer
  • FRET is a physical phenomenon which can occur between two fluorescent molecules under certain conditions: the two molecules must be close enough to each other (less than 100 ⁇ ) and the emission spectrum of one of the molecules (the donor molecule) must cover the excitation spectrum of the second molecule (the acceptor molecule).
  • the donor molecule when the donor molecule is excited at its excitation wavelength, it reaches a higher energy level. In a few picoseconds, part of the energy is dispersed in the medium in different forms (heat ). If the donor molecule is in an optimal orientation and close to an acceptor molecule, its energy can be transferred to this acceptor molecule without the intervention of a photon or the need for collision between the two molecules.
  • the acceptor molecule is then excited and emits light at its own emission wavelength.
  • the fluorogenic reporter molecule can be a synthetic molecule obtained by chemical synthesis or a protein allowing the emission of a fluorescent signal.
  • the peptide has at each of its ends a synthetic fluorogenic reporter molecule, respectively MCA (donor molecule) and Dnp (acceptor molecule).
  • the donor is 5 - [(2 'aminoethyl) - amino] naphthalene sulfonic acid (EDANS) and the acceptor is 4 - [[4' - (dimethyl amino] phenyl] acid) azo] benzoic (DABCYL).
  • the peptide of the invention coupled to the colorogenic or fluorogenic molecule is obtained by chemical synthesis.
  • the reporter molecule can also be a protein allowing the emission of a fluorescence signal. Therefore and in an advantageous embodiment, the peptide has at each of its ends a mutated GFP.
  • GFP Green Fluorescent Protein
  • GFP Green Fluorescent Protein
  • This protein could be purified and its gene identified.
  • the sequence coding for GFP can be cloned in phase with sequences coding for very diverse proteins. GFP retains its fluorescence properties when it is linked to other proteins, which allows easy study of many phenomena due to proteins to which GFP is linked, such as the study of cell migration or migration. of a protein inside the different cellular compartments.
  • CFP When these two proteins are close enough to each other and when CFP is excited at its excitation wavelength, CFP can transfer its activation energy to YFP which can then emit light at 535 nm.
  • the sequences corresponding to the previously mentioned calpain 3 autolysis sites will therefore be cloned between the CFP and YFP sequences.
  • This system will be used to detect calpaine 3 by producing in living cells chimeric proteins within which CFP will be linked to YFP by a peptide cleavable by calpaine 3.
  • the invention also relates to a DNA sequence coding for a peptide coupled to at least one fluorescent protein, said peptide containing at least one amino acid sequence capable of being cleaved by calpain 3 or an isoform of calpam 3.
  • the DNA sequence codes for the following peptides: CFP-site 1- YFP; CFP-site 2- YFP; CFP-site 3- YFP
  • the invention also relates to a vector containing said DNA sequence and a promoter for inducing expression of the DNA sequence in a host cell.
  • a vector is for example the plasmid pTOM developed by the Applicant, directly derived from the plasmid described in [Nanderklish 2000]. It also relates to a host cell transformed by said vector.
  • the invention also relates to a method for in vitro detection of the activity of calpaine 3 or of an isoform of calpaine 3 in a biological sample according to which: in a first step, said biological sample is brought into contact with the peptide previously described, in a second step, the presence or absence of cleavage of said peptide by calpaine 3 or an isoform of calpaine 3 is detected by measuring the intensity of the colorimetric or fluorimetric reaction.
  • the first step can take different forms depending on whether the detection is carried out on a biological sample consisting of either living cells or a cell extract, the cells being of animal or human origin, or of tissue.
  • contact with the peptide can be done in two ways.
  • the peptide is brought directly into contact with the cell so that it must have sufficient permeability properties to penetrate the cell.
  • the permeability of the peptide will be determined according to the nature of the reporter molecule.
  • the biological sample corresponds to host cells transfected with a vector coding for the DNA sequence corresponding to the peptide of the invention, the reporter molecules then corresponding to proteins allowing the emission of a fluorescent signal.
  • the peptide is simply brought into contact with said extract.
  • the detection of the activity can also be done, as already said, directly on tissue sections.
  • the biological sample organ, part of an organ, for example muscle biopsies
  • isopentane cooled with liquid nitrogen. It is stored at -80 ° C until use.
  • Sections from 5 to 15 ⁇ m are made using a cryostat and placed on a glass slide.
  • the sections are also stored at -80 ° C if they are not used immediately.
  • the detection of calpain activity can be carried out by depositing the peptide directly on the slide.
  • the peptide has, at each of its ends, respectively a donor fluorogenic molecule and an acceptor fluorogenic molecule, the intensity of the fluorogenic reaction being determined by FRET.
  • FRET fluorogenic reaction
  • the method for detecting the activity of calpaine 3 or of an isoform of calpaine 3 finds an advantageous application for the in vitro diagnosis of
  • LGMD2A Consequently, the invention also relates to the use of the detection method described above for the in vitro diagnosis of LGMD2A.
  • the invention also relates to a method for screening for inhibiting or activating substances of calpain 3 or of an isoform of calpaine 3.
  • Said method can take two different embodiments. According to a first embodiment, the method consists:
  • the biological sample can be in the form of cells, cellular extracts or even tissues.
  • the preparation of the biological sample containing the peptide is then carried out by mixing the treated sample (cell, cell or tissue extract) with the peptide.
  • the peptide has, at each of its ends, respectively a donor fluorogenic molecule and an acceptor fluorogenic molecule, the intensity of the fluorogenic reaction being determined by FRET.
  • the method consists:
  • the biological sample consists of cells or cell lines transfected with a vector comprising the DNA sequence coding for the peptide of the invention, in the event that the reporter molecule is of protein origin.
  • the peptide has at each of its ends respectively a donor fluorogenic molecule and an acceptor fluorogenic molecule and the method consists in: a / preparing a biological sample containing said peptide, b / measuring the FRET level in l absence of the activator or inhibitor substance of calpain 3 or of a calpain 3 isoform, c / bringing the biological sample containing the peptide into contact with the activating or inhibiting substance of calpaine 3 or of an isoform of calpaine 3, d / measuring the FRET level in the presence of the activating or inhibiting substance of calpaine 3 or an isoform of calpain 3, e / conclude that there is: an activating substance if the FRET level measured in b / is greater than the FRET level measured in d / an inhibiting substance if the rate FREIGHT measured in b / is equal to the FRET rate measured in d /
  • the subject of the invention is also a method of analyzing the efficiency of the gene transfer from calpaine 3 consisting of:
  • the peptide has, at each of its ends, respectively a donor fluorogenic molecule and an acceptor fluorogenic molecule, the intensity of the fluorogenic reaction being determined by FRET.
  • the calpaine 3 gene is perfectly identified and the transfection techniques precisely described in document EP 717110 so that they will not be further detailed.
  • Figure 1 Partial sequence of calpaine 3; the position of the autolysis sites is indicated by the arrows; the sequences used in the peptides are underlined and are identical in all the species for which the sequence of calpain 3 is known to date (man, mouse, monkey, rat, ox).
  • Figure 2 Measurement over time of the cleavage activity of the peptides corresponding to the autolysis site 1, 2 and 3 of calpain 3 (curves A, B and C, respectively) by calpains 1 (left column) and 2 (right column) recombinant
  • Figure 3 Measurement over time of the cleavage activity of the peptides corresponding to the autolysis sites of calpain 3 with extracts of C2C12 cells transfected or not with a plasmid coding for calpain 3.
  • Figure 4 Measurement during of the time of the cleavage activity of the peptides corresponding to the autolysis sites of calpain 3 by extracts of myoblasts of normal (+ / +) or deficient in calpain 3 (- / -) mice.
  • Figure 5 Measurement over time of the cleavage activity of the peptide corresponding to the site 3 of autolysis of calpain 3 by extracts of normal myotubes from mice (+ / +) or deficient in calpain 3 (- / -)
  • Figure 6 Measurement for 6 hours of the cleavage activity of the peptides corresponding to the autolysis sites of calpain 3 by extracts of normal myoblasts from mice (+ / +) or deficient in calpain 3 (- / -)
  • Figure 7 Measurement for 6 hours of the cleavage activity of the peptides corresponding to the autolysis sites of calpain 3 by extracts of normal mouse quadriceps (+ / +) or calpain-3 deficient (- / -)
  • Figure 8 portion of sequence of the plasmid pTOM.
  • the amino acids in italics are part of the EYFP sequence.
  • the amino acids in fat are part of that of ECFP.
  • the STOP codon of EYFP was eliminated in the vector pTOM.
  • the bases in italics and in bold show the phases of the EYFP and ECFP sequences, respectively.
  • the underlined bases correspond to the fragment which was eliminated to construct the vector pTOMp.
  • sequences A and B correspond to the translation of the vector pTOM from the ATG of the coding sequence of EYFP, respectively before and after elimination of the double-stranded fragment located between the sites restriction Ee / 136II and Smal.
  • sequence A the sequences coding for ⁇ YFP and ⁇ CFP are not in phase. They are in sequence B.
  • Figure 9 A: Migration on agarose gel of the PCR products on colonies subcultured after transformation with pTOMp. The PCRs were carried out with the oligonucleotides midEYFP.a and midECFP.m. B: Migration of these PCR products after digestion with EcoRI; Well n ° l: scale lkb; # 2: pTOM; n ° 3: pTOM after digestion with Ec ⁇ RI; n ° 4 to n ° 9: migration of the PCR products from gel A after digestion with Ec ⁇ RI; their size is always 800bp.
  • Figure 10 cloning site on the vector pTOM (10a) and sequence of the oligonucleotides coding for the autolysis sites of calpain 3 (10b, 10c, 10d).
  • Each pair of complementary oligonucleotides is composed of an oligonucleotide whose name ends in ".a" and an oligonucleotide whose name ends in
  • Figure 11 Migration on agarose gel of PCR products on colonies subcultured after transformation with pTOM and the insert coding for site 2 of autolysis; the PCR was carried out with the oligonucleotides SGp94S2.a and midECFP.m.
  • Figure 12 restriction map of the plasmid pTOM
  • FIG. 13 restriction map of the plasmid pTOMs1, pTOMs2, TOMs3
  • Mca-NMDNSLL-Dnp site 2
  • Mca-PVQYETR-Dnp site 3
  • calpain 2 Rat, recombinant, E.coli (Calbiochem) caspase 3: Human, recombinant, E.coli (Calbiochem)
  • the reaction is carried out at 37 ° C., either over one hour (with a fluorescence measurement every 50 seconds in this case) or over 6 hours (measurement every 2 minutes).
  • the medium is agitated between each measurement.
  • the wavelengths used for the detection of the fluorescence of the peptides are: - Mca excitation wavelength: 325nm.
  • the reaction conditions were developed, and in particular the composition of the reaction buffer. Indeed, the detection of fluorescence has proven to be very sensitive.
  • the first tests consisted in varying the different components of the buffer and their concentration. Different NaCl concentrations have been tested. The importance of a low concentration of DMSO, in which the peptides are resuspended, has been demonstrated. It has also been shown that the presence of CHAPS in the reaction medium, as well as BSA, allows optimal detection of fluorescence.
  • the reactions are carried out at 37 ° C., in the presence of 10 mM of calcium. Indeed, calpaine 3 is active when it is in the presence of calcium concentrations of the order of nanomolar. Buffer composition:
  • TrisHCl 50mM, Bmercaptoethanol 5mM, glycerol 40%, pH 7.8. Storage at room temperature. Fluorescent peptide resuspension buffer: The peptides are resuspended at 1 mg / ml in 100% DMSO>. Storage at 4 ° C, protected from light.
  • DMEM Eagle medium modified by Dulbecco (Gibco BRL)
  • MEM Non-essential amino acid solution
  • SVF Fetal calf serum
  • C2C12 DMEM + 10% SVF
  • Plasmids used pECFP-Nl (Clontech); pEYFP-Cl (Clontech). Methods: 1 st day:
  • FUGENE 6 is to be expected (cell control), as well as a well in which the cells will have been in contact with FUGENE 6 only (FUGENE 6 toxicity control).
  • PB S Distrachloro phosphate-buffered solution (without calcium, magnesium or sodium bicarbonate) -
  • calpain 3 has greater stability in muscle cells due to the presence of titin. In order to prove that calpain 3 could cleave its own autolysis sites, it is therefore overexpressed in C2C12 cells by transfecting these cells with a plasmid coding for calpam 3. A control transfection with pECFP was carried out at the same time than transfection with the plasmid coding for calpam 3. The transfection efficiency on C2C12 is less than 10%>. The proteins are then extracted and their activity is tested at the autolysis sites ( Figure 3).
  • the curves representing the activity of transfected or non-transfected C2C12 extracts at sites 1 and 2 show a slight increase in fluorescence, which could mean that calpain 3 can cleave these sites.
  • Calpain 3 is a protein expressed in muscle, therefore the basal activity observed for extracts from non-transfected cells is normal. However, no difference can be detected between transfected or non-transfected cells for sites 1 and 2.
  • site 3 the cleavage activity is greater in the transfected cells. The difference is minimal but it is consistent with the small percentage of cells transfected.
  • the cleavage activity on sites 1 and 2 is greater in extracts of cells + / + than in extracts of cells - / -.
  • the increase in activity on site 3 is here confirmed when the reaction takes place over 6 hours.
  • the activity is greater in cell extracts - / - than in cell extracts + / +.
  • Oligonucleotides site 1, site 2, site 3
  • SCSI 10 dam-Str R bacteria (Stratagene); XLl-Blue (Stratagene).
  • Plasmid vector pTOM (Genethon) ( Figure 12).
  • the complementary single-stranded oligonucleotides are brought into contact with one another at a concentration of 20 ng / ⁇ l final each in the SYBR Green buffer.
  • the vector pTOM is digested with the two enzymes BamHlet BspEl at 37 ° C. for 2 h for each enzyme.
  • Ligation of the oligonucleotides in pTOM In the ligation mixture, the ratio between the quantity of insert and the quantity of vector is 3 (in moles). The ligation reaction is carried out in the presence of T4 DNA ligase (BioLabs) overnight at 16 ° C.
  • Electroporation conditions 2500 V, 200 ohm, 25 ⁇ F.
  • the colonies are counted and subcultured in a 96-well plate in 100 ⁇ l LB + kanamycin at 10 ⁇ g / ml final. To verify the presence of the plasmid in the colonies. PCR is carried out on these colonies with either the midEYFP.a and midECFP.m pair, or the pair formed by one of the following forward oligos:
  • Each oligonucleotide is SG P 94S1.
  • E has CCGGAAGTGGCACGAACATG for site 1 specific for a fragment
  • SGp94S2 a CCGGAAGTGGCGTGAGAAAT for site 2 double-strand clone. They are centered at the SGp94S3 site level. a CCGGAAGTGGCATTGTTCCC for j es j te 3 BspEl restriction.
  • DMEM Middle of Eagle modified by Dulbecco (Gibco BRL)
  • MEM Non-essential amino acid solution (Gibco BRL)
  • SVF Fetal calf serum (Gibco BRL)
  • the DNA of the different plasmids is prepared according to the QIAGEN Endofree protocol
  • Plasmids used pECFP-Nl (Clontech); pEYFP-Cl (Clontech).
  • pTOMp The strategy of construction of the vector carrying the two sequences coding for ECFP and EYFP in phase (called pTOMp) consisted in digesting the plasmid pTOM by two restriction enzymes at unique sites on pTOM and generating blunt ends, Ec / 136II and Smal ( Figure 8). The linearized vector was purified and a ligation reaction of the vector on itself was carried out. After transformation and subculturing of positive colonies, a PCR reaction made it possible to confirm the presence of the plasmid in these colonies (FIG. 9). About a third of the transplanted colonies were thus able to be amplified and therefore had to contain the vector pTOMp.
  • oligonucleotides coding for cleavage sites with calpain 3 in the expression vector pTOM To facilitate the phenomenon of FRET between the two proteins EYFP and ECFP, amino acids glycine and serine were added by hand and on the other side of the cleavage site so as to facilitate the bringing together of the two proteins, the glycines facilitating the flexibility of the chimeric protein and the serines increasing its solubility in an aqueous medium (FIG. 10).
  • the sequence of the oligonucleotides is such that they form restriction sites for BspEl and BamBI at each end when they are paired.
  • the bases marked in bold underlined in the sequences of the oligonucleotides are bases which do not modify the protein sequence but which are different from the genomic sequence. These bases have been modified in order to limit the formation of duplexes of homologous primers, which could hinder the formation of double-stranded oligonucleotides.
  • the modification of the bases was also made according to the frequency of use of the codons in the mouse.
  • the restriction sites used for cloning are unique sites.
  • the enzyme BspEl is inactive if the cloning site is methylated.
  • the cloning of the vector pTOM intended to receive the double-stranded oligonucleotides was therefore done in bacteria whose gene coding for Dam methylase is mutated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
EP02755089A 2001-06-29 2002-06-24 Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite mehtode Withdrawn EP1399545A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0108614A FR2826656B1 (fr) 2001-06-29 2001-06-29 Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite methode
FR0108614 2001-06-29
PCT/FR2002/002178 WO2003002730A2 (fr) 2001-06-29 2002-06-24 Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite methode

Publications (1)

Publication Number Publication Date
EP1399545A2 true EP1399545A2 (fr) 2004-03-24

Family

ID=8864926

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02755089A Withdrawn EP1399545A2 (fr) 2001-06-29 2002-06-24 Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite mehtode

Country Status (8)

Country Link
US (1) US20040180395A1 (ja)
EP (1) EP1399545A2 (ja)
JP (1) JP2004520850A (ja)
CN (1) CN1514878A (ja)
AU (1) AU2002321389B2 (ja)
CA (1) CA2429429A1 (ja)
FR (1) FR2826656B1 (ja)
WO (1) WO2003002730A2 (ja)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4803976B2 (ja) * 2003-07-09 2011-10-26 独立行政法人科学技術振興機構 細胞内ｉｐ３測定用分子センサー
FR2858177A1 (fr) * 2003-07-28 2005-02-04 Genethon Utilisation du phenomeme fret, detecte par mplsm, pour le suivi in vivo d'evenements biologiques
JP2007049943A (ja) * 2005-08-18 2007-03-01 Kyoto Univ 細胞内カルシウムイオン指示機能を有するポリペプチド
FR2891544A1 (fr) * 2005-09-30 2007-04-06 Genethon Ass Loi De 1901 Substrat proteique pour la detection de l'activite calpaine 3
FR2962041B1 (fr) 2010-07-01 2012-07-27 Genethon Inhibiteurs de la calpaine 3 pour le traitement de dystrophies musculaires et de cardiomyopathies
CN102154288B (zh) * 2010-12-21 2012-12-19 山东农业大学 一种骨骼肌特异性capn3启动子及其应用
WO2014136780A1 (ja) * 2013-03-04 2014-09-12 国立大学法人 東京大学 カルパイン活性検出蛍光プローブ
CN104655596A (zh) * 2013-11-18 2015-05-27 李捷 一种含红细胞血液样品的质量检测方法及检测试剂盒
EP3987050A1 (en) * 2019-06-24 2022-04-27 Urteste S.A. Novel diagnostic marker for pancreatic cancer
AU2022297106A1 (en) * 2021-06-24 2023-12-07 Goryo Chemical, Inc. Fluorescent probes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19650142A1 (de) * 1996-12-04 1998-06-10 Basf Ag Neue Calpaine, ihre Herstellung und Verwendung

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SORIMACHI H. ET AL: "Molecular Cloning of a Novel Mammalian Calcium-dependent Protease Distinct form Both m- and µ-Types", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 264, no. 25, 25 November 1989 (1989-11-25), pages 20106 - 20111, XP002010549 *

Also Published As

Publication number Publication date
WO2003002730A2 (fr) 2003-01-09
FR2826656A1 (fr) 2003-01-03
CA2429429A1 (fr) 2003-01-09
AU2002321389B2 (en) 2005-03-24
JP2004520850A (ja) 2004-07-15
FR2826656B1 (fr) 2003-09-12
US20040180395A1 (en) 2004-09-16
CN1514878A (zh) 2004-07-21
WO2003002730A3 (fr) 2003-12-11

Similar Documents

Publication Publication Date Title
Herman et al. Lack of a robust unfoldase activity confers a unique level of substrate specificity to the universal AAA protease FtsH
Suzuki et al. Calpain: novel family members, activation, and physiological function
Shimada et al. Alanine scanning mutagenesis of the switch I region in the ATPase site of Dictyostelium discoideum myosin II
Itoh et al. Expression and analysis of Gs alpha mutants with decreased ability to activate adenylylcyclase
Ermolova et al. Pathogenity of some limb girdle muscular dystrophy mutations can result from reduced anchorage to myofibrils and altered stability of calpain 3
EP1399545A2 (fr) Methode de detection de l'activite de la calpaine 3 dans un echantillon biologique et peptides pour la mise en oeuvre de ladite mehtode
Unsworth et al. Dynamin is required for F‐actin assembly and pedestal formation by enteropathogenic Escherichia coli (EPEC)
Mannan et al. An Ire1–Phk1 Chimera Reveals a Dispensable Role of Autokinase Activity in Endoplasmic Reticulum Stress Response
Elgert et al. A novel soluble guanylyl cyclase activator, BR 11257, acts as a non-stabilising partial agonist of sGC
Averna et al. Changes in calpastatin localization and expression during calpain activation: a new mechanism for the regulation of intracellular Ca 2+-dependent proteolysis
Peng et al. Vesicle encapsulation stabilizes intermolecular association and structure formation of functional RNA and DNA
Chen et al. Designing protease sensors for real-time imaging of trypsin activation in pancreatic cancer cells
Ketteler et al. A pathway sensor for genome-wide screens of intracellular proteolytic cleavage
Leonard et al. Analysis of dishevelled localization and function in the early sea urchin embryo
WO2007039699A2 (fr) Substrat proteique pour la detection de l'activite calpaine 3
Baba et al. Effects of neutral salts and pH on the activity and stability of human RNase H2
US7982021B2 (en) Nucleic acid molecules encoding emission ratiometric indicators of phosphoinositides
EP1442298B1 (fr) Procede de selection d'agents bio-actifs par couplage de luminescence et systeme cellulaire vivant pour la mise en oeuvre de ce procede
Grabau et al. Lipid binding by Escherichia coli pyruvate oxidase is disrupted by small alterations of the carboxyl-terminal region
Thompson et al. A conserved tyrosine residue of Saccharomyces cerevisiae leukotriene A4 hydrolase stabilizes the transition state of the peptidase activity
Xiao et al. Roles of μ-calpain in cultured L8 muscle cells: application of a skeletal muscle-specific gene expression system
EP1171601B1 (en) Nucleic acids encoding a mutt domain-containing polypeptide
CA2659353C (en) Composition and method for treatment of tumors
TWI457565B (zh) 用於鑑別出改變ＮＡＰＥ－ＰＬＤ或Ａｂｈ４之作用劑的分析方法
Parchaliuk et al. Yeast two-hybrid system

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030429

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20050419

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060411