Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4727—Mucins, e.g. human intestinal mucin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/0005—Vertebrate antigens
  • A61K39/0011—Cancer antigens
  • A61K39/001136—Cytokines
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

• the invention relates to a pool of DNA plasmid constructs containing the sequences of human MUC-1 encoding fragments and to a pool of DNA plasmids in which the fragments themselves are preceded by the sequence encoding a protein consisting of human ubiquitin fused to a bacterial Lad fragment.
• the invention further relates to their use in the preparation of pharmaceutical compositions for use as DNA anti-tumor vaccines.
• the invention provides an anti-tumor therapy based on the induction or activation of the immune response able to bring about tumor rejection.
• the validity of such an idea is demonstrated from the first clinical results; for example, patients treated with a viral vaccine containing the Carcinoembryonic Antigen (CEA) encoding sequences demonstrated immune system activation against this antigen (Tsang KY et al . J. Natl. Cancer. Inst . 87: 982, 1995).
• CEA Carcinoembryonic Antigen
• an immune anti-tumor response is achievable through four different approaches: a) Ex vivo engineering of patient tumor cells in order to make them more immunogenic and suitable as a vaccine; b) Ex vivo engineering of patient immune cells in order to pre-activate an in vi tro immune response. c) Inoculation of naked or liposome capsulated or viral particle integrated (retrovirus, vaccinia virus, adenovirus, etc.) DNA encoding tumor associated antigens; d) Treatment with recombinant or synthetic soluble tumor antigens conjugated or mixed with adjuvants.
• the first two approaches consist of the engineering of every single patient cell and are limited in that they are necessarily patient-specific, while the latter two are aimed to obtain products comparable to a traditional drug.
• the new vaccination methods reflect the development of new technologies.
• Muscle cells express class I MHC antigens at low levels only, and do not apparently express class II antigens or co-stimulatory molecules. Consequently, transfected muscle cells are unlikely to play an important role in the onset of the immune response per se.
• Antigen Presenting Cells such as macrophages or dendritic cells
• APC Antigen Presenting Cells
• macrophages or dendritic cells play a fundamental role in capturing the myocyte released antigen and in the subsequent processing and presenting of the respective peptides in the context of the class I and II molecules, thus inducing a CD8+ cell activation with cytotoxic activity as well as activation of the CD4+ cells co-operating with B lymphocytes in eliciting the antibody response
• cytokines is known to improve the therapeutic effect deriving from immunization with DNA.
• Cytokines can be administered in the form of exogenous proteins as reported in Irvine et al . , J. Immunol . 156: 238, 1996.
• An alternative approach is represented by the contemporaneous inoculation of both the tumor antigen or the desired cytokine encoding plasmids, thus allowing the cytokine to be produced in si tu (Kim JJ et al . Immunol 158 : 816, 1997) .
• MUC-1 is an epithelial luminal surface glycoprotein (Patton S . et al . BBA 1241 : 407, 1995) . In the cell transformation process this glycoprotein loses the apical localization and its expression level rises dramatically.
• the protein function consists of protecting the luminal surfaces, for example in the mammal gland, ovary, endometrium, colon, stomach, pancreas, bladder, kidney, etc.
• a glycosylation defect is reported that makes tumor cell associated MUC-1 antigenically different from normal cell associated MUC-1. This phenomenon causes tumor MUC-1 to expose the antigen epitopes that are normally masked by the sugar moieties in the normal cell expressed MUC-1. This characteristic makes tumor MUC-1 particularly interesting in an induction of a tumor specific antibody response (Apostolopoulos V. et al . Cri t . Rev. Immunol . 14 :293, 1994) .
• the vaccination is aimed at inducing immune responses against tumor cells expressing MUC1 at high levels, preserving at the same time the low expressing normal epithelia.
• the DNA vaccination relies upon the entrance of a gene or portions thereof inside the body cells followed by transcription and translation of the inserted sequence and thus the intracellular synthesis of the corresponding polypeptide.
• An important advantage of this system is that the neo-synthesized protein is naturally processed inside the cell and the produced peptides are associated with the Major Histocompatibility Complex class I molecules (MHC-I) .
• MHC/peptide complexes are therefore naturally exported to the cell surface where they can be recognized by the immune system CD8+ cytotoxic cells.
• the invention relates particularly to a pharmaceutical composition containing one or more DNA encoding Mucin (MUC-1) protein fragments .
• the DNA used in the present invention can be plasmid or viral DNA, preferably plasmid DNA obtained employing the pMRS30 expression vector described in fig. 13.
• compositions according to the invention contain preferably at least two DNA fragments of the Mucin (MUC-1) or of another protein overexpressed in tumor cells.
• compositions according to the invention contain preferably at least four fragments, each ranging from 200 to about 700 nucleotides, each sequence being juxtaposed and possibly partially overlapping, from about 50 to about 150 nucleotides, at the 3' and/or 5' end of the adjacent one.
• the DNA fragments according to the invention can be possibly preceded at the 5' end by a ubiquitin encoding DNA sequence and possibly also by a Lad portion of Escherichia coli .
• the invention relates also to new DNA fragments and to the use of Mucin-1 fragments defined above in the medicine and anti- tumor vaccine preparation.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS166 expression vector.
• This DNA includes the sequence corresponding to nucleotides 136-339 of the EMBL sequence J05581, preceded by the translation start codon, ATG and followed by the two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes a Metionin followed by the amino acids encoded by the 136-339 fragment of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS169 expression vector.
• This DNA includes the sequence corresponding to nucleotides 205-720 of the EMBL sequence J05581, preceded by the translation start codon, ATG and followed by two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes a Metionin followed by the amino acids encoded by the 205-720 fragment of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS168 expression vector.
• This DNA includes the sequence corresponding to nucleotides 631-1275 of the EMBL sequence J05581, preceded by the translation start codon, ATG and followed by two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes a Metionin followed by the amino acids encoded by the 631-1275 fragment of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS167 expression vector.
• This DNA includes the sequence corresponding to nucleotides 1222-1497 of the EMBL sequence J05581, preceded by the translation start codon, ATG and followed by two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes a Metionin followed by the amino acids encoded by the 1222-1497 fragment of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS175 expression vector.
• This DNA includes the sequence corresponding to nucleotides 136-1497 of the EMBL sequence J05581, preceded by the translation start codon, ATG and followed by two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes a Metionin followed by the amino acids encoded by the 136-1497 fragment of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) termed UBILacI .
• the encoded polypeptide includes the ubiquitin sequence fused to a partial sequence of the bacterial protein beta-galactosidase, as described in Chau V. et al .
• Fig. 7 Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the expression vector pMRS30 to give the pMRS171 expression vector.
• This DNA includes the sequence termed UBILacI (see fig. 6) fused to the sequence corresponding to nucleotides 136-339 of the EMBL sequence J05581 followed by two translation stop codons, TGA and TAA.
• the coded polypeptide thus includes the amino acid sequence reported in Fig. 6, fused to the sequence including the amino acids encoded by the fragment 136-339 of the EMBL sequence J05581.
• Fig. 7 Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the expression vector pMRS30 to give the pMRS171 expression vector.
• This DNA includes the sequence termed UBILacI (see fig. 6) fused to the sequence corresponding to nucleotides 136-339 of the EMBL sequence J05
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS174 expression vector.
• This DNA includes the sequence termed UBILacI (see fig. 6) fused to the sequence partially corresponding to nucleotides 205-720 of the EMBL sequence J05581 followed by two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes the amino acid sequence reported in Fig. 6, fused to the sequence including the amino acids encoded by the fragment 205-720 of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS173 expression vector.
• This DNA includes the sequence termed UBILacI (see fig. 6) fused to the sequence partially corresponding to nucleotides 631-1275 of the EMBL sequence J05581 followed by two translation stop codons, TGA and
• the encoded polypeptide thus includes the amino acid sequence reported in Fig. 6, fused to the sequence including the amino acids encoded by the fragment 631-1275 of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS172 expression vector.
• This DNA includes the sequence termed UBILacI (see fig. 6) fused to the sequence partially corresponding to nucleotides 1222-1497 of the EMBL sequence J05581 followed by two translation stop codons, TGA and
• the encoded polypeptide thus includes the amino acid sequence reported in Fig. 6, fused to the sequence including the amino acids encoded by the fragment 1222-1497 of the EMBL sequence J05581.
• Nucleotide DNA sequence (with the respective amino acid sequence) inserted at the Xbal site of the pMRS30 expression vector to give the pMRS176 expression vector.
• This DNA includes the sequence named UBILacI (see fig. 6) fused to the sequence partially corresponding to nucleotides 136-1497 of the EMBL sequence J05581 followed by two translation stop codons, TGA and TAA.
• the encoded polypeptide thus includes the amino acid sequence reported in Fig. 6, fused to the sequence including the amino acids encoded by the fragment 136-1497 of the EMBL sequence J05581.
• the 1- 2862 region corresponds to the Accl (location 504) - BamHI (location 3369) region of the pSV2CAT vector (EMBL M77788) ;
• the 2863-3721 region includes the human cytomegalovirus promoter (human cytomegalovirus major immediate-early gene enhancer) ;
• the 3722-4905 region includes several cloning sites, including Xbal (location 3727) , and the processing signal of the rabbit beta- globin gene.
• a DNA plasmid pool encoding, in eukaryotic cells, fragments of the MUC-1 human protein antigen was prepared. Constructs are based on the mammalian expression vector termed pMRS30, described in figure 13 and previously claimed in the Patent Application W095/11982, and contain partial sequences of the MUC-1 cDNAs reported in the EMBL database with accession number J05581. MUC-1 encoding DNA was fragmented so that each fragment represents a discrete portion, partially overlapping to the adjacent ones. Administration of a mix of such plasmids can cause different plasmids to transfect different APC cells at the administration site. Therefore such cells produce and process discrete portions of the MUC-1 protein giving the related peptides.
• the occurring subdominant and cryptic peptides can also be presented in association with class I MHC molecules thus generating a cytotoxic immune response.
• the present invention thus relates to the use of a group of four constructs ( Figures 1 to 4) containing MUC-1 cDNA partial fragments in admixture containing at least two of them and a group of four constructs ( Figures 7 to 10) containing MUC-1 cDNA partial fragment preceded by the DNA encoding a protein sequence containing Ubiquitin and an Escherichia coli Lac I portion ( Figure 6) used separately or in admixture containing at least two of them.
• the present invention relates also to the use of the construct ( Figure 5) containing the almost complete sequence of the MUC-1 cDNA and the construct ( Figure 11) containing the almost complete sequence of the MUC-1 cDNA preceded by the DNA encoding a protein sequence containing Ubiquitin and an Escherichia coli Lac I portion.
• the mixture of the four constructs containing the partial fragments of the MUC-1 cDNA and the mixture of the four constructs containing the partial fragments of the MUC-1 cDNA preceded by the DNA encoding a protein sequence, containing Ubiquitin and an Escherichia coli Lac I portion, represents a preferred embodiment of the present invention.
• Constructs according to the present invention can be used in the anti-tumor therapy of patient affected with tumors characterized by high MUC-1 expression.
• Constructs described in the present invention were obtained as follows.
• the fragments of the MUC-1 DNA were obtained by RT-PCR from BT20 cell line or by DNA partial chemical synthesis. Such fragments were then cloned into the pMRS30 expression vector and verified by sequencing.
• the fragments were obtained from the first series of constructs by a PCR re-amplification. These fragments were then fused to the DNA encoding the Ubiquitin (obtained by RT-PCR from MCF7 cell line mRNA) and a partial lad sequence (obtained by PCR from the commercial vector pGEX) .
• fragments or constructs according to the invention are suitably formulated, using carriers and methods previously employed in naked DNA vaccines, as described for example in The Immunologist, 1994, 2:1; WO 90/11092, Proc . Natl. Acad. Sci . U.S.A., 1986, 83, 9551; US 5580859; Immunology today 19 (1998), 89-97); Proc. Natl. Acad. Sci. U.S.A. 90 (1993), 11478-11482; Nat. Med. 3 (1997), 526-532; Vaccine 12 (1994), 1495-1498; DNA Cell. Biol.
• the dosages will be determined on the basis of clinical and pharmacological-toxicological trials. Generally speaking, they will be comprised between 0.005 ⁇ g/kg and 5 ⁇ g/kg of the fragment mix.
• the composition of the invention can also contain a cytokine or a cytokine encoding plasmid.
• Example 1 Plasmid pMRSl ⁇ construction.
• BT20 tumor cells (ATCC HTB-19) were cultured in Eagles MEM supplemented with 10% fetal calf serum. Ten million cells were trypsinized, washed with PBS, and mRNA extracted.
• RNA was subjected to RT-PCR (reverse transcriptase-polymerase chain reaction) reaction in the presence of the following synthetic oligonucleotides :
• VI1 (5 GATCTCTAGAATGACAGGTTCTGGTCATGCAAGC 3)
• V4 (5 GATCTCTAGAAAGCTTATCAACCTGAAGCTGGTTCCGTGGC 3)
• the resulting pMRS166 vector contains a DNA fragment including the ATG codon, the sequence corresponding to the nucleotides 136-339 of the EMBL sequence J05581, and two stop codons, TGA and TAA.
• RNA obtained as reported in example 1 was amplified by RT-PCR in the presence of the following synthetic oligonuclotides :
• the whole fragment was thus cloned in the Xbal site of the pMRS30 expression vector.
• the resulting pMRS169 vector contains a DNA fragment including the ATG codon, the sequence partially corresponding to the nucleotides 205-720 of the EMBL sequence J05581, and two stop codons, TGA and TAA.
• RNA obtained as reported in example 1 was amplified by RT-PCR in the presence of the following synthetic oligonuclotides :
• VI3 (5 GATCTCTAGAATGGGCTCAGCTTCTACTCTGGTGCACAACGGC 3)
• V8 (5 GATCTCTAGAAAGCTTATCACAAGGCAATGAGATAGACAATGGCC 3)
• the produced DNA fragment, purified and digested with the restriction enzyme Xbal was cloned in the pMRS30 expression vector.
• the resulting pMRS168 vector contains a DNA fragment including the ATG codon, the sequence corresponding to the nucleotides 631-1275 of the EMBL sequence J05581, and two stop codons, TGA and TAA.
• Example 4 Plasmid pMRS167 construction. An aliquot of the RNA obtained as reported in example 1 was subjected to RT-PCR reaction in the presence of the following synthetic oligonucleotides :
• the produced DNA fragment, purified and digested with the restriction enzyme Xbal was cloned in the pMRS30 expression vector.
• the resulting pMRS167 vector contains a DNA fragment including the ATG codon, the sequence corresponding to the nucleotides 1222-1497 of the EMBL sequence J05581, and two stop codons, TGA and TAA.
• Example 5 Plasmid pMRS175 construction. pMRS166, 169, 168, 167 plasmids were subjected to PCR reaction in the presence of the following nucleotide pairs: VI1 (see example 1)
• V21 (5 GGCTCAGCTTCTACTCTGGTGCACAACGGC 3)
• V22 (5 CAAGGCAATGAGATAGACAATGGCC 3) for pMRS168
• V23 (5 CTGGTGCTGGTCTGTGTTCTGGTTGCG 3)
• the four DNA fragments obtained in the respective PCR reactions were mixed in equimolar amounts and PCR reacted in the presence of the Vll and V10 oligonuclotides.
• the resulting pMRS175 vector contains a DNA fragment including the ATG codon, the sequence partially corresponding to the nucleotides 136-1497 of the EMBL sequence J05581 and two stop codons TGA and TAA.
• Example 6 Plasmid pMRS171 construction.
• MCF7 tumor cells (ATCC HTB-22) were cultured in Eagles MEM supplemented with 10% fetal calf serum. Ten million cells were trypsinized, washed with PBS, and mRNA extracted.
• DNA from pGEXHT (Pharmacia) was subjected to PCR reaction in the presence of the following synthetic oligonucleotides:
• LacIdown (5GATCGGATCCTCGGGAAACCTGTCGTGCCAGCTGC 3) This reaction gives a DNA fragment termed fragment 2.
• the resulting pMRS156 vector contains a DNA fragment including the sequence encoding the ubiquitin fused to the sequence encoding a bacterial beta-galactosidase portion. This fragment, termed UBILacI, is reported in fig. 6.
• Plasmid pMRS166 DNA was subjected to a PCR reaction in presence of the following synthetic oligonucleotides: V3 (5GATCGGATCCACAGGTTCTGGTCATGCAAGC 3) V4 (see Example 1)
• V3 5GATCGGATCCACAGGTTCTGGTCATGCAAGC 3
• V4 see Example 1
• the resulting fragment was cloned into the pMRS30 expression vector.
• the resulting pMRS171 vector contains a DNA fragment including the UBILacI sequence, the sequence corresponding to the 136-339 nucleotides of the EMBL sequence J05581 and two stop codons, TGA and TAA. This fragment is reported in fig. 7.
• Plasmid pMRS174 construction Plasmid pMRS169 DNA was subjected to PCR reaction in the presence of the following synthetic oligonucleotides: V5 (5GATCGGATCCGTGCCCAGCTCTACTGAGAAGAATGC 3) V6 (5GATCTCTAGAAAGCTTATCAGCTGGGAATTGAGAATGGAGTGCTCTTGC 3) The produced DNA fragment, purified and digested with the restriction enzymes Xbal and BamHI, was fused, by ligation into the two BamHI sites, to the UBILacI fragment deriving from the pMRS156 plasmid. The resulting fragment was cloned into the pMRS30 expression vector.
• the resulting pMRS174 vector contains a DNA fragment including the UBILacI sequence, the sequence corresponding to the 205-720 nucleotides of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is reported in fig. 8.
• Plasmid pMRS168 DNA was subjected to PCR reaction in the presence of the following synthetic oligonucleotides:
• V7 (5GATCGGATCCGGCTCAGCTTCTACTCTGGTGCACAACGGC 3)
• V8 (see example 3)
• the resulting fragment was cloned into the pMRS30 expression vector.
• the resulting pMRS173 vector contains a DNA fragment including the UBILacI sequence, the sequence corresponding to the 631-1275 nucleotides of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is reported in fig. 9.
• Plasmid pMRS167 DNA was subjected to PCR reaction in the presence of the following synthetic oligonucleotides:
• the resulting fragment was cloned into the pMRS30 expression vector.
• the resulting pMRS172 vector contains a DNA fragment including the UBILacI sequence, the sequence corresponding to the 1222-1497 nucleotides of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is reported in fig. 10.
• Plasmid pMRS167 DNA was subjected PCR reaction in the presence of the following synthetic oligonucleotides: V3 (see example 6)
• the resulting fragment was cloned into the PMRS30 expression vector.
• the resulting pMRS176 vector contains a DNA fragment including the UBILacI sequence, the sequence corresponding to the 136-1497 nucleotides of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is reported in fig. 11.
• Example 11 Eukaryotic cell transfection and testing for transcriptio .
• CHO (Chinese Hamster Ovary) cells were cultured in alpha MEM supplemented with ribonucleotides and deoxyribonucleotides at transfection time.
• Dendritic cells were obtained from CD34+ hemopoietic precursors cultured in IMDM without serum, supplemented with GM- CSF, IL4, SCF, Fit3 and TNFalpha. After 7 days the obtained cell population was transfected.
• Dendritic cells were obtained from monocytes isolated from PBMC (peripheral blood mononuclear cells) , cultured in RPMI supplemented with FCS, GM-CSF, and IL-4. After 7 days the obtained cell population was transfected. In each case, about one million cells were transfected with one of the plasmids reported in examples 1 to 10. Transfection was carried out using 3 ⁇ g of plasmid DNA and 4 ⁇ l of DMRIE (Gibco) by lipofection.
• a mRNA aliquot was subjected to RT-PCR reaction in the presence of the oligonucleotide pair specific for the transfected DNA plasmid.
• figure 12 reports the electrophoretic analysis of the DNA fragments obtained by RT-PCR from the mRNA of the three cell populations, transfected with the pMRS169 plasmid. In this case the oligonucleotide pair V12/V6 was used. Example 12. In vivo study results.
• the in vivo studies were conducted using human MUCl transgenic C57BL mice. As a consequence in these animals the MUCl protein represents a self-protein.
• the employed vaccination schedule consists of 3 intradermic (dorsal portion, 50 micrograms DNA for each side) administrations (at days 0, 14, 28) of 100 micrograms plasmid DNA. At day 14 after the last administration, the animals were sacrificed and sera were tested for anti-human mucin antibodies. The assayed fragment mixes, object of the present invention, stimulated a good immune response in the treated animals.
• the two vaccinations differ in the type of the elicited antibody response.
• the antibody titer results much more higher in the vaccination with 3XTR.
• IgG subtypes are in favor of an essentially humoral (antibody) response in the case of vaccination with 3XTR, and of a cellular response (cytotoxic) in the case of vaccination with DNA.
• cytotoxic a principally cytotoxic immune response is preferable. Because the experiments were carried out on transgenic mice, in whom the human mucin is "self", we can foresee a similar response in humans. This response could justify the use, as DNA vaccines, of the compounds of the present invention in the treatment of MUCl overxpressing human tumors .

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Organic Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Epidemiology (AREA)
• Oncology (AREA)
• Mycology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• General Chemical & Material Sciences (AREA)
• Toxicology (AREA)
• Zoology (AREA)
• Gastroenterology & Hepatology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=11380969

Family Applications (1)

Country Status (19)

Families Citing this family (11)

Family Cites Families (2)

• 1998
  • 1998-10-30 IT IT1998MI002330A patent/IT1303683B1/it active
• 1999
  • 1999-10-18 CA CA002348745A patent/CA2348745A1/en not_active Abandoned
  • 1999-10-18 EA EA200100395A patent/EA200100395A1/ru unknown
  • 1999-10-18 HU HU0103784A patent/HUP0103784A2/hu unknown
  • 1999-10-18 CZ CZ20011521A patent/CZ20011521A3/cs unknown
  • 1999-10-18 MX MXPA01004186A patent/MXPA01004186A/es unknown
  • 1999-10-18 EP EP99971329A patent/EP1124956A2/de not_active Withdrawn
  • 1999-10-18 AU AU11522/00A patent/AU1152200A/en not_active Abandoned
  • 1999-10-18 JP JP2000579265A patent/JP2002528519A/ja active Pending
  • 1999-10-18 BR BR9914892-7A patent/BR9914892A/pt not_active IP Right Cessation
  • 1999-10-18 SK SK571-2001A patent/SK5712001A3/sk unknown
  • 1999-10-18 CN CN99812745A patent/CN1324406A/zh active Pending
  • 1999-10-18 WO PCT/EP1999/007874 patent/WO2000025827A2/en not_active Application Discontinuation
  • 1999-10-18 TR TR2001/01141T patent/TR200101141T2/xx unknown
  • 1999-10-18 PL PL99348156A patent/PL348156A1/xx unknown
  • 1999-10-21 AR ARP990105316A patent/AR020927A1/es unknown
  • 1999-10-22 PE PE1999001068A patent/PE20001287A1/es not_active Application Discontinuation
  • 1999-10-29 CO CO99068636A patent/CO5231134A1/es not_active Application Discontinuation
• 2001
  • 2001-04-20 BG BG105458A patent/BG105458A/xx unknown

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events