SK5712001A3 - Pharmaceutical composition - Google Patents

Abstract

Provided herein is a pharmaceutical composition containing one or more DNA molecules encoding fragments of a protein overexpressed in tumor cells, in order to induce an anti-tumor Ag-specific immune response, in association with suitable excipients and adjuvants.

Description

Pharmaceutical composition

Field of the invention

The invention relates to a group of DNA plasmid constructs comprising sequences of fragments encoding human MUC-1 and to a group of DNA plasmids in which the fragment itself encoding a protein consisting of human ubiquitin fused to a bacterial Lac1 fragment is preceded. The invention further relates to their use as DNA tumor vaccines.

BACKGROUND OF THE INVENTION

The invention provides anti-tumor therapy based on the induction or activation of an immune response capable of causing tumor rejection. The validity of such an idea is demonstrated by the first clinical results; for example, patients treated with a viral vaccine containing sequences encoding a carcinoembryonic antigen (CEA) have demonstrated activation of the immune system against this antigen (Tsang KY et al., J. Natl. Cancer. Inst. 87: 982,1995).

Activation of the immune anti-tumor response is achievable through four different approaches:

(a) Ex vivo deliberate alteration of patient tumor cells to make them more immunogenic and suitable as a vaccine;

b) Ex vivo deliberate alteration of the patient's tumor cells to pre-activate the in vitro immune response;

c) Inoculation of DNA encoding tumor associated antigens which is naked or enveloped in liposomes or incorporated into viral particles (retroviral, vaccinia viral, adenoviral, etc.);

d) Treatment with recombinant or synthetic soluble tumor antigens conjugated or admixed with adjuvants.

The first two approaches consist of deliberate alteration of each individual patient cell and are limited in that they are necessarily specific to each patient.

The other two approaches aim to obtain products comparable to a traditional drug.

New vaccination methods reflect the development of new technologies. Recent information derived from experimentation with naked DNA vaccines that induce either a persistent antibody or cellular immune response makes traditional protein subunit vaccines consisting of certain specific peptides that induce lymphocyte populations become obsolete. Intramuscular or intradermal injected proteins encoded by naked DNA induce a cytotoxic specific response as well as a helper response. This strong combination is very effective, but the mechanism of this subordination process is still not fully understood. Muscle cells express MHC class I antigens only at low levels and apparently do not express class II antigens or co-stimulatory molecules. Consequently, transfected muscle cells are unlikely to play an important role in the onset of the immune response. Recent data show that antigen-presenting cells (APCs), such as macrophages or dendritic cells, play an essential role in capturing myocyte-released antigen and subsequently processing and presenting the corresponding peptides in the context of class I and II molecules, thereby inducing CD8 + cell activation with cytotoxic activity as well as activation of CD4 + cells cooperating with B cells to elicit an antibody response (Corr M et al., J. Exp. Med. 184: 1555, 1996) (Tighe, H. et al., Immunology Today 19: 89,1998).

In addition, the use of cytokines is known to improve the therapeutic effect derived from DNA immunization. Cytokines can be administered in the form of exogenous proteins as published by Irvine et al., J. Immunol. 156: 238, 1996. An alternative approach is represented by the simultaneous inoculation of both a tumor antigen-encoding plasmid and a desirable cytokine-encoding plasmid, thereby allowing the cytokine to be produced in situ (Kim J J et al., Immunol 158: 816, 1997).

The efficient immunization approach of the present invention is based on the use of DNA vectors as vaccines against MUC-1 human antigen or polymorphic epithelial mucin (PEM) that is overexpressed in tumor cells. MUC-1 is an eptithelial luminal surface glycoprotein (Patton S. et al., BBA 1241: 407, 1995). In the process of cell transformation, it loses f t 'r

This glycoprotein apical localization and its expression level is dramatically increasing. Protein function consists of protecting the luminal surfaces, for example in the mammary glands, ovaries, endometrium, colon, stomach, pancreas, bladder, kidneys, etc. A defect in glycosylation has been reported to cause MUC-1 associated with tumor cells to be antigenically different from MUC-1 associated with normal cells. This phenomenon is due to the fact that MUC-1 reveals antigenic epitopes that are normally masked by carbohydrate residues in MUC-1 expressed by normal cells. This property makes tumor MUC-1 very interesting in terms of inducing a tumor-specific antibody response (Apostolopoulos V. et al., Crit. Rev. Immunol. 14: 293, 1994).

The subject is a vaccination aimed at inducing immune responses to tumor cells expressing MUC1 at high levels while at the same time preserving normal low-expression epitheliums. DNA vaccination is based on the entry of a gene or portions thereof into the body of cells, followed by transcription and translation of the inserted sequence, and thus intracellular synthesis of the corresponding polypeptide. An important advantage of this system is that the non-synthesized protein is naturally processed within the cell and the peptides produced are associated with molecules of the major histocompatibility class I (MHC-I) complex. MHC / peptide complexes are therefore naturally exported to the cell surface, where they can be recognized by CD8 + cytotoxic cells of the immune system. Only polypeptides synthesized within the cell are then processed and presented in conjunction with class I MHC molecules, utilizing a single mechanism to stimulate a specific cytotoxic response. Vaccine systems based on protein or peptide administration are usually more effective in stimulating an antibody immune response which has so far been shown to be ineffective in rejecting tumor cells. Current gene therapy techniques are based on DNA packaging in recombinant viral vectors (retroviral and adenoviral). Administration of naked DNA is more advantageous with respect to efficacy and safety compared to viral vector therapies. (Kumar V and Sercarz E. Nature Med. 2: 857, 1996; McDonnel WM et al., New England J. of Med. 334: 42, 1996). In fact, naked DNA is neither able to duplicate nor integrate into

- host tissue DNA, and does not induce an immune response to viral proteins.

Recently, the use of ubiquitin has been reported to enhance processing of a neo-synthesized protein and thereby induce cytotoxic lymphocytes (Rodriguez F. et al, J. Virology 71: 8497, 1997). Previously, the use of ubiquitin to generate proteins with an N-terminal amino acid has been reported to render them unstable and thus more susceptible to degradation (Bechmair).

A. et al., Science 234: 179 (1986). Higher instability of these proteins was subsequently associated with enhanced intracellular processing and presentation of model proteins by MHC-1 (Grant EP et al., J. Immunol. 155: 3750, 1995) (Wu Y and Kipps TJ, J. Immunol. 159: 6037, 1997).

The use of unit constructs containing DNA fragments encoding a partial antigen (influenza viral nucleoprotein) having a higher antigen presentation efficiency in DNA vaccination than analogs with whole antigen sequences has been disclosed (Anton L. C. et al., J. Immunol. 158: 2535, 1997). In addition, the processing of intracellular proteins and the presentation of the corresponding MHC peptides by Class I proteins are subject to immunological surveillance mechanisms under physiological conditions. For a given protein and a specific MHC context, there are peptide fragments called dominants (i.e., predominating over subdominants or crypts) that are unable to generate any immune response because they are recognized as intrinsic. In accordance with the present invention, it has now been found that an approach to promote presentation of a non-dominant epitope by administering a mixture of antigenic protein fragments is capable of eliciting a surprising cytotoxic immune response.

It has now been found that DNA molecules that encode fragments of a protein overexpressed in tumor cells can be conveniently used to induce an antigen-specific anti-tumor immune response.

SUMMARY OF THE INVENTION

The present invention provides a pharmaceutical composition comprising one or more DNA fragments encoding a mucin (MUC-1) protein.

The compositions of the invention preferably comprise at least two DNA fragments of mucin (MUC-1) or other protein overexpressed in tumor cells.

The compositions of the invention preferably comprise at least four fragments, each of from 200 to 700 nucleotides in length, each sequence being aligned immediately adjacent to the adjacent sequence and may also partially overlap about 50 to about 150 nucleotides at the 3 'and / or 5 * end of the adjacent sequence.

The DNA fragment encoding ubiquitin may also be inserted at the 5 'end upstream of the DNA fragment according to the invention and may also be the Lad part of Escherichia coli.

The invention also relates to novel DNA fragments and to the use of the above-defined mucin-1 fragments in medical and anti-cancer vaccine compositions.

A pool of DNA plasmids that encode human protein antigen MUC-1 fragments in eukaryotic cells was prepared. The constructs are based on the mammalian expression vector referred to as pMRS30 described in Figure 13 and already claimed in WO95 / 11982, and contain partial MUC-1 cDNA sequences disclosed in the EMBL database under accession number J05581. The MUC-1 encoding DNA was divided into fragments such that each fragment represented a discrete portion partially overlapping with an adjacent portion. Administration of a mixture of such plasmids may cause different plasmids to transfect different APC cells at the site of administration. Therefore, such cells produce and process discrete portions of the MUC-1 protein, resulting in related peptides. Under such conditions, subdominant and cryptic peptides may also be presented in conjunction with class I MHC molecules, thereby generating a cytotoxic immune response.

Thus, the present invention relates to the use of a group of four constructs (Figures 1 to 4) containing MUC-1 cDNA partial fragments in a mixture comprising at least two of them and a group of four constructs (Figures 7 to 10) containing MUC-1 cDNA partial fragments before finds DNA encoding a protein sequence comprising ubiquitin and Escherichia coli Lac I part (Figure 6), which are used separately or in a mixture comprising at least two of them.

The present invention also relates to the use of a construct (Figure 5) comprising an almost complete MUC-1 cDNA sequence and a construct (Figure 11) comprising an almost complete MUC-1 cDNA sequence preceded by a DNA encoding a protein sequence comprising ubiquitin and Escherichia coli Lac I moiety .

A mixture of four constructs containing partial MUC-1 cDNA fragments and a mixture of four constructs containing partial MUC-1 cDNA fragments preceded by a DNA encoding a protein sequence comprising ubiquitin and Escherichia coli Lac I portions is a preferred embodiment of the present invention.

The constructs of the present invention can be used for the anti-tumor treatment of patients afflicted with tumors characterized by high MUC-1 expression.

The constructs described in the present invention were obtained as follows.

For the first series of constructs, MUC-1 DNA fragments were obtained by RT-PCR from the BT200 cell line or by partial chemical DNA synthesis. Such fragments were then cloned into the pMRS30 expression vector and verified by sequencing.

For the second series of constructs, fragments were obtained from the first series of PCR constructs by re-amplification. These fragments were then fused to DNA encoding ubiquitin (obtained by RT-PCR from MCF7 cell line mRNA) and a partial lacI sequence (obtained by PCR from the commercial vector pGEX). The DNA sequences thus obtained were then cloned into the pMRS30 expression vector and verified by sequencing. For intended therapeutic or prophylactic uses, the fragments or constructs of the invention are suitably formulated using carriers and methods that have been previously utilized in naked DNA vaccines, as described, for example, in The Immunologist, 1994, 2: 1; WO 90/11092, Proc. Natl. Acad. Sci. U.S.A., 1986, 83, 9551; US 5580859; Immunology today 19 (1998), 89-97; Proc. Natl. Acad. Sci. U.S.A. 90 (1993), 11478-11482; Nat. Med. 3 (1997), 526-532; Vaccine 12 (1994) 1495-1498; DNA Cell. Biol. 12 (1993), 777-783. Doses will be determined on the basis of clinical and pharmacological-toxicological tests. Generally speaking, they will

Contain between 0.005 gg / kg and 5 µg / kg of the fragment mixture. The composition of the invention may also comprise a cytokine or a cytokine encoding a plasmid.

The invention will be further illustrated by the following examples.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the pMRS166 expression vector. This DNA contains a sequence corresponding to nucleotides 136-339 of EMBL sequence J05581, preceded by a translation start codon, ATG, followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises methionine followed by amino acids encoded by the 136-339 fragment of EMBL sequence J05581.

Figure 2

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the pMRS30 expression vector, thereby producing the pMRS169 expression vector. This DNA contains a sequence corresponding to nucleotides 205-720 of EMBL sequence J05581, preceded by a translation start codon, ATG, followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises methionine followed by amino acids encoded by the 205-720 fragment of EMBL sequence J05581.

Figure 3

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the pMRS30 expression vector, resulting in the pMRS168 expression vector. This DNA contains a sequence corresponding to nucleotides 631-1275 of EMBL sequence J05581, preceded by a translation start codon, ATG, followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises methionine followed by amino acids encoded by the 631-1275 fragment of EMBL sequence J05581.

-8Picture 4

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the pMRS30 expression vector, thereby producing the pMRS167 expression vector. This DNA contains a sequence corresponding to nucleotides 1222-1497 of EMBL sequence J05581, preceded by a translation start codon, ATG, followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises methionine followed by amino acids encoded by the 1222-1497 fragment of EMBL sequence J05581.

Figure 5

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the pMRS30 expression vector, thereby producing the pMRS175 expression vector. This DNA contains a sequence corresponding to nucleotides 136-1497 of EMBL sequence J05581, preceded by a translation start codon, ATG, followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises methionine followed by amino acids encoded by the 136-1497 fragment of EMBL sequence J05581.

Figure 6

The nucleotide DNA sequence (with the corresponding amino acid sequence) designated UBILac1. The encoded polypeptide comprises a ubiquitin sequence fused to a partial sequence of the bacterial beta-galactosidase protein as described in Chau V. et al., Science 243: 1576, 1989.

Figure 7

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the expression vector pMRS30, thereby producing the pMRS171 expression vector. This DNA contains a sequence designated UBILac1 (see FIG. 6) fused to a sequence corresponding to nucleotides 136-339 of EMBL sequence J05581 followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises the amino acid sequence shown in

Figure 9 fused to a sequence comprising amino acids encoded by fragment 136-339 of EMBL sequence J05581.

Figure 8

The nucleotide DNA sequence (with the corresponding amino acid sequence) was inserted into the XbaI site of the expression vector pMRS30 to give the pMRS174 expression vector. This DNA contains a sequence designated UBILacI (see FIG. 6) fused to a sequence partially corresponding to nucleotides 205720 of EMBL sequence J05581 followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises the amino acid sequence shown in Figure 6 fused to a sequence comprising the amino acids encoded by the fragment 205-720 of the EMBL sequence J05581.

Figure 9

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the expression vector pMRS30, thereby producing the pMRS173 expression vector. This DNA contains a sequence designated UBILacI (see FIG. 6) fused to a sequence partially corresponding to nucleotides 6311275 of EMBL sequence J05581 followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises the amino acid sequence shown in Figure 6 fused to a sequence comprising amino acids encoded by fragment 631-1275 of EMBL sequence J05581.

Figure 10

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the expression vector pMRS30, thereby producing the pMRS172 expression vector. This DNA contains a sequence designated UBILacI (see FIG. 6) fused to a sequence partially corresponding to nucleotides 12221497 of EMBL sequence J05581, followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises the amino acid sequence shown in Figure 6 fused to a sequence comprising the amino acids encoded by fragment 1222-1497 of EMBL sequence J05581.

-10Picture 11

The nucleotide DNA sequence (with the corresponding amino acid sequence) inserted into the XbaI site of the expression vector pMRS30, thereby producing the pMRS176 expression vector. This DNA contains a sequence designated UBILacI (see FIG. 6) fused to a sequence partially corresponding to nucleotides 1361497 of EMBL sequence J05581 followed by two translation stop codons, TGA and TAA. Thus, the encoded polypeptide comprises the amino acid sequence shown in Figure 6 fused to a sequence comprising the amino acids encoded by fragment 136-1497 of EMBL sequence J05581.

Figure 12

Electrophoresis analysis on 1% agarose gel in 1xTBE. mRNA extracted from CHO, CD34 + dental cells and dental cells from PBMC, respectively, transfected with pMRS169, and subjected to RT-PCR reaction with or without (lanes 4, 8, 12) or without (lanes 5, 9, 13) reverse transcriptase. DNA molecular weight marker (lane 1); internal negative controls (lanes 2, 6); internal positive controls (lanes 3, 7, 10, 11); positive control from the Promega kit (lane 14).

Figure 13

Nucleotide sequence of pMRS30 expression vector. 1-1862 region corresponds to the Acc1 (position 504) - BamHI (position 3369) region of the pSV2CAT vector (EMBL M77788); The 2862-3721 region contains the human cytomegalovirus promoter (enhancer of the human cytomegalovirus major immediate-early gene); The 3722-4905 region contains several cloning sites including the XbaI (position 3727) and rabbit beta-globin gene processing signal.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Construction of plasmid pMRS166

-11-20 tumor cells (ATCC HTB-19) were cultured in Eagles MEM supplemented with 10% fetal bovine serum. Ten million cells were trypsinized, washed with PBS, and mRNA extracted.

An aliquot of this RNA was subjected to RT-PCR (reverse transcriptase polymerase chain reaction) reaction in the presence of the following synthetic oligonucleotides:

Villa (5 'GATCTCTAGAATGACAGGTTCTGGTCATGCAAGC 3')

V4 (5 'GATCTCTAGAAAGCTTATCAACCTGAAGCTGGTTCCGTGGC 3')

The DNA fragment produced, purified and digested with the restriction enzyme XbaI, was cloned into a pMRS30 expression vector containing a human cytomegalovirus promoter and a beta-globin polyadenylation signal as claimed in U.S. Pat. WO9511982. The resulting pMRS166 vector contains a DNA fragment comprising an ATG codon, a sequence corresponding to nucleotides 136339 of EMBL sequence J05581, and two stop codons, TGA and TAA.

This fragment is shown in Figure 1.

Example 2

Construction of plasmid pMRS169

An RNA aliquot obtained as in Example 1 was subjected to RT-PCR in the presence of the following synthetic oligonucleotides:

VI2 (5 'GATCTCTAGAATGGTGCCCAGCTCTACTGAGAAGAATGC 3')

VI5 (5 'GGCGGTGGAGCCCGGGGCTGGCTTGT 3')

The DNA fragment produced, purified and digested with the restriction enzymes SmaI and XbaI, was fused, via the SmaI restriction site, to a DNA fragment which was entirely synthesized and contains a sequence partially corresponding to nucleotides 457-720 of EMBL sequence J05581 and two stop codons, TGA and TAA. The entire fragment was then cloned into the XbaI site of the pMRS30 expression vector. The resulting pMRS169 vector contains a DNA fragment comprising an ATG codon, a sequence partially corresponding to nucleotides 205-720 of EMBL sequence J05581, and two stop codons, TGA and TAA.

This fragment is shown in Figure 2.

-12Example 3

Construction of plasmid pMRS168

An RNA aliquot obtained as described in Example 1 was amplified by RT-PCR in the presence of the following synthetic oligonucleotides:

VI3 (5 'GATCTCTAGAATGGGCTCAGCTTCTACTCTGGTGCACAACGGC 3')

V8 (5 'GATCTCTAGAAAGCTTATCACAAGGCAATGAGATAGACAATGGCC 3')

The DNA fragment produced, purified and digested with the restriction enzyme XbaI, was cloned into the pMRS30 expression vector. The resulting pMRS168 vector contains a DNA fragment comprising an ATG codon, a sequence corresponding to nucleotides 631-1275 of EMBL sequence J05581, and two stop codons, TGA and TAA.

This fragment is shown in Figure 3.

Example 4

Construction of plasmid pMRS167

An RNA aliquot obtained as described in Example 1 was subjected to RT-PCR reaction in the presence of the following synthetic oligonucleotides:

VI4 (5 ¹ GATCTCTAGAATGCTGGTGCTGGTCTGTGTTCTGGTTGCGC 3 ')

VI0 (5 'GATCTCTAGAAAGCTTATCACAAGTTGGCAGAAGTGGCTGC 3') The DNA fragment produced, purified and digested with the restriction enzyme XbaI, was cloned into the pMRS30 expression vector. The resulting pMRS167 vector contains a DNA fragment comprising an ATG codon, a sequence corresponding to nucleotides 1222-1497 of EMBL sequence J05581, and two stop codons, TGA and TAA.

This fragment is shown in Figure 4.

Example 5

Construction of plasmid pMRS175

Plasmids pMRS166, 169, 168, 167 were subjected to a PCR reaction in the presence of the following nucleotide pairs.

V11 (see Example 1)

-13V18 (5 'AACCTGAAGCTGGTTCCGTGGC 3') prepMRS166

V19 (5 'GTGCCCAGCTGTACTGAGAAGAATGC 3')

V20 (5 'GCTGGGAATTGAGAATGGAGTGCTCTTGC 3') prepMRS169

V21 (5 ¹ GGCTCAGCTTCTACTCTGGTGCACAACGGC 3 ¹ )

V22 (5 'CAAGGCAATGAGATAGACAATGGCC 3') prepMRS168

V23 (5 'CTGGTGCTGGTCTGTGTTCTGGTTGCG 3')

V10 (see Example 4) for pMRS167

The four DNA fragments obtained in the respective PCR reactions were mixed in equimolar amounts and subjected to a PCR reaction in the presence of V11 and V10 oligonucleotides.

The DNA fragment produced, purified and digested with an XbaI restriction enzyme, was cloned into the pMRS30 expression vector. The resulting pMRS175 vector contains a DNA fragment comprising the ATG codon, a sequence partially corresponding to nucleotides 136-1497 of EMBL sequence J05581, and two stop codons TGA and TAA.

Example 6

Construction of plasmid pMRS171

MCF7 tumor cells (ATCC HTB-22) were cultured in Eagles MEM supplemented with 10% fetal calf serum. Ten million cells were trypsinized, washed with PBS and extracted with mRNA.

An RNA aliquot was subjected to RT-PCR in the presence of the following synthetic oligonucleotides:

UBlup (5 'GATCTCTAGAATGCAGATCTTCGTGAAGACCCTGACTGGT 3')

UBIdown (5 'TCACCAGCGAGACGGGCAACAGCCATGCACCACTACCGTGCCTCCCACCTCTG AGACGGAGCACCAGG 3')

The result of the reaction is a DNA fragment referred to as fragment 1.

DNA from pGEX11T (Pharmacia) was subjected to a PCR reaction in the presence of the following synthetic oligonucleotides:

-14Laclup (5 'CCTCCGTCTCAGAGGTGGGAGGCACGGTAGTGGTGCATGGCTGTTGCCCGTCTCGCTGGTGAAAAG 3')

Lacldown (5 'gatcggatcctcgggaaacctgtcgtgccagctgc 3 ¹ )

The result of this reaction is a DNA fragment referred to as fragment 2.

DNA fragments 1 and 2 obtained in the respective PCR reactions were mixed in equimolar amounts and subjected to a PCR reaction in the presence of UBlup and Lacldown oligonucleotides.

The DNA fragment produced, purified and digested with the restriction enzymes XbaI and BamHI, was cloned into the commercial plasmid pUC18. The resulting pMRS156 vector contains a DNA fragment comprising a sequence that encodes ubiquitin fused to a sequence encoding a bacterial beta-galactosidase portion. This fragment, referred to as UBILacI, is shown in Figure 6.

The plasmid pMRS166 DNA was subjected to a PCR reaction in the presence of the following synthetic oligonucleotides:

V3 (5 'GATCGGATCCACAGGTTCTGGTCATGCAAGC 3')

V4 (see example 1)

The DNA fragment produced, purified and digested with the restriction enzymes XbaI and BamHI, was fused by ligation to two BamHI sites of the UBILacI fragment derived from the pMRS156 plasmid. The resulting fragment was cloned into the pMRS30 expression vector. The resulting pMRS171 vector contains a DNA fragment comprising the UBILacI sequence, the sequence corresponding to nucleotides 136-339 of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is shown in Figure 7.

Example 7

Construction of plasmid pMRS174

The plasmid pMRS169 DNA was subjected to a PCR reaction in the presence of the following synthetic oligonucleotides:

V5 (5 'GATCGGATCCGTGCCCAGCTCTACTGAGAAGAATGC 3')

V6 (5 'GATCTCTAGAAAGCTTATCAGCTGGGAATTGAGAATGGAGTGCTCTTGC 3 ¹ )

The produced DNA fragment, purified and digested with the restriction enzymes XbaI and BamHI, was fused by ligation to two BamHI sites of the UBILacI fragment derived from the pMRS156 plasmid. The resulting fragment was cloned into the pMRS30 expression vector. The resulting pMRS174 vector contains a DNA fragment comprising the UBILacI sequence, the sequence corresponding to nucleotides 205-720 of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is shown in Figure 8.

Example 8

Construction of plasmid pMRS173

The plasmid pMRS168 DNA was subjected to a PCR reaction in the presence of the following synthetic oligonucleotides:

V7 (5 'GATCGGATCCGGCTCAGCTTCTACTCTGGTGCACAACGGC 3')

V8 (see example 3)

The DNA fragment produced, purified and digested with the restriction enzymes XbaI and BamHI, was fused by ligation to two BamHI sites of the UBILacI fragment derived from the pMRS156 plasmid. The resulting fragment was cloned into the pMRS30 expression vector. The resulting pMRS173 vector contains a DNA fragment comprising the UBILacI sequence, the sequence corresponding to nucleotides 631-1275 of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is shown in Figure 9.

Example 8

Construction of plasmid pMRS172

The plasmid pMRS167 DNA was subjected to a PCR reaction in the presence of the following synthetic oligonucleotides:

V9 (5 'GATCGGATCCCTGGTGCTGGTCTGTGTTCTGGTTGCGC 3')

V10 (see Example 4)

The DNA fragment produced, purified and digested with the restriction enzymes XbaI and BamHI, was fused by ligation to two BamHI sites of UBILacI.

-16 fragment derived from the pMRS156 plasmid. The resulting fragment was cloned into the pMRS30 expression vector. The resulting pMRS172 vector contains a DNA fragment comprising the UBILacI sequence, the sequence corresponding to nucleotides 1222-1497 of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is shown in Figure 10.

Example 10

Construction of plasmid pMRS176

The plasmid pMRS167 DNA was subjected to a PCR reaction in the presence of the following synthetic oligonucleotides:

V3 (see example 6)

V10 (see Example 4)

The DNA fragment produced, purified and digested with the restriction enzymes XbaI and BamHI, was fused by ligation to two BamHI sites of the UBILacI fragment derived from the pMRS156 plasmid. The resulting fragment was cloned into the pMRS30 expression vector. The resulting pMRS176 vector contains a DNA fragment comprising the UBILacI sequence, the sequence corresponding to nucleotides 136-1497 of the EMBL sequence J05581, and two stop codons, TGA and TAA. This fragment is shown in Figure 11.

Example 11

Transformation of eukaryotic cells and transcription testing

CHO cells (Chinese hamster ovary cells) were cultured in alpha MEM supplemented with ribonucleotides and deoxyribonucleotides at the time of transfection.

Dendritic cells were obtained from CD34 + hemopoietic precursors cultured in serum-free IMDM, supplemented with GM-CSF, IL4, SCF, Flt3 and TNFalpha. After 7 days, the cell population obtained was transfected.

Dendritic cells were obtained from monocytes isolated from PBMC (peripheral blood mononuclear cells), cultured in RPMI supplemented with FCS, GM-CSF, and IL-4. After 7 days, the cell population obtained was transfected.

In each case, approximately one million cells were transfected with one of the plasmids listed in Examples 1 to 10. Transfection was performed using 3 µg plasmid DNA and 4 µί DMRIE (Gibco) lipofection.

After 24 hours, cells were harvested, washed with PBS and lysed to extract mRNA.

An mRNA aliquot was subjected to an RT-PCR reaction in the presence of an oligonucleotide pair specific for the transfected DNA plasmid.

This experiment was performed for each plasmid shown in Examples 1 to 10 using the following oligonucleotide pairs: V11 / V4 for pMRS166, V12 / V6 for pMRS169, V13 / V8 for pMRS168, V4 / V10 for pMRS167, V4ZV10 for PMRS175, UBIup / V4 for pMRS171, UBIup / V6 for pMRS174, UBIup / V8 for pMRS173, UBIup / V10 for pMRS172, V14 / V10 for pMRS176.

As a representative example, Figure 12 shows an electrophoretic analysis of DNA fragments obtained by RT-PCR from mRNA of three cell populations transfected with plasmid pMRS169. In this case, the V12 / V6 oligonucleotide pair was used.

Example 12

Results of in vivo studies

In vivo studies used a mixture of four fragments and a pMRS30 plasmid (no insert vector used as a negative control). To test whether immunization occurred, an ELISA assay was used to detect specific antigens against human mucin.

In vivo studies were performed using transgenic C57BL mice with human MUC1. As a result, the MUC1 protein was a self-protein in these animals. The vaccine regimen utilized consisted of 3 intradermal (in the back, 50 pg of DNA on each side) (on days 0, 14, 28) administration of 100 pg of plasmid DNA. 14 days after the last administration, the animals were sacrificed and their sera tested for anti-human mucin antibodies.

The fragment fragments tested object of the present invention stimulated a good immune response in the treated animals.

On the other hand, vaccination experiments were also performed with a 60 amino acid peptide corresponding to the 20 amino acids shown in Figure 2 from position 86 to position 105, which was repeated three times (this peptide is referred to as 3xTR).

These two vaccinations differ in the type of antibody response elicited. Antibody titration results are much higher when vaccinated with 3xTR. In addition, the IgG subtypes observed are in favor of a humoral (antibody) response in the case of 3xTR vaccination, and a cellular response (cytotoxic) in the case of DNA vaccination. A cytotoxic immune response is principally preferred for anti-tumor therapy. Since the experiments were carried out in transgenic mice for which human mucin was intrinsic, we can assume a similar response in humans. This response could justify the use of the compounds of the present invention as DNA vaccines for the treatment of human tumors in which MUC1 is overexpressed.

yy yy yy yy

-19 Sequence Listing <110> Menarini Ricerche S.p.A.

<120> A pharmaceutical composition comprising DNA fragments encoding an antigenic protein having an antitumor effect <130> 5653MEUR <140>

<141>

<150> MI98A002330 <151> 1998-10-30 <160> 35 <170> PatentIn Ver. 2.1 <210> 1 <211> 213 <212> DNA <213> human <400> 1

accacaggtt ccggtcatgc aagccccacc ccacctggag aaaacgagac ttcccctacc 60 cacagaagtt cagtgcccag ccccactcag aagaatcctg tgactacgac cagcaacgta 120 ccc: ccagcc acagccccgg tccagcctcc tccaccactc acgcacagga tcccactccg 180 gccccggcca cggaaccagc tccaggccga taa 213

<210> 2 <211> 524

<212> DNA <213> human <400> 2 and, cgcgccca gccccactga gaagaatgcc gcgaccacga ccagcagcgc accctccagc 60 cacagccccg gctcajgcccc ccccaccacc cagggacagc acgtcacccc ggccccggcc 120 acggaaccac cctcacgtcc agctgccacc tggggacagg atgccacctc ggccccaccc ISO accaggccag ccccgggccc caccaccccg ccagcccacg acgccacctc agccccggac 240 aacaagccag ccccgggaag caccgctcca ccagcacacg gcatcacctc gcccccgcat 300 accaggccgg ccccaagtag caccgccccc cccgcccatg ccgtcacatc tgccccggac 360 aacaggcccg caccgcgcag cacagcaccg Ccagtacaca acgttactag tgccccaggc 420 cczgccagcg gcccagcccc tactccagcg cacaacggca cctccgcgcg cccgaccaca 480 accccagcga gcaagagcac cccaccctca attcccagct Gataa S25

<210> 3 <211> 654 <212> DNA <213> human <400> 3

atgggcccag ctcctacccc ggtccacaac cgcacctctg ccagggctac cacaacccca 60 gccagcaaga gcactccatt ctcaattccc agccaccact ctgatactcc taccaccctt 120 gccagccata gcaccaagac tgatgccagt agcactcacc atagcacggt acctcctctc 180 acctccccca atcacagcac ttctccccag ttgtctactg gcgtctcttt ccttttcctg 240 tcttttcaca tctcaaacct ccagtctaat tcctctctgg aagatcccag caccgactac 300 taccaagagc tgcagagaga catttctgaa atgtttttgc agatttataa acaagggggc 360 ttcctgggcc tcCccaatat taagttcacg ccaggatctg tggtggtaca attgactctg 420 gccctccgag aaggtaccat caatgtccac gacgtggaga cacagttcaa tcaatataaa 430 acgaaagcag cctctcgata taacctgacg atctcagacg tcagcgtgag tgatgtgcca 540 cccccttcct ctgcccagtc tggggceggg gtgccaggct gggccatcgc gctgctggtg 600 cccgtccetg ttctgattgc cctggccatt gtctatctca ttgccttccg ATAA 654

r r r e

-21 <210> 4 <211> 285 <212> DNA <213> Human <400> 4

atccccgegc tgcccCgtgC tctggttgcg ctcgccattg tctatctcat tgccttcgct 60 gcccgtcagG gccgccgaaa gaactacggg cacccggaca tctttccagc ccgggatacc 120 caccatccca cgagcgagta ccccacctac cacacccacg ggcgctatgt gccccctagc 180 agcaccgatc gcacccccta tgagaaagct tctgcaggta atggtggcag cagcctctct 240 Cacacaaacc cagcagccgc agccacctct gccaacttgt oataa 235

<210> 5 <211> 1371 <212> DNA <213> human <400> 5 atgacaggcc cccgtcacgc aagccctacc ccaggtcgag aaaaggagac ctcggccacc 60 cacagaagcc c ag — gcccag ccccaccgag aagaacgccg ccagcacgac cagcaccgca 120 c: ccccac; c acagccccgg cccacgcccc cccaccaccc acggacagga cgccaccctg 180 gcccccgcca cggaaccagc cccaggctca gctgccaccc ggggacagga tcecaccccg 240 gtcccagtca ccaggccagc cctgggctcc accaccccac cagcccacga cgccacctca 300 cccccggaca acaagccagc cccgggaagt accgccccac cagcacacgg cgctacctcg 360 cccccggaca ccaggccgcc cccaggtagc accgcccctc ccgcccatcc tcccacatcc 420 cccccggaca acaggcccgc atcgcgcagc acagcaccgc cagcacacaa cgttactact 480 eccccagccc ccgccagcgg cccagcctct actccggccc acaacggcac ccccgcgcgc 540 gccaccacaa ccccacccag caagaccact ccatcctcaa tccccaccca ccactcccat 500 actcctacca czz. ^ zzzzz ctataccatt aacaccgact ct = ct = CC = t tcaccatagc í □: a: = a :: ::: c ctccaaccac acaacííc'c zzzs. = zzzzc taccggggcc . 2 v tctctctctt cctccccctc tcacatttca aacctccact ttaattcctc tccggaagat 7SC cccaccaccg accaccacca agacctgcag acagacactt ctgaaatgtt tttgcacatt 840 tataaacaac ccagttttct gcccctctcc aacactaact tcaggccagg atctgcggtc 900 gcacaatcaa ctcccgcctC ccgagaaggt accatcaacc tccacgacgc ggagacacag 960

r r

cccaaccacc ataaaaccca accagcctct ccaCataacc tgacgatccc acaccccagc 1020 gcgagccacg tcccattCcc tttcCctgcc cagCctggcg cCgggctgcc acgctggggc 1080 atcgcgccgc tcgcgctggc ccgcgttccg cccgcgccgg ccattgccca tcccattgcc 1140 ccggccgccc gtcagcgccg ccgaaagaac tacgggcagc tggacatctc tccagcccgg 1200 gacaccCacc atcctatcag cgagtacccc acctaccaca cccaCcggcg ctatgtgccc 1260 cccagcagca ccgaccgcag cccccatgag aaggttcccg caggtaaccg cggcagcagc 1320 cccccecaca caaacccagc agtggcagcc acttctgcca actcgcgata and 1371

<210> 6 <211> 369 <212> DNA <213> human <400> 6

atgcagatct tcgtgaagac cctgactggc aacaccaCca cCcCccaagC ggagccgagC 60 gacaccaccg agaacgccaa ggcaaagacc caagacaacg aaggcacccc CccCcaccag 120 cagaggccca tcCCCgcagg caagcagccg gaacaCgccc gcacccCCCc cgaccacaac ISO atccagaaag agcccacccc gcacccggcg ccccgcccca gagccccgac gcacggcagc 240 cccgcatggc tgecccccgt ctcgcccgcg aaaagaaaaa ccaccccggc gcccaacacc 300 caaaccgccc ctcccccccc gccggccgac tcaccaaccc agcccccacg acacgCCCcc 360 cgaggaccc 369

<210> 7 <211> 579 <212> DNA <213> human <400> 7 atgcagaccc tcgcgaagac cccgacccgc aagaccacca cccccgaagc ggagccgagC 60 gacaccaccg agaatgccaa ggcaaagacc caagacaacg aaggcacccc ccccgaccag 120 cagaggccca cccccccagg caagcagccg gaagaccgcc gcaccccccc Cgaccacaac 130 acccagaaac agcccacccc gcaccccccg CCCCCCCCC gaggcccgag gcacggcagc 240

-23SS ^ Scacggc cgccccccgc cccgccggcg aaaagaaaaa ceaccccggc ccccaacacg 300 caaaccgccc ccecccgcgc gccggccgac ccaccaacgc agccggcacg acaggccccc 360 caaggaccca caggccccgg ccacgcaagc Cccaccccag ccggagaaaa ggagacttcg 420 gccacccaga gaagcccacc ccccagcccc accgagaaga acgccgcgag cacgaccacc 480 agcgcacccc ccagccacag ccccggccca ggccccccca ccacccagca acacgacccc 540 accccggccc cggccacgga accagcccca agccgacaa 579 <210> 8 <211> 891 <212> DNA <213> human <400> 8

aCccagaCcC ccgcgaagac cccgaccggc aagaccatca ctctcgaagC ggagccgagC 60 gacaccactg agaacgccaa ggcaaagacc caaaacaagg aaggcatccc tčctgaccag 120 cagaggccca cccttgcagg caagcagcCg gaagaCcgcc gcactctttc CgacCacaac 180 acccagaaag agcccacccc ccacccggcg ccccgcccca gaggcgggag gcacggcagt 240 ggcgcacggc cgCtgcccgc cccgccggcg aaaagaaaaa ccaccctggc gcccaatacg 300 caaaccgccc ctccccacgc gccggccgac tcactaacgc agccggcacg acacgccccc 360 cgaggatccg tgcccagctc tacegacaag aaCgctgcga gCaCgaccac caccgtacCc 420 cccagccaca gccccggctc aggctcctcc accacccagg gacaggatgc cactctcccc 480 ccggccacgg aaccagcccc aggctcagcC cccacccggg gacaccaCgC caccCcggtc 540 ccagccacca ggccagcccC cggctccacc accccgccag cccaccatgt caccccagcc 600 ccggacaaca agccagcccc gggaagcacc cccccaccag cacacggcgC taccccggcC 660 ccggatacca ccccggcccc aggtagcacc gccccccccg cccacggcgC cacatctgcc 720 ccggacaaca cgcctgcaCt cggcagcaca gcaccgccag cacacaacgc caccacCgcc 780 CcaggcCccg ctagcggctc agcccccacc ccggcgcaca acggcaccCc cgcgcgcgcg 840 accacaaccc cagcgagcaa gagcacccca ttcecaattc ccagctgata and e9i

<210> 9 <211> 1020 <212> DNA <213> human

-24+ r r f “e It is r r r · <

r r - r - e i - t <400> 9

atgcagatct tcgtgaagac cctgactcgt aagaccatca ctctcaaagt cgacccgagt 60 cacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc Ccctcaccag 120 cagaggctca tctttgcagg caagcagcca gaagatcgcc ccactctttc tgactacaac ISO atccagaaag agtccaccct gcacctggtg ctccgtctca gagctcggag gcacggtagt 240 ggtgcatggc tgttgcccgt ctcgccggtc aaaagaaaaa ccaccctggc gcccaatacg 300 caaaccgcct ctccccgcgc gttcgccgat tcattaatgc agctagcacg acaggtttcc 360 ccaggatccg gctcagcttc tactccggcc cacaacggca cctctgccag ggccaccaca 420 accccagcca ccaagagcac tccactctca acccccagcc accactctga tacccctacc 480 acccttccca cccatagcac caagactgat cccagcagca cccaccatag cacagtacct 540 cctctcacct cccccaatca cagcacttct ccccacctgc ccactggggc ccctttctct 600 ttCCtgtCtt ttcacatttc SaäCZZCCä ^ tttaattcct ctctggaaga tc: CAGC c 650 gactactacc aaaagctgca gagagacacc tctgaaatgt ttttccagac ttataaacaa 720 gggggttttc tcgccctctc caacactaag ttcaagccag gatctgcggt cgtacaattg 780 actctggcct cccgagaagc taccatcaat gtccaccacg cggagacaca gctcaaccag 840 tataaaacgg aagcagcctc tcgatacaac ctaacgatcc cagacgtcag cgcgagtgat 900 gtgccatttc ctttctctgc ccagcccgcg cctgcggccc caggcCcggg catcgcgccg 960 ctggcgctgg tccgtgctcc ggccccgctg gccacccccc atctcaccgc cctgtgataa 1020

<210> 10 <211> 651 <212> DNA <213> human

<400> 10 atgcagatct tcgtgaagac cctgactcgt aagaccatca ctctccaact cgacccgagt 60 cacaccaccg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctcaccag 120 cagaggctca tctctgcagg caagcacctg gaagatggcc ccactctttc tgactacaac 180 atccagaaag agtccaccct ccacccggtg ctccgtctca caggtgggag gcacggtagt 240 ggtgcatggc tgttgcccgt ctcgccggta aaaagaaaaa ccaccctggc gcccaatacg 300 caaaccgcct ctccccgcgc gttggccaat tcattaatgc agctggcacg acaggtttcc 360 cgaggatccc tggtgecggt ccccgttctg gttgcgctcg ccattgtcta tctcattgcc 420 ttggctgtct gtcagtgccg ccgaaagaac taccgccagc tggacatctt tccagcccgg 480 catacctacc accctatgag cgagcacccc acctaccaca cccacgagcg ctatgtgccc 540 cctaccagta ccgatcctag cccctataag aacctttctg cacctaatcc tcacaccacc 600 C 5 1 caaacccag »- agtggcagcc acctccgcca and

<210> 11 <211> 1737 <212> DNA <213> human r -25 <400> 11

atgcagacct tcgtgaagac cctgactggt aagaccatca ctctcgaagt cgagccgagt 60 cacaccattg agaatgccaa cgcaaagatc caagacaagg aagccatccc tcctgaccag 120 cagaggctca tctttgcagg caagcagccg caagatggcc gcaccccctc tgaccacaac 180 atccagaaag agcccacccc gcacctggcg ccccgcccca gacgcgggag gcacggcagt 240 ggcgcatcgc tgtcgcccgt cccgctggcg aaaagaaaaa ccaccctccc gcccaatacg 300 caaaccgcct ctccccacgc cctggccgat tcattaatge agccggcacg acaggcttcc 360 cgaggaccca caggccccgg ccacgcaagc tccaccccag ctcgagaaaa ggagacttcg 420 gccacccaga gaagttcagt gcccagcccc actgagaaga acgctgtgag CaCcaccacc 430 agcgcacccc ccagccacag ccccggttca gccccctcca ccactcaggg acacgatctc 540 accctgcccc cggccacgga accagcccca ggttcagcĽg ccacccgggg acaggacgcc 600 accccggtcc cagccaccag gccagccccg ggccccacca ccccgccagc ccacgacgcc 660 accccagccc cagacaacaa cccagccccg ggaagcaccg ccccaccagc acacggcgcc 720 accccggccc cggacaccag gccggcccca ggcagtaccg ccccccccgc ccacggcgtc 780 acatccgccc cggacaacac ccctgcaccg ggtagcacag caccgccagc acacaacgct 840 accagtgccc caggccccgc cagccgctca gcccccaccc cggcgcacaa cggcaccccc 900 gcgcgcgcga ccacaa'cccc accgagcaag agcaccccac ccccaatccc cagccaccac 960 tctgatactc ceaccaccct tgccagccat agcaccaaga ccgacgccáa tagcactcac 1020 cacagcacgg cacctccccc cacccccccc aaccacagca CCCCCCCCC gccgcctacc 1080 gcggcccctc ccccttccct gtctctccac ačtccaaacc tccagtttaa tccccctctg 1140 gaagatccca gcaccgacta ccaccaagag ccgcagagag acatccctga aatgcctccg 1200 cagatccata aacaagggcg ccccctgggc C: C ccaata ttaagttcag cccaggatct 1250 gcggcggcac aa: CGAC :: C cgccccccga gaaggcacca ccaacgccca cgacgcgcag 1320 acacagttca atcagtataa aacggaagca gcctcccgat ataacctgac gateteagae 13s0 etcagcgtga gcgatgtgcc atttccctcc tctgcccagt ctggggctgg agcgccsggc 1440 tggcgcatcg cgctgctggt gctggtctgt gttctggttg cgctggccat tgtctatctc 1500 attgccttgg ccgtctgtca gtgccgccga aagaactacg ggcagctgga catctttcca 1560 gcccgggata cctaccatcc tatgagcgag taccccacct accacaccca tcggcgctat 1620 gcccccccta gcactaccga ccgcagcccc tatcagaagg tttctgcagc taatcgtgcc 1680 agcagcccct cttacacaaa cccaccagtg gcagccacct ctgccaactt gtcataa 1737

<210> 12 <211> 4905 <212> DNA <213> human <400> 12

ccaggaagct cctctgtgtc ctcataaacc ctaacctcct ctacttgaga cgacattcca 60 accataggct gcccatccac cctctgtgtc ctcctgctaa ttaggtcact taacaaaaac 120 caaactgggt agggcttttt cacacaccgc tttctaaggg taattttaaa atatctggga 130 agccccttcc actgctgcgt tccagaactg ttcgtaaaca gcccacaaat gtcaacagca 240 gaaacataca agctgtcagc tttgcacaag ggcccaacac cctgctcatc aagaagcact 300 ccggttgctc tgttagtaat gtccaaaaca ggaggcacat tttccccacc tctgtaggtt 360 ccaaaatatc tagtgttttc atttttactt cgatcaggaa cccagcactc cactcgataa 420 geattatcct tatccaaaac agccttgtcg tcagcgtcca tctgctgact gtcaactata 4S0 ccattttttg gggttacagt ttgagcagga tatttggtcc tgtagtctgc taacacaccc 540 tccagctcca aaggttcccc accaacacca aaaaaacgaa aatttgaccc ttcaatggct 600 ttcccagcac caccctcatg agtcttttgt gtccccgaat gcaagtetaa catagcagtc 660 accccaataa cctcagtttt aacagcaaca gccccccaca tcaaaatact tccacacgtt 720 aactcctcat ttaaattacc caaaggaatt cttgaagacg aaagggccec gtcatacgcc 7s0 tattttcata ggtcaatgtc atgataataa tggcttctta gacgtcaggt gccacetttc 840 cgggaaatgt ccgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc 900 cgctcatgag acaataaccc tgataaatgc ttcaataata tcgaaaaagg aagageatca 960 g t and t LcScCä tctccgtgtc gcccttactc cccttcccgc ggcatettgc cttcctgttt 1020 ttcctcaccc agaaacgctg ccgaaagtaa aagacgccga agaecagetg cgtgcacgag 1030 tgggttacat cgaactggat cccaacagcg gtaagatcct tgagagtttt cgccccgaag 1140 aacgttttcc aatgatgagc acttttaaag ttcccccatg tggcgcggta Ctatcccgtc 1200 tccacgccgg gcaagagcaa cccggccgcc gcacacacca ttctcagaat gacttggttg 1260 agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatcca 1320 gtgctgccac aaccatgagc gataacactg cggccaacct actcccgaca accatcggag 1380 gacccaacga gctaaccgct tctctgcaca acatcgggga tcatgcaact cgccttgatc 1440 gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgaeacc acgatccctg 1SC0 cagcaatggc aacaaccttg cgcaaactat taaccgccga actactcact ctaccctccc 15 = 0 ggcaacaatt aatagactgg atggaggcgg acaaacctgc aagaccactt ctgcgcccgg 1620 cccttcccgc cggccggtct attgctgata aacctgcagc cggtgagcgt ccctctcgcc 1630 gtatcattgc agcaccaggg ccagatcgca agccctcccg tatcgcagtc atctacacga 1740 cggggagcca ggcaactatg gatcaacgaa atagacagat egetgagata ggtgcctcac 1800 tgattaacca ttggtaactg tcagaccaag tttactcata tatactttag attgattcaa 1860 aacctcattt ttaatttaaa aggatccagg egaagatcct tctcgataat cccatgacca 1920 aaatccctca acgtgagcct tccctccact caccgtcaga ccccgtagaa aagatcaaag 1930 catcttcttg cttctccccg taatctcctg cctgcaaaca aaaaaaccac 2 04 0 cgctaccacc ttgccggatc aagagcxacc: ccgaacgtaa M _ w w ccggccccag cagag = GCAC azaccaaa.a c-gccctzcc- 21i: accacttcaa gaactcccca ccaccgccca cat ^ acctcgc cctgccaatc c ^ g & gcuäcc 222C tggctgctgc cagtggcgat aactcgtgtc ttacccggct cgactcaaga cgatagttac 2260 cggataaggc gcagcgctcg ggctgaacgg cgggetegtg cacacagccc agcttggagc 2340 gaaccacci.a caccgaactg agatacctac agegegaget aegagaaagc gccacacttc 2400 ccgaagcgag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagegea 2460 cgagcgagct tccaggggga aacgcccgct atctttatag tcctgtcggg tttccccacc 2520 tccgactcaa gcgccgatct ttgtgatgct cgtcacgggg gcggagccta tcgaaaaacg 2580 ccagcaacgc ggccttttca ccgctcctgg ccttctgctg cccctttgct cacatgttct 2640 ttcctgcctt atcccctgat tctgtggata accgtattac cccctttgag tgagctgata 2700

r * · r r r

ccgctzcgcca cagccgaacg accgagcgca gcgagccagt gagcgaggaa gcggaagagc 2760 gcccgacgcg gcatcccctc ctcacgcatc tgtgcggcac ttcacaccgc atatcgcgca 2820 cccCcagtac aacctgcGcc gacgccgcat £ CCtä3CCCd gtacacaatc aatattcgcc 23 = 0 atcagccaCa ttattcactg gttatatagc acaaaccaat accggctatt ggccatcgca 2.-4 0 tacgCtgtac ccatatcata acatgtacac ttacaccggc Ccacgtccaa cattaccgcc 3000 acgccgacat tgaccaccga ctacctacca acagcaazca attacggcgt cattagctca 3060 cagcccacac accgagcccc gcgccacaca acccacggca aacggcccgc ctggccgacc 3120 gcccaacgac ccccgcccac tgacgtcaac aatgacgcat gcccccatag taacgccaať 3180 agggacCCCc caccgacgcc aacgggcgga gcacctacgg taaactgccc acttgccagt 3240 acaccaagcg tatcacatgc caagcacgcc ccccatcgac gtcaatgacc gtaaatcgcc 3300 cccccagcac tacgcccagc acacgacctt acgggaccct cctacctgcc agtacaccta 3360 cgcatcagtc atcgctatta CCATGGTG gcggttCCgg cagtacatca atgggcgtgg 3420 acagcggcct gactcacggc catttccaag tctccacccc attgacgtca atgggagctc 3480 gcrccggcac caaaaCcaac cagactCtcc aaaatgtcgt aacaactccg ccccatcgac 3540 claaatgggc cgcaggcgcg tacggcggga agtctatata agcagagccc ctttactgaa 3500 ccgccagacc gcctggagac gccatccacg ccccccccac ctccatagaa gacaccggga 3660 ccgaCccagc cCccgcggcc gggaacggtg catcggaacg cggattcccc ctgccaagaa 3720 agcccgccca gaacccggga gagctcctga caacctcagg gtgagtccgg ccacccctga 3780 cccccccccc ccctccacca ttgcaaaatc catgtcacac cgagggegca aagctttcag 3840 agzgccgccc agaatggcaa gatgcccctt gcatcaccat ggacccccac gacaatctcg 3900 ccccccccac cccccacccc gctgacaacc accgccccct cttattttct tcccaccccc 3960 cgcaaccccc ccgttaaact tcagcctgca tccgcaacga atttttaaat tcacccccgt 4020 ccacccgcca gattgtaagc actctctcta atcacccctc tttcaacgca accacggcat 4080 accacaccgc accccagcac agctttagag aacaaccgtc ataattaaat gataaggtag 4140 aacacccccg cacacaaacc ccggccggcg cggaaacacc cccaccggca gaaacaacta 4200 caccccggcc accaccccgc ccccccctcc acggccacaa tgatatacac tgcccgagac 4260 gagcacaaaa tactccgagc ccaaaccggg cccccccgct aaccatgttc acgcccccct 4320 ::: c cccc: and cagcccccgg gcaacgtgcc cgccgccccg ccgcctcatc attttgccaa 4380 agaacccacc ccccaggcgc aggctgccca ccagaaggcg gcggccggtg Cgcccaacgc 4440 cccggcccac aaacaccacc aagacccccc cccccccgcc aaaaattatg gagacaccat 4500 gaagcccccc gagcatccga cccccggcca ataaaggaaa tttatcttca Ctgcaatagt 4560 gccccggaae cccccgcgcc ccccacccgg aaggacacac gcgagcgcaa atcattcaaa 4620 acaccagaac gagcacccgg cccagagccc ggcaacacac gccacatgcc ggccgccata 4580 aacaaacgcg gctaCaaaga ccccaccagt atacgaaaca cccccccgct gcccactccc 4740 caccccacag aaaacccccg acccgagccc acacccccct tatactctgt ttCccgctat 4800 aacaxcccxa aaaccttcct actagccaga cctttcctcc 4 3 60

<210> 13 <211> 31 <212> DNA <213> artificial sequence <220>

r -28 <223> Artificial sequence description: synthetic oligonucleotide <400> 13 gatcggatcc acaggttctg gtcatgcaag c 31 <210> 14 <211> 41 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 14 gatctctaga aagcttatca acctgaagct ggttccgtgg c 41 <210> 15 <211> 36 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 15 gatcggatcc gtgcccagct ctactgagaa gaatgc 36 <210> 16 <211> 49 <212> DNA <213> artificial sequence • r

-29 <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 16 gatctctaga aagcttatca gctgggaatt gagaatggag tgctcttgc 49 <210> 17 <211> 40 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 17 gatcggatcc ggctcagctt ctactctggt gcacaacggc 40 <210> 18 <211> 45 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 18 gatctctaga aagcttatca caaggcaatg agatagacaa tggcc 45 <210> 19 <211> 38 <212> DNA <213> artificial sequence

-30 <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 19 gatcggatcc ctggtgctgg tctgtgttct ggttgcgc 38 <210> 20 <211> 41 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 20 gatctctaga aagcttatca caagttggca gaagtggctg c 41 <210> 21 <211> 34 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 21 gatctctaga atgacaggtt ctggtcatgc aagc 34 <210> 22 <211> 39 <212> DNA <213> artificial sequence f ·

-31 <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 22 gatctctaga atggtgccca gctctactga gaagaatgc 39 <210> 23 <211> 43 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 23 gacctctaga atgggctcag cttctactct ggtgcacaac ggc 43 <210> 24 <211> 41 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 24 gatctctaga atgctggtgc tggtctgtgt tctggttgcg c 41 <210> 25 <211> 26 <212> DNA <213> artificial sequence

-32 <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 25 ggcggtggag cccggggctg gcttgt 26 <210> 26 <211> 22 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 26 aacctgaagc tggttccgtg gc 22 <210> 27 <211> 26 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 27 gtgcccagct ctactgagaa gaatgc 26 <210> 28 <211> 29 <212> DNA <213> artificial sequence

-33 <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 28 gctgggaatt gagaatggag tgctcttgc 29 <210> 29 <211> 30 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 29 ggctcagctt ctactctggt gcacaacggc 30 <210> 30 <211> 25 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 30 caaggcaatg agatagacaa tggcc 25 <210> 31 <211> 27 <212> DNA <213> artificial sequence

-34 <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 31 ctggtgctgg tctgtgttct ggttgcg 27 <210> 32 <211> 40 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 32 gatctctaga atgcagatct tcgtgaagac cctgactggt 40 <210> 33 <211> 68 <212> DNA <213> artificial sequence <220>

<223> Artificial sequence description: synthetic oligonucleotide <400> 33 tcaccagcga gacgggcaac agccatgcac cactaccgtg cctcccacct ctgagacgga 60 gcaccagg 68 <210> 34 <211> 66 <212> DNA <213> artificial sequence f r

-35yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyat!

<223> Artificial sequence description: synthetic oligonucleotide <400> 34 cctccgtctc agaggtggga ggcacggtag tggtgcatgg ctgttgcccg tctcgctggt gaaaag <210> 35 <211> 35 <212> DNA <213> artificial sequence <220 <223> Description 35 gatcggatcc tcgggaaacc tgtcgtgcca gctgc

Claims (15)

PATENT CLAIMS A pharmaceutical composition which, together with suitable excipients and adjuvants, comprises one or more different mammalian expression plasmids, each comprising a sequence encoding a different fragment of the MUC-1 mucin protein, wherein the sequence: (a) if it encodes more than one MUC-1 fragment, it is selected from the group of sequences having 200 to 700 nucleotides which bind to each other or overlap in the region of 50 to 150 nucleotides at the corresponding 3 'or 5' ends or (b) if it encodes only one fragment, it is the fragment shown in Figure 5. Pharmaceutical composition according to claim 1, characterized in that it comprises at least two different plasmids. Pharmaceutical composition according to claim 2, characterized in that it comprises at least three different plasmids. A pharmaceutical composition according to claim 3 comprising at least four different plasmids. Pharmaceutical composition according to claim 2, characterized in that it comprises at least two different plasmids whose sequences encoding the MUC-1 fragment are selected from the sequences shown in Figures 1, 2, 3 and 4. Pharmaceutical composition according to claim 5, characterized in that it comprises four different plasmids whose sequences encoding the MUC-1 fragment are selected from the sequences shown in Figures 1, 2, 3 and 4. Pharmaceutical composition according to any one of claims 1 to 6, characterized in that before the 5 'end of the MUC-1 coding sequence » The fragment is the sequence shown in Figure 6 that encodes ubiquitin and the Lac1 portion of Escherichia coli. The pharmaceutical composition of claim 7, wherein the sequence upstream of the 5 'end of the sequence encoding the MUC-1 fragment that encodes ubiquitin and the Lac1 portion of Escherichia coli is selected from the sequences shown in Figures 7, 8, 9, and 10th Pharmaceutical composition according to claim 1, characterized in that it comprises a mixture of different plasmids, each carrying the constructs shown in Figures 7, 8, 9 and 10. Pharmaceutical composition according to claim 1, characterized in that it comprises the construct shown in Figure 11. Pharmaceutical composition according to any one of claims 1 to 10, characterized in that the sequence encoding the MUC-1 fragment is incorporated into the pMRS30 expression vector described in Figure 13. Pharmaceutical composition according to any one of claims 1 to 11, characterized in that it also contains a cytokine or a plasmid encoding a cytokine. A plasmid consisting of the pMRS30 expression vector shown in Figure 13, which is fused to a sequence encoding an MUC-1 fragment selected from the sequences shown in Figures 1, 2, 3, 4 and 5. A plasmid consisting of the pMRS30 expression vector shown in Figure 13, which is fused to a construct selected from the constructs shown in Figures 7,8, 9,10 and 11. -3815. A DNA molecule selected from the DNA molecules shown in Figures 7, 8, 9, 10 and 11. Use of a DNA molecule according to claim 15 for the manufacture of a medicament having an antitumor effect.