Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/22—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Neisseriaceae (F)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the subject of the present invention is a new variant of the Tbp2 subunit of the Neisseria meningitidis transferrin receptor, its use as a medicament, as well as the DNA fragment coding for this variant.
• meningitis is either of viral origin or of bacterial origin.
• the bacteria mainly responsible are: N. meningitidis and Haemophilus in ⁇ uen ⁇ ae, respectively involved in approximately 40 and 50% of cases of bacterial meningitis.
• the N. meningitidis species is subdivided into serogroups according to the nature of the capsular polysaccharides. Although there are a dozen serogroups, 90% of meningitis cases are attributable to 3 serogroups: A. B and C.
• N. meningitidis group B is not or little immunogenic in humans, whether it is in conjugated form or not. Thus, it appears highly desirable to seek a vaccine against meningitis induced by N meningitidis, in particular serogroup B. other than a polysaccharide-based vaccine.
• transferrin and lactoferrin since the amount of iron in free form is negligible in humans (of the order of 10 * 18 M), in any case insufficient to allow bacterial growth.
• N. meningitidis has a receptor for human transferrin and a receptor for human lactoferrin which allow it to fix these iron chelating proteins and subsequently capture the iron necessary for its growth.
• the transferrin receptor of the N. meningitidis B16B6 strain was purified by Schryvers et al (WO 90/12591) from a membrane extract.
• This protein as purified appears essentially made up of 2 types of polypeptides: a polypeptide of a high apparent molecular weight of 100 kDa and a polypeptide of a lower apparent molecular weight of approximately 70 kDa, as revealed after electrophoresis on gel of polyacrylamide in the presence of SDS.
• the purification product used in particular by Schryvers is by definition arbitrary and for the purposes of this patent application, called the human transferrin receptor (RTH) and the polypeptides constituting it, subunits.
• RTH human transferrin receptor
• the high molecular weight and lower molecular weight subunits are respectively called Tbpl and Tbp2.
• the recognition of the transferrin receptor subunits is revealed by addition of a rabbit anti-immunoglobulin antibody coupled to peroxidase, then by addition of the substrate for this enzyme.
• Tables I and II below indicate the profile of certain representative strains as it appears on 7.5% polyacrylamide gel after electrophoresis in the presence of SDS; the bands are characterized by their apparent molecular weights expressed in kilodaltons (kDa):
• NB In brackets, the serogroup is indicated in order. the serotype. subtype and immunotype. e »e> o
• NB In brackets, the serogroup, the serotype, the subtype and the immunotype are indicated in order. ns * o- * (Jt ce o
• the first type corresponds to strains which have a receptor whose 2 subunits under the experimental conditions used, are recognized in Western blot by the anti-receptor antiserum IM2394, while only the high subunit molecular weight is recognized by the anti-receptor antiserum IM2169.
• the second type corresponds to strains which have a receptor whose 2 subunits under the experimental conditions used, are recognized in Western blot by the anti-receptor antiserum IM2169, while only the high subunit molecular weight is recognized by the anti-receptor antiserum IM2394.
• strains of type M982 are, for example, strains S3032 (12. P 1.12.16). 6940 (19. P 1.6). M978 (8. P 1.1, 7). 2223 (B: nd). 1610 (B: nd), C708 (A: 4. P 1.7), M981 (B: 4). also called 891. and 2996 (B: 2b, P 1.2).
• strain IM2154 (serogroup C) is cited by way of example as being of type B16B6.
• the protein Tbp2 rather than Tbpl, has a number of characteristics which make it a potential vaccine candidate: ubiquitous expression, accessibility to the surface of the germ, the capacity to induce neutralizing antibodies and limited variability since as this has just been exposed, two major groups have been identified to date.
• compositions have already been proposed containing:
• Tbp2 from at least one type B 16B6 strain and Tbp2 from at least one type M982 strain (WO 93/7172).
• Tbp2 M982 and Tbp2 B16B6 were fixed as shown in the table below, indicating the position of the amino acids, bounds included for the different domains, and by reference to the numbering appearing in SEQ ID NO 1 and 3.
• This definition also applies to all Tbp2s of type M982 or B16B6, after alignment of a sequence type M982 or B16B6 on the reference sequence, to the maximum of homology.
• the position of the domains of the Tbp2 subunit of the strain 8680 is indicated as follows: first domain (1 - 334), second domain (335 - 530) and third domain (531 - 677).
• the N-terminal or first domain includes in its entirety the transferrin binding site and is therefore most likely exposed to the outside. Consequently, the N-terminal domain alone constitutes an element of choice for purposes i ci. vaccine.
• the hinge region of strains of the M982 type constitutes a major problem in the production of a vaccine.
• this region is immunodominant, during an immunization, the antibodies induced will be directed mainly against this region and consequently the immune response will be specific for the protein Tbp2 of the homologous strain.
• Tbp2s of type M982 no longer whole Tbp2s of type M982, but Tbp2s at least deleted from their four hyper ⁇ 'ariables portions or, alternatively, deleted from the second and third domains.
• composition of choice Since an essential region for the induction of broad spectrum immunity is probably the first domain, a pharmaceutical composition of choice has appeared to be, for example, at least composed:
• Tbp2 M982 protein (100% Tbp2);
• Tbp2 M982 protein comprising only the first 350 N-terminal amino acids (Tbp2 50%);
• Tbp2s proteins were first produced in E. coli by the recombinant route.
• Tbp2 M982 its production is described in EPA 586 266 (published March 9, 1994).
• Those of the other two Tbp2s M982 are reported in Examples 4 and 6 of the present application.
• Example 8 The preparation of hyperimmune sera and the analysis of these sera. preliminary to the immunodominance study. is the subject of Example 8 of the present application. The study of cross-reactivity is the subject of more details in Example 9.
• strains classified as type M982 either by analysis of the outer membrane proteins by SDS-Page electrophoresis followed by immunorevelation. either on the basis of the size of the tpb2 gene amplified by PCR, were studied in dot blot (analysis on whole genes) for their cross reactivity (see Example 9). These strains were obtained free of charge from Dr D.A. Caugant. They have been isolated in very diverse regions of the world and at different times. Therefore, this collection should be representative. 14 strains are not recognized by the anti-Tbp2 M982 100% serum, while only 4 escape recognition by the anti-Tbp2 M982 80% serum and 1 by the anti-Tbp2 M982 50% serum.
• the subject of the invention is a protein in substantially purified form, which is the lower molecular weight subunit (Tbp2) of the human transferrin receptor (RTH) of a strain of N. meningitidis; the strain being characterized in that it is not recognized in dot blot by an antiserum obtained against a polypeptide corresponding to the Tbp2 of the strain N.
• Tbp2 the lower molecular weight subunit
• RTH human transferrin receptor
• Tbp2 M982 meningitidis M982 (Tbp2 M982) deleted from the hypervariable portions of its hinge region (Tbp2 M982 ⁇ 362 - 379; ⁇ 418 - 444; ⁇ 465 - 481; ⁇ 500 - 520); and the Tbp2 subunit being characterized (i) in that it is encoded by a DNA fragment of approximately 2.1 kb.
• the Tbp2 subunit according to the invention is characterized (i) in that it is encoded by a DNA fragment of approximately 2.1 kb
• the strain of N. meningitidis which it derives is itself characterized in that its genome comprises an open reading frame (ORF) coding for said Tbp2 subunit of approximately 2.1 kb.
• the protein according to the invention is encoded by a DNA fragment of approximately 2.1 kb. it is quite obvious, given what has been said previously, that this protein has a hinge region of the M982 type.
• Tbp2 protein derived from this strain therefore very particularly constitutes a vaccine candidate of choice.
• a Tbp2 subunit according to the invention advantageously derives from a strain of N. meningitidis which is not recognized in dot blot by an antiserum obtained against a fragment of Tbp2 M982 ranging from the amino acid in position 1 to the amino acid in position 350, that is to say against a polypeptide corresponding to the Tbp2 of the strain N. meningitidis M982 substantially deleted from the second and third domains.
• a Tbp2 subunit according to the invention derives in particular from a strain of N. meningitidis whose Tbp2 subunit is recognized in Western blot of membrane fractions by an antiserum obtained against the RTH of the strain M982 (anti antiserum -RTH M982) and by an antiserum obtained against the RTH of the strain B 1616 (anti-RTH antiserum B16B6).
• antisera have been described in patent application WO 93/6861.
• a Tbp2 subunit according to the invention comprises an amino acid sequence whose degree of homology (of identity) with the amino acid sequence of Tbp2 M982, as shown in ID SEQ No. 1 , is from 60 to 70%, advantageously about 65%.
• a Tbp2 subunit according to the invention comprises an amino acid sequence whose degree of homology with the amino acid sequence of Tbp2 8680, as shown in ID SEQ No. the amino acid in position 1 to the amino acid in position 677. is from 80 to 100%, advantageously from 90 to 100%. preferably from 95 to 100%.
• it comprises an amino acid sequence substantially as shown in ID SEQ No. 5 starting with the amino acid residue in position 1 and ending with the amino acid residue in position 677.
• a Tbp2 subunit according to the invention can be in dissociated form from the high molecular weight subunit (Tbpl) of the N. meningitidis strain from which Tbp2 is derived or else in association with this Tbpl, thus forming a complex Tbpl-Tbp2 considered to be the receptor for human transferrin.
• Tbpl high molecular weight subunit
• the Tbp2 subunit according to the invention must be substantially purified; that is to say separate from the environment in which it exists in a natural way. Among others, it may be a preparation in particular devoid of the cytoplasmic and periplasmic proteins to H. pylori.
• the invention also relates to an isolated DNA fragment coding for a protein according to the invention as well as for a precursor of this protein; the latter comprising a signal peptide homologous or heterologous to the protein according to the invention.
• a DNA fragment coding for a protein according to the invention is described in ID SEQ NO 5 from nucleic acid in position 30 to nucleic acid in position 2061.
• a DNA fragment coding for a precursor of a protein according to the invention is described in ID SEQ NO 5 from nucleic acid in position 1 to nucleic acid in position 2061.
• a DNA fragment according to the invention can also comprise a nucleic acid sequence other than that shown in ID SEQ NO 5 provided that it can hybridize to the DNA fragment shown in ID SEQ NO 5, under conditions of high stringency.
• Hybridization methods as well as the implementation of high stringency conditions are within the reach of those skilled in the art.
• hybridization procedures are described in Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons Inc .. 1994; Silhavy et al. Experiments with Gene Fusions. Cold Spring Harbor Lab .. 1984: Davis et al, A Manual for Genetic Engineering: Advanced Bacterial Genetics, CSH Lab .. 1980.
• important parameters are indicated which must be taken into account in order to optimize the conditions. of hybridization, are found in the formula which makes it possible to calculate a critical value, the melting temperature (Tm), above which two complementary strands separate (Casey & Davidson, Nucl. Acid Res.
• Tm melting temperature
• Tm 81.5 + 0.5 X (% G + C) + 1.6 log (positive ion concentration) - 0.6 X (% formamide).
• the hybridization temperature is about 20-25 ° C below the melting temperature as calculated.
• high stringency conditions are obtained by carrying out pre-hybridization and hybridization incubations for 4 - 16 hrs, at approximately 55 - 60 ° C, in 6 x SSC solution (1 M NaCl, 0.1 M sodium citrate . pH 7.0).
• the invention also relates to (i) a polypeptide derived in particular by deletion of a Tbp2 subunit according to the invention; and (ii) an isolated DNA fragment coding for such a polypeptide.
• a polypeptide having an amino acid sequence which derives from that of a Tbp2 subunit according to the invention, the first, second and third domains of which are defined by alignment to the maximum of homology, on the sequence of the Tbp2 subunit of the reference strain M982; in particular by total or partial deletion of at least one domain of said Tbp2 subunit according to the invention, provided that the first and second domains are not simultaneously and completely deleted.
• sequence which derives from another sequence is obviously understood a sequence resulting by intellectual process from this other sequence.
• it is a polypeptide capable of binding to human transferrin and derived from a Tbp2 subunit according to the invention, in particular by deletion of one or more amino acids located on the side of the C-terminus or in the region of the first forty amino acids of the Tbp2 subunit.
• the C-terminal end is defined as being the part of Tbp2 corresponding to the second and third domains.
• a polypeptide according to the invention has an amino acid sequence which derives from a Tbp2 subunit according to the invention:
• a polypeptide according to the invention has a partial, almost total or total deletion of the third domain, preferably total.
• the first as well as the second domain can be maintained in their entirety, partially or totally deleted; this independently of each other.
• the following combinations are possible (knowing that the first, second and third domains in their entirety are respectively represented by 1, 2 and 3, and that O and ⁇ mean respectively, partially and totally deleted):
• polypeptide derived from a Tbp2 subunit according to the invention by partial deletion of the second domain, which comprises in their entirety or almost entirely the first and third domains; or the combination 1, O 2.3.
• a polypeptide according to the invention can also respond to the combination Ol .02, 3, the partial deletion of the first domain advantageously covering all or part of the region homologous to that of Tbp2 M982, ranging from the amino acid in position 1 to the amino acid approximately in position 40.
• this partial deletion relates substantially to one or more regions of the second domain which are the homologs of the regions of the sequence M982 going:
• a partial deletion of the second domain relates substantially to one or more hypervariable portions. These portions are, after alignment to the maximum of homology, the counterparts of the portions of the sequence M982 going:
• the partial deletion relates simultaneously to the four portions (i) to (iv) described above.
• the almost integral deletion of the second domain extends over the region which is the homolog of the region of the second domain of the Tbp2 M982 subunit ranging from the amino acid in one of the positions 346 to 361 with the amino acid in position 543.
• this partial deletion advantageously relates to all or part of the region which is the homolog of the region of the first domain of the sub - Tbp2 unit of type M982 going from the amino acid in position 1 to the amino acid in position 281.
• a deletion of interest relates to all or part of the region which is the homolog of the region of the first domain of said Tbp2 subunit of type M982 ranging from acid amino in position 1 to the amino acid approximately in position 40.
• the degree of homology can be easily calculated by aligning the sequences so as to obtain the maximum degree of homology; to do this, it may be necessary to artificially introduce vacant spaces, as illustrated in the Figure 1. Once the optimal alignment is achieved, the degree of homology is established by counting all the positions in which the amino acids of the two sequences are found identically, compared to the total number of positions.
• polypeptide according to the invention is cited, the sequence of which has at least 70-75%, advantageously at least 80%. preferably at least 90%. most preferably 100% homology with:
• a polypeptide according to the invention has an amino acid sequence which comprises at least 10, advantageously at least 20. preferably at least 50, most preferably at least 100 amino acids.
• a polypeptide according to the invention can also additionally comprise an amino acid sequence which does not have any homology with the sequences of the Tbp2 subunits according to the invention.
• an additional sequence can be that of any other polypeptide to the exclusion of Tbp2.
• an additional sequence may be that of a signal peptide located in the N-terminal position of a polypeptide according to the invention.
• Examples of signal sequence are shown in ID SEQ Nos. 1 to 4.
• an appropriate heterologous signal sequence may be a signal sequence found in the precursor of a lipoprotein.
• a Tbp2 subunit according to the invention can be directly purified from the native strain or advantageously, obtained by recombinant route in a heterologous or homologous expression system.
• the polypeptides according to the invention are preferably recombinant products.
• the DNA fragment coding for the Tbp2 of strain 8680 was cloned and sequenced.
• the subject of the invention is therefore also:
• the DNA fragment according to the invention may or may not be associated with a DNA block coding for a heterologous signal peptide or not. to the polypeptide encoded by said DNA fragment, depending on whether or not secretion of the polypeptide is sought. Preferably, this secretion will be sought.
• signal region or a promoter already exist in fairly large numbers and are known to the skilled person. His general skills will allow him to choose a particular signal region or promoter which will be adapted to the host cell in which he envisages expression.
• the host cell can be a mammalian cell, a bacterium or a yeast; the latter two being preferred. Again, the choice of a particular line is within the reach of the skilled person.
• the invention also relates to a pharmaceutical composition
• a pharmaceutical composition comprising, as active principle, a Tbp2 subunit or a polypeptide according to the invention.
• a pharmaceutical composition according to the invention is in particular useful for inducing an immune response in humans against N meningitidis, inter alia a vaccine effect so as to protect humans against infections with N meningitidis, in prevention or in therapy.
• composition according to the invention can also comprise:
• ⁇ ⁇ a polypeptide capable of binding human transferrin and derived from a Tbp2 subunit of N meningitidis whose Tbp2 subunit is not recognized in Western blot of membrane fractions by an anti-RTH M982 antiserum and is recognized by a anti-RTH antiserum B16B6, in particular by deletion of one or more amino acids located on the side of the C-terminal end of the Tbp2 subunit.
• composition according to the invention advantageously comprises at least one, preferably two additional elements chosen from the four set out above.
• the additional Tbp2 subunit of type M982 advantageously comprises an amino acid sequence the degree of homology of which with the amino acid sequence of Tbp2 M982, as shown in ID SEQ No. 1, is 90 100 %. It is preferably the Tbp2 M982 subunit.
• the additional type B 16B6 Tbp2 subunit advantageously comprises an amino acid sequence the degree of homology of which with the amino acid sequence of Tbp2 B16B6, as shown in ID SEQ No. 3, is 90 to 100%. It is preferably the Tbp2 B 16B6 subunit.
• the additional polypeptide (ii) derives from a Tbp2 subunit of a strain of N. meningitidis whose Tbp2 is recognized in Western blot of membrane fractions by an anti-RTH M982 antiserum and is not recognized by an anti-RTH B16B6 antiserum. in particular by partial deletion of the second domain, inter alia by substantial deletion of the hypervariable regions of the second domain of the Tbp2 subunit or by substantial deletion of the second or third domain of the Tbp2 subunit.
• this polypeptide is derived from a Tbp2 subunit which comprises an amino acid sequence whose degree of homology with the amino acid sequence of Tbp2 M982, as shown in ID SEQ No. 1. is 90 to 100%.
• it is a polypeptide which is derived from Tbp2 M982.
• the additional polypeptide (iv) derives from a Tbp2 subunit of a strain of N. meningitidis whose Tbp2 is not recognized in Western blot of membrane fractions by an anti-RTH M982 antiserum and is recognized by an anti antiserum -RTH B 16B6. in particular by substantial deletion of the second or third domain of the Tbp2 subunit, preferably of the second and third domains.
• this polypeptide derives from a Tbp2 subunit which comprises an amino acid sequence whose degree of homology with the amino acid sequence of Tbp2 M982. as shown in ID SEQ No 3, is 95 to 100%
• it is a polypeptide which derives from Tbp2 B16B6
• composition according to the invention comprises
• a pharmaceutical composition according to the invention can be manufactured in a conventional manner.
• the polypeptide (s) according to the invention are combined with an adjuvant, a diluent or a support acceptable from a pharmaceutical point of view.
• a composition according to The invention can be administered by any conventional route used in the field of vaccines, in particular by the subcutaneous route, by the intramuscular route or by the intravenous route, for example in the form of an injectable suspension. can be given as a single dose or repeated once or several times after a certain interval The appropriate dosage varies depending on various parameters, for example, the individual treated or the method of administration
• Figure 1 respectively show the alignments of the Tbp2 M982 and 8680 sequences. Maximum homology according to the Kanehisa program (Bisance ISIC-2). The degree of homology is 65%.
• Figure 2 shows the maximum homology alignments of the sequences of the hinge domains (second domain) of Tbp2 M982 (1). 6940 (2), 2223 (3), C708 (4), M978 (5), 1610 (6), 867 (7), S3032 (8) and 981 (9). In italics is given the numbering of the sequence of Tbp2 M982, as it appears in ID SEQ NO 1. In bold appear the sequences of the hypervariable portions which can be deleted according to a preferred mode. (C) indicates the consensus sequence.
• Figures 3 to 5 respectively illustrate the construction of plasmids pTG5782. pTG5755 and pTG5783.
• a freezing of the strain N. meningitidis 8680 is taken up in approximately 1 ml of Muller Hinton broth (BMH, Difco). The bacterial suspension is then spread on the Muller Hinton solid medium containing cooked blood (5%).
• the purification method is essentially as described by Schryvers et al (supra).
• the bacterial pellet obtained in IA is thawed, then resuspended in 200 ml of 50 mM Tris HCl buffer, pH 8.0 (buffer A). The suspension is centrifuged for 20 min at 15,000 xg at 4 ° C. The pellet is recovered, then resuspended in buffer A at the final concentration of 150 g / 1. 150 ml fractions are treated for 8 min at 800 bars in a cell lyser working under high pressure (Rannie, model 8.30H). The cell lysate thus obtained is centrifuged for 15 min at 4 ° C at 15,000 x g. The supernatant is recovered and then centrifuged for 75 min at 4 ° C at 200,000 x g.
• the pellet After removing the supernatant, the pellet is taken up in buffer A and after assaying proteins according to Lowry, the concentration of the suspension is adjusted to 5 mg / ml. To 1.4 ml of the membrane suspension is added 1.75 mg of biotynylated human transferrin according to the method described by Schryvers. The final concentration of the membrane fraction is 4 mg / ml. The mixture is incubated for 1 hour at 37 ° C. and then centrifuged at 100,000 xg for 75 min. at 4 ° C. The membrane pellet is taken up in buffer A containing 0.1 M NaCl and incubated for 60 min. at room temperature.
• the resin is washed with 3 column volumes of 50 mM Tris-HCl buffer pH 8.0 containing IM NaCl, 10 mM EDTA 0.5% Sarkosyl (buffer B) and then with one column volume of buffer B containing guanidine HCl 750 mM.
• the transferrin receptor is then eluted by buffer B containing guanidine HCl 2M.
• the eluate is collected as a fraction, the volume of which corresponds to IV. in tubes containing IV of 50 mM Tris HCl pH 8.0. NaCl IM.
• the optical density at 280 nm of the eluate is measured at the column outlet using a UV detector.
• the fractions corresponding to the elution peak are collected and dialyzed against 10 mM phosphate buffer. pH 8.0 containing 0.05% Sarkosyl and lyophilized The lyophilisate is taken up in water at a concentration 10 times higher. The solution is dialyzed a second time against 50 mM phosphate buffer pH 8.0 containing 0.05% Sarkosyl (buffer C) then the solution is filtered through a membrane with a porosity of 0.22 ⁇ m.
• the culture of the strain N. meningitidis 8640, as well as the purification steps up to the preparation of the membrane suspension are carried out under conditions identical to those described in Example 1.
• the resin is washed with 3 column volumes of 50 mM Tris-HCl buffer pH 8.0 containing 1 M NaCl, 0.5 m EDTA 10 mM Sarkosyl (buffer B) and then with one column column of buffer B containing 750 mM guanidine HCl.
• the transfe ⁇ ine receptor is then eluted with the 50 mM Tris-HCl buffer pH 8.0 1 M NaCl 0.05% EDTA 10 mM Sarkosyl and 2 M guanidine HCl.
• the optical density at 280 nm of the eluate is measured at the column outlet using a UV detector.
• the fractions corresponding to the elution peak are combined and the protein is precipitated by the addition of three volumes of cooled ethanol.
• the protein is collected by centrifugation for one hour at 10,000 x g.
• the precipitate is taken up in a certain volume of 10 mM phosphate buffer pH 7.0 containing 0.5 M NaCl, 5 M guanidine-HCl (buffer D) so that the final protein concentration is approximately 1 mg / ml.
• the solution is brought into contact with the phenyl-Sepharose resin (Pharmacia) previously equilibrated with the same buffer.
• the incubation is carried out in a bath with rotary shaking for 2 hours at room temperature.
• the gel is then conditioned in a column.
• the high molecular weight subunit (Tbpl) is collected in the direct eluate, while the lower molecular weight subunit (Tbp2) is fixed on the resin.
• the column is rinsed with three volumes of buffer D then with 5 volumes of 10 mM phosphate buffer pH 7.0.
• Tbp2 is eluted with 1 OmM phosphate buffer pH 7.0 containing 0.5% Sarkosyl.
• the excess of Sarkosyl contained in the Tbp2 elution buffer is eliminated by ethanol precipitation, the protein is then taken up in the 50 mM phosphate buffer pH 8.0 containing 0.05% Sarkosyl (buffer C).
• the solution is then filtered through a membrane with a porosity of 0.22 ⁇ m.
• the protein content is determined and adjusted to 1 mg / ml by the addition of buffer C, under aseptic conditions. This preparation is stored at -70 ° C.
• the DNA is extracted by a conventional phenol chloroform method.
• the pellet is taken up in 25 ml of lysis solution (glucose 50 mM, EDTA, 10 mM, Tris, 25 mM pH 8.0) supplemented with 1 ml of proteinase K (Sigma) at 10 mg / ml.
• lysis solution glucose 50 mM, EDTA, 10 mM, Tris, 25 mM pH 8.0
• proteinase K Sigma
• RNAse A (Sigma) at 2 mg / ml is added and the suspension is incubated at 37 ° C for 90 min.
• the DNA is extracted by adding 0.5 volumes of phenol.
• the extraction is carried out by stirring for 10 min. then 0.5 volumes of chloroform-isoamyl alcohol (24: 1) are added.
• the supernatant is removed and is again treated with phenol / chloroform.
• the phenol / chloroform extraction step is repeated until the aqueous phase is cleared.
• the DNA is precipitated with 2 volumes of absolute ethanol in the presence of 0.3 M sodium acetate pH 7. Then rinsed in 70% ethanol. The DNA is taken up in 1 ml of distilled water, then assayed with a spectrophotometer at 260 nm and at 280 nm. One unit of OD 260 nm corresponds to 50 ng of DNA / ⁇ l. DNA preparations are considered satisfactory and usable if the DO 260 / DO 280 ratio is between 1.8 and 2.
• tbp2 From 10 ng of genomic DNA the tbp2 gene is amplified by PCR using the following primers:
• the reaction medium is as follows: 10 ng of genomic DNA; 0.5 ⁇ M of 5 'and 3' primers; 200 ⁇ M of dNTPs (Boehringer); 10 ⁇ l of Ox l PCR buffer (Biotaq) and 2.5 U of Taq polymerase (Biotaq).
• the reaction volume is adjusted to 100 ⁇ l with distilled water.
• the amplification conditions in a Trioblock device are as follows: denaturation: 94 ° C, 1 min; hybridization: 58 ° C, 2 min; elongation: 72 ° C, 3 min; number of cycles: 25.
• the DNA fragment amplified by PCR is subjected to electrophoresis on a 1% preparative agarose gel ("Electrophoresis grade”. BRL) is prepared in TAE buffer (Tris acetate 0.04M, EDTA 0.002M pH 8.0). The amplified band corresponding to the tbpl gene is cut.
• the DNA contained in the agarose is purified using a Geneclean kit (Bio 101). The DNA is then digested with EcoRI and BamHI for 2 h at 37 ° C. The digested DNA is then repurified by extraction with phenol / chloroform, precipitated with 2 volumes of ethanol, then taken up in 20 ⁇ l of Tris-EDTA (TE) buffer (10 mM Tris-HCl. 1 mM EDTA pH 8.0) .
• TE Tris-EDTA
• the vector pBSK (-) (Stratagene) is digested with £ coRI and BamH] and then purified as described above for the EcoRllBamHl insert.
• the EcoRl / BamUl insert and pBSK are ligated in the presence of T4 ligase (Boehringer) at 16 ° C. overnight under the following conditions: vector 100 ng; insert 200-300 ng; buffer T4 ligase 10X (Boehringer) 1 ⁇ l; 5U ligase; water qs 10 ⁇ l.
• T4 ligase Boehringer
• E. coli XLl-Blue (recAl. EndA ⁇ , gyr A96, thi- ⁇ . /,. hi/R17. SupE44. RelAl. Lac. (F proAB, lacQZ ⁇ MlS, TnlO (tet 1 " )) is precultured in 10 ml of SB medium (Difco) in the presence of tetracycline at 10 ⁇ g / ml overnight at 37 ° C. 500 ⁇ l of preculture are used to seed 11 of SB medium.
• the germs are washed three times with 10% glycerol in water, reducing the washing volumes from 500 ml to 120 ml, the supernatant is removed after centrifugation at 2500 xg for 15 min at 4 ° C. After the last washing, the bacteria are taken up in 3 ml of 10% glycerol 1 mM Hepes pH 7.5 The germs are aliquoted under 100 ⁇ l in tubes placed in liquid nitrogen The electrocompetent bacteria are stored for one month at -70 ° vs. Five ⁇ l of the ligation reaction are used to transform 100 ⁇ l of E.
• coli XL-1 bacteria by electroporation in 2 mm thick cells (Eurogentec) at a voltage of 2500 volts. After electroporation, the germs are incubated for 1 hour at 37 ° C. then 1/10 and 9/10 of the volume of the preparation are spread on boxes of LB medium (Difco) plus ampicillin (100 ⁇ g / ml) supplemented with X- gal (25 ⁇ g / ml) and IPTG (25 ⁇ g / ml) allowing a white / blue selection of the recombinant clones.
• LB medium Difco
• ampicillin 100 ⁇ g / ml
• X- gal 25 ⁇ g / ml
• IPTG 25 ⁇ g / ml
• the recombinant clones (white) are analyzed after mini-preparation of plasmid according to a conventional method (Maniatis et al., 1989) by double digestion EcoRI, BamHI.
• the clones selected are those which have integrated a 2.1 kb fragment.
• the direction of integration of the insert is determined after digestion with Hincll.
• the plasmid DNA of the clones of interest is prepared in large quantity by a maxi-preparation using a purification method on a tip-250 column (Quiagen Kit).
• EXAMPLE 4 Polypeptide T / 2169 (1.02, ⁇ 3; 1-350) whose sequence as shown in ID SEQ NO 1 (IM2169). from amino acid in position 1 to amino acid in position 350.
• the PCR fragment is then digested with BspHI and Hc / ell and inserted simultaneously with the H ⁇ ell-Hindlll fragment of pTG4704 which contains the 3 ′ part of the region coding for Tbp2. in the plasmid pTG3704 described in the application EPA 586 266, digested with Ncol and Hin ⁇ U ⁇ , to generate the plasmid pTG5768.
• OTG5011 TGCGCAAGCTTACAGTTTGTCTTTGGTTTTCGCGCTGCCG HindiII
• This PCR fragment is digested with Sphl and HmdlII, then cloned into the plasmid pTG4710 described in application EPA 586,266; the plasmid pTG5740 is thus generated.
• the Haell-HindIII fragment of pTG5740 comprising the 3 ′ part of the sequence coding for the human transferrin binding domain (hTf) (3 ′ of the region coding for the first domain) is inserted into the plasmid pTG3704 digested with BamHI and H / ⁇ dlII, simultaneously with the BamHI-Haell fragment of pTG5768 comprising the araE promoter, the signal sequence rlpB and the start of the coding sequence of Tbp2; plasmid pTG5782 is thus generated.
• This vector includes the araB promoter. the sequence coding for the RlpB secretion signal fused to the sequence coding for the N-terminal domain of Tbp2 (1 - 350).
• a strain of E. coli is transformed with pTG5782.
• the transformants are cultured at 37 ° C. in M9 medium + 0.5% succinate + arginine 50 ⁇ g / ml + ampicillin 100 ⁇ g / ml.
• 0.2% arabinose (inducer) is added. After one hour of induction, cells are taken and extracts are prepared.
• a Western blot analysis followed by a revelation by hTF-peroxidase makes it possible to detect a majority band whose PM corresponds to that expected for this truncated form of Tbp2.
• T / 2169 In a test as described in Example 4 of WO93 / 6861 (published: 15/04/93) purified T / 2169 is found to be capable of inducing bactericidal antibodies and therefore should be useful for vaccine purposes.
• EXAMPLE 5 Polypeptide T / 2394 (1.02, ⁇ 3; 1-340) whose sequence as shown in ID SEQ NO 2 (IM2394), from amino acid in position 1 to amino acid in position 340.
• the plasmid pTG4710 is digested with Mlul and Hindlll.
• the Mlul-HmdlII fragment comprising the 3 ′ part of the sequence coding for Tbp2 is replaced by the PCR fragment coding for the C-terminal part of the hTf binding domain.
• the plasmid pTG5707 is thus generated. Then replaced in the plasmid pTG5707.
• the plasmid pTG5755 is thus generated.
• This vector includes the araB promoter, the sequence coding for the RlpB secretion signal fused to the sequence coding for the N-terminal domain of Tbp2 (1 - 340).
• T / 2394 (1-340) is produced and purified as described in Example 4B. - jl -
• EXAMPLE 6 Polypeptide D4 / 2169 (1, 02, 3) whose sequence is identical to that as shown in ID SEQ NO 1, from the amino acid in position 1 to the amino acid in position 691, deleted from regions 362-379, 418-444, 465-481 and 500-520.
• Polypeptide D4 / 2169 (1, 02, 3) whose sequence is identical to that as shown in ID SEQ NO 1, from amino acid in position 1 to amino acid in position 691. deleted from regions 362 -379, 418-444, 465-481 and 500-520.
• the DNA fragment coding for the Tbp2 subunit of the N. meningitidis IM2169 strain is amplified by PCR (Polymerase chain reaction) using specific primers complementary to the 5 'and 3' regions, (respectively
• a DNA fragment is thus obtained and after digestion with EcoRI. it counts 2150 nt. This EcoRI fragment is then ligated to the dephosphorylated EcoRI ends of the phagemid pBluescriptSK (-) (Stratagene) to give the recombinant phagemid pSK / 2169tbp2. 1.2. Implementation of deletions.
• the phage form of the recombinant phagemid pSK / 2169tbp2 is obtained after rescue by the phage "helper" VCS Ml 3 according to the technique described by Stratagene, supplier of the basic vector, and used to infect the bacterial strain CJ236.
• the mutations dut and ung carried by the strain CJ236 result in the synthesis of DNA molecules which have incorporated the nucleotide precursor dUTP.
• the phages are harvested and the single-stranded DNA is extracted with a phenol / chloroform mixture. This DNA is hybridized, under conventional conditions, to the following oligonucleotides:
• 2169dl 5 'CGCATCCAAAACCGTACCTGTGCTGCCTGA 3 2169d2 5' TTTATCACTTTCCGGGGGCAGGAGCGGAAT 3 2169d3 5 'GTTGGAACAGCAGACAGCGGTTTGCGCCCC 3 2169d4 5' GAACATACTTTGTTCGTTTTTGC
• the hybridization reaction is continued for 30 min. in decreasing temperature from 70 ° C to 30 ° C.
• the second complementary strand is then completed by complete synthesis in the presence of the four deoxynucleotides.
• T4 DNA polymerase and T4 DNA ligase according to standard conditions.
• the E. coli SURE strain (Stratagene) is transformed by the DNA thus obtained.
• the molecules carrying dUTP. that is to say, non-mutated, are destroyed.
• the phages obtained are analyzed by standard techniques for rapid preparation of plasmid DNA and digestion with the appropriate restriction enzymes. The presence of the mutation sought is then verified by nucleotide sequencing.
• the clone pSK2169 # 7, carrying the four mutations ⁇ 1203-1256, ⁇ 1371-1451, ⁇ 1512-1562, and ⁇ 1617-1679 is selected.
• the plasmid pTG5768 described above is digested with Hpal and Xcml.
• An Xcml-Xcml fragment from pTG5768 and the Hp ⁇ l-Xcml fragment from the plasmid pSK / 2169ed # 7 are simultaneously inserted into this vector. to generate the plasmid pTG5783.
• This vector includes the araB promoter, the sequence coding for the RlpB secretion signal fused to the modified tbpl sequence (deletions dl to d4).
• the level of expression of the protein by N. meningitidis RTH is determined by measuring the ability of "a specified number of nuclei to fix the Tfh coupled to peroxidase.
• Bacterial density of the culture is calculated from the absorbance of the suspension measured at 600 nm knowing that a unit of absorbance corresponds to 3.1 ⁇ "CFU / ml.
• One ml of a bacterial culture is centrifuged for 15 min at 2500 g then the bacterial pellet is taken up in a volume of 50 mM Tris-HCl pH 8.0 so as to obtain a suspension of 1.10 ⁇ CFU / ml.
• a series of dilutions of reason 2 is carried out from this suspension (1/2 to 1/2048). Fifty ⁇ l of each of these
• a culture of the strain of E. coli described in Example 4B above or in Example 6B above is lysed by passage through a lysis apparatus (Rannie) and then centrifuged. Insoluble material is loaded onto a 5% 10% acrylamide gel
• RTH M982 and B16B6 are purified as described in Examples 1 and 2 of WO 93/6861.
• Albino New Zealand rabbits receive, multisite subcutaneously, 50 ⁇ g of one of the products described above in the present example, in the presence of complete Freund's adjuvant. 21 days and 42 days after the first injection, the rabbits again receive 50 ⁇ g of the same product, but these times in the presence of incomplete Freund's adjuvant. 15 days after the last injection, the animal serum is removed, then decomplemented for 30 min at 56 ° C and sterilized by filtration on a membrane with a porosity of 0.22 ⁇ m (Millipore).
• the filtrate is subsequently exhausted by contact with the initial strain (M982 or B 16B6) which, to do this, has been cultivated beforehand in the presence of iron in free form (under these conditions, the synthesis of the transferrin receptor is repressed ).
• the contact methods are as follows: 10 ml of the filtrate are added to 10 ⁇ cfu (colony-forming units) of a culture of the initial strain. Addition is continued overnight at 4 ° C. with stirring. The bacteria are then eliminated by centrifugation for 15 min at 2500 x g. The supernatant is recovered and then subjected again to 3 successive adsorption operations as previously described.
• the adsorbed sera are filtered through a membrane with a porosity of 0.22 ⁇ m (Millipore) and stored at -20 ° C.
• the capacity of anti-RTH or anti-Tbp2 sera to induce the lysis of the different strains of N. meningitidis is evaluated by a bactericidal test. This technique consists in bringing together two volumes of dilutions of reason 2 (1/4 to 1/2048) of the adsorbed and decomplemented serum to be titrated, a volume of young rabbit supplement diluted to 1 / 1.5 and a volume of bacterial suspension containing 70 germs from culture for 5 h at 37 ° C. in MHB broth pH 7.2, EDDA 30 ⁇ M. The reagents are mixed with each other in wells and incubated for 30 min at 37 ° C with shaking.
• the bactericidal reaction of the serum with respect to germs is stopped by the addition of 1 ml of agar consisting of MH broth pH 7.2, 20% of supplement G (Pasteur Diagnostic) and 15% of noble agar ( Difco). The wells are then incubated overnight at 37 ° C. in the presence of 10% CO2. Reading the results consists in counting the colonies formed from the non-lysed bacteria.
• the titer is defined as the inverse of the last dilution of the serum inducing the lysis of 50% of the bacteria initially introduced.
• Tbp2-100% serum 577
• Tbp2-80% 580
• Tbp2-50% 583
• a nonsense protein of Escherichia coli control serum 582
• M982 and B16B6 are cultivated in the absence or in the presence of a chelating agent.
• the membrane is incubated with a different hyperimmune sera to be examined (diluted in blocking buffer: dilutions ranging from 1/500 to 1/10000) for ih at 37 ° C.
• the membrane is then washed twice in blocking buffer with strong stirring then, in order to reveal the first serum, it is again incubated with a goat anti rabbit IgG serum coupled with peroxidase (Zymed) diluted to 1/1000 in buffer blocking.
• the peroxidase substrate used is a chemiluminescent substrate (Kit ECL, Amersham) used according to the manufacturer's recommendations.
• the M982 strain is cultivated in an iron depleted medium. Five ml of the culture in the exponential phase (approximately 1.10 ° germs / ml) are centrifuged at
• the suspension is lysed by sonication (Branson-Sonifer 450 device, probe 3 mm in diameter) for 2 min. Lysis is continued by adding
• Triton XI 00 at 1% final and incubation 30 min in ice.
• the suspension is centrifuged at 8000 g to remove the non-lysed bacteria. then the supernatant is centrifuged for 30 min at 10,000 g to obtain the external membranes in the form of a pellet.
• the pellet is taken up in Tris-HCI 125 mM. pH 8.0. then dosed in proteins by a micromethod (Kit Micro-BCA. Pierce) used according to the manufacturer's recommendations.
• Electrophoresis is carried out on polyacrylamide gel in the presence of SDS according to the Laemmli method (Laemli. 1970).
• the separator gel contains 12.5% acrylamide and the concentration gel contains 5%.
• the samples to be analyzed are diluted to half in sample buffer (0.125 M Tris buffer at pH 6.8; 25% glycerol; 2.5% 2-Mercaptoethanol: 0.001% Bromophenol blue) and hydrolyzed at 100 ° C .
• sample buffer 0.125 M Tris buffer at pH 6.8; 25% glycerol; 2.5% 2-Mercaptoethanol: 0.001% Bromophenol blue
• Fifty ⁇ g of protein is deposited for a large gel and 1 ⁇ g for Phast gels (Pharmacia, crosslinking 12.5%).
• the migration is carried out at a constant voltage 50 V for gels of 15x12 cm
• the proteins are transferred onto a nitrocellulose membrane (Schleicher &Schull; 0.45 ⁇ m) according to the Towbin method (Towbin et al., 1979).
• the transfer takes place under constant amperage (1 mAJcxxfi) for 90 min for a large gel and 1 hour for a Phast gel.
• the effectiveness of the transfer is revealed by staining with Ponceau red (Kodak).
• the nitrocellulose is washed in blocking buffer (Tris-HCl 0.5 M pH 7.5; 1% skimmed milk; 150 mM NaCl) for 1 hour at room temperature.
• Tbp2 protein of the M982 strain is specifically recognized by the anti-Tbp2 100%), anti-Tbp2 80% and anti-Tbp2 50% sera. No other N. meningitidis protein is recognized by these sera.
• the anti-protein serum of E. coli does not recognize the Tbp2 of the N. meningitidis M982 strain.
• a first filter is revealed with human transferrin coupled to peroxidase (TGH) and makes it possible to define a titer for fixing the TFH:
• the third is revealed with a serum directed against a whole recombinant Tbp2 M982 protein (100%);
• the fourth is revealed with a serum directed against a recombinant Tbp2 M982 protein deleted from the hypervariable portion of the "hinge” region (80%);
• the fifth is revealed with a serum directed against a recombinant Tbp2 M982 protein corresponding to the 50% N-terminal region.
• the titles are defined as the inverse of the last dilution for which a coloration is visible.
• Example 1 A preparation of RTH 8680 as obtained in Example 1 is used as an immunogen in order to prepare an antiserum according to the protocol described in Example 8B. 10B. Culture of strains
• N. meningitidis strains 92/04. M871. 504/91, 8680, 8726, BZ83, 44, 52 and 8710 strains from the meningococcal reference laboratory: Dr. Caugant, WHO-collaborationg center for reference and research on meningococci, NIPH. Oslo, Norway; and part of electrophoretic group ET5 (B. Mohamed-Rokbi, Thesis presented on October 10, 1995, in front of Claude Bernard University. Lyon, France for obtaining the Doctorate degree) as well as the strains M982 and B16B6 are cultivated as described in Example 1 A.
• the bactericidal activity of the antiserum prepared in 10A is tested against the strains cultivated in 10B according to the protocol described in Example 8C.
• the bactericidal titers obtained against the strains of the electrophoretic group ET5 highlight a cross bactericidal activity.
• Those obtained at against the strains B16B6 and M982 on the other hand testify to an absence of cross bactericidal disease.
• ATTTGTTAAA AATAAATAAA ATAATAATCC TTATCATTCT TTAATTGAAT TGGGTTTAT 59
• AGC GAC GAT CAA AAA GTT GCC GTT GTC GGC
• AGC GCG AAA ACC AAA GAC 1163 Ser Asp Asp Gin Lys Val Ala Val Val Gly Ser Ala Lys Thr Lys Asp 335 340 345
• AAC AGT AGT CAA GCT GAT GCT AAA ACG GAA CAA GTT GAA CAA AGT ATG 1691 Asn Ser Ser Gin Ala Asp Ala Lys Thr Glu Gin Val Glu Gin Ser Met 510 515 520
• AAA AGC CAG CCT GAA AGC CAA CAG GAT GTA TCG GAA AAC AGC GGC GCG 192 Lys Ser Gin Pro Glu Ser Gin Gin Asp Val Ser Glu Asn Ser Gly Ala 30 35 40
• GAG GGC AAT AAG GCG GCA TTT CAG CAC GAG ATT GAG CAA AAC GGC GTG 1248 Glu Gly Asn Lys Ala Ala Phe Gin His Glu Ile Glu Gin Asn Gly Val 385 390 395

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Medicinal Chemistry (AREA)
• Communicable Diseases (AREA)
• General Chemical & Material Sciences (AREA)
• Biophysics (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biochemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Oncology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Genetics & Genomics (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=9483560

Family Applications (1)

Country Status (7)

Families Citing this family (14)

Family Cites Families (3)

• 1995
  • 1995-10-10 FR FR9512106A patent/FR2739624B1/fr not_active Expired - Fee Related
• 1996
  • 1996-10-10 CA CA002207302A patent/CA2207302A1/en not_active Abandoned
  • 1996-10-10 WO PCT/FR1996/001580 patent/WO1997013860A1/fr not_active Application Discontinuation
  • 1996-10-10 HU HU9801714A patent/HUP9801714A3/hu unknown
  • 1996-10-10 EP EP96933511A patent/EP0796332A1/fr not_active Withdrawn
  • 1996-10-10 JP JP9514773A patent/JPH11500630A/ja active Pending
• 1997
  • 1997-05-21 NO NO972314A patent/NO972314L/no not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events