EP0238329A2 - Sondes génétiques - Google Patents

Sondes génétiques Download PDF

Info

Publication number
EP0238329A2
EP0238329A2 EP87302344A EP87302344A EP0238329A2 EP 0238329 A2 EP0238329 A2 EP 0238329A2 EP 87302344 A EP87302344 A EP 87302344A EP 87302344 A EP87302344 A EP 87302344A EP 0238329 A2 EP0238329 A2 EP 0238329A2
Authority
EP
European Patent Office
Prior art keywords
locus
dna
minisatellite
region
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP87302344A
Other languages
German (de)
English (en)
Other versions
EP0238329A3 (en
EP0238329B1 (fr
Inventor
Alec John Jeffreys
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Syngenta Ltd
Original Assignee
Zeneca Ltd
Imperial Chemical Industries Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zeneca Ltd, Imperial Chemical Industries Ltd filed Critical Zeneca Ltd
Priority to AT8787302344T priority Critical patent/ATE105024T1/de
Publication of EP0238329A2 publication Critical patent/EP0238329A2/fr
Publication of EP0238329A3 publication Critical patent/EP0238329A3/en
Application granted granted Critical
Publication of EP0238329B1 publication Critical patent/EP0238329B1/fr
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • the present invention relates generally to polynucleotides and DNA and RNA probes, their preparation and their use in genetic characterisation. Such uses may include for example establishing human, animal or plant origin, and the polynucleotides and probes of the invention may thus find use for example in paternity disputes or forensic medicine or in the prevention, diagnosis and treatment of genetic disorders or predispositions.
  • the present invention is based upon the discovery that informative genetic loci may be identified in the genome by the use of multi-locus probes and that polynucleotides and polynucleotide probes may be prepared each of which is specific for a single such informative genetic locus.
  • hypervariable loci include minisatellites 5 ⁇ to the insulin gene (Bell, Selby and Rutter, 1982), 3 ⁇ to the c-Ha- ras l gene (Capon et al ., 1983), type II collagen gene (Stoker et al ., 1985) and between the 2 and ⁇ 1 globin genes (Goodbourn et al ., 1983) as well as the D14S1 locus defined by an anonymous DNA clone derived from the telomeric region of the long arm of chromosome 14 (Wyman and White, 1980; Balazs et al ., 1982; Wyman, Wolfe and Botstein, 1984).
  • minisatellites differ substantially in their variability, ranging from only 6 different alleles detected at the collagen hypervariable region (Sykes, Ogilvie and Wordsworth, 1985) to more than 80 at the D14S1 locus (Balazs et al ., 1986).
  • the total number of hypervariable loci in the human genome is unknown but is likely to be large. Indeed the human genome might contain at least 1500 hypervariable regions.
  • an informative genetic locus as one at which at least 3 different alleles can be distinguished in any sample of 100 randomly selected unrelated individuals. This is expressed herein by stating that the locus has an allelic variation of at least 3(100).
  • the sample of randomly selected unrelated individuals will be 500, more preferably 1000, and the ability to distinguish at least 3 different alleles in such samples is referred to herein as 3­(500) and 3(1000) respectively. It is essential that the sample of 100, 500 or 1000 randomly selected unrelated individuals is indeed selected at random as it will usually be possible to identify 100, 500 or 1000 individuals who have less than 3 alleles at a given informative genetic locus by screening a sufficiently large number of members of the total population.
  • informative genetic locus as used herein may alternatively be defined as one at which at least 3 different alleles can be distinguished in DNA extracted from any 20 cell lines selected from the following, which cell lines have been deposited with the American Type Culture Collection (ATCC):-
  • a method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having a degree of polymorphism of at least 3 comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus; and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having a degree of polymorphism of at least 3 (as hereinbefore defined).
  • the polynucleotide probe comprises, with the inclusion of a labelled or marker component, a polynucleotide comprising at least three tandem repeats (there being on average at least 70% homology between all tandemly repeated sequences) of sequences which are homologous with a minisatellite region of the genome to a degree enabling hybridisation of the probe to a corresponding DNA fragment obtained by fragmenting the sample DNA with a restriction endonuclease, wherein:
  • the said DNA fragment contains a minisatellite from a minisatellite region or hypervariable locus which region or locus is detectable by a polynucleotide probe comprising at least three tandem repeats of the sequence (including complementary sequences):- (A)AGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent) or the sequence (including complementary sequences):- AGAGGTGGGCAGGTGG 2 (wherein T is T or U).
  • a polynucleotide in isolated or cloned form which comprises a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a minisatellite from said minisatellite region or hypervariable locus, wherein: 1) said region or locus has an allelic variation (as herein defined) of at least 3(100) and 2) said region or locus is detectable by a polynucleotide probe comprising at least three tandem repeats of the sequence (including complementary sequences):- (A)AGGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent or the sequence (including complementary sequences):- AGAGGTGGGCAGGTGG 2
  • the present invention also relates to a corresponding polynucleotide in which the aforesaid region or locus has a degree of polymorphism of at least 3 as opposed to an allelic variation of at least 3.
  • polynucleotides of the present invention and polynucleotides prepared by the hereinbefore defined method of the invention are prepared by microbiological reproduction of cloned material or by direct synthesis.
  • the invention includes polynucleotides of DNA, RNA and of any other kind hybridisable to DNA.
  • the polynucleotides as defined above are unlabelled and can be in double stranded (ds) or single stranded (ss) form.
  • the invention includes labelled polynucleotides in ss-form for use as probes as well as their labelled ds-­precursors, from which ss-probes can be produced.
  • a polynucleotide probe which comprises a polynucleotide of the present invention as hereinbefore defined or a polynucleotide prepared by a method as hereinbefore defined having a labelled or marker component.
  • a polynucleotide probe which comprises a polynucleotide of the present invention as hereinbefore defined or a polynucleotide prepared by a method as hereinbefore defined having a labelled or marker component.
  • the nucleotide sequence of the polynucleotide will be in single stranded form, but preferably the probe will comprise the polynucleotide wholly in a single stranded form.
  • a method of preparing a polynucleotide probe as hereinbefore defined which comprises labelling or marking a polynucleotide of the present invention as hereinbefore defined or a polynucleotide prepared by a method of the present invention as hereinbefore defined.
  • the polynucleotide probes of the present invention are preferably 32 p -radiolabelled in any conventional way, but can alternatively be radiolabelled by other means well known in the hybridisation art for example to give 35S-­radiolabelled probes. They may also be labelled with biotin or a similar species by the method of D C Ward et al , as described in Proceedings of the 1981 ICN-UCLA Symposium on Developmental Biology using Purified Genes held in Keystone, Colorado on March 15-20, 1981 vol. XXIII 1981 pages 647-658 Academic Press; Editor Donald D Brown et al or even enzyme-­labelled by the method of A D B Malcolm et al , Abstracts of the 604th Biochemical Society Meeting, Cambridge, England (meeting of 1 July 1983).
  • a method of characterising a test sample of genomic DNA by reference to one or more controls which comprises fragmenting sample DNA with one or more restriction enzymes which do not cleave to any relevant extent a sequence corresponding to a tandem repeat, probing the DNA fragments with a polynucleotide or polynucleotide probe comprising a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment containing a minisatellite from said single minisatellite region or hypervariable locus, detecting hybridised fragments of DNA, and comparing the hybridised fragments with a said control or controls, wherein:
  • the present invention also relates to a corresponding method of characterising a test sample in which the aforesaid region or locus has a degree of polymorphism of at least 3 as opposed to an allelic variation of at least 3.
  • the method of the present invention is preferably effected by the use of a polynucleotide or a polynucleotide prefered by a method of the present invention or a polynucleotide probe of the invention as hereinbefore defined.
  • sample DNA is human DNA.
  • a region of human, animal or plant DNA at a recognised locus or site is said to be hypervariable if it occurs in many different forms e.g. as to length or sequence.
  • a region of human, animal or plant DNA which is comprised of tandem repeats of a short DNA sequence. All repeat units may not needily show perfect identity.
  • a gene or other segment of DNA which shows variability from individual to individual or between a given individuals paired chromosomes is said to be polymorphic.
  • the percentage homology is given by the number of base pairs in A less the number of base pair substitutions, additions or deletions in B which would be necessary in order to give A, expressed as a percentage.
  • the percentage homology between two sequences ATGC and AGC is 75%.
  • Nucleotide (nt) and base pair (bp) are used synonimously. Both can refer to DNA or RNA.
  • the abbreviations C, A, G, T refer conventionally to (deoxy)cytidine, (deoxy)adenosine, (deoxy)guanosine and either deoxythymidine or uridine. It will be appreciated however that the abbreviations A, C, G and T may include other base modified nucleosides capable of base pairing with one of the conventional nucleosides (deoxy)adenosine, (deoxy)cytidine, (deoxy)guanosine and either deoxythymidine or uridine. Such base modified nucleoside include (deoxy) inosine and (deoxy)8-azaguanosine.
  • the tandem repeats may be perfect repeats or imperfect repeats or a mixture of perfect and imperfect repeats. There are preferably at least three repeats and more preferably at least 7 repeats in the probe sequence.
  • probes of the invention which may be used singly or in combination with other locus specific probes either in a sequence of tests or in a single test using a mixture or cocktail of probes may be useful in the following areas:
  • polynucleotides of the invention and the polynucleotides prepared by the processes of the invention and polynucleotide probes of the present invention are capable of hybridising with fragments of DNA containing a minisatellite from a minisatellite region or hypervariable locus which is identifiable by a polynucleotide probe comprising of any one sequence selected from:- AGGAATAGAAAGGCGGGYGGTGTGGGCAGGGAGRGGC 3 GTGGAYAGG 4 TGGGAGGTGGRYAGTGTCTG 5 GAATGGAGCAGGYGRCCAGGGGTGACTCA 6 GGGCTGGGGAGATGGTGGAGGAGGTGTTGG 7 AGGCTGGGGAGATGGTGGAGGAAGTAC 8 TCTGTAATGGGTATAGGGAGGGCCCCGGGAAGGGGGTGTGGYX 9 (wherein Y is C, T or U, X is G or C, R is A or G and T is T or U) or tandem repeats thereof; or a sequence
  • polynucleotides of the invention polynucleotides prepared by the processes of the invention and probes of the present invention are capable of hybridising with fragments of DNA containing a minisatellite from a single specific minisatellite region or hypervariable locus and are thus locus specific.
  • the polynucleotides and probes of the present invention will be locus specific under high stringency hybridization conditions.
  • locus specific is used herein in relation to a polynucleotide or probe to mean that the polynucleotide or probe may be used under hybridization conditions which ensure that the polynucleotide or probe hybridises to only a single specific locus.
  • locus specific probes of the present invention when used at reduced hybridisation stringencies may be capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus and may thus be used to identify other informative genetic loci.
  • a method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100) which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe as hereinbefore defined and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus on the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100); the method being effected under hybridisation conditions effective to render the probe capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus.
  • a polynucleotide in isolated or cloned form, which comprises a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a minisatellite from said minisatellite region or hypervariable locus, wherein:-
  • the invention also relates to corresponding method and to a corresponding polynucleotide in which the said region or locus has a degree of polymorphism of at least 3.
  • the invention further relates to probes comprising such locus specific polynucleotides and to a method of characterising a test sample of DNA using such polynucleotides and polynucleotide probes.
  • the locus specific polynucleotides and probes of the present invention may be homologous with the minisatellite of the minisatellite containing DNA fragment or less preferably with a sequence flanking the minisatellite.
  • polynucleotides and probes of the present invention comprise tandem repeats of a particular sequence such sequence will in general be repeated at least 3 times and such repeats need not necessarily be exact repeats. Repeats which are not exact are described elsewhere as imperfect repeats. Such repeats will nevertheless be recognisably repeated. In general this will mean that there is on average at least 70% homology between all repeating units. Preferably there is at least 80%, more preferably at least 85%, especially 90% homology between all repeating units. It will be appreciated however that the nucleotide sequence or "repeat unit" need not be repeated at all if desired.
  • n is advantageously at least 5, but preferably at least 10.
  • n is 10 to 40, but in principle n can be any number, even from 1 up to 10,000.
  • any flanking sequences are largely irrelevant. They can be omitted or can be present in any number of nucleotides, for example up to 50,000 although to work with such a long probe would not ordinarily be sensible. Such large polynucleotides may nevertheless serve as carriers from which smaller polynucleotides, especially useful as probes, may be excised. These flanking sequences may form part of either ds-DNA or ss-DNA, even when the repeat sequences are of ss-DNA.
  • polynucleotides and polynucleotide probes of the present invention comprise any one sequence selected from formulae 3 to 9 as hereinbefore defined or a sequence complementary thereto or tandem repeats thereof (there being on average at least 70% homology between all tandemly repeated sequences) or a sequence complementary thereto.
  • One preferred polynucleotide of the present invention thus comprises the sequence of formula 3 as hereinbefore defined or tandem repeats thereof or a sequence complementary thereto.
  • Such a nucleotide sequence is specific as to an autosomal locus located on chromosome 7.
  • Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as p ⁇ g3.
  • a further preferred polynucleotide of the present invention comprises the sequence of formula 4 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto.
  • Such a nucleotide sequence is specific as to a locus located on chromosome 1.
  • Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as ⁇ MS1.
  • a further preferred polynucleotide of the present invention comprises the sequence of formula 5 as hereinbefore defined or tandem repeat(s) thereof, or a sequence complementary thereto.
  • Such a nucleotide sequence is specific as to a locus located on chromosome 7.
  • Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as ⁇ MS31.
  • a further preferred polynucleotide of the present invention comprises the sequence of formula 6 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto.
  • Such a nucleotide sequence is specific as to a locus located on chromosome 1.
  • Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as ⁇ MS32.
  • a further preferred polynucleotide of the present invention comprises a sequence selected from formulae 7 and 8 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto.
  • Such a nucleotide sequence is specific as to a locus located on chromosome 5.
  • Polynucleotides and polynucleotide probes comprising such sequences are referred to herein as ⁇ MS8.
  • a further preferred polynucleotide of the present invention comprises the sequence of formula 9 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto.
  • Such a nucleotide sequence is specific as to a locus located on chromosome 12.
  • Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as ⁇ MS43.
  • a method of establishing the identity or otherwise of the test sample donor with one or more control sample donors in which the control sample(s) are similarly fragmented and a comparison is made of the hybridised fragments from the respective samples.
  • a method of establishing a family connection between the test sample donor and one or more control sample donors in which the control sample(s) are similarly fragmented and a comparison is made of the hybridised fragments from the respective samples.
  • the above-mentioned methods may be effected using the polynucleotides or probes of the present invention either singly or by using at least two polynucleotides or probes of the present invention either in a sequence of tests or in a single test using a mixture of the said polynucleotides or probes.
  • a method for the diagnosis of an inherited disease, abnormality or trait which comprises probing the test sample with at least one polynucleotide or polynucleotide probe as hereinbefore defined, said probe, being associated with a particular inherited disease, abnormality or trait.
  • the probes of the present invention which we have tested all serve as locus-specific probes under high stringency hybridization conditions.
  • the present invention enables informative genetic loci to be identified in the human genome and thereby enables locus specific probes to be prepared, each locus specific probe being specific as to a single informative genetic locus.
  • the degree of individual specificity of genotypes determined by locus-specific probes can be estimated from the heterozygosity H at each locus.
  • the mean allele frequency q at a locus is given by (1-H), and the probability that two randomly-selected individuals share the same genotype is q2(2-q).
  • This probability of false association of two individuals varies from 0.02 for ⁇ MS8 ot 0.0002 for ⁇ MS31, and is a conservative estimate in that heterogeneity in q will reduce these probabilities.
  • the cumulative probability of false association for all six minisatellite probes is ⁇ 10 ⁇ 16, comparable to the odds that two randomly-selected DNA fingerprints detected by one multilocus probe are identical (see British Patent Application No. 8525252).
  • locus-specific hypervariable probes should prove particularly useful in forensic medicine, as shown by the murder case analysed in Fig. 11C where insufficient DNA was recovered from two of the forensic samples for DNA fingerprint analysis. Semen DNA from both victims showed a common phenotype with probes ⁇ MS1 and ⁇ MS31 different from that of the suspect. From the above discussion, we can calculate the probability that victims X and Y had been sexually assaulted by different unrelated men at 2x10 ⁇ 7. Similarly, the chance that the two hypothetical assailants were first-degree relatives, for examples brothers, is 0.07. This provides strong evidence that X and Y were sexually assaulted by the same man, a conclusion which was subsequently confirmed by DNA fingerprint analysis of larger amounts of forensic material.
  • the Mendelian inheritance of the hypervariable DNA fragments also allows them to be used for establishing family relationships in for example paternity disputes.
  • the probability that a child's paternal allele is fortuitously present in a randomly-selected man can be estimated at 2q-q2.
  • the cumulative probability of false inclusion of a first degree relative of the true father, such as a brother is 0.02.
  • hypervariable locus-specific probes can provide a powerful method for establishing family relationships with the caveat that mutations to new length alleles at these unstable loci could occasionally lead to false exclusions.
  • the mutation rate at these hypervariable loci is not yet known.
  • locus-specificity and sensitivity of these locus-specific probes enable pooled probes to be used to generate multi-locus Southern blot patterns (Fig. 12). These "reconstituted DNA fingerprints" produced by 5 pooled probes are considerably less complex than their counterparts detected by multi-locus probes, and should be more amenable to being encoded digitally following densitometric scanning. Despite the high variability of the individual minisatellites, the pooled-probe profiles show a substantial (18%) level of fragment sharing between unrelated North European individuals, mainly as a result of electrophoretic comigration of minisatellite fragments from different loci.
  • This Example describes the isolation and properties of a specified minisatellite fragment in a DNA fingerprint.
  • DNA was isolated from white blood cells as described by Jeffreys A J et al , (1985) Nature 316, 76-79 and from an Epstein Barr virus transformed lymphoblastoid cell line (see Nilsson, K et al (1971) Int. J. Cancer 8, 443-450) derived from individual III 9 of the HPFH pedigree described by Jeffreys et al ., Am. J. Hum. Genet. 39 , 11-24. Restriction digestion and Southern plot hybridizations were performed as described elsewhere in the above-mentioned references of Jeffreys A J et al . Double-stranded DNA probe fragments were isolated by electrophoresis onto DE81 paper as described by Dretzen, G et al (1981) Anal. Biochem.
  • p ⁇ g3 DNA was sonicated, size-selected and shotgun cloned into the Sma I site of M13mp19 [see Yanis-Perron C et al (1985) Gene 33, 103-119].
  • 12 random clones were sequenced by the dideoxynucleotide chain-­termination method [see Sanger, F et al (1977) Proc. Nat. Acad. Sci. USA 74, 5463-5467 and Biggin M D et al (1983) Proc. Natl. Acad. Sci. USA 80, 3963-3965].
  • M13 clones containing the 5 ⁇ and 3 ⁇ flanking regions were detected by hybridization with 32 p -labelled flanking probes a and b (see Fig. 1 described below) and sequenced to establish the flanking region sequence and the beginning and end points of the minisatellite.
  • Fig 1 illustrates this purification by gel electrophoresis.
  • DNA from individual III9 in the pedigree described by Jeffreys et al was digested with Sau 3A and 6-9 kb fragments collected by preparative gel electrophoresis (fraction 1). These fragments were re-electrophoresed to give fractions 2-5. Aliquots of III9 DNA digested with Sau 3A and of each fraction were electrophoresed through a 0.8% agarose gel and Southern blot hybridized with the minisatellite probe 33.15. Fragment g (8.2 kb), which tends to cosegregate with HPFH, is approximately 1000-fold purified in fraction 3.
  • the fragment 'g', detected in the Sau 3A digest referred to above, and purified as described to produce an approximately 1000 fold enriched fragment 'g' fraction was cloned into ⁇ L47.1 as described in the above-mentioned Loenen and Brammar reference, and propagated on P2 lysogenic rec + E . coli to select for recombinant phage.
  • the resulting library was screened by hybridisation to probe 33.15.
  • the four positive plaques obtained were very samall (plaques ⁇ 0.1 mm diameter) but could be replated at a low efficiency 0-8 pfu/plaque) on rec B, rec C E . coli to produce normal-sized plaques (1mm diameter).
  • the structure of the minisatellite fragment in p ⁇ g3 was determined by restriction mapping (Fig. 1B) and DNA sequencing (Fig. 2).
  • Fig. 1B shows the organization of DNA fragment g.
  • the Sau 3A insert in p ⁇ g3 was mapped with restriction endonuclease Alu I (A), Dde I (D), Hae III (H) Mbo II (M), Pst I (P) and Sau 3A (S). There are no cleavage sites for Hin fI or Rsa I.
  • the 7.14 kb insert contains 171 tandem repeats of a 37 bp sequence (see Fig. 2) plus 747 bp flanking DNA.
  • the 5 ⁇ flanking region contains the beginning of an inverted Alu element (hatched). The origins of unique sequence flanking probes a and b are shown.
  • Fig 2 shows the DNA sequence of hypervariable fragment g.
  • the sequence of the 5 ⁇ and 3 ⁇ flanking regions and the beginning and end of the minisatellite is shown together with the repeat sequences of three random regions (a-c) from the minisatellite.
  • the beginning of the inverted Alu element is shown in underlined uppercase, and several simple sequence regions in the 5 ⁇ flanking region are underlined.
  • the consensus sequence (con) of the 37 bp minisatellite repeat unit is shown, and differences from this consensus are given for individual repeat units.
  • the second repeat unit in region c contains a Hae III cleavage site (underlined), and this region therefore spans the internal Hae III site in the minisatellite (Fig. 1B).
  • the consensus repeat sequence is also shown aligned with the "core" sequence in a similar manner to that in British Paent Publication No. 2,166,445.
  • the clone p ⁇ g3 contains a 6.3 kb minisatellite devoid of restriction sites, except for a single internal Hae III site.
  • the minisatellite is comprised of 171 repeats of a 37 bp unit which contains the sequence GTGGGCAGG; this sequence corresponds precisely to the most invariant part of the 11-16bp core sequence previously identified as being shared by several different human minisatellites (see British Patent Publication No. 2,166,445 and Fig 2 herein).
  • the repeat units are not completely homogeneous; sequence analysis of several randomly-selected regions from within the minisatellite revealed a limited amount of repeat sequence variation.
  • variants including a 4 bp deletion which produces a subset of 33 bp repeat units, are diffused over more than one repeat unit.
  • One variant (an A ⁇ C transversion in region C) creates the unique internal Hae III site and is therefore probably only found in one repeat unit. The beginning and end repeat units of the minisatellite are noticeably more diverged in sequence than are internal repeats.
  • the minisatellite in p ⁇ g3 is flanked by non-­repeated DNA containing the normal density of restriction sites (Fig. 1B).
  • the beginning of the 5 ⁇ flanking region is comprised of the head of an inverted Alu element.
  • the remaining 5 ⁇ and 3 ⁇ flanking regions, defined by hybridization probes a and b are unique sequence DNA and hybridize only to this locus in the total DNA (data) not shown).
  • the 5 ⁇ flanking region contains a considerable amount of simple sequence DNA [polypurine and (ACC) n ] (Fig 2).
  • Minisatellite fragment g detects a single polymorphic locus
  • the Sau 3A insert from p ⁇ g3 was hybridized in the presence of human competitor DNA to human DNA digested with Hin fI, the restriction enzyme routinely used for DNA fingerprinting (Fig 3).
  • Figure 3 shows the Mendelian inheritance of polymorphic DNA fragments detected by p ⁇ g3.
  • 8 ⁇ g samples of human DNA were digested with Hin fI and electrophoresed through a 0.8% agarose gel.
  • Digests were Southern blot hybridized with the Sau 3A insert of p ⁇ g3, in 1 x SSC at 65° in the presence of 6% polyethylene glycol and 50 ⁇ g/ml alkali-­sheared human placental competitor DNA, and washed after hybridization in 0.2 x SSC at 65°.
  • p ⁇ g3 detects a single locus which is heterozygous in all individuals shown. Inheritance of alleles (indicated by letters) is Mendelian.
  • DNA fragments detected by p ⁇ g3 at high stringencies segregate in a Mendelian fashion as alleles of a single locus (Fig. 3).
  • Fig 4 shows the distribution of minisatellite allele sizes. The length of the minisatellite in the shortest common allele was determined by genomic mapping of this fragment in a homozygote, using flanking single-copy probes a and b (Fig 1) (data not shown).
  • At least 77 different alleles could be resolved in this population sample, with repeat numbers ranging from 14 to ⁇ 525 per allele.
  • the homozygotes in the population sample were all homozygous for the shortest allele. The above estimates of number of alleles and the mean frequency of rare alleles are limited by gel resolution, and the true number of different length alleles in this sample may be greater.
  • fragment g demonstrates that the large and highly polymorphic DNA fragments in DNA fingerprinting are in principle amenable to molecular cloning to provide locus-specific probes suitable for studying individual hypervariable regions. While fragment g could be cloned in bacteriophage ⁇ , the resulting clones showed abnormal growth properties on rec + E . coli . This will lead to a depletion of minisatellite clones from conventional amplified human libraries in phage. The cloned minisatellite is unstable both in and on subcloning into pUC13 in recA E . coli ; the final recombinant p ⁇ g3 had lost about 30 repeat units compared with fragment g. The physical map of p ⁇ g3 (Fig 1) does not therefore completely reflect the organization of fragment g.
  • the cloned DNA fragment has the structure expected for a minisatellite, establishing that fragment g is not derived from a longer satellite DNA. Despite the presence both of a "core" sequence in each repeat unit and part of an Alu sequence in the 5 ⁇ flanking region, the cloned fragment g acts, in the presence of competitor human DNA, as a locus-­specific probe.
  • the failure of p ⁇ g3 to detect efficiently other core-containing minisatellites is due to the additional non-core DNA present in each repeat unit which probably interferes with cross-hybridization to other minisatellites (see British Patent Publication No. 2,166,445).
  • the cloned minisatellite shows extreme length polymorphism, presumably due to allelic variation both in the number of repeat units and in the ratio of 37 and 33 bp repeat types in each allele.
  • This locus is much more polymorphic than most or all of the cloned human hypervariable regions so far characterized including the selection of relatively short cloned minisatellites initially used to define the "core" sequence [see British Patent Publication No. 2,166,445].
  • the heterozygosity at this locus is at least 96.6%, with most homozygotes arising from the short common allele.
  • New alleles at this locus are generated by alteration in the repeat number, either by slippage during DNA replication or by unequal exchange driven by the "core" sequence, a putative recombination signal.
  • the parameter 4N e v ( ⁇ ) where N e is the effective population size and v is the mutation rate per gamete to a new length allele, can be most accurately estimated from the number of different alleles scored in a population sample, using the infinite allele model [see Ewens W J (1972) Theor. Popul. Biol. 3, 87-112].
  • the mutation rate v to new length alleles at this locus is approximately 0.002 per gamete. This value of v is an underestimate, since the number of alleles detected is limited by gel resolution and since there is not an infinite number of potential resolvable alleles.
  • the average length of minisatellite DNA at this locus is 5kb, and thus the mutation (recombination) rate per kb minisatellite is >4 x 10 ⁇ 4, compared with 10 ⁇ 4 per kb estimated for other shorter core-containing minisatellites and a mean meiotic recombination rate of 10 ⁇ 5 per kb for human DNA [see Jeffreys, A J et al (1985) Nature 314, 67-73].
  • the rate of generation of new portions at this minisatellite locus is remarkably high, consistent with the inventor's previous suggestions that these core-rich regions may be recombination hotspots.
  • the mutation rate is relatively low for short alleles, which might explain how the shortest allele has drifted to achieve a significant frequency in the population without being disrupted by unequal exchange during this process.
  • DNA fingerprints have proved a powerful method for individual identification and for establishing family relationships in for example paternity and immigration disputes.
  • the accuracy of this method is determined by the low mean probability x that a band is shared by two randomly-selected individuals.
  • x has been estimated empirically at 0.2 for DNA fingerprint Hin cI fragments larger than 4 kb.
  • band sharing between individuals that is, where a band in one individual is matched in a second individual by a band of similar mobility and autoradiographic intensity
  • DNA fingerprint probes 33.6 and 33.15 it is possible to score the segration of up to 34 dispersed autosomal loci in large human sibships. For most loci examined, only one of the two alleles is scorable in the set of larger (>4 kb) resolved DNA fingerprint fragments, suggesting that large size differences exist between minisatellite alleles, with many alleles being located in the poorly resolved ( ⁇ 4 kb) region of the DNA fingerprint.
  • Minisatellite probes 33.6 and 33.15 detect together about 60 hypervariable loci, many of which should now be amenable to cloning to provide a bank of highly informative single locus probes, for example ideal for linkage studies in man.
  • Linkage analysis of inherited disorders is also possible in single large families using the entire DNA fingerprint. If a polymorphic fragment is detected which appears to cosegregate with the disease, it is essential that this fragment be cloned to provide a locus-specific probe for extending the linkage analysis to additional affected families.
  • Recombinant phage DNA was digested with Sau 3A and the large insert fragment separated from small vector fragments by electrophoresis in low gelling temperature agarose (Sea Plaque).
  • the gel slice containing the insert was dissolved in 3 vol water at 65° and aliquots containing 10 ng insert DNA were labelled with 32 p by random oligonucleotide priming [Feinberg and Vogelstein, (1984) Anal. Biochem. 137 , 266-267.
  • Genomic DNA samples were restricted and electrophoresed as described by Jeffreys et al (1986) Am. J. Hum. Genet. 39 , 11-24. DNA was transferred to Hybond-N (Amersham), fixed by u/v irradiation and prehybridized at 65° for 5 min in 0.5M sodium phosphate, 7% SDS, 1mM EDTA (pH7.2) [Church and Gilbert, (1984), Proc. Natl. Acad. Sci. USA 81 , 1991-1995.
  • Filters were hybridized overnight with 0.5 ⁇ g/ml 32 p -labelled probe DNA (specified activity ⁇ 109 cpm/ug DNA) in the presence of 25 ⁇ g/ml sheared single-­stranded human placental DNA competitor. After hybridization, filters were washed at 65° in 40 mM sodium phosphate, 1% SDS (pH7.2) followed by a high stringency wash at 65° in 0.1 x SSC (15 mM NaCl, 1.5 mM trisodium citrate pH7.0) 0.01% SDS. Filters were autoradiographed from 3 hr to 1 week at -80° in the presence of an intensifier screen.
  • Each MS recombinant DNA was sonicated and 0.3 -­0.6 kb fragments size-selected and shotgun cloned into the Sma I site of M13mp19 [Yanis-Perron, Vieira and Messing, (1985), Gene 33 , 103-119].
  • Recombinant phage were screened by plaque hybridization with 32 p -labelled MS insert DNA. 10 strongly-positive single-stranded phage DNAs from a given MS recombinant were compared pairwise by the C-test [Winter and Fields, (1980) Nucleic Acids Res.
  • each ⁇ MS recombinant could act as a locus-specific probe for a hypervariable minisatellite
  • the Sau 3A insert of each recombinant was hybridized in the presence of human competitor DNA to Hin fI digests of three randomly selected individuals, or to Alu I digests for ⁇ MS32, the minisatellite tandem repeat units of which contain a Hin fI site (Fig 5). 8 out of 10 of the recombinants hybridized to one or two large variable DNA fragments in each human DNA tested.
  • Four of the recombinants detected by probe 33.6 ( ⁇ MS8, 40, 42 and 47) hybridized to the same pattern of variable DNA fragments and are therefore derived from the same hypervariable locus (Fig 5 Table 1).
  • Figure 5 shows an Example of the screening of ⁇ MS recombinants for locus-specific hypervariable DNA probes.
  • 2 ⁇ g samples of DNA from three unrelated individuals were digested with Hin fI, eletrophoresed through a 0.8% agarose gel and Southern blot hybridized with 32 p -labelled Sau 3A inserts from p ⁇ g3 (Example 1), ⁇ MS8 and ⁇ MS40 as herein described in Materials and Methods. Filters were washed after hybridization in 0.1 x SSC at 65°, and autoradiographed in the presence of an intensifier screen for 1 day (left panel) or 1 week (right panel). Note that ⁇ MS8 and ⁇ MS40 detect the same hypervariable locus, and that on prolonged autoradiography, additional variable DNA fragments are detectable.
  • ⁇ MS1, 31, 32 and 43 were derived from different loci which did not include the previously characterised p ⁇ g3 locus (see Example 1 and Fig 5). Although none of these ⁇ MS recombinants produced DNA 'fingerprints' of multiple variable fragments, most ⁇ MS probes were seen to cross-hybridize weakly to additional polymorphic DNA fragments on prolonged autoradiographic exposure (Fig. 5).
  • the minisatellite in MS8 consists of two mutually-interspersed repeat units 29 and 30 bp long.
  • the consensus repeat sequence of p ⁇ g3 is also shown in Fig 2.
  • Each repeat sequence is aligned with the core sequence, with matches shown in uppercase, and a new core sequence derived from a comparison of the core with p ⁇ g3, ⁇ MS31 and ⁇ MS32 is also disclosed.
  • minisatellite in ⁇ MS8 consists of an intermingled array of two closely-related but distinct repeat units 29 and 30 bp long (Fig 6). The end-points of the minisatellites in the ⁇ MS recombinants have not yet been determined.
  • tandem-repetitive minisatellite consisting mainly of a tandem-repetitive minisatellite.
  • the tandem-repeat units of p ⁇ g3, ⁇ MS1, ⁇ MS31 and ⁇ MS32 each contain the core sequence, as expected (Fig 6).
  • the copies of the core sequence are imperfect, and comparisons of the repeat units of these minisatellites do not clearly define a new core sequence preferentially associated with these large and extremely variable loci. It seems likely instead that a wide range of core derivatives may be associated with large minisatellites.
  • minisatellites ⁇ MS8 and ⁇ MS43 detected by probe 33.6 which consists of tandem repeats of a diverged version of the core sequence (see British Patent Publication No.
  • Figure 7 shows the Mendelian inheritance of the hypervariable locus detected by ⁇ MS32.
  • 1 ⁇ g DNA samples from CEPH family 1413 were digested with Alu I and Southern blot hybridised to the 32 p -labelled Sau 3A insert from ⁇ MS31. This family is completely informative at this locus.
  • Figure 8 provides an estimation of allelic variability at the hypervariable locus detected by MS43. 1 ⁇ g samples of DNA from twenty random-selected English people were digested with Hin fI and Southern blot hybridized to ⁇ MS43. All individuals are heterozygous, indicating that the level of heterozygosity at this hypervariable locus is high (H > 0.86, p > 0.95). A more accurate estimate of heterozygosity may be made by comparing alleles in each individual with alleles in the six nearest neighbours on the autoradiograph to estimate the levels of allele sharing between individuals.
  • the larger allele in individual 5 appears to be present in 7, but not in 2, 3, 4, 6 and 8. Similarly, the smaller allele in 5 is not present in 2-4 or 6-8.
  • FIG. 9 shows an analysis of allelic length variation at hypervariable loci in pools of human DNA. 10 ⁇ g samples of DNA from a single individual (a), from a pool of 15 individuals (b) and from a pool of 150 people (c) were digested with Alu I (for ⁇ MS32) or Hin fI (for all remaining probes) and Southern blot hybridized with the indicated locus-specific hypervariable probes. All individuals were randomly-selected North Europeans. Individual a was included within pool b, and all pool b individuals were included in pool c. It should be noted that ⁇ MS43 detects a second variable region represented by the short Hin fI alleles marked 0; this region has not been further characterised.
  • ⁇ MS8 For the least variable locus, ⁇ MS8, there are two predominant alleles 5.3 and 7.2 kb long plus 7 lower frequency alleles resolvable in the pool of 15 people. That the two predominant alleles are not the result of sampling error in these 15 individuals is shown by their similar prevalence in the pool of 150 individuals, together with a larger spectrum of low frequency alleles. Similarly, ⁇ MS43 (94% heterozygosity) shows 7 major alleles shared by the 15- and 150-individual pools, together with many minor alleles.
  • at least 50 different ⁇ ­MS32 alleles can be resolved in the pool of 150 individuals; this will be a minimal estimate of the total number of alleles limited by gel electrophoretic resolution.
  • loci detected are extremely variable and indeed are amongst the most polymorphic loci so far isolated from human DNA.
  • Figure 10 shows the segregation of the hypervariable locus detected by ⁇ MS32 in a panel of human-­rodent somatic cell hybrid DNAs digested with Alu I. This locus cosegregates with human chromosome 1 (see Table 2 below). Interestingly, the hybrid cell line MOG 2C2 carried two alleles of both ⁇ MS32 and ⁇ MS1 (data not shown). This strongly suggests that both parental copies of human chromosome 1 have been retained in this hybrid, and, since all other positive hybrids contained only a single allele at each of these loci, this provides strong supporting evidence for synteny of ⁇ MS1 and ⁇ MS32. Hybrid F4SC13c112 contains chromosome 1p but is negative for ⁇ MS32; thus ⁇ MS32 is provisionally localised to chromosome 1q. The following code is used in Figure 10:
  • Table 2 shows the chromosome assignment of hypervariable loci in human-rodent somatic cell hybrids.
  • each locus-specific hypervariable probe is given, together with the fraction of unambigously informative cell hybrids which are concordant for the presence or absence of the intact chromosome and the hypervariable locus.
  • all chromosomes except one were multiply excluded by this analysis.
  • the cloned minisatellites so far localized tend to be derived from the larger human autosomes (Table 1), as expected if they are dispersed randomly over the human genome. In the absence of precise regional localization, it remains possible that these minisatellites are preferentially located at centromeres and telomeres, which are rich in simple sequence satellite DNA. However, segregation analysis of DNA fingerprint fragments in recombinant inbred strains of mice has shown that murine minisatellites are not preferentially associated with centromeres or telomeres, and it is likely that their human counterparts are similarly dispersed.
  • the tandem repetitive minisatellite probes which have been tested are very sensitive, presumably as a result of the repetitive nature of both the hybridization probe and the target minisatellite DNA.
  • the Southern blot autoradiographic signal obtained after overnight hybridization is saturated at probe DNA concentrations of >0.1 ng/ml (data not shown), and signals can be readily obtained from 60 ng or less of human genomic DNA (see Fig 11A).
  • these probes can detect an admixture of 2% or less of one individual's DNA with another (see Fig 11B).
  • Fig 11C shows an analysis of semen stains from two victims who had been sexually assaulted and destroyed, where the recovery of DNA from the second victim was insufficient for conventional DNA fingerprint analysis which requires at least 0.5 ⁇ g DNA per test (see UK Patent Publication No. 2,166,445).
  • Figure 11 shows an assessment of the sensitivity of locus specific probes and their application to the forensic analysis of a double rape/murder case.
  • Figure 11A decreasing amounts of human DNA digested with Hin fI were Southern blot hybridized with 32 p -labelled insert DNA from MS1. Filters were autoradiographed in the presence of an intensifier screen for 1 week.
  • Figure 11B decreasing amounts of individual A DNA were mixed with 4 ⁇ g individual B DNA in the indicated ratios, and Southern blot hybridized, with ⁇ MS1 as in Fig 11A.
  • victims X and Y had been sexually assaulted and destroyed. A suspect Z had been charged with the murder of Y, and forensic evidence further suggested that both X and Y had been destroyed by the same individual.
  • DNA from the following forensic specimens was isolated and analysed: a, hair from X taken two days post-mortem; b, a mixture of semen and vaginal fluid recovered from the pubic hair of X; c, fresh blood from suspect Z; d, cardiac blood taken one day post-mortem from Y; e, vaginal swab from Y bearing semen, blood and vaginal material; F, a stain from Y's skirt bearing semen and blood. Samples a and b had been stored dry at 4° for 3 years, samples d and e at 4° for 2 months and sample f stored dry at 4° for 2 months.
  • DNA was extracted following the procedures of Gill, Jeffreys and Werrett (1985) Nature 318 , 577-579, digested with Hin fI and Southern blot hybridized to 32 p -­labelled ⁇ MS1 insert. 0.8 ⁇ g DNA was analysed in each sample, except for sample e (0.1 ⁇ g DNA) and f (0.04 ⁇ g DNA). Autoradiography was for one week in the presence of an intensifier screen. Note that the semen stains b, e and f each contain two hybridizing DNA fragments which are not attributable to the victim. In addition, sample b contains the victim's alleles derived from vaginal DNA. The semen alleles in b, e and f are indistinguishable, suggesting that victims X and Y had indeed been sexually assaulted by the same man. The alleles of suspect Z do not match those of the semen stains.
  • the multilocus Southern blot patterns are highly individual-specific with only 18% (S.D. ⁇ 11%) of DNA fragments shared between pairs of randomly-selected North Europeans (40 pairs tested). For sibs, the level of fragment sharing rises as expected to -57% (10 sib pairs tested).
  • each offspring contains 3.4 ⁇ 0.5 (S.D.) DNA fragments which are specifically of paternal origin, and an equal number of maternal-specific DNA fragments (10 father/mother/child trios tested).
  • Figure 12 shows the detection of multiple hypervariable loci in human DNA by hybridisation with pooled minisatellite probes.
  • 4 ⁇ g DNA samples from a random selection of English people (1-6), from sib pairs (7, 8 and 9, 10) and from father/child/mother family groups (11, 12, 13 and 14, 15, 16) were digested with Hin fI and electrophoresed a 0.8% agarose gel until all fragments less than 2 kb had electrophoresed off the gel.
  • the digests were Southern blot hybridized with 2 ng of insert DNA from each p ⁇ g3, ⁇ MS1, ⁇ MS8, ⁇ MS31 and ⁇ MS43; inserts were pooled prior to labelling with 32 p by random oligonucleotide priming. Variations in band labelling intensity presumably arise from variability in the efficiency of labelling and hybridization of individual probes.
EP87302344A 1986-03-19 1987-03-18 Sondes génétiques Expired - Lifetime EP0238329B1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AT8787302344T ATE105024T1 (de) 1986-03-19 1987-03-18 Genetische sonden.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB8606719 1986-03-19
GB868606719A GB8606719D0 (en) 1986-03-19 1986-03-19 Genetic probes

Publications (3)

Publication Number Publication Date
EP0238329A2 true EP0238329A2 (fr) 1987-09-23
EP0238329A3 EP0238329A3 (en) 1988-11-30
EP0238329B1 EP0238329B1 (fr) 1994-04-27

Family

ID=10594846

Family Applications (1)

Application Number Title Priority Date Filing Date
EP87302344A Expired - Lifetime EP0238329B1 (fr) 1986-03-19 1987-03-18 Sondes génétiques

Country Status (22)

Country Link
US (1) US5175082A (fr)
EP (1) EP0238329B1 (fr)
JP (2) JPH0630636B2 (fr)
KR (1) KR870009024A (fr)
CN (1) CN87102927A (fr)
AT (1) ATE105024T1 (fr)
AU (2) AU604686B2 (fr)
DE (1) DE3789679T2 (fr)
DK (1) DK140287A (fr)
FI (1) FI871189A (fr)
GB (2) GB8606719D0 (fr)
HU (1) HUT44800A (fr)
IE (1) IE59859B1 (fr)
IL (1) IL81936A0 (fr)
IN (1) IN168721B (fr)
NO (1) NO871122L (fr)
NZ (1) NZ219685A (fr)
PL (1) PL264696A1 (fr)
PT (1) PT84502B (fr)
RU (1) RU1788970C (fr)
YU (1) YU47887A (fr)
ZA (1) ZA871993B (fr)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0264305A2 (fr) * 1986-08-19 1988-04-20 Gilbert Vassart Sonde d'hybridation pour la détection de séquences nucléotidiques polymorphes
EP0294098A1 (fr) * 1987-05-29 1988-12-07 City Of Hope Sondes d'ADN synthétiques
EP0298656A1 (fr) * 1987-07-10 1989-01-11 Stephen Thomas Reeders Sondes polynucléotides
WO1989001979A1 (fr) * 1987-09-04 1989-03-09 Isis Innovation Limited Sonde d'adn
WO1989007658A1 (fr) * 1988-02-18 1989-08-24 University Of Utah Identification genetique avec des adn d'investigation ayant des sites repetitifs en tandem en quantite variable
EP0337625A2 (fr) * 1988-04-13 1989-10-18 Imperial Chemical Industries Plc Sondes
WO1990002818A1 (fr) * 1988-09-08 1990-03-22 Lifecodes Corporation Sondes pour la detection de polymorphisme de restriction dans des genomes eucaryotiques
GB2224573A (en) * 1988-10-20 1990-05-09 Ici Plc Polynucleotide probes
EP0370719A2 (fr) * 1988-11-25 1990-05-30 Imperial Chemical Industries Plc Des séquences nucléotidiques élongées
EP0390518A2 (fr) * 1989-03-30 1990-10-03 Lifecodes Corporation Compositions et procédés applicables à l'étude du dosage génétique
WO1992013968A1 (fr) * 1991-02-07 1992-08-20 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Sondes hypervaribles a specificite monolocus
ES2056028A1 (es) * 1993-02-18 1994-09-16 Inia Procedimiento para la seleccion de oligonucleotidos para la amplificacion especifica de genomas altamente variables.
US5556955A (en) * 1991-08-22 1996-09-17 Etat Francais Represente Par Le Delegue General Pour A'armement Process for detection of new polymorphic loci in a DNA sequence, nucleotide sequences forming hybridization probes and their applications
US5582979A (en) * 1989-04-21 1996-12-10 Marshfield Clinic Length polymorphisms in (dC-dA)n.(dG-dT)n sequences and method of using the same
WO1999066070A1 (fr) * 1998-06-18 1999-12-23 Tomaras Constantine Biometrie adn utilisee aux fins d'identification
WO2000077251A2 (fr) * 1999-06-11 2000-12-21 Astrazeneca Uk Limited Dosages biologiques

Families Citing this family (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IS1355B6 (is) * 1984-11-12 1989-04-19 Lister Institute Of Preventive Medicine Fjölkjarna kannar
GB8606719D0 (en) * 1986-03-19 1986-04-23 Lister Preventive Med Genetic probes
US4987066A (en) * 1986-11-07 1991-01-22 Max Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for the detection of restriction fragment length polymorphisms in eukaryotic genomes
IT1230152B (it) * 1988-06-10 1991-10-14 Ici Plc Sequenze di nucleotidi.
US5853989A (en) * 1991-08-27 1998-12-29 Zeneca Limited Method of characterisation of genomic DNA
DE69230736T2 (de) * 1991-08-27 2000-06-21 Zeneca Ltd Verfahren zur Charakterisierung genomischer DNA
US5629147A (en) * 1992-07-17 1997-05-13 Aprogenex, Inc. Enriching and identifying fetal cells in maternal blood for in situ hybridization
EP0726905B1 (fr) * 1993-11-03 2005-03-23 Orchid BioSciences, Inc. Polymorphismes de mononucleotide et leur utilisation en analyse genetique
CA2182517C (fr) * 1994-02-07 2001-08-21 Theo Nikiforov Extension d'amorces ligase/polymerase-a mediation de polymorphismes de mononucleotides et son utilisation dans des analyses genetiques
US5871918A (en) * 1996-06-20 1999-02-16 The University Of North Carolina At Chapel Hill Electrochemical detection of nucleic acid hybridization
US6479235B1 (en) 1994-09-30 2002-11-12 Promega Corporation Multiplex amplification of short tandem repeat loci
US7008771B1 (en) 1994-09-30 2006-03-07 Promega Corporation Multiplex amplification of short tandem repeat loci
US5753439A (en) * 1995-05-19 1998-05-19 Trustees Of Boston University Nucleic acid detection methods
US6132971A (en) * 1995-06-27 2000-10-17 The University Of North Carolina At Chapel Hill Microelectronic device
US6346387B1 (en) 1995-06-27 2002-02-12 Xanthon, Inc. Detection of binding reactions using labels detected by mediated catalytic electrochemistry
US6180346B1 (en) 1995-06-27 2001-01-30 The Universtiy Of North Carolina At Chapel Hill Electropolymerizable film, and method of making and use thereof
US6361951B1 (en) 1995-06-27 2002-03-26 The University Of North Carolina At Chapel Hill Electrochemical detection of nucleic acid hybridization
US6127127A (en) * 1995-06-27 2000-10-03 The University Of North Carolina At Chapel Hill Monolayer and electrode for detecting a label-bearing target and method of use thereof
US5968745A (en) * 1995-06-27 1999-10-19 The University Of North Carolina At Chapel Hill Polymer-electrodes for detecting nucleic acid hybridization and method of use thereof
US6387625B1 (en) 1995-06-27 2002-05-14 The University Of North Carolina At Chapel Hill Monolayer and electrode for detecting a label-bearing target and method of use thereof
US5871697A (en) 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US6418382B2 (en) 1995-10-24 2002-07-09 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5972693A (en) * 1995-10-24 1999-10-26 Curagen Corporation Apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5888736A (en) * 1995-12-22 1999-03-30 Visible Genetics, Inc. Method, compositions and kit for detection and identification of microorganisms
US6413718B1 (en) 1996-05-01 2002-07-02 Visible Genetics Inc. Method for sequencing of nucleic acid polymers
CA2286864A1 (fr) * 1997-01-10 1998-07-16 Pioneer Hi-Bred International, Inc. Amplification et analyse genetiques sur la base d'une hybridation
US7138511B1 (en) 1997-01-28 2006-11-21 The Regents Of The University Of California Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6171788B1 (en) 1997-01-28 2001-01-09 The Regents Of The University Of California Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6475724B1 (en) * 1997-01-28 2002-11-05 The Regents Of The University Of California Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US5919626A (en) 1997-06-06 1999-07-06 Orchid Bio Computer, Inc. Attachment of unmodified nucleic acids to silanized solid phase surfaces
US6544730B1 (en) 1997-10-27 2003-04-08 Prescott Deininger High density polymorphic genetic locus
US6238863B1 (en) 1998-02-04 2001-05-29 Promega Corporation Materials and methods for indentifying and analyzing intermediate tandem repeat DNA markers
US20030207295A1 (en) * 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
US20060275782A1 (en) 1999-04-20 2006-12-07 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
AU5495600A (en) * 1999-06-17 2001-01-09 Fred Hutchinson Cancer Research Center Oligonucleotide arrays for high resolution hla typing
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7611869B2 (en) 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
EP1950305A1 (fr) 2001-05-09 2008-07-30 Monsanto Technology, LLC Gènes tyr et utilisations associées
US20030129607A1 (en) * 2001-05-25 2003-07-10 Invitrogen Corporation Compositions and methods for extension of nucleic acids
US20030119000A1 (en) * 2001-11-05 2003-06-26 Jon Polansky Methods to screen and treat individuals with glaucoma or the propensity to develop glaucoma
US7222059B2 (en) * 2001-11-15 2007-05-22 Siemens Medical Solutions Diagnostics Electrophoretic trace simulator
US20040175704A1 (en) 2003-03-06 2004-09-09 Stratagene Compositions and methods for polynucleotide sequence detection
US7300755B1 (en) * 2003-05-12 2007-11-27 Fred Hutchinson Cancer Research Center Methods for haplotyping genomic DNA
US20050239889A1 (en) * 2004-04-26 2005-10-27 Jean Gosselin In vivo release of endogenous anti-microbial mediators by leukotriene B4 (LTB4) administration
US8163480B2 (en) * 2006-10-05 2012-04-24 Quest Diagnostics Investments Incorporated Nucleic acid size detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2166445A (en) 1984-11-12 1986-05-08 Lister Preventive Med Polynucleotide probes
EP0201184A2 (fr) 1985-03-28 1986-11-12 F. Hoffmann-La Roche Ag Procédé pour l'amplification des séquences d'acide nucléique

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE53862T1 (de) * 1982-01-22 1990-06-15 Cetus Corp Verfahren zur charakterisierung von hla und die darin benutzten cdns-testmittel.
DK105582A (da) * 1982-03-11 1983-09-12 Nordisk Insulinlab Fremgangsmaade til bestemmelse af humane hla-d(r) vaevstyper og gensonde til brug ved fremgangsmaaden
IL71064A (en) * 1983-02-28 1989-10-31 Lifecodes Corp Paternity and forensic test involving analysis of dna polymorphic genetic regions
US4683194A (en) * 1984-05-29 1987-07-28 Cetus Corporation Method for detection of polymorphic restriction sites and nucleic acid sequences
US4801531A (en) * 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
EP0229782B1 (fr) * 1985-06-14 1992-11-04 Bristol-Myers Squibb Company Procedes d'identification d'alleles associes a un risque accru de diabete
GB8606719D0 (en) * 1986-03-19 1986-04-23 Lister Preventive Med Genetic probes
WO1989007658A1 (fr) * 1988-02-18 1989-08-24 University Of Utah Identification genetique avec des adn d'investigation ayant des sites repetitifs en tandem en quantite variable

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2166445A (en) 1984-11-12 1986-05-08 Lister Preventive Med Polynucleotide probes
EP0201184A2 (fr) 1985-03-28 1986-11-12 F. Hoffmann-La Roche Ag Procédé pour l'amplification des séquences d'acide nucléique

Non-Patent Citations (36)

* Cited by examiner, † Cited by third party
Title
1977, SCIENCE, vol. 194, pages 161 - 169
A D B MALCOLM ET AL., ABSTRACTS OF THE 604TH BIOCHEMICAL SOCIETY MEETING, 1 July 1983 (1983-07-01)
AM. J. HUM. GENET., vol. 39, 1986, pages 11 - 24
BELL, G I ET AL., NATURE, vol. 295, 1982, pages 31 - 35
BIGGIN M D ET AL., PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 3963 - 3965
BIGGIN; GIBSON; HONG, PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 3963 - 3965
BLATTNER ET AL., SCIENCE, vol. 194, 1977, pages 161 - 169
CHURCH; GILBERT, PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1991 - 1995
D C WARD ET AL.: "Proceedings of the 1981 ICN-UCLA Symposium on Developmental Biology using Purified Genes held in Keystone, Colorado on March 15-20, 1981", vol. XXIII, 1981, ACADEMIC PRESS, pages: 647 - 658
DRETZEN, G ET AL., ANAL. BIOCHEM., vol. 112, 1981, pages 295 - 298
EWENS W J, THEOR. POPUL. BIOL., vol. 3, 1972, pages 87 - 112
FEINBERG, A P ET AL., ANAL. BIOCHEM, vol. 137, 1984, pages 266 - 267
FEINBERG; VOGELSTEIN, ANAL. BIOCHEM., vol. 137, 1984, pages 266 - 267
GILL; JEFFREYS; WERRETT, NATURE, vol. 318, 1985, pages 577 - 579
JEFFREYS A J ET AL., NATURE, vol. 316, 1985, pages 76 - 79
JEFFREYS ET AL., AM. J. HUM. GENET., vol. 39, 1986, pages 11 - 24
JEFFREYS ET AL., AM. J. HUM. GENET., vol. 39, pages 11 - 24
JEFFREYS ET AL., NATURE, vol. 314, 1985, pages 67 - 73
JEFFREYS, A J ET AL., J MOL. BIOL., vol. 156, 1982, pages 487 - 503
JEFFREYS, A J ET AL., NATURE, vol. 314, 1985, pages 67 - 73
LEBO, R V ET AL., PROC. NAT. ACAD. SCI. USA, vol. 80, 1983, pages 4804 - 4812
LEONEN; BRAMMAR: "A bacteriophage lambda vector for cloning large DNA fragments made with several restriction enzymes", GENE, vol. 20, 1980, pages 249 - 259
LOENEN, W A M; BRANMAR, W J, GENE, vol. 20, 1980, pages 249 - 259
LOENEN; BRAMMAR, GENE, vol. 20, 1980, pages 249 - 259
MATFIELD, M, PH.D. THESIS, 1983
NICHOLLS ET AL., NUCLEIC ACIDS RES., vol. 13, 1985, pages 7569 - 7578
NILSSON, K ET AL., INT. J. CANCER, vol. 8, 1971, pages 443 - 450
SANGER, F ET AL., PROC. NAT. ACAD. SCI. USA, vol. 74, 1977, pages 5463 - 5467
SANGER; NICKLEN; COULSON, PROC. NATL. ACAD. SCI. USA, vol. 74, 1977, pages 5463 - 5467
VIEIRA J; MESSING J, GENE, vol. 19, 1982, pages 259 - 268
VIEIRA, J; MESSING J, GENE, vol. 19, 1982, pages 259 - 268
WINTER; FIELDS, NUCLEIC ACIDS RES., vol. 8, 1980, pages 1965 - 1974
WYMAN ET AL., NATH. ACAD. SCI. USA, vol. 77, 1985, pages 6754 - 6758
YANG, R C A ET AL., METH. ENZYMOL, vol. 68, 1979, pages 176 - 182
YANIS-PERRON C ET AL., GENE, vol. 33, 1985, pages 103 - 119
YANIS-PERRON; VIEIRA; MESSING, GENE, vol. 33, 1985, pages 103 - 119

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0264305A2 (fr) * 1986-08-19 1988-04-20 Gilbert Vassart Sonde d'hybridation pour la détection de séquences nucléotidiques polymorphes
EP0264305A3 (fr) * 1986-08-19 1989-03-22 Gilbert Vassart Sonde d'hybridation pour la détection de séquences nucléotidiques polymorphes
EP0294098A1 (fr) * 1987-05-29 1988-12-07 City Of Hope Sondes d'ADN synthétiques
EP0298656A1 (fr) * 1987-07-10 1989-01-11 Stephen Thomas Reeders Sondes polynucléotides
WO1989001979A1 (fr) * 1987-09-04 1989-03-09 Isis Innovation Limited Sonde d'adn
WO1989007658A1 (fr) * 1988-02-18 1989-08-24 University Of Utah Identification genetique avec des adn d'investigation ayant des sites repetitifs en tandem en quantite variable
EP0337625A2 (fr) * 1988-04-13 1989-10-18 Imperial Chemical Industries Plc Sondes
EP0337625A3 (fr) * 1988-04-13 1991-07-24 Imperial Chemical Industries Plc Sondes
WO1990002818A1 (fr) * 1988-09-08 1990-03-22 Lifecodes Corporation Sondes pour la detection de polymorphisme de restriction dans des genomes eucaryotiques
AU630888B2 (en) * 1988-09-08 1992-11-12 Lifecodes Corporation Probes for the detection of rflp in eucaryotic genomes
GB2224573A (en) * 1988-10-20 1990-05-09 Ici Plc Polynucleotide probes
GB2224573B (en) * 1988-10-20 1993-05-12 Ici Plc A method for the assessment of sample dna fragmentation and polynucleotide probes therefor
EP0370719A2 (fr) * 1988-11-25 1990-05-30 Imperial Chemical Industries Plc Des séquences nucléotidiques élongées
FR2639651A1 (fr) * 1988-11-25 1990-06-01 Ici Plc Procede de caracterisation d'un echantillon analytique d'adn genomique par extension de sequences de nucleotides, et kits de diagnostic pour la mise en oeuvre de ce procede
EP0370719A3 (fr) * 1988-11-25 1991-10-09 Imperial Chemical Industries Plc Des séquences nucléotidiques élongées
EP0390518A3 (fr) * 1989-03-30 1991-07-24 Lifecodes Corporation Compositions et procédés applicables à l'étude du dosage génétique
EP0390518A2 (fr) * 1989-03-30 1990-10-03 Lifecodes Corporation Compositions et procédés applicables à l'étude du dosage génétique
US5582979A (en) * 1989-04-21 1996-12-10 Marshfield Clinic Length polymorphisms in (dC-dA)n.(dG-dT)n sequences and method of using the same
WO1992013968A1 (fr) * 1991-02-07 1992-08-20 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Sondes hypervaribles a specificite monolocus
US5556955A (en) * 1991-08-22 1996-09-17 Etat Francais Represente Par Le Delegue General Pour A'armement Process for detection of new polymorphic loci in a DNA sequence, nucleotide sequences forming hybridization probes and their applications
ES2056028A1 (es) * 1993-02-18 1994-09-16 Inia Procedimiento para la seleccion de oligonucleotidos para la amplificacion especifica de genomas altamente variables.
WO1999066070A1 (fr) * 1998-06-18 1999-12-23 Tomaras Constantine Biometrie adn utilisee aux fins d'identification
WO2000077251A2 (fr) * 1999-06-11 2000-12-21 Astrazeneca Uk Limited Dosages biologiques
WO2000077251A3 (fr) * 1999-06-11 2001-05-25 Astrazeneca Uk Ltd Dosages biologiques

Also Published As

Publication number Publication date
CN87102927A (zh) 1988-04-27
GB8706401D0 (en) 1987-04-23
IE870713L (en) 1987-09-19
EP0238329A3 (en) 1988-11-30
IL81936A0 (en) 1987-10-20
DK140287A (da) 1987-09-20
DE3789679D1 (de) 1994-06-01
ATE105024T1 (de) 1994-05-15
US5175082A (en) 1992-12-29
JPH05276948A (ja) 1993-10-26
PT84502A (en) 1987-04-01
DE3789679T2 (de) 1994-08-25
NZ219685A (en) 1990-02-26
NO871122L (no) 1987-09-21
PL264696A1 (en) 1988-06-23
AU604686B2 (en) 1991-01-03
RU1788970C (ru) 1993-01-15
IN168721B (fr) 1991-05-25
GB2188323A (en) 1987-09-30
YU47887A (en) 1991-02-28
PT84502B (pt) 1989-11-10
JPH0630636B2 (ja) 1994-04-27
FI871189A (fi) 1987-09-20
JPS62282600A (ja) 1987-12-08
GB2188323B (en) 1990-06-06
AU7738887A (en) 1988-01-07
AU7070187A (en) 1988-01-07
EP0238329B1 (fr) 1994-04-27
NO871122D0 (no) 1987-03-18
DK140287D0 (da) 1987-03-18
HUT44800A (en) 1988-04-28
KR870009024A (ko) 1987-10-22
IE59859B1 (en) 1994-04-20
ZA871993B (en) 1987-12-30
FI871189A0 (fi) 1987-03-18
GB8606719D0 (en) 1986-04-23

Similar Documents

Publication Publication Date Title
EP0238329B1 (fr) Sondes génétiques
Wong et al. Characterization of a panel of highly variable minisatellites cloned from human DNA
AU581582B2 (en) Dna probes to fingerprint genomes at hypervariable or minisatellite regions
ES2393318T3 (es) Estrategias para la identificación y detección de alto rendimiento de polimorfismos
USH2220H1 (en) Identification and mapping of single nucleotide polymorphisms in the human genome
US20040181048A1 (en) Identification and mapping of single nucleotide polymorphisms in the human genome
AU637768B2 (en) Genetic identification employing dna probes of variable number tandem repeat loci
JPH06507309A (ja) ウシ科動物における多形性dnaマーカー
Bahary et al. The Zon laboratory guide to positional cloning in zebrafish
Monnat Jr et al. Molecular structure and genetic stability of human hypoxanthine phosphoribosyltransferase (HPRT) gene duplications
EP0570371B1 (fr) Procede de cartographie genomique par identification directe d'haplotypes par l'analyse de sequences d'introns
JP2008526253A (ja) ウシにおける牛乳産生増大のためのdnaマーカー
EP0342717A2 (fr) Sondes polynucléotides
US6383747B1 (en) Method for determining ancestral haplotypes using haplospecific geometric elements within the major histocompatibility complex multigene cluster
US5084566A (en) DNA probe which reveals a hypervariable region on human chromosone 1
Robic et al. Construction of a high-resolution RH map of the human 2q35 region on TNG panel and comparison with a physical map of the porcine homologous region 15q25
EP0221633A1 (fr) Caractérisation génétique utilisant les polymorphismes de restriction-longueur de fragment
EP0660877B1 (fr) Analyse genetique
WO1993017104A1 (fr) Sequence adn du gene de dystrophie myotonique et ses utilisations
US20040058334A1 (en) Novel method for genetic linkage analysis by mitotic recombination
US7105353B2 (en) Methods of identifying individuals for inclusion in drug studies
Everts et al. Isolation of DNA markers informative in purebred dog families by genomic representational difference analysis (gRDA)
Dolf DNA Fingerprinting: Approaches and Applications
Whatley et al. The cell, molecular biology and the new genetics
AU2873192A (en) Genetic analysis

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE ES FR GB GR IT LI LU NL SE

PUAL Search report despatched

Free format text: ORIGINAL CODE: 0009013

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE CH DE ES FR GB GR IT LI LU NL SE

17P Request for examination filed

Effective date: 19890508

17Q First examination report despatched

Effective date: 19911015

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ZENECA LIMITED

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH DE ES FR GR IT LI LU NL SE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRE;WARNING: LAPSES OF ITALIAN PATENTS WITH EFFECTIVE DATE BEFORE 2007 MAY HAVE OCCURRED AT ANY TIME BEFORE 2007. THE CORRECT EFFECTIVE DATE MAY BE DIFFERENT FROM THE ONE RECORDED.SCRIBED TIME-LIMIT

Effective date: 19940427

Ref country code: LI

Effective date: 19940427

Ref country code: CH

Effective date: 19940427

Ref country code: BE

Effective date: 19940427

Ref country code: AT

Effective date: 19940427

Ref country code: NL

Effective date: 19940427

Ref country code: FR

Effective date: 19940427

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 19940427

Ref country code: SE

Free format text: THE PATENT HAS BEEN ANNULLED BY A DECISION OF A NATIONAL AUTHORITY

Effective date: 19940427

REF Corresponds to:

Ref document number: 105024

Country of ref document: AT

Date of ref document: 19940515

Kind code of ref document: T

REF Corresponds to:

Ref document number: 3789679

Country of ref document: DE

Date of ref document: 19940601

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 19940807

EN Fr: translation not filed
NLV1 Nl: lapsed or annulled due to failure to fulfill the requirements of art. 29p and 29m of the patents act
PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 19950331

26N No opposition filed
PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20030430

Year of fee payment: 17

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20041001