IE59859B1 - Improvements in genetic probes - Google Patents

Abstract

Test samples of genomic DNA may be characterized by the use of polynucleotide probes each of which is specific for an informative genetic locus. Such probes may be prepared by the use of probes which are capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus. The polynucleotides and probes of the invention are of use for genetic identification purposes, paternity and maternity testing and particularly in forensic medicine.

Description

The present Invention relates generally to polynucleotides and DNA and RNA probes, their preparation and their use in genetic characterisation. Such uses may include for example establishing human, animal or plant origin, and che polynucleotides and probes of the Invention may thus find use for example in paternity disputes or forensic medicine or in the prevention, diagnosis and treatment of genetic disorders or predispositions.

In Patent Specification No. there are described various DNA sequences which may be used as probes to hybridize Individually at a number of polymorphic sites within the human and animal genomes enabling the production of a fingerprint** composed of marked bands of differing molecular weights. The fingerprint as a whole is characteristic of the individual concerned and the origin of the differing bands can be traced through the ancestry of che individual and can in certain cases be postulated as associated with certain genetic disorders.

The present Invention is based upon the discovery that informative genetic loci may be identified in the genome by the use of multi-locus probes and that polynucleotides and polynucleotide probes may be prepared each of which is specific for a single such informative genetic locus.

Hitherto, only, a limited number of hypervariable loci have been discovered in human DNA; these Include mlnisatelllces 5* to the insulin gene (Bell, Selby and Rutter, 1982), 3' to the c-Ha-rasl gene (Capon et al., 1983), type II collagen gene (Stoker et al.. 1985) and between the ζ2 and kijl globin genes (Goodboutn et al., 1983) as well as the D14S1 locus defined by an anonymous DNA clone derived from the telomeric region of the long arm of chromosome 14 (Wyman and White, 1980; Balazs et al., 1982; Wyman, Wolfe and Botstein, 1984). These minisatellites differ substantially in their variability, ranging from only 6 different alleles detected at the collagen hypervariable region (Sykes, Ogilvie and Wordsworth, 1985) to more than 80 at the D14S1 locus (Balazs et al., 1986). The total number of hypervariable loci in the human genome is unknown but is likely to be large. Indeed the human genome might contain at least 1500 hypervariable regions.

It has been found that it is possible to clone a DNA fragment Identified by hybridisation of fragments of genomic DNA with a polynucleotide probe capable of differentiating DNA by reference to more than one polymorphic .minisatellite region or hypervariable locus, for example the probes 33.6 and 33,15 described and claimed in the Patent Specification No. and to prepare therefrom a polynucleotide or probe capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus on the genome, said region or locus being an Informative genetic locus. In this specification we define an informative genetic locus as one at which at least 3 different alleles can be distinguished in any sample of 100 randomly selected unrelated individuals. This is expressed herein by stating that the locus has an allelic variation of at least 3(100). Preferably the sample of randomly selected unrelated individuals will be 500, more preferably 1000, and the ability to distinguish at least 3 different alleles in such samples is referred to herein as 3 (500) and 3(1000) respectively. It is essential that the sample of 100, 500 or 1000 randomly selected unrelated individuals is indeed selected at random as lt will usually be possible to identify 100, 500 or 1000 individuals who have less chan 3 alleles at a given informative genetic locus by screening a sufficiently large number of members of the total population. f The higher is this polymorphism at a given Informative genetic locus, the more useful and informative V will be the locus specific probe in genetic characterisation for example in individual identification for paternity or forensic evaluation.

It will be appreciated in this regard that the term individual has been used above to refer not only to humans, but also to other animals as well as to plants and to cell lines derived from such humans, animals and plants. In each case, however the sample of randomly selected unrelated individuals will all be from the same species.

In respect of the human applications of the present invention the expression informative genetic locus as used herein may alternatively be defined as one at which -at least 3 different alleles can be distinguished in DNA extracted from any 2C cell lines selected from those listed below.

This is expressed herein by stating that the locus has a degree of polymorphism of at least 3. The cell lines referred to above, have been deposited with the American Type Culture Collection (ATCC), and are as follows:- Cell line ATCC Deposit No Hela CCL2 RPMI 2650 CCL 30 Detroit 532 CCL 54 Detroit 525 CCL 65 Detroit 529 CCL 66 Detroit 510 CCL 72 HI-38 CCL 75 Citrullinemia CCL 76 Cell line ATCC Deposit Ho EB-3 CCL 85 RAJI CCL 83 JIYOYE (P-2003) CCL 87 5 MI-26 CCL 95 Detroit 551 CCL 110 RPMI 6666 CCL 113 RPMI 7666 CCL 114 CCRF-CEM CCL 119 10 CCRF-SB CCL 120 HT—1080 CCL 121 HG 261 CCL 122 CHP3 (M.W.) CCL 132 LL47 (MaDo) CCL 135 15 HEL 299 CCL 137 LL 24 CCL 151 HFLI CCL 153 HI-1003 CCL 154 MRC-5 CCL 171 20 IMR-90 CCL 1C6 LS 174T CCL 138 LL 86(LeSa) CCL 190 LL 97A (AIMy) CCL 191 HLF-a CCL 199 25 CCD-13Lu CCL 200 CCD-8Lu CCL 201 CCD-llLu CCL 202 CCD—14Br CCL 203 CCD—16Lu CCL 204 30 CCD-18Lu CCL 205 CCD-19LU CCL 210 Cell line ATCC Deposit No. Hs888Lu CCL 21 MRC-9 CCL 212 Daudi CCL 213 CCD-25Lu CCL 215 SWA 03 CCL 230 NAMALWA CRL 1432 All the above-mentioned cell lines are freely available from the ATCC, 12301 Parklawn Drive, Rockville, Maryland 20852—1776, USA and are listed in the ATCC catalogue of Cell Lines and Hybridomas. All the above-mentioned cell lines were on deposit with the ATCC prior to 1985.

Thus according to one feature of the present invention there is provided a method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as is hereinbefore defined) of at least 3(100), which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus; and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as hereinbefore defined) of at least 3(100). * According to a further feature of the present invention there is provided a method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular < 5 χ· ΙΟ region or locus in the genome, said region or locus being of human origin and having a degree of polymorphism of at least 3 (as hereinbefore defined), which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic mlnisatelllte region or hypervariable locus; and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which ls specific as to a particular region or locus in the genome, said region or locus having a degree of polymorphism of at least 3 (as hereinbefore defined).

Preferably the polynucleotide probe comprises, with the Inclusion of a labelled or marker component, a polynucleotide comprising at least three tandem repeats (there being on average at least 702 homology between all tandemly repeated sequences) of sequences which are homologous with a minisatellite region of the genome to a degree enabling hybridisation of the probe to a corresponding DNA fragment obtained by fragmenting the sample DNA with a restriction endonuclease, wherein: a) the repeats each contain a core which ls at least 702 homologous with a consensus core region of similar length present in a plurality of minisatellites from different genomic loci; b) the core is from 6 to 16 nucleotides long; c) the total number of nucleotides within the repeating unit which do not contribute to the core ls not more than 15.

Advantageously the said DNA fragment contains a mlnisatelllte from a mlnisatelllte region or hypervariable locus which region or locus is detectable by a polynucleotide probe comprising at least three tandem repeats of the sequence (including complementary sequences):— (A)AGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent) or the sequence (including complementary sequences):— AGAGGTGGGCAGGTGG 2 (wherein T is T or ϋ).

According to a further feature of the present invention there is provided a polynucleotide in isolated or cloned form, which comprises a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a minisatellite from said minisatellite region or hypervariable locus, wherein: 1) said region or locus has an allelic variation (as herein defined) of at least 3(100) and 2) said region or locus is detectable by a polynucleotide probe comprising at least three tandem repeats of the sequence (including complementary sequences):— (A)AGGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent) or the sequence (including complementary sequences):— AGAGGTGGGCAGGTGG (wherein T is T or U).

The present invention also relates to a corresponding polynucleotide in which the aforesaid region or locus is of human origin and has a degree of polymorphism of at least 3 as opposed to an allelic variation of at least 3.

According to further features of the present Invention the polynucleotides of the present invention and polynucleotides prepared by the hereinbefore defined method of the invention are prepared by microbiological reproduction of cloned material or by direct synthesis.

The invention includes polynucleotides of DNA, RNA and of any other kind hybridisable to DNA. The polynucleotides as defined above are unlabelled and can be in double stranded (ds) or single stranded (ss) form.

The invention includes labelled polynucleotides in ss-form for use as probes as well as their labelled dsprecursors, from which ss-probes can be produced.

Thus according to a further feature of the present invention there is provided a polynucleotide probe which comprises a polynucleotide of the present invention as hereinbefore defined or a polynucleotide prepared by a method as hereinbefore defined having a labelled or marker component. Generally at least the nucleotide sequence of the polynucleotide will be in single stranded form, but preferably the probe will comprise the polynucleotide wholly in single stranded form.

According to a further feature of the present invention there is provided a method of preparing a polynucleotide probe as hereinbefore defined which comprises labelling or marking a polynucleotide of the present invention as hereinbefore defined or a polynucleotide prepared by a method of the present Invention as hereinbefore defined.

The polynucleotide probes of the present invention are preferably ^P-radiolabelled in any conventional way, but can alternatively be radiolabelled by other means well known 0 in the hybridisation art for example to give 35s— radiolabelled probes. They may also be labelled with biotin / or a similar species by the method of D C Ward et al, as described in Proceedings of the 1981 ICN—UCLA Symposium on * Developmental Biology using Purified Genes held in Keystone, Colorado on March 15-20, 1981 vol. XXIII 1981 pages 647-658 Academic Press; Editor Donald D Brown et al or even enzymelabelled by the method of A D B Malcolm et al. Abstracts of the 604th Biochemical Society Meeting, Cambridge, England (meeting of 1 July 1933).

According to a further feature of the present invention there is provided a method of characterising a test sample of genomic DNA by reference to one or more controls which comprises fragmenting sample DNA with one or more restriction enzymes which do not cleave to any relevant extent a sequence corresponding to a tandem repeat, probing the DNA fragments with a polynucleotide or polynucleotide probe comprising a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment containing a mlnisatelllte from said single mlnisatelllte region or hypervariable locus, detecting hybridised fragments of DNA, and comparing the hybridised fragments with a said control or controls, wherein: 1) said mlnisatelllte region or hypervariable locus has an allelic variation of at least 3(100) and 2) said region or locus is detectable by a polynucleotide « $ 1 probe capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus.

The present invention also relates to a 5 corresponding method of characterising a test sample in which the aforesaid region or locus is of human origin and has a degree of polymorphism of at least 3 as opposed to an allelic variation of at least 3.

The method of the present invention is preferably 10 effected by'the use of a polynucleotide or a polynucleotide prefered by a method of the present invention or a polynucleotide probe of the invention as hereinbefore defined.

Preferably the sample DNA is human DNA.

In order to assist the reader the following the present specifIcation:Hypervariable A region of human, animal or plant DNA at a recognised locus or site is said be hypervariable if it occurs in many different forms e.g. as to length or sequence.

Mlnlsatelllte A region of human, animal or plant DNA which is comprised of tandem repeats of a short DNA sequence. All repeat units may not necesarlly show perfect identity. Polymorphic A gene or other segment of DNA which shows variability from individual to individual or between a given individuals paired chromosomes is said to be polymorphic.

Repeat or Tandem Repeat (Sequence) A polynucleotide sequence which is perfectly or Imperfectly repeated in series. In general a sequence which 2 ls said to be tandemly repeated will be repeated at least three times. z Imperfect Repeat (Sequence) A sequence which is not an exact repeat either as V to number or kind of nucleotides but recognisably a repeat of a consensus sequence.

Homology In comparing two repeat or tandem repeat sequences A and B, the percentage homology is given by the number of base pairs in A less the number of base pair substitutions, additions or deletions in B which would be necessary in order to give A, expressed as a percentage. Thus the percentage homology between two sequences ATGC and AGC is 752.

Consensus Core (Sequence) A sequence which can be identified as the closest match among a number of repeat sequences; usually among the repeat units of two or more different minisatellites.

Nucleotide (nt) and base pair (bp) are used synonimously. Both can refer to DNA or RNA. The abbreviations C, A, G, T refer conventionally to (deoxy)cytidine, (deoxy)adenosine, (deoxy)guanosine and either deoxythymidine or uridine. It will be appreciated however that the abbreviations A, C, G and T may include other base modified nucleosides capable of base pairing with one of the conventional nucleosides (deoxy)adenosine, (deoxy)cytidine, (deoxy)guanosine and either deoxythymidine or uridine. Such base modified nucleoside include (deoxy) inosine and (deoxy)8-azaguanosine.

Where the polynucleotide or polynucleotide probe of * the present invention comprises a tandemly repeated sequence, ΐ the tandem repeats may be perfect repeats or Imperfect 3 repeats or a mixture of perfect and imperfect repeats. There are preferably at least three repeats and more preferably at least 7 repeats in the probe sequence.

The probes of the invention which may be used singly or in combination with other locus specific probes either in a sequence of tests or in a single test using a mixture or cocktail of probes may be useful in the following areas: 1. Paternity and maternity testing in man. 2. Family group verification in e.g. immigration disputes and inheritance disputes. 3. Zygosity testing in twins. 4. Tests for inbreeding in man.

. General pedigree analysis in man. 6. Identification of loci associated with genetic disease in man, thereby enabling specific probes to be constructed to detect a genetic defect. 7. Forensic medicine, for example (a) fingerprinting semen samples from rape victims (b) fingerprinting blood, hair and semen samples from e.g. soiled clothing (c) identification of human remains. (4) characterisation of other forensic tissue samples e.g. skin. 8. Cell Chimaerism studies, e.g. following donor versus recipient cells after bone marrow * 30 4 transplantation. 9. Livestock breeding and pedigree f analysis/authentication. (This could include, for example, the routine control and checking of pure ? strains of animals, and checking pedigrees in the case of litigation involving e.g. race horses and dog breeding). Also to provide genetic markers which might show association with inherited traits of economic importance.

. Routine quality control of cultured animal or plant cell lines, checking for contamination of pure cell lines and for routine identification work. 11. Analysis of tumour cells and tumours for molecular abnormalities. 12. It is anticipated that the polynucleotides or probes derived therefrom have a potential use in plant breeding.

The locus specific probes of the present Invention are, however, particularly useful in forensic medicine as demonstrated in Example 3 hereinafter and at least the probe pAg3 may cosegregate with the heterocellular form of hereditary persistence of foetal haemoglobin. The probes also provide a powerful method for use in paternity testing and related utilities (see utilities 2 and 5 above) as well as in cell chimaerism studies.

Brief description of the drawings Figure IA shows gel electrophoretic purification of a specified hypervariable DNA fragment from a DNA * fingerprint, the fragment being designated therein as ΐ fragment g. Figure IB shows the organisation of DNA fragment g by means of a restriction map of cloned DNA; Figure 2 shows the DNA sequence of hypervariable fragment g, particularly highlighting the consensus repeat v sequence and its alignment w.ith the core sequence of Patent Specification No.

Figure 3 shows the Mendelian inheritance of polymorphic DNA fragments detected by pAg3; Figure 4 shows the distribution of minisatellite allele sizes detected by hybridisation to pj Figure 5 shows the screening of /.MS recombinants for locus specific hypervariable DNA probes; Figure 6 shows the consensus repeat sequence units of the^MS series of minisatellites and of the pAg3 minisatellite; Figure 7 shows the Mendelian inheritance of the hypervariable locus detected by the probe designated herein as AMS32; Figure S shows an estimation of the allelic variability at the hypervariable locus detected by the probe designated herein asAMS43; Figure 9 shows an analysis of allelic length variation at hypervariable loci in pools of human DNA; Figure 10 shows the segregation of the hypervariable locus detected by the probe designated herein as AMS32, in a panel of human-rodent somatic cell hybrid DNAs digested with Alu I; Figure 11 shows an assessment of the sensitivity of locus specific hypervariable probes and their application to the forensic analysis of a double rapeZmurder case; and " 30 Figure 12 shows the detection of multiple hypervariable loci in human DNA by hybridisation with pooled minisatellite probes of the present invention. β Advantageously the polynucleotides of the invention, and the polynucleotides prepared by the processes λ of the invention and polynucleotide probes of the present . invention.are capable of hybridising vith fragments of DNA % containing a minisatellite from a minisatellite region or hypervariable locus which is identifiable by a polynucleotide probe comprising of any one sequence selected from:— AGGAATAGAAAGGCGGGYGGTGTGGGCAGGGAGRGGC 3 GTGGAYAGG 4 TGGGAGGTGGRYAGTGTCTG 5 GAATGGAGCAGGYGRCCAGGGGTGACTCA 6 GGGCTGGGGAGATGGTGGAGGAGGTGTTGG 7 AGGCTGGGGAGATGGTGGAGGAAGAGTAC 8 TCTGTGTAATGGGTATAGGGAGGGCCCCGGGAAGGGGGTGTGGYX 9 (wherein Y is C, T or U, X is G or C, R is A or G and T is T or U) or tandem repeats thereof; or a sequence complementary thereto.

The polynucleotides of the invention, polynucleotides prepared by the processes of the Invention and probes of the present invention are capable of hybridising with fragments of DNA containing a minisatellite from a single specific minisatellite region or hypervariable * locus and are thus locus specific. In general the fi polynucleotides and probes of the present invention will be locus specific under high stringency hybridization conditions. In this regard the expression locus specific is used herein in relation to a polynucleotide or probe to mean that the polynucleotide or probe may be used under hybridization conditions which ensure that the polynucleotide or probe hybridises to only a single specific locus.

It will be appreciated, however, that the locus specific probes of the present invention when used at reduced hybridisation stringencies may be capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus and may thus be used to identify other informative genetic loci.

Thus according to a further feature of the present invention there is provided a method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100), which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe as hereinbefore defined and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus on the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100); the method being effected under hybridisation conditions effective to render the probe capable of differentiating DNA by reference to more than one polymorphic mlnlsatellite region or hypervariable locus.

According to a further feature of the present invention there is provided a polynucleotide, in isolated or 8 cloned form, which comprises a nucleotide sequence which is specific as to a single minisatellite region or hypervariable f locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding « DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a minisatellite from said minisatellite region or hypervariable locus, wherein:— 1) said region or locus has an allelic variation (as herein defined) of at least 3(100) and 2) said region or locus Is detectable by a locus specific polynucleotide probe as hereinbefore defined.

The invention also relates to a corresponding method and to a corresponding polynucleotide In which the said region or locus has a degree of polymorphism of at least 3.

The invention further relates to probes comprising such locus specific polynucleotides and to a method of characterising a test sample of DNA using such polynucleotides and polynucleotide probes.

The locus specific polynucleotides and probes of the present invention may be homologous with the minisatellite of the minisatellite containing DNA fragment or less preferably with a sequence flanking the minisatellite.

Where the polynucleotides and probes of the present invention comprise tandem repeats of a particular sequence such sequence will in general be repeated at least 3 times and such repeats need not necessarily be exact repeats.

Repeats which are not exact are described elsewhere as * imperfect repeats. Such repeats will nevertheless be ΐ recognisably repeated. In general this will mean that there is on average at least 701 homology between all repeating units. Preferably there is at least 80S, more preferably at least 85S, especially 90S homology between all repeating units. It will be appreciated however that the nucleotide sequence or repeat unit need not be repeated at all if desired.

The number of repeat units, n, is advantageously at least 5, but preferably ac least 10. Conveniently n is 10 to 40, but in principle n can be any number, even from 1 up to 10,000.

Where the polynucleotides and probes of the present Invention comprise tandem repeats of a particular sequence, any flanking sequences are largely irrelevant. They can be omitted or can be present in any number of nucleotides, for example up to 50,000 although to work with such a long probe would not ordinarily be sensible. Such large polynucleotides may nevertheless serve as carriers from which smaller polynucleotides, especially useful as probes, may be excised. These flanking sequences may form part of either ds—DNA or ss-DNA, even when the repeat sequences are of ss-DNA.

Preferably the polynucleotides and polynucleotide probes of the present invention comprise any one sequence selected from formulae 3 to 9 as hereinbefore defined or a sequence complementary thereto or tandem repeats thereof (there being on average at least 70Σ homology between all tandemly repeated sequences) or a sequence complementary thereto.

One preferred polynucleotide of the present Invention thus comprises the sequence of formula 3 as hereinbefore defined or tandem repeats thereof or a sequence complementary thereto. Such a nucleotide sequence is specific as to an autosomal locus located on chromosome 7.

Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as pAg3.

A further preferred polynucleotide of the present invention comprises the sequence of formula 4 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto. Such a nucleotide sequence ls specific as to a locus located on chromosome 1. Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as λ MSI.

A further preferred polynucleotide of the present invention comprises the sequence of formula 5 as hereinbefore defined or tandem repeat(s) thereof, or a sequence complementary thereto. Such a nucleotide sequence ls specific as to a locus located on chromosome 7. Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as AMS31.

A further preferred polynucleotide of the present invention comprises the sequence of formula 6 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto. Such a nucleotide sequence ls specific as to a locus located on chromosome 1. Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein as AMS32.

A further preferred polynucleotide of the present Invention comprises a sequence selected from formulae 7 and 8 as hereinbefore defined or tandem repeat(s) thereof or a sequence complementary thereto. Such a nucleotide sequence ls specific as to a locus located on chromosome 5.

Polynucleotides and polynucleotide probes comprising such sequences are referred to herein as AMS8.

A further preferred polynucleotide of the present invention comprises the sequence of formula 9 as hereinbefore 1 defined or tandem repeat(s) thereof or a sequence complementary thereto. Such a nucleotide sequence is specific as to a locus located on chromosome 12. Polynucleotides and polynucleotide probes comprising such a sequence are referred to herein asAMS43.

As Indicated above there is in general at least 70%, advantageously at least 802, preferably at least 352 and most preferably at least 902 homology between repeat units.

It is especially preferred however that any one of the sequences of formulae 3 to 9 be repeated exactly. In this regard it will be appreciated that this latter requirement may be met provided that each repeat unit has a sequence falling within the scope of the desired formula; it is thus not necessary that each repeat unit possesses exactly the same sequence.

In a preferred embodiment of the present Invention there is provided a method of establishing the Identity or otherwise of the test sample donor with one or more control sample donors, in which the control sample(s) are similarly fragmented and a comparison is made of the hybridised fragments from the respective samples.

In a further preferred embodiment there is provided a method of establishing a family connection between the test sample donor and one or more control sample donors, in which the control sample(s) are similarly fragmented and a comparison is made of the hybridised fragments from the respective samples.

The above-mentioned methods may be effected using the polynucleotides or probes of the present invention either singly or by using at least two polynucleotides or probes of the present invention either in a sequence of tests or in a single test using a mixture of the said polynucleotides or probes.

In a further preferred embodiment of the present invention there is provided a method for the diagnosis of an inherited disease, abnormality or trait which comprises ί probing the test sample with at least one polynucleotide or polynucleotide probe as hereinbefore defined, said probe, being associated with a particular inherited disease, abnormality or trait.

The probes of the present invention which we have tested all serve as locus—specific probes under high stringency hybridization conditions.

The extreme variability of loci detected by those probes of the present invention which we have tested, combined with their sensitivity in Southern blot hybridizations, provide an especially useful tool in individual identification, particularly when Insufficient DNA is available for multi-locus DNA fingerprinting analysis as described and claimed in Patent Specification No.it'5' ss multi-locus DNA fingerprints can be obtained from 0.5 pg DNA, whereas the locus—specific probes are at least an order of magnitude more sensitive and can be used on as little as 1 μΐ blood.

In any unusual situation where even smaller quantities of sample might require testing then the present invention will be particularly valuable in conjunction with the amplification technique described in European Patent Application No. 86302299.2 (Publication No. 0201184).

The present invention enables informative genetic loci to be identified in the human genome and thereby enables locus specific probes to be prepared, each locus specific probe being specific as to a single informative genetic $ locus. We have specifically identified six different very 3 informative genetic loci, which loci possess very high heterozygositites in the population tested (at least 902) and which are amongst the most polymorphic so far isolated . and we have prepared a locus specific probe for each locus 5 which probes we have designated pAg3, AmSI, AmS8, AMS31, /MS32 and AMS43 (as hereinbefore defined).

The degree of individual specificity of genotypes determined by locus—specific probes can be estimated from the heterozygosity H at each locus. The mean allele frequency q at a locus is given by (1—H), and the probability that two randomly-selected individuals share the same genotype is q2(2-q). This probability of false association of two individuals varies from 0.02 for ^Mse ot 0.0002 forAMS31, and is a conservative estimate in that heterogeneity in q will reduce these probabilities. The cumulative probability of false association for all six minisatellite probes is λζ10"16, comparable to the odds that two randomly-selected DMA fingerprints detected by one multilocus probe are Identical (see Patent Specification No.2.bitted) . In contrast the chance that two slbs are identical for a given hypervariable locus is given by lZ4(l+q)2. The cumulative probability of sib identity for all six probes is 0.0004, compared with 'ΊΟ-7 for a DNA fingerprint using one multilocus probe.

These locus-specific hypervariable probes should prove particularly useful in forensic medicine, as shown by the murder case analysed in Fig. 11C where insufficient DNA was recovered from two of the forensic samples for DNA fingerprint analysis. Semen DNA from both victims showed a common phenotype with probes AMSl and AMS31 different from that of the suspect. From the above discussion, we can calculate the probability that victims X and Y had been 4 sexually assaulted by different unrelated men at 2xl0~^.

Similarly, the chance that the two hypothetical assailants were first—degree relatives, for examples brothers, is 0.07.

This provides strong evidence that X and Y were sexually » assaulted by the same man, a conclusion which was subsequently confirmed by DNA fingerprint analysis of larger amounts of forensic material. Furthermore, the semen stains from X and Y are almost certainly derived from a single individual, rather than two or more assailants. Consider for example stain b in Fig. 11C, which shows two victim alleles and two additional assailant alleles. The chances that a pool of three individuals (two assailants and one victim) would show four or less resolvable alleles is given by q2 (55-21Oq+216q2). For probe MSI, this probability is 0.02 and for probeAMS31 0.005, giving a combined probability that X was sexually assaulted by two men, rather than one, of -4. This establishes that X and Y were assaulted by a single individual, and shows that locus—specific probes, unlike multi—locus DNA fingerprint probes, can be used to estimate the number of individuals represented in a mixed DNA sample.

The Mendelian inheritance of the hypervariable DNA fragments also allows them to be used for establishing family relationships in for exaaple paternity disputes. For a given locus—specific probe, the probability that a child's paternal allele is fortuitously present in a randomly—selected man can be estimated at 2q—q^. For all six minisatellites, the cumulative probability of false inclusion of a non-father is 6 Tf (2q^—qj2)-107, comparable to that obtained using two DNA 1 fingerprint probes. Similarly, the cumulative probability of false inclusion of a first degree relative of the true father, such as a brother, is 0.02. Thus sequential use of these hypervariable locus—specific probes can provide a powerful method for establishing family relationships with the caveat that mutations to new length alleles at these unstable loci could occasionally lead to false exclusions.

The mutation rate at these hypervariable loci is not yet known.

The locus—specifIcity and sensitivity of these locus—specific probes enable pooled probes to be used to generate multi-locus Southern blot patterns (Fig. 12). These reconstituted DNA fingerprints produced by 5 pooled probes are considerably less complex than their counterparts detected by multi-locus probes, and should be more amenable to being encoded digitally following densltometric scanning. Despite the high variability of the individual minisatellites, the pooled-probe profiles show a substantial (182) level of fragment sharing between unrelated North European individuals, mainly as a result of electrophoretic comigration of mlnlsatelllte fragments from different loci. This level of band sharing is similar to that seen in conventional DNA fingerprints produced by multi—locus probes, where the level of band sharing is^SZ between randomly-selected individuals. Since on average 8.4 DNA fragments are resolved in a mixed—probe pattern, the chance that all of these fragments in one individual are present in a second randomly—selected individual can be conservatively estimated at 0.18θ·4 » 6x10"?. These patterns therefore provide a high level of Individual specificity, though not as high as can be achieved using multi—locus probes or by sequential hybridization with locus—specific probes (see 6 above). Both the pooled probes and individual locus—specific probes will prove particularly useful in studies of cell chimaerism, particularly for providing donor versus recipient markers for following engraphment after bone marrow transplantation; DNA mixing experiments (Fig. 12) indicate that low levels of chimaerism could be detected using these probes.

In the following Examples temperatures are given in °C and the probes 33.6 and 33.15 are as described in Patent Specification No. having the consensus repeat sequence;— (A)AGGGCTGGAGG, and AGAGGTGGGCAGGTGG respectively 2? Example 1 This Example describes the isolation and properties of a specified minisatellite fragment in a DNA fingerprint. General methods DNA was isolated from white blood cells as described by Jeffreys A J et al, (1985) Nature 316, 76—79 and from an Epstein Barr virus transformed lymphoblastoid cell line (see Nilsson, K et al (1971) Int. J. Cancer 8, 443—450) derived from individual III 9 of the HPFH pedigree described by Jeffreys et al.. Am. J. Hum. Genet. 39, 11—24.

Restriction digestion and Southern blot hybridizations were performed as described elsewhere in the above-mentioned references of Jeffreys A J et al. Double-stranded DNA probe fragments were isolated by electrophoresis onto DE81 paper as described by Dretzen, G et al (1981) Anal. Biochem. 112, 295— 298 and labelled with 32p by random oligonucleotide priming as described by Feinberg, A P et al (1984) Anal. Biochem. 137, 266—267; single-stranded minisatellite probe 33.15 was prepared as described by Jeffreys et al (1985) Nature 314, 67-73.

Cloning hypervariable fragment g 600 pg individual III 9 lymphoblastoid cell line DNA digested with Sau3A was fractionated by electrophoresis through a 0.52 agarose gel, and relevant size fractions collected by electroelution onto dialysis membrane as described in Yang, R C A et al, (1979) Meth. Enzymol, 68, 176—182. After two cycles of preparative gel electrophoresis fragment g was 1000 fold purified (yield 150 ng DNA). 20 ng of this partially purified fraction was ligated to 60 ng AL47.1 arms isolated after cleavage with BamHI (see Loenen, V A M and Branmar, W J (1980) Gene. 20, 249—259) packaged in vitro and plated onto E. coll WL95 (803, supE, supF, hsdRif*, hsdMk*. tonA, trp?-, metg, lysogenic for P2) [see Loenen reference above and Jeffreys, A J et al (1982) J Mol. Biol. 156, 487—503] to select for recombinants. The resulting library of 1500 recombinant phage was screened by plaque hybridization with minisatellite probe 33.15. Four positive plaques were replated and rescreened on E. coll ED8910 (803, supE, supF, recB21. recC22. hsdS) [see Loenen reference above] and recombinant phage DNA prepared by the method of Blattner et al (1977) Science 194, 161—169. The Sau3A Insert of recombinant phage g3 was subcloned into the BamHI site of pUC13 [Vieira J and Messing J (1982) Gene 19, 259—268] and propagated in a recA derivative of E_. coli JM83 JM83, A(recA-srlR) 306::Tnl0 [see Matfield, M (1983) Ph.D. thesis, University of Leicester].

DNA sequence analysis pAg3 DNA was sonicated, size-selected and shotgun cloned into the Sma I site of M13mpl9 [see Yanis-Perron C et al (1985) Gene 33, 103—119]. To determine the DNA sequence of the tandem-repetitive region of p^g3, 12 random clones were sequenced by the dideoxynucleotide chaintermination method [see Sanger, F et al (1977) Proc. Nat. Acad. Sci. USA 74, 5463-5467 and Biggin M D et al (1933) Proc. Natl. Acad. Sci. USA 80, 3963-3965]. 8 of these clones were derived from the tandem-repetitive minisatellite region of pAg3 and were used to define the consensus repeat sequence. M13 clones containing the 5' and 3' flanking regions were detected by hybridization with -^2P—labelled flanking probes a and b (see Fig. 1 described below) and sequenced to establish the flanking region sequence and the 9 beginning and end points of the minisatellite.

RESULTS Isolation of a specific mlnlsatellite from a DNA fingerprint Individual III9 from the Gujarati pedigree described by Jeffreys et al. [(1986) Am. J. Hum. Genet. 39, 11—24] is affected by HPFH (hereditary perslstance of foetal haemoglobin) and her DNA fingerprint, detected in Sau3A digest by mlnlsatellite probe 33.15, contains a 8.2 kb polymorphic fragment (fragment 'g'; Fig. IA) which tends to cosegregate with HPFH in other members of this pedigree as described in (1986) Am. J. Hum. Genet. 39, 11—24. This DNA fragment was purified away from other minisatellite fragments by two rounds of preparative gel electrophoresis (Fig. 1).

Fig 1 illustrates this purification by gel electrophoresis. DNA from individual III9 in the pedigree described by Jeffreys et al was digested with Sau3A and 6—9 kb fragments collected by preparative gel electrophoresis (fraction 1). These fragments were re-electrophoresed to give fractions 2-5. Aliquots of III9 DNA digested with Sau3A and of each fraction were electrophoresed through a 0.82 agarose gel and Southern blot hybridized with the mlnlsatellite probe 33.15. Fragment g (8.2 kb), which tends to cosegregate with HPFH, is approximately 1000-fold purified in fraction 3.

The fragment *g', detected in the Sau 3A digest referred to above, and purified as described to produce an approximately 1000 fold enriched fragment *g* fraction was cloned into>L47.1 as described in the above-mentioned Loenen and Brammar reference, and propagated on P2 lysogenic rec* E. coll to select for recombinant phage. The resulting library was screened by hybridisation to probe 33.15. The four positive plaques obtained were very samall (plaques <0.1 mm diameter) but could be replated at a low efficiency 0 0-8 pfu/plaque) on recB, recC E_. coll to produce normal-sized plaques (1mm diameter). Two clones, Agl and Ag3, were further characterised and shown to contain a Sau3A insert of 7.7 and 7.8 kb repectively. These clones were both derived from band g (see below), but were shorter than band g by 0.5 and 0.4 kb respecively. Since there was no size heterogeneity of the Sau3A insert in either Agl orAg3 grown on recB. recC E. coll (data not shown), we conclude that part of the insert has been lost from each clone during their initial propagation in rec+ E. coll.

Yields of Agl and Ag3 DNA prepared by the Blattner method [see (1977) Science 194, 161-169] were very low ( 1Z of the normal yields of AL47.1 recombinant DNA), again pointing to abnormal growth properties of these minisatellite clones. £he Sau3A Insert was therefore subcloned into pUC13 [see Vieira, J and Messing J (1982) Gene 19, 259—268] and propagated in a recA derivative of E. coll JM83 [see Matfield M (1983) Ph.D thesis University of Leicester] to minimise rearrangement of the insert. The resulting subclone, pig3 (see Pig. IB described below), contained a 7.1 kb Sau3A insert, 0.7 kb shorter than the insert in g3.

Organisation of mlnisatelllte fragment g The structure of the mlnisatelllte fragment in pAg3 was determined by restriction mapping (Fig. IB) and DNA sequencing (Fig. 2).

Fig. IB shows the organization of DNA fragment g. The Sau 3A insert in pAg3 was mapped with restriction endonuclease Alul (A), Ddel (D), Hae III (H) MboII (M), Pstl (P) and Sau3A (S). There are no cleavage sites for Hlnfl or Rsai. The 7.14 kb insert contains 171 tandem repeats of a 37 bp sequence (see Fig. 2) plus 747 bp flanking DNA. The 5' flanking region contains the beginning of an inverted Alu element (hatched). The origins of unique sequence flanking probes a and b are shown. 1 Fig 2 shows the DNA sequence of hypervariable fragment g. The sequence of the 5' and 3' flanking regions and the beginning and end of the minisatellite is shown together with the repeat sequences of three random regions (a—c) from the minisatellite. The beginning of the Inverted Alu element is shown in underlined uppercase, and several simple sequence regions in the 5’ flanking region are underlined. The consensus sequence (con) of the 37 bp minisatellite repeat unit is shown, and differences from this consensus are given for individual repeat units. The second repeat unit in region c contains a Haelll cleavage site (underlined), and this region therefore spans the internal Haelll site in the minisatellite (Fig. IB). The consensus repeat sequence is also shown aligned with the core sequence in a similar manner to that in Patent Specification No. .

The clone pjkg3 contains a 6.3 kb minisatellite devoid of restriction sites, except for a single internal Haelll site. The minisatellite is comprised of 171 repeats of a 37 bp unit which contains the sequence GTGGGCAGG; this sequence corresponds precisely to the most invariant part of the 11—16bp core sequence previously identified as being shared by several different human minisatellites (see Patent Specification No. and Fig 2 herein). The repeat units are not completely homogeneous; sequence analysis of several randomly—selected regions from within the mlnlsatelllte revealed a limited amount of repeat sequence variation. Most variants, including a 4 bp deletion which produces a subset of 33 bp repeat units, are diffused over more than one repeat unit. One variant (an A-bC transversion in region C) creates the unique Internal Haelll 2 site and is therefore probably only found in one repeat unit. The beginning and end repeat units of the minisatellite are noticeably more diverged in sequence than are internal repeats.

The minisatellite in p^g3 is flanked by nonrepeated DNA containing the normal density of restriction sites (Fig. IB). The beginning of the 5’ flanking region, is comprised of the head of an inverted Alu element. The remaining 5' and 3' flanking regions, defined by hybridization probes a and b (Fig IB), are unique sequence DNA and hybridize only to this locus in the total DNA (data not shown). The 5' flanking region contains a considerable amount of simple sequence DNA [polypurine and (ACC)n] (Fig 2).

Mlnlsatellite fragment R detects a single polymorphic locus To determine whether the entire cloned minisatellite fragment can be used as a hybridization probe to detect specifically the corresponding locus in human DNA, the Sau3A insert from p)kg3 was hybridized in the presence of human competitor DNA to human DNA digested with Hinfl. the restriction enzyme routinely used for DNA fingerprinting (Fig 3).

Figure 3 shows the Mendellan inheritance of polymorphic DNA fragments detected by pAg3. 8pg samples of human DNA were digested with Hinfl and electrophoresed through a 0.82 agarose gel. Digests were Southern blot hybridized with the Sau3A insert of ρΛ?3, in 1 x SSC at 65° in the presence of 62 polyethylene glycol and 50pg/ml alkalisheared human placental competitor DNA, and washed after 3 hybridization in 0.2 x SSC at 65°. p,\g3 detects a single locus vhich is heterozygous in all Individuals shown. Inheritance of alleles (indicated by letters) is Mendelian.

At high stringencies (0.2 x SSC, 65°), either one or two hybridizing fragments were detected in all individuals examined. pAg3 detected the 8.2 kb fragment g In previouslytested relatives of III 9, confirming that band g had been cloned (data not shown). At lower stringencies (1 x SSC, 65°), additional faintly hybridizing polymorphic DNA fragment were detected (data not shown).

DNA fragments detected by pAg3 at high stringencies segregate in a Mendelian fashion as alleles of a single locus (Fig 3). This locus is not sex-linked and also showed no significant but Incomplete sex-linkage in two large pedigrees studied (61 progeny tested, z 0.18 at $ 0.43; data not shown); it therefore behaves as an autosomal locus, and has been located on chromosome 7 (see Table 1).

Extreme polymorphic variation at this ainlsatelllte locus Hlnfl digests of DNA from 79 randomly-selected British Caucasians were screened with the insert from pag3, first singly and then in pools of 14 people (1 pg DNA per individual) which were electrophoresed though a 35 cm long 0.7Z agarose gel to maximise allele resolution. The lengths of the different alleles detected in this population sample are shown in Fig 4, together with the estimated number of repeat units in each allele and the allele frequencies. Thus Fig 4 shows the distribution of minisatellite allele sizes. The length of the minisatellite in the shortest common allele was determined by genomic mapping of this fragment in a homozygote, using flanking single-copy probes a and b (Fig 1) (data not shown). The number of repeats per allele is approximate and depends on the ratio of 37 to 33 bp repeat units in the mlnlsatellite. Excluding the short common 4 allele, the remaining alleles were sampled either once (42 alleles), twice (12 alleles), three times (12 alleles) or four times (5 alleles). This distribution does not differ significantly from that predicted if all of these alleles are uniformly rare (q0.0081, 2(4 d.f.] · 4.0), and is therefore consistent with a simple model of one common short allele (q=0.165) and 103 equally rare alleles (qx0.0081 per allele) being present in the population.

At least 77 different alleles could be resolved in this population sample, with repeat numbers ranging from 14 to^525 per allele. The homozygotes in the population sample were all homozygous for the shortest allele. The above estimates of number of alleles and the mean frequency of rare alleles are limited by gel resolution, and the true number of different length alleles in this sample may be greater.

The distribution of allele lengths does not appear to be completely random, but shows evidence of trimodality (Fig 4), with short (14-16 repeats), medium (41-68 repeats) and long (107—525 repeats) classes of alleles. A bimodal distribution of allele lengths has been previously noted in Caucasians for the hypervariable region located 5' to the human insulin gene (see Bell, G I et al (1982) Nature 295, 31—35], though this bimodality is not evident in blacks (Lebo, R V et al (1983) Proc. Nat. Acad. Sci. USA 80, 48044812].

The isolation of fragment g demonstrates that the large and highly polymorphic DNA fragments in DNA fingerprinting are in principle amenable to molecular cloning to provide locus—specific probes suitable for studying individual hypervariable regions. While fragment g could be cloned in bacteriophage A , the resulting clones showed abnormal growth properties on rec~*~ E. coli. This will lead to a depletion of mlnlsatellite clones from conventional amplified human libraries in phage. The cloned mlnlsatellite is unstable both in and on subcloning into pUC13 in recA E. coll; the final recombinant pAg3 had lost about 30 repeat units compared with fragment g. The physical map of pAg3 (Fig 1) does not therefore completely reflect the organization of fragment g.

The cloned DNA fragment has the structure expected for a minisatellite, establishing that fragment g is not derived from a longer satellite DNA. Despite the presence both of a core sequence in each repeat unit and part of an Alu sequence in the 5' flanking region, the cloned fragment g acts, in the presence of competitor human DNA, as a locusspecific probe. The failure of pAg3 to detect efficiently other core-containing minisatellites is due to the additional non-core DNA present in each repeat unit which probably interferes with cross—hybridization to other minisatellites (see Patent Specification No .

The cloned minisatellite shows extreme length polymorphism, presumably due to allelic variation both in the number of repeat units and in the ratio of 37 and 33 bp repeat types in each allele. In a random population sample of 158 chromosomes, one common and at least 76 rare alleles could be resolved. This locus is much more polymorphic than most or all of the cloned human hypervariable regions so far characterized including the selection of relatively short cloned minisatellites initially used to define the core sequence [see Patent Specification No. -9/^ ] . The heterozygosity at this locus is at least 96.6Z, with most homozygotes arising from the short common allele. 6 New alleles at this locus are generated by alteration in the repeat number, either by slippage during DNA replication or by unequal exchange driven by the core sequence, a putative recombination signal. Under the neutral mutation random drift hypothesis, the parameter 4Nev (Θ), where Ne is the effective population size and v is the mutation rate per gamete to a new length allele, can be most accurately estimated from the number of different alleles scored in a population sample, using the infinite allele model [see Ewens W J (1972) Theor. Popul. Biol. 3, 87-112].

We estimate Θ at 60-90 for this locus, depending on whether the common short allele is included or not. Since Ne for man isA/10^, the mutation rate v co new length alleles at this locus is approximately 0.002 per gamete. This value of v is an underestimate, since the number of alleles detected is limited by gel resolution and since there is not an infinite number of potential resolvable alleles. The average length of minisatellite DNA at this locus is 5kb, and thus the mutation (recombination) rate per kb minisatellite is >4 x 10 compared with per kb estimated for other shorter core-containing minisatellites and a mean meiotic recombination rate of 10"5 per kb for human DNA [see Jeffreys, A J et al (1985) Nature 314, 67—73]. Thus the rate of generation of new alles at this mlnlsatelllte locus is remarkably high, consistent with the Inventor's previous suggestions that these core-rich regions may be recombination hotspots. Presumably, the mutation rate is relatively low for short alleles, which might explain how the shortest allele has drifted to achieve a significant frequency in the population without being disrupted by unequal exchange during this process.

DNA fingerprints have proved a powerful method for individual identification and for establishing family relationships in for example paternity and immigration disputes. The accuracy of this method is determined by the low mean probability x that a band is shared by two randomly—selected individuals. For British Caucasians, x has been estimated empirically at 0.2 for DNA fingerprint Hincl fragments larger than 4 kb. In cases where band sharing between individuals occurs (that is, where a band in one Individual is matched in a second individual by a band of similar mobility and autoradiographic intensity), it is not clear whether the shared bands represent identical alleles of the same minisatellite locus. The allele distribution in Fig 4 enables us to calculate x for alleles >4 kb; for this specific mlnisatelllte locus, x " 0.016, an order of magnitude lower than the estimate from multi—locus DNA fingerprints. If this cloned minisatellite is typical of loci represented in DNA fingerprints, then most bands shared between unrelated DNA fingerprints are due to fortuitous comigration of different mlnisatelllte fragments. The important practical consequence of this is that, in cases of non-exclusion in for example paternity disputes where all paternal bands in a child are precisely present in the DNA fingerprint of the putative father, the very low probability of false Inclusion previously calculated for x · 0.2 ls a gross overestimate of the true probability (for x 0.016).

Using DNA fingerprint probes 33.6 and 33.15, it is possible to score the segratlon of up to 34 dispersed autosomal loci In large human sibships. For most loci examined, only one of the two alleles is scorable in the set of larger (>4 kb) resolved DNA fingerprint fragments, suggesting that large size differences exist between 8 mlnlsatelllte alleles, with many alleles being located In the poorly resolved (<4 kb) region of the DMA fingerprint. This is also seen for the cloned minisatellitej Hinfl alleles at this locus vary from 1.7 to 20.4 kb in length, and the allele frequency distribution in Fig 4 shows that both alleles of this locus would be resolved in the DNA fingerprints of only 402 of individuals, while neither allele would be scorable in 142 of people.

Minisatellite probes 33.6 and 33.15 detect together about 60 hypervariable loci, many of which should now be amenable to cloning to provide a bank of highly informative single locus probes, for example ideal for linkage studies in man. Linkage analysis of inherited disorders is also possible in single large families using the entire DNA fingerprint. If a polymorphic fragment is detected which appears to cosegregate with the disease, it is essential that this fragment be cloned to provide a locus-specific probe for extending the linkage analysis to additional affected families.

In the following Example 2 below the materials and methods set out below were used. a) Cloning a selection of large mlnlsatellites pg blood DNA from each of 40 randomly—selected individuals were pooled, digested to completion with Sau3A and 5-15 kb fragments isolated by preparative electrophoresis in a 0.62 agarose gel followed by electroi 9 elution onto a dialysis membrane. The purified fraction vas electrophoresed in a second preparative gel to remove all traces of contaminating small Sau3A fragments. 50 ng of the 5—15 kb fraction were ligated to 100 ng /1.47.1 arms isolated after cleavage with BamHI [Loenen and Brammar, (1980) Gene . 249—259] packaged in vitro and a library constructed, screened with human minisatellite probes 33.6 and 33.15 (see Patent Specification No. ) and positive plaques Isolated as described in Example 1 to produce the MS series of recombinant phage. b) Isolation of alnisatelllte hybridization probes Recombinant phage DNA was digested with Sau3A and the large insert fragment separated from small vector fragments by electrophoresis in low gelling temperature agarose (Sea Plaque). The gel slice containing the insert was dissolved in 3 vol water at 65° and aliquots containing 10 ng insert DNA were labelled with 32p by random oligonucleotide priming [Feinberg and Vogelstein, (1984) Anal. Biochem. 137, 266—267. c) Southern blot hybridization Genomic DNA samples were restricted and electrophoresed as described by Jeffreys et al (1986) Am. J. Hum. Genet. 39, 11-24. DNA was transferred to Hybond-N (Amersham), fixed by u/v irradiation and prehybridized at 65° for 5 min in 0.5M sodium phosphate, 7Z SDS, ImM EDTA (pH7.2) [Church and Gilbert, (1984), Proc. Natl. Acad. Sci. USA 81, 1991—1995. Filters were hybridized overnight with 0.5 pg/ml 32P-labelled probe DNA (specified activity ^10^ cpmZug DNA) in the presence of 25 μg/ml sheared singlestranded human placental DNA competitor. After 0 hybridization, filters were washed at 65° in 40 mM sodium phosphate, IS SDS (pH7.2) followed by a high stringency wash at 65° in 0.1 x SSC (15 mM NaCl, 1.5 mM trisodium citrate pH7.0) 0.012 SDS. Filters were autoradiographed from 3 hr co 1 week at —80° in the presence of an intensifier screen, d) Determination of the tandem repeat sequence of the MS recombinants Each MS recombinant DNA was sonicated and 0.3 — 0.6 kb fragments size-selected and shotgun cloned into the Smal site of M13mpl9 [Yanis-Perron, Vieira and Messing, (1985), Gene 33, 103—119]. Recombinant phage were screened by plaque hybridization with 32p-iat>eiie(j hs insert DNA. 10 strongly-positive single-stranded phage DNAs from a given MS recombinant were compared pairwise by the C—test [Winter and Fields, (1980) Nucleic Acids Res. 8_, 1965—1974]; most DNAs fell into two complementary C-test groups and were therefore likely to be derived from the long, tandem-repetitive region of the AMS Insert. Two M13 recombinants from each of the two complementary groups were sequenced by the dideoxynucleotide chain-termination method [Sanger, Nicklen and Coulson, (1977) Proc. Natl. Acad. Sci. USA 74, 5463—5467; Biggin, Gibson and Hong, (1983) Proc. Natl. Acad. Sci. USA 80, 3963-3965] to determine the consensus repeat sequence of each MS recombinant on both strands.

Example 2 a) Isolation of a selection of locus-specific hypervariable DNA probes The strategy for cloning a selected fragment from a human DNA fingerprint by preparative gel electrophoretic isolation of the fragment followed by cloning in bacteriophage has been described in Example 1. To isolate a wider range of minisatellites, 6—15 kb size-selected Sau3A 1 fragments from DNA pooled from 40 randomly—selected individuals were cloned into the BamHI replacement vector AL47.1 [Leonen and Brammar, (1980)? "A bacteriophage lambda vector for cloning large DNA fragments made with several restriction enzymes" Gene 20, 249-259). Since human mlnisatellltes can show substantial allelic variation in length, as demonstrated in Example 1, the use of pooled human DNAs to clone large Sau3A fragments should maximize the number of clonable hypervariable loci which have large Sau3A alleles. From a library of 2000 recombinants, 5 phage were isolated by hybridization to human mlnisatelllte probe 33.15 and an additional 5 phage were detected by probe 33.6, to produce the MS series of recombinants (see Table 1).

Table 1. Summary of hypervarlable locua-speclflc mlnlsatellite probes Sau3A Clone detected by other Isolates Insert length kb variation detected with heterozygosity Z allelic length range, kb chromosome assignment 5 pAg3 33.15 — 7.1 Hinfl 97 1.5 - 22 7q31.3 qter AMS1 33.15 — 4.6 Hinfl 98 2.0 - 22 ip AMS8 33.6 MS40, MS42 MS47 7.0 Hinfl 90 2.4 - 9.5 5 AMS31 33.15 — 5.7 Hinfl 99 3.5 - 13 7pter q22 10 AMS32 33.15 — 5.9 Alul 97 2.3 - 28 iq AMS43 33.6 8.3 Hinfl 94 3.5 - 16 12 3 To determine whether each Λ MS recombinant could act as a locus-specific probe for a hypervariable minisatellite, the Sau3A insert of each recombinant was hybridized in the presence of human competitor DNA to Hinfl digests of three randomly selected individuals, or to Alul digests forx\MS32, the minisatellite tandem repeat units of which contain a Hinfl site (Fig 5). 8 out of 10 of the recombinants hybridized to one or two large variable DNA fragments in each human DNA tested. Four of the recombinants detected by probe 33.6 (AMS8, 40, 42 and 47) hybridized to the same pattern of variable DNA fragments and are therefore derived from the same hypervariable locus (Fig 5 Table 1).

Figure 5 shows an Example of the screening of A MS recombinants for locus—specific hypervariable DNA probes. pg samples of DNA from three unrelated individuals were digested with Hinfl. eletrophoresed through a 0.32 agarose gel and Southern blot hybridized with 32p_iabelled Sau3A inserts from pAg3 (Example 1),AMS3 andAMS40 as herein described in Materials and Methods. Filters were washed after hybridization in 0.1 x SSC at 65°, and autoradiographed in the presence of an intensifier screen for 1 day (left panel) or 1 week (right panel). Note that»\MS8 andAMS40 detect the same hypervariable locus, and that on prolonged autoradiography, additional variable DNA fragments are detectable.

The remaining recombinants A MSI, 31, 32 and 43 were derived from different loci which did not Include the previously characterised pAg3 locus (see Example 1 and Fig 5). Although none of these A MS recombinants produced DNA 'fingerprints' of multiple variable fragments, most AMS probes were seen to cross—hybridize weakly to additional polymorphic DNA fragments on prolonged autoradiographic exposure (Fig. 5). 4 Two of the Λ MS recombinants detected by probe 33.15,A MS3 andAMS30, failed to detect a specific locus in human DNA digested with Hinfl or Sau3A, either in the presence or absence of human competitor DNA. On prolonged autoradiograph, both recombinants detected the same faint pattern of variable DNA fragments (data not shown). We have no explanation for this lack of locus—specificity, and these two MS recombinants have not been further characterized.

Thus despite previously reported difficulties in cloning large and unstable human minlsatellltes [see for example Nicholls et al (1985) Nucleic Acids Res. 13, 7569— 7573 and Wyman et al (1980) Proc. Natl. Acad. Sci. USA TJ_, 6754-6758] we have been able to demonstrate that at least some of the largest and most variable DNA fragments detected in a DNA fingerprint are amenable to cloning in bacteriophage A, provided that the Inserts are stabilised by propagation of phage in a recBC E,. coll host. b) Determination of the repeat sequence units of cloned mini—satellites Random segments of insert DNA from each Λ MS recombinant were sequenced to determine whether each cloned hypervariable locus consisted of tandem-repetitive minisatellite (see Materials and Methods). All A MS clones were shown to consist primarily of tandem repeat units ranging in length from 9 bp forAMSl to 45 bp forAMS43 (Pig 6).

Fig 6 shows the consensus repeat sequence units of the A MS series of minlsatellltes. Random segments of each cloned mlnlsatelllte were sequenced to define the consensus repeat unit. Variable positions in each consensus are shown as: R, r = A or G; Y, y C or Tj N, n · any base. The minisatellite in MS8 consists of two mutually—interspersed repeat units 29 and 30 bp long. The consensus repeat sequence of pAg3 is also shown in Fig 2. Each repeat sequence is aligned with the core sequence, with matches shown in uppercase, and a new core sequence derived from a comparison of the core with pAg3,AMS31 and XMS32 is also disclosed.

In no minisatellite are the repeat units completely homogeneous, consistent with the variation between repeat units seen at previously sequenced minisatellites (see Patent Specification No. and Example 1 . herein). Most notably, the mlnisatelllte inAMS8 consists of an intermingled array of two closely—related but distinct repeat units 29 and 30 bp long (Fig 6). The end-points of the minisatellites in the A MS recombinants have not yet been determined.

Thus five new hypervariable loci have been Isolated, each consisting mainly of a tandem-repetitive minisatellite. The tandei»-repeat units of pAg3, AMS1.AMS31 and>MS32 each contain the core sequence, as expected (Fig 6). However, the copies of the core sequence are imperfect, and comparisons of the repeat units of these minisatellites do not clearly define a new core sequence preferentially associated with these large and extremely variable loci. It seems likely instead that a wide range of core derivatives may be associated with large mlnisatellltes. More notably, mlnisatellltes AMS3 andAMS43 detected by probe 33.6, which consists of tandem repeats of a diverged version of the core sequence (see Patent Specification No. s.a'Q/SS' ) , contain highly diverged versions of the core sequence (Fig 2). Again, comparisons of A MS8, A.MS43 and 33.6 do not clearly reveal a new specific sequence preferentially associated with these three loci (data not shown). It is clear that a detailed search for further sequence motifs associated with the most variable minisatellites, particularly those detected by probe 33.6, will require the analysis of a much larger spectrum of cloned mlnlsatellites. c) Mendellan Inheritance and variability of loci detected by clones mlnlsatellites The five new mlnlsatellites isolated,Λ MSI, 8, 31, 32 and 43, each detect a single large and variable locus. Mendellan inheritance of all loci has been confirmed by analysing segregation in large horizontal pedigrees provided by the CEPH programme (Fig 7).

Figure 7 shows the Mendellan inheritance of the hypervariable locus detected byAMS32. 1 pg DNA samples from CEPH family 1413 were digested with Alu I and Southern blot hybridised to the 32p—labelled Sau 3A insert fromAMS31.

This family is completely informative at this locus.

The extent of allelic variability for each probe has been estimated by analysing the frequency of allele sharing between randomly—selected English individuals (Fig 3). Figure 3 provides an estimation of allelic variability at the hypervariable locus deteced by MS43. 1 pg samples of DNA from twenty random-selected English people were digested with Hinfl and Southern blot hybridized toAMS43. All individuals are heterozygous, indicating that the level of heterozygosity at this hypervariable locus is high (H > 0.86, p > 0.95). A more accurate estimate of heterozygosity may be made by comparing alleles in each individual with alleles in the six nearest neighbours on the autoradiograph to estimate the levels of allele sharing between individuals.

For example, the larger allele in individual 5 appears to be present in 7, but not in 2, 3, 4, 6 and 8. Similarly, the smaller allele in 5 is not present in 2—4 or 6—8. Over all individuals examined, s * 0.11, from which the mean allele frequence q can be estimated as q · 1 — (1—s)^ 0.056 and the heterozygosity as (1-q) 942. This is a minimum estimate of heterozygosity limited by gel electrophoretic resolution.

All loci are highly variable with heterozygosities ranging from 902 forAMS8 to 992 forAMS31 (see Table 1 above). The extent of allelic length variation has been further analysed by comparing the spectrum of alleles resolved in pools of 15 and 150 individuals (Fig 9). Figure 9 shows an analysis of allelic length variation at hypervariable loci in pools of human DNA. 10 pg samples of DNA from a single individual (a), from a pool of 15 individuals (b) and from a pool of 150 people (c) were digested with Alul (forAMS32) or Hinfl (for all remaining probes) and Southern blot hybridized with the Indicated locus—specific hypervariable probes. All individuals were randomly-selected North Europeans. Individual a was included within pool b, and all pool b individuals were Included in pool c. It should be noted thatAMS43 detects a second variable region represented by the short Hinfl alleles marked 0; this region has not been further characterised.

For the least variable locus,AMS8, there are two predominant alleles 5.3 and 7.2 kb long plus 7 lower frequency alleles resolvable in the pool of 15 people. That the two predominant alleles are not the result of sampling error in these 15 individuals is shown by their similar prevalence in the pool of 150 individuals, together with a larger spectrum of low frequency alleles. Similarly,Λ MS43 (942 heterozygosity) shows 7 major alleles shared by the 15— and 150-lndivldual pools, together with many minor alleles.

In contrast, the most variable loci AMS1, 31 and 32 and pAg3, with heterozygosities estimated at 97—992, show no alleles with a significant population frequency which are shared at equal Intensity by both pools of individuals (with the exception of the shortest 1.6 kb allele of pAg3 as described hereinbefore, and thus the number of alleles at these loci is likely to be very high. For example, at least 50 different A MS32 alleles can be resolved in the pool of 150 individuals; this will be a minimal estimate of the total number of alleles limited by gel electrophoretic resolution.

The length dispersal of alleles in Caucasians also varies between these hypervariable loci (see Fig 9 and Table 1), Most alleles ofAMS31 are distributed fairly uniformly over a relatively narrow size range of 5.5 — 9.3 kb, whereas alleles of A MSI vary in size from 2—20 kb. There is evidence in some cases of non-uniformity of allele length distribution; in partlcularA MSA3 shows two predominant allelic size classes of 5—6 kb and 8—14 kb, and pAg3 shows three size classes of 1.6—1.7, 2.8-3.6 and 5—15 kb as hereinbefore described in Example 1.

As indicated above the loci detected are extremely variable and Indeed are amongst tbe most polymorphic loci so far isolated from human DNA. d) Chromosome assignment of hypervariable loci None of the hypervariable locus—specific probes hybridise to rodent DNA, and therefore the segregation of these loci could be followed in man-rodent somatic cell hybrids [see Fig 10 and Table 2 below]. The six loci were assigned to four different autosomes, with chromosomes 1 and 7 each bearing two hypervariable loci.

Figure 10 shows the segregation of the hypervariable locus detected byAMS32 in a panel of humanrodent somatic cell hybrid DNAs digested with Alul. This locus cosegregates with human chromosome 1 (see Table 2 below). Interestingly, the hybrid cell line MOG 2C2 carried two 9 alleles of bothAMS32 and AMSl (data not shown). This strongly suggests that both parental copies of human chromosome 1 have been retained in this hybrid, and, since all other positive hybrids contained only a single allele at each of these loci, this provides strong supporting evidence for synteny of A MSI and AmS32. Hybrid F4SC13cll2 contains chromosome lp but is negative forAMS32; thus A MS32 is provisionally localised to chromosome lq.

The following code is used in Figure 10: 1. human 2 16. human 1 2. hamster 17. rat 3. mouse 18. DUR 4.3 4. FG10 19. FIR 5 5. PCT BA18 20. C4A 6. l 21. DUR 4R3 7. SIF4A24EI 22. 3W4 cl 5 8. SIF15P5 23. clone 21 9. CTP34B4 24. WILF 1 10. TWIN 19 D12 25. F4SC13 cl 11. TWIN 19 F9 26. SIF4A31 12. TWIN 19 F6 27. FST 9/10 13. TWIN 19 C5 28. HORL 41IB6 14. HOG 2C2 29. HORP 9.5 15. MOG 2E5 Table 2 shows the chromosome assignment of hypervariable loci in human-rodent somatic cell hybrids. hybrid no.

Table 2 Chtoaosoae asslgneent of hypervariable loci In huaan-rodent somatic cell hybrids chr. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 1 — — — — — - - P — - 4- — — — — — — 4- 4- 4· — — + 4· 2 - — — — — — — — — — — — 4- - - — 4· 4- — P 4· — — — 3 + — — 4- - - — — + + -*· - — - - - - 4- 4- 4· 4- 4- + 4- 4 - — — — — — — — 4- 4- — - 4- 4- 4- 4- 4- 4- 5 — M — 4· - - — — M — — - 4- - - - - M - - - — — + 6 - — — — — — — — + 4- — — — — 4- — 4- 4· 4· 4- 4- - — 4- 7 - D — — 4· — — - — - - — - - - 4- 4· N N N N 4- 4- 8 - — 4- N — — — — - »- — — 4- — - - — 4- 4- 4· 4- 4- 4· 4- 9 - - — - — - — 4· N N 4· - 4- 4· 10 M — — - - — — — - 4- - 4- 4- — - — 4- - - - - - 4- 4- 11 + — — + -¼ — - - - - 4- — 12 4· — — + — — — — + — 4- — — 4- - — 4- 4- 4- 4- 4· — 4· 13 + — — 4- - - - — — 4- + - - - - - - - N N N N — 4- 14 4· M — + 4- — — 4- 4· 4- - 4- — — — - 4- 4- 4- 4- 4- 4- 4- 4- 03 15 4· — — — + - — — - + + — 4· — — - 4- - - — — - 4· 4· O 16 — - — - - - — — t· - - - — - - - — 4- 4- - - - 4- 4- 17 + — — + 4· - - — 4- - 4- - 4- 4· 4- 4- 4- 4- 4- 18 4- + — 4- — - - - - + - 4- - - - — 4- 4- 4- 4- 4- + 4- 19 — — — — — 4· — — — — — — — — — — 4- — 20 M — — M — — — — - t- - - — - - - 4- - 4- 4- 4- 4- — - 21 + — — + 4· - - - — - — 4- 4- — 4- 4· - — 4- 4· 4- 4- 4- 4- 22 4· — M + — — - - M + N - — - - — — — 4· 4- 4- 4- N N X + — — + — — + 4- 4- + 4- + — 4- 4- 4- + — — — — 4· 4- pAg3 — — — - 4- + - M M — - - - - - - 4- 4- — — — - 4- 4- chr. 7 17/17 amsi — — M — — — - 4- - — + - - — - - — 4- 4· 4- — - 4- 4· chr. 1 22/22 AMS8 — N — 4- - - — — - - - - 4- - - - — 4- - — — - 4- 4· chr. 5 20/21 AMS31 — -► — — + 4- - — - — - — — - - 4- 4· - — — - 4· 4- chr. 7 20/20 AMS 3 2 — — — - - - - - - - + — - - - - 4- 4· 4· — — 4- 4- chr. 1 23/23 AMS43 + — — 4· + - - — — + - 4- — - 4· - — 4- 4· 4· 4- 4- — 4- chr. 12 24/24 1 In Table 2 the following somatic cell hybrids were typed» 1, DUR4.3, 2, FIR5, 3, C4A; 4, DUR4R3; 5, 3W4cl5; 6, clone 21; 7, WILF.l; 8, F4SC13cll2; 9, SIF4A31; 10, FST9/10; 11, H0RL411B6, 12, HORP9.5; 13, FG10; 14, PCTBA18; 15, le9498> 16, SIF4A24E1; 17, SIF15P5; 18, CTP34B4; 19, TWIN 19D12; 20, TWIN 19F9; 21, TWIN 19F6; 22, TWIN 19C5; 23, MOG 2C2; 24, MOG 2E5 and the meaning of the symbols employed in the Table are as follows.·— *, chromosome or hypervariable locus present; —, chromosome or locus absent; M, chromosome present in only some cells or locus only weakly detected by Southern blot hybridization; N, chromosome not tested or equivocal result, locus not tested; P, short arm present; D, chromosome 7pter^q22 present as a 7/X translocation. The deduced chromosome assignment of each locus—specific hypervariable probe is given, together with the fraction of unamblgously informative cell hybrids which are concordant for the presence or absence of the Intact chromosome and the hypervariable locus. For each hypervariable probe, all chromosomes except one were multiply excluded by this analysis.

The hybridization of > MSI to hybrid 8 (F4SC13cll2) containing chromosome lp suggests thatAMSl is located on lp. Conversely,Λ MS32 does not hybridize to hybrid 8, suggesting localization to lq. pAg3 does not hybridize to hybrid 2 (FIR5) which contains chromosome 7pter*q22. Furthermore, hybrids JDA 13.1 and JDA 3 containing 7pter-»q31.3 and 7q31.3->qter respectively are negative and positive respectively for pAg3 (data not shown), localizing pAg3 to 7q31.3-*qter. Conversely, Λ MS31 hybridizes to FIRS and JDA 13.1 but not JDA 3, suggesting a localization to 7pter-*q22. This lack of clustering was confirmed by linkage analysis in large CEPH sibships, which showed no significant linkage between either pair of syntenic markers (z> —2 at >0.35 for each pair, data not shown).

All six cloned minisatellite loci, including pAg3 described in Example 1, are autosomal and dispersed; of the two syntenic pairs of minisatellites found, neither show significant pair-wise linkage. This autosomal localization and lack of clustering is fully consistent with previous results from segregation analysis of DNA fingerprints which showed that the numerous hypervariable DNA fragments detected by polycore probes are derived from multiple and dispersed autosomal loci, although the chromosome localization of individual fragments could not be deduced from DNA fingerprints.

The cloned minisatellites so far localized tend to be derived from the larger human autosomes (Table 1), as expected if they are dispersed randomly over the human genome. In the absence of precise regional localization, it remains possible that these mlnisatellltes are preferentially located at centromeres and telomeres, which are rich in simple sequence satellite DNA. However, segregation analysis of DNA fingerprint fragments in recombinant inbred strains of mice has shown that murine minisatellites are not preferentially associated with centromeres or telomeres, and it is likely that their human counterparts are similarly dispersed.

Example 3 Mlnisatelllte probe sensitivity and forensic applications The tandem repetitive minisatellite probes which have been tested are very sensitive, presumably as a result of the repetitive nature of both the hybridization probe and the target· minisatellite DNA. The Southern blot autoradiographic signal obtained after overnight hybridization is saturated at probe DNA concentrations of >0.1 ng/ml (data not shown), and signals can be readily obtained from 60 ng or less of human genomic DNA (see Fig llA). Similarly, depending on the genotypes of the individuals tested, these probes can detect an admixture of 2% or less of one individual's DNA with another (see Fig 11B).

The sensitivity and variability of these locusspecific mlnlsatellite probes makes them particularly useful in forensic medicine. Fig 11C shows an analysis of semen stains from two victims who had been sexually assaulted and murdered, where the recovery of DNA from the second victim was insufficient for conventional DNA fingerprint analysis which requires at least 0.5 pg DNA per test (see Patent Specification No . -3e,) Thus Figure 11 shows an assessment of the sensitivity of locus specific probes and their application to the forensic analysis of a double rape/murder case. In Figure llA decreasing amounts of human DNA digested with Hinfl were Southern blot hybridized with 32p-labelled insert DNA from MSI. Filters were autoradiographed in the presence of an intensifier screen for 1 week. In Figure 11B decreasing amounts of individual A DNA were mixed with 4 pg individual B DNA in the Indicated ratios, and Southern blot hybridized, with Λ MSI as in Fig llA. In Figure 11C victims X and Y had been sexually assaulted and murdered. A suspect Z had been charged with the murder of Y, and forensic evidence further suggested that both X and Y had been murdered by the same individual. DNA from the following forensic specimens was isolated and analysed; a, hair from X taken two days post—mortem; b, a mixture of semen and vaginal fluid recovered from the pubic hair of X; c, fresh blood from suspect Z; d, cardiac blood taken one day post-mortem from Y; e, vaginal swab from Y bearing semen, blood and vaginal material; F, a stain from Y's skirt bearing semen and blood. Samples a and b had been stored dry at 4° for 3 years, samples d and e at 4° for 2 months and sample f stored dry at 4° for 2 months. DNA was extracted following the procedures of Gill, Jeffreys and Werrett (1985) Nature 318, 577-579, digested with Hlnfl and Southern blot hybridized to 32p_ labelled A MSI insert. 0.8 pg DNA was analysed in each sample, except for sample e (0.1 pg DNA) and f (0.04 pg DNA). Autoradiography was for one week in the presence of an intensifier screen. Note that the semen stains b, e and f each contain two hybridizing DNA fragments which are not attributable to the victim. In addition, sample b contains the victim's alleles derived from vaginal DNA. The semen alleles in b, e and f are indistinguishable, suggesting that victims X and Y had indeed been sexually assaulted by the same man. The alleles of suspect Z do not match those of the semen stains.

These results were confirmed by hybridization with AMS31 (data not shown) and by DNA fingerprint analysis of larger amounts of forensic material. In the light of this evidence, the charges preferred against the suspect were discontinued by the crown prosecutor.

Example 4 Pooled mlnisatelllte probes The sensitivity of these minisatellites in Southern blot hybridizations permits pools of probes to be used to detect variable DNA fragments from several loci' simultaneously, as shown for a pool of 5 probes (pAg3, AMS1, AmS8, AMS31 and AMS43) in Fig 10. In theory, the number of ^ different DNA fragments detectable by 5 probes is ^1 + Hi), where Hf is the heterozygosity of the i th probe. For these 5 probes, on average 9.78 fragments should be detected per individual. In practice, 8.4 * 1.2 (S.D.) bands > 2 kb are resolved (40 randomly selected individuals tested). This loss of resolvable bands is partly due to exclusion of the small (1.6 kb) and relatively common pAg3 allele (Example 1, mean loss per individual · 0.33 band), but is mainly the result of electrophoretic comigration of different minisatellite alleles.

The multilocus Southern blot patterns are highly individual-specific with only 182 (S.D. ♦ 112) of DNA fragments shared between pairs of randomly—selected North Europeans (40 pairs tested). For sibs, the level of fragment sharing rises as expected to —572 (10 sib pairs tested).

In father/mother/child trios, all offspring fragments can be traced back to the parents (Fig 12). Each offspring contains 3.4 ♦ 0.5 (S.D.) DNA fragments which are specifically of paternal origin, and an equal number of maternal—specific DNA fragments (10 father/mother/child trios tested).

Thus as indicated above, Figure 12 shows the detection of multiple hypervariable loci in human DMA by hybridisation with pooled mlnlsatellite probes. 4 pg DNA samples from a random selection of English people (1—6), from sib pairs (7, 8 and 9, 10) and from father/child/mother family groups (11, 12, 13 and 14, 15, 16) were digested with Hinfl and electrophoresed though a 0.82 agarose gel until all 5δ fragments less than 2 kb had electrophoresed off the gel.

The digests were Southern blot hybridized with 2 ng of insert DNA from each pAg3, AMS1, AMS8, AMS31 and AMS43j inserts were pooled prior to labelling with 32p by random oligonucleotide priming. Variations in band labelling intensity presumably arise from variability in the efficiency of labelling and hybridization of individual probes. 7 CERTIFIED CELL LINES - CCL The L-M(TK') subline is potentially useful in a variety of genetic and biochemical studies, including somatic cell hybridization (Proc. Nat. Acad. Sci. 69.-5IO-5I4,1972) and gene transfer studies (ibid.. 77:1583-1587. 1980). No deterioration ingrowth potential was detected when ATCC stocks were cultured in medium supplemented with up to 60 pg/ml BUdR and the cells exhibited their sensitivity to HAT selection medium.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: unknown. 15 at ATCC.

Freese Medium: Culture medium, 95%: dimethyl sulfoxide (DMSO). 5% antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Dulbecco's modified Eagle's medium with 4.5 g/L glucose. 90% fetal bovine serum, 10% antibiotic-free. Growth Characteristics of Thawed Cells: An inoculum of 5 x 10* viable cells/ml in the above culture medium at 37°C will increase -fold in 7 days provided the pH is maintained at 7.2 and the cultures are refed on day 4.

Plating Efficiency: Approximately 60% in the above culture medium.

Morphology: Fibrobiast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 40 Cells:_I 5 6 2 6 8 I I I_ Chromosomes: 40 42 43 44 45 46 47 48 49 The stemline chromosome number is hyper-diploid with the 2S component occuring at 3.8% Twenty-one markers were common to nearly all S metaphases studied. Of these, t2arebiarmed(M(-M |j) and 9 are acrocentric (M ij-^2i)· Four markers M 2. M«. Ms and Mg, respectively i (4). i (6). :(8) and i (14) are isochromosomes and M (is t (x:3). Normal chromosomes 14,15. 16 and 17 were absent. Normal X was present in the majority of cells.

Sterility: Tests for bacteria, mycoplasma and fungi were negative.

Species: Confirmed as mouse by isoenzyme analysis.

Reverse Transcriptase: Positive.

Tumorigenicity: Tumors developed wi*thml4 days at 100% frequency (5/ 5) in nude mice inoculated subcutaneously with 107 cells. Biochemical Markers: Resistant to bromodeoxyuridine.

Submitted by: T.R. Chen, American Type Culture Collection, Rockville, Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 2_HtLa_(Eplfheloid carcinoma, cervix, Human)_ HeLa was the first aneuploid. epitheliaHike cell line to be derived from human tissue and maintained continuously by serial cell culture. It was isolated by G.O. Gey, W.D. Coffman, and M.T. Kubicek in February, 1951, from a carcinoma of the cervix of a 31 year-old Negro female (Cancer Res. !2:264.1952). In a recent re-examination of the original slides Jones tt at. (Obstet. Gynecol. 38: 945-949. 1971) diagnosed the tumor as an adenocarcinoma. Since its origin, it has been one of the most widely studied cell lines.

A plasma clot culture was sent to W.F. Scherer in May. 1952, who maintained it serially in monolayer cultures in a medium consisting of human serum, 40%; chick embryo extract, 2% and Hanks* balanced salt solution. 58%. In 1954. the line was frozen (Proc. Soc. Exp. Biol. Med. 87: 480, 1954). and stored until 1959, at which time it was recultured and refrozen until I960. After another recultivation and freezing, it was reactivated in November, 1961. for the American Type Culture Collection.

The line was submitted at approximately the 76-88 passage level, and may be considered most similar in characteristics to (he cells described in the classic studies of Scherer, Syverton, and Gey (J. Exp. Med. 97:695. 1953).

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown: 90-102 from culture received by W.F. Scherer. 1952.

Freeze Medium: Basal medium (Eagle) with Hanks' BSS, 80% human serum. 15% glycerol. 5% antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids and Earle's BSS, 90%; human serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 0.5 - 1.0 x 105 viable cells/ml in above culture medium at 37 C. in an atmosphere of 5% carbon dioxide-95% air. multiplies approximately 15-fold in 7 days.

Plating Efficiency: Approximately 45% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution SO Cells: 2n - 46 Cells:_15259 13 83111 I Chromosomes: 70 78 79 80 81 82 83 84 85 86-147-164 There is a small telocentric chromosome in 98% of the cells. 100% aneuploidy in 1385 cells examined. Four typical HeLa marker chromosomes have been reported in the literature. (For details see references 28-30 on page x of this catalogue). Marker No. 1 is a rearranged long arm and centromere of chromosome I and the long arm of chromosome 3. Marker No. 2 is a combination of short arm of chromosome 3 and long arm of chromosome 5. Marker No. 3 is an isochromosome of the short arm of chromosome 5. Marker No. 4 consists of the long arm of chromosome 11 and an arm of chromosome 19.

HeLa Marker Chromosomes: One copy of No. I. one copy of No. 2. four-five copies of No. 3. and two copies of No. 4 as revealed by G-banding patterns.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Conbrmed as humao by immunofluorescence test Virus Susceptibility: Susceptible to poliovirus type I and adenovirus type 3.

CERTIFIED CELL LINES — CCL DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 38*.

Freeze Medium: Culture medium. 93% dimethyl sulfoxide (DMSO). 7%; antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids and Earle's BSS. 90% fetal bovine serum. 10% antibiotic-free.

Growth Characteristics of Thawed Ceils: An inoculum of IO5 viable cells in 3 ml of the above culture medium per T-15 flask, yields a 3-5 fold increase within 6 days at 37.5 C. provided medium is renewed thrice weekly and the pH is maintained at 7.3-7.4 with a 1 θ humidified mixture of 5-10% carbon dioxide-air.

Plating Efficiency: Approximately 12% in above culture medium.

Morphology: Epithelial-like.

Karyoiogy: Chromosome Frequency Distribution 100 Cells: 2n = 60 Cells:_28I5 27 9959I2IIIIII 7 Chromosomes: 52 53 54 55 56 57 58 59 60-67 68 69-79-87-94-98 103-110 One large submetacentric marker chromosome. Most of the cells contained a chromosome with a secondary constriction and many of the cells contained dicentric chromosomes.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as monkey by immunofluorescence test. 0 Virus Susceptibility: Susceptible to poliovirus type 1. SV40 virus, and vesicular stomatitis (Indiana Strain) virus.

Reverse Transcriptase: Not detected.

Submitted by: Η. E. Hopps. Division of Biologies Standards. National Institutes of Health, Bethesda. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

’This reference stock replaces the seed stock (passage 50) described in the first edition of the Registry.

ATCC CCL 28_Dempsey_(Skin, Human) Klinefelter's syndrome, XXXXY_ The Dempsey human skin cell line was established byT.C. Hsu and L. Lockhart in April, 1964. from a 2½ year-old male child with Klinefelter Syndrome containing a sex chromosome complement of XXXXY. The cells were cultivated in McCoy's medium containing 20% fetal bovine serum. Autoradiography experiments have demonstrated that the cells have three late replicating X chromosomes and a diploid chromosome number of 49 (Hereditas 52: 320. 1965). The Dempsey cell line was submitted to the 0 American Type Culture Collection in the 8th passage in August. I964f This cell line should be considered provisionally to have a finite life expectancy.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 21.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 93% (dye exclusion).

Culture Medium: McCoy's 5a medium, 80%; fetal bovine serum. 20%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 103 viable cells/ mJ in the above culture medium at 37 C. in an atmosphere of % carbon dioxide-95% air, multiplies 3-4 fold in 7 days.

Morphology: Fibroblast-like. 0 Karyoiogy: Chromosome Frequency Distribution 59 Cells: 2n = 46 Cells:_1244366 29 3 I Chromosomes: 41 42-44 45 46 47 48 49 50-95 Stability graph shows 100% stability in the stemline number (49). Karyotypes of cells with stemline number of chromosomes were stable with all cells having three extra chromosomes in the X. 6-12 group.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. and vesicular stomatitis (Indiana Strain) virus.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type R. 5Q Submitted by: T.C. Hsu, Section of Cytology. University of Texas. M.D. Anderson Hospital. Houston. Texas.

Prepared and characterized by: Institute for Medical Research. Camden, New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 30_RPMI 2650_(Nasal septum. Human) Quasi-diploid tumor_ The RPMI 2650 cell line was established in July. 1962. by G.E. Moore and A. A. Sandberg (Cancer 17:170. 1964) from the pfeurai effusion of a patient with an extensive malignant tumor of the nasal septum. The tumor was diagnosed as an anaplastic squamous cell carcinoma. The cells were originally grown in RPM] medium 906K and 2-5% fetal calf serum, but also grew well in other culture media. The cell line was grown on glass by Moore and Sandberg for 35 transplants apparently without alteration of the normal karyotype, however Moorhead re-analyzed the karyotype of the RPMI 2650 cells (Exp. Cell Res. 39: 190, 1965) and found that although the chromosome number was 46 there was a consistent minor rearrangement involving the D group of chromosomes. The d CERTIFIED CELL LINES - CCL ATCC CCL 39 (continued) nearly-normal karyotype, the stability of chromosome number, and probable origin from malignant celts make this cell line unique among the permanent human cell lines available. RPMI cells have been subcultured in excess of 100 passages. The cell line was submitted io the American Type Culture Collection in the 15th passage in January. 1963. and was grown up to the 22nd passage in minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS and 10% fetal calf serum.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 22.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-fret.

Viability: Approximately 30% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids and Earle's BSS. 90%; fetal calf serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 0.5-1.0 x IO5 viable cells/ml in the above culture medium at 31 C in an atmosphere of 5% carbon dioxide-95% air. multiplies approximately 4-fold in 7 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Epithelial-like. The cells are very small and grow in dense clusters on glass in freshly seeded culture vessels. The clusters fuse to form a thick layer of cells with production of mucoid material.

Karyology: Chromosome Frequency Distribution 53 Cells: 2n = 46 Cells:_2 2 4 37 I I I I I I 2 Chromosomes: 43 44 45 46-49 50-64-73-82-87-92 100% of cells karyotyped contained: one marker chromosome morphologically like a 113-15 chromosome but with unusually large short arms: one marker chromosome, morphologically like a *18 chromosome with small short arms: and one unusually large *19-20 chromosome. Marker chromosomes may have resulted from reciprocal translocations. Cells in stemline number show karyotype stability (one cell had a break in *6-12 chromosome, one cell had a *13-15 ring chromosome).

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Specie*: Confirmed as human by cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. herpes simplex virus, and vesicular stomatitis (Indiana Strain) virus. Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: G.E. Moore. Departments of Surgery apd Medicine. Roswell Park Memorial Institute. Buffalo. New York. Prepared and characterized by: Institute for Medical Research, Camden. New Jersey and American Type Culture Collection, Rockville. Maryland.

ATCC CCL 32_MB III (de Bruyn-Gey)_(Lymphosarcoma, Mouse) _ Strain MB III was derived in 1947. by W.M.deBruynandG.O. Gey. (Acta Unio Internationale contra Cancnim 7.-772.1952) as one of three cell strains (MB I. II. and ill) with tumor-producing and non-tumor-producing properties initiated from a mouse lymphosarcoma MB (T86I57) which originated in 1935. as a spontaneous tumor that arose in a Fl hybrid of the dilute brown Murray-Little strain and C57 black strain. The primary strain, MB I, consisted of a mixed population of lymphoblasts and fibroblasts and is tumor-producing. Strain MB III was derived from a culture of MB I. in which the fibroblasts gradually disappeared and the round lymphoblastic cells became predominant. Concurrent with the disappearance of the fibroblasts, the tumor producing capacities of the strain were lost.

The original stock of MB 111 cells was cultivated in 66% human placental cord serum, 16% bovine embryo extract and 18%GeyY BSS containing 100 units of penicillin per ml. The medium was later altered to 50% human placental cord serum. 10% bovine embryo extract and 40% Gey's BSS. The MB 111 cells have been readily adapted to a wide variety of the media (Eagle's. Waymouth's etc.) supplemented with serum. In contrast to the early Μ B strains the Μ Β II1 cells grow readily in suspension systems. They were the first cells to be grown in suspension.

Strain MB Ill has been employed in studies relating to: (I) tumorigenicity. (2) suspension culture systems. (3) chromosome constitution. (4) cell nutrition and (5) rickettsia.

A roller tube of MB III grown on Eagle's MEM * 30% calf serum was submitted to the American Type Culture Collection in March. 1965. The medium was altered to Eagle's MEM. with non-essential amino acids and sodium pyruvate in Earle's BSS plus 10% newborn calf serum and the cells were adapted to static cultures for characterization (Cancer Res. 9:282.1949; ibid.. 9:395.1949. Ann. N.Y. Acad. Sci. 58: 1039.1954; J. Immunol. 76:475. 1956; J. Exp. Med. /09:271. 1959; J. Biol. Chem. 234: 1042. 1959; Proc. Soc. Exp. Biol. Med. 100: 686. 1959; J. Nat. Cancer Inst. 28: 1333. 1962).

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown.

Freeze Medium: Culture medium. 95%: glycerol, 5%; antibiotic-free.

Viability: 85-90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle), with non-essential amino acids, sodium pyruvate, and Earle's BSS, 90%; newborn calf serum, 10%; antibiotic-free.

Growth Characteristic* of Thawed Cells: An inoculum of 2 x 10s cells in 3 ml of the above culture medium per Τ-15 flask yields* 6-8 fold increase with 7 days at 37 C, provided the medium is renewed twice weekly and the pH adjusted to 7.2 with a humidified mixture of S or 10% carbon dioxide in air. Subcultures are prepared by shaking or gentle mopping Fluting Efficiency: Not measurable in the above culture medium.

Morphology: Lymphoblast-like.

CERTIFIED CELL LINES - CCL ATCC CCL 53.1 (continued) Culture Medium: Ham's FIO medium. 82.5¾. horse scrum (not inaclivaied). 15%. fetal bovine serum (not inactivated). 2.5% antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 10' viable cells/ml in the above culture medium, multiplies 7-8 fold in 7 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 40 Cells:_I 1312545 14 741 I I Chromosomes: 72-76 77 78 79 80 81 82 83 84 85 86-97-166 Stemline number is hypertetraploid. Karyotype is stable within stemline number. Marker chromosomes: A medium size chromosome with a submedian centromere and a smaller chromosome with a median centromere. The remaining 81 chromosomes have terminal centromeres, the first one is larger than normal. A minute chromosome was noted in 20% of the cells.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as mouse by cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to herpes simplex, vaccinia, pseudorabies and vesicular stomatitis (Indiana Strain) viruses. Not susceptible to poliovirus type I.

Melanin Production: The clone produced melanin in over 50% of the cells for at least 33 passages after recovery from the frozen state. Tumorigenicity: Melanotic tumors developed after inoculation of 10* cells in five out of six C57BL mice.

Reverse Transcriptase: Positive.

Submined hy: G. Sato. Department of Biochemistry. Brandeis University. Waltham. Massachusetts.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville, MarylandATCC CCL 54 Detroit S32_(Skin, Human) Down's syndrome, male_ Detroit 532 is a fibroblast-like cell line which has an apparent finite life span of approximately 30 serial subcultures from the tissue of origin with a subculture interval of approximately 4 days and a subcultivation ratio of I to 3-5. lt was derived in 1964, by C.S. Stulberg and W.F. Simpson from foreskin tissue of a 2-month-old Caucasian infant with Down's syndrome (mongolism) and is one of a series of strains with abnormal chromosomal (aneuploid) configurations being developed for the Animal Cell Culture Collection Committee. The primary cultures were established from I mm fragments of minced tissues which were allowed to attach to the bottom of petri dishes after placement (to avoid floating) in small volumes of minimum essential medium (Eagle) with non-essential amino acids and Earle's BSS. 90% fetal bovine scrum. 10%, and supplemented with lactalbumin hydrolysate. 0.1%and sodium pyruvate, I mM per L. The primary explants were incubated in a 5% carbon dioxide-95% air atmosphere at 37 C. with frequent changes of medium until fibroblast-like outgrowths had formed dense cellular networks covering the growth areas (30days). Cells were removed with 0.2% trypsin and thereafter subcultured in the above medium. Antibiotics were employed through the first 7 subcultures and then discontinued. A modal chromosome number 47. with trisomy for group 21. has been characteristic of approximately 75% of tbe population since its origin.

Susceptibility to virus strains includes picornaviruses (poliovirus, types 1,2.3: echovirus, types 9.11: Coxsackie virus type A9: and certain rhinoviruses); adenovirus, types 3.7; parainfluenza virus, type 3. vaccinia.virus; and herpes simplex virus. Detroit 532 cells have been used at the Child Research Center of Michigan for the isolation and propagation of cytomegaloviruses.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 9.

Freeze Medium: Basal medium (Eagle). 80%: fetal bovine serum. 15%: glycerol. 5%: antibiotic-free.

Viability: Approximately 92% (dye exclusion).

Culture Medium: Minimum essentia) medium (Eagle) with non-essential amino acids, sodium pyruvate (I mM per L). lactalbumin hydrolysate (0.1%). and Earle's BSS. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Chancteristb of Thawed Cells: An inoculum of 0.5 - 1.0 x IP viable cells/ml in the above culture medium at 37 C. in aa atmosphere of 5%· carbon dioxide-95% air. multiplies approximately 3-5 fold in 4 days. The cells have a total life expectancy of approximately 30 serial subcultures from the tissue of origin with a subculture interval of approximately 4 days and a subcultivatioa ratio of I to 3-S.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 100 Cells: 2n = 46 Cells:_2 1 2 2 13 74 3 I 2 Chromosomes: 42 43 44 45 46 47 48-94>94 Approximately 75% of the cells are trisomic for group 21 which constitutes a chromosomal marker characteristic of cells from individuals with Down's syndrome.

SteriUty: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by immunofluorescence test and karyology.

Vires Susceptibility: Susceptible to poliovirus type I.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submined by: C.S. Stulberg. Child Research Center of Michigan, Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan, Detroit. Michigan and American Type Culture Colkctioa. Rockville. Maryland. 1 CERTIFIED CELL LINES - CCL ATCC CCL 65_Detroit 525 (Skin, Human) XO plua centric fragment. Turner'» ayndronx_ Detroit 525 is one of a series of fibroblast-like cell lines developed from individuals with abnormal (aneuploid) chromosomes for (he American Type Culture Collection by methods previously described in this Catalogue (see CCL 54; Detroit 532). It was derived by W.F. Simpson. C.S. Stulbergand W.D. Peterson. Jr., in October. 1963. from skin tissue obtained from a three and one-half year-old Caucasian female who exhibited some of the symptoms diagnostic of Turner's syndrome. Karyotypic analysis of the cell population showed that a major part of the cell population (95%) has 45 chromosomes and a centric fragment (J. Ped. 66: 120. 1965). Sex chromatin was not found, and it was concluded that an X chromosome is missing. The centric fragment may be either the remnant of the X chromosome or a deleted Y chromosome lacking male determinants. The karyotypic findings have persisted through thirty transfers of the cell strain (Proc. Southern Soc. Ped. Res. 5: 12. 1964).

This cell line has an apparent finite life expectancy of approximately 30 serial subcultures from the tissue of origin, with a subculture interval of approximately 4 days and a subcultivation ratio of I to 2 or 2 to 3. A culture in the 16th passage was submitted to the American Type Culture Collection.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 16.

Freeze Medium: Basal medium (Eagle). 80%; fetal bovine serum. 15%; glycerol. 5%; antibiotic-free.

Viability: Approximately 85% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids, sodium pyruvate (ImM per L). lactalbumin hydrolysate (0.1%). and Earle's BSS. 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 0.5 - 1.0 x 105 viable cells/ml in above culture medium at 37 C. in an atmosphere of 5% carbon dioxide-95% air. multiplies approximately 2-3 fold in 4 days, for the number of subcultures indicated above.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology1 Fibroblast-like.

Karyology: Chromosome Frequency Distribution 100 Cells; 2n = 46 Ceils: _790 I 2 Chromosomes: 45 46 47-92 Centric fragment counted as one chromosome in above frequency distribution. Approximately 95% of the cells possessed the centric fragment.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Specie: Confirmed as human by immunofluorescence test and karyology.

Virus Susceptibility: Susceptible to poliovirus type I.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted hy: C.S. Stulberg, Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection, Rockville. Maryland.

ATCC CCL ¢6_Detroit 529 (Skin, Human) Trisomy for X and a group G chromosome, Down’s syndrome Detroit 529 is one of a series of fibroblast-like cell lines developed from individuals with abnormal (aneuploid) chromosomes for the American Type Culture Collection by methods previously described in this Catalogue (see CCL 54; Detroit 532). It was derived by W.F. Simpson. C.S. Stulberg and W.D. Peterson. Jr., in October. 1963; from skin tissue obtained from a two and one-half year-old Caucasian female who exhibited symptoms and signs of Down's sy ndrome (mongolism). Karyotypic analysis showed that a majority 190%) of the cell population demonstrated the expected trisomy of a group G chromosome. In addition, trisomy of the X chromosome was evidenced by karyotyping as well as by finding two Barr bodies in a high proportion of appropriately stained cells (Proc. Southern Soc. Ped. Res. 5:12, 1964).

This cell line has an apparent finite life expectancy of approximately 30 serial subcultures from the tissue of origin, with a subculture interval of approximately 4 days and a subcultivation ratio of I to 2 or 2 to 3. A culture in the I Ith passage was submitted to the American Type Culture Collection.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 11.

Freeze Medium: Basal medium (Eagle). 80%; fetal bovine serum. 15%: glycerol. 5%; antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids, sodium pyruvate (ImM per L). lactalbumin hydrolysate (0.1%). and Earle's BSS, 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 0.3 - 0.5 x 105 viable cells/ml in above culture medium at 37 C. in an atmosphere of 5% carbon dioxide- 95% air, multiplies 2-3 fold in 4 days for the number of subcultures indicated above.

Flaring Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

JNES - CCL ATCC CCL 66 (continued! Karyology: Chromosome Frequency Distribution 100 Cells: 2n = 4b Cells._4 I 689 Chromosomes: 45 46 47 48 Approximately 90% of cells analyzed showed trisomy for both X and a group C chromosome.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by immunofluorescence test and karyology.

Virus Susceptibility: Susceptible to poliovirus type I.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: C.S. Stulberg. Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 68_Sf I Ep (NBL-11)_(Epidermis. Cottontail rabbit, Sylvilagus floridanus)_ The Si I Ep (NBL-I I, cell line was initiated by AJ. Kniazeff. W.A. Nelson-Rees, and R.B. Owens, on December 31.1964. from minced ear epidermis of an adult male cottontail rabbit which had papillomatosis. The cells were initiated in minimum essential medium (Eagle) with non-essential amino acids, and Earle's BSS with reduced bicarbonate (0.85 g per L). 80%: newborn bovine serum. 20%; penicillin (250 u/ml): streptomycin (0.1 mg/L). polymyxin (50 u/ml); fungizone (0.03 mg ml). All antibiotics were omitted starting with the 3rd passage. The serum concentration was reduced to 10% (passage 2 to 66) and fetal bovine serum was utilized from passage 31 to 66. This line has been cultured continuously at pH 7.4-7.6 and 37 C. but can be adequately maintained at 25 C. Cell morphology varied from fibroblast-like to epithelial-like in early passages. A gradual loss of fibroblast-like cells has resulted in the stabilization of fairly uniform epithelial-like cells, which tend to become spindle-shaped when crowded.

The cell line was developed especially for studies of epidermis specific virus replication (Shope Papilloma. Rabbit) and may be useful in studies of viruses producing lesions in the skin. The reference seed stock was frozen on April 21. 1967. at the 66th serial passage. It has been demonstrated that the cells can be successfully propagated for at least 20 passages beyond the frozen reference seed stock.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 66.

Freeze Medium: Culture medium. 90%: dimethyl sulfoxide (DMSO). 10%; antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Cuhure Medium: M inimum essential medium (Eagle) with non-essential amino acids and Earle's BSS with reduced bicarbonate (0.85 g per L). 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 4 x 10-' viable cells in a 3 oz bottle will yield 2.8 χ 106 cells in 6 days. (Fluid change required on 3rd day.) Plating Efficiency: Less than )% in above culture medium.

Morphology: Epithelial-like.

Xaryology: Chromosome Frequency Distribution 51 Cells: 2n = 42 Cells:_2 I 8 35 3 I I Chromosomes: 39 40 41 42 43 44-47 The diploid number ± 1 chromosome is found in 90% of the cells. Chromosome rearrangements (dicentrics) observed inca. I2%of the metaphases. Apposition of centromeres noted frequently between small and large telocentric at late prophase.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as rabbit by fluorescent antibody (indirect) technique.

Virus Susceptibility: Susceptible to herpes simplex, reovirus type 3. vaccinia, vesicular stomatitis (Ogden Strain) viruses. Not susceptible to adenovirus type 5. Coxsackie A-9 and B-5. and poliovirus type 2.

Reverse Transcriptase: Not detected.

Submitted by: A J. Kniazeff. W.A. Nelson-Rees, and R.B. Owens. University of California. School of Public Health. Naval Biological Laboratory, Berkeley. California.

Prepared and characterized by: University of California. Naval Biological Laboratory, Berkeley, California and American Type Culture Collection. Rockville, Maryland.

ATCC CCL 70_CV-1_(Kidney, African Green Monkey» Cercoplthcau aethiops) The CV-1 cell line was derived from the kidney of a male adult African green monkey hy F.C. Jensen et el. in March, 1964 for use io Rous sarcoma virus transformation studies (Proc. Nat. Acad. Sci. 33:53, 1964). The cells were grown in a modified Eagle's basal medium (containing twice the concentration of amino acids and vitamins) in Earle's balanced salt solution and 10% calf serum and 25 mcg/ml of aureomycin. The cells grow rapidly and form monolayers of fibroblast-like cells that support the multiplication of SV40 virus with pronounced degenerative changes (CPE). M onolayers of CV-1 cells can be maintained on maintenance media fi: as long as 4 weeks without a medium change. The cells have been cultured for 90 passages although some shift in chromosome number begins to 3 CERTIFIED CELL LINES - CCL appear at these high passage levels. CV*| cells have been used to demonstrate thymidine kinase activity following simian, adeno and papovavirus infect ions (Virology 27.-453.1965). The cell line wassubmittcd to the American Type Culture Collection in March. 1966. in the 15th passage.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 22.

Freeze Medium: Culture medium, 95% dimethyl sulfoxide (DMSO). 5% antibiotic-free.

Viability: Approximately 76% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids and Earle's BSS 90%; fetal bovine serum. 10% 10 antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 10* viable cells/ ml in the above culture medium, multiplies 5-fold in 6 days. Ptating Efficiency: Approximately 27% in the above culture medium.

Morphology: Fibroblast-like.

Karyoiogy: Chromosome Frequency Distribution 56 Cells: 2n = 60 Cells:_1 I 8 41 I I 1 I 1 Chromosomes: 56 57 58-60 61 -64-98-(I0-120 Stemline number is diploid. Karyotype shows normal diploid male with a pair of marker chromosomes. The karyotype remains diploid for at least 20 passages after recovery from the frozen state.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as monkey by cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. herpes simplex. Eastern equine encephalitis. Western equine encephalitis. California encephalitis and SV40 viruses.

Reverse Transcriptase: Not detected.

Submitted by: F.C. Jensen. The Wistar Institute of Anatomy and Biology, Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research, Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 71_CAR _(Fin tissue. Goldfish, Carassius auratus)_____________ The adult goldfish (CAR) cell line was established by L. Moewus-Kobb from the fin tissue of the goldfish and grown in basal medium (Eagle) with Hanks* balanced salts. 85% fetal bovine serum. 15% at 25 C. This cell line has been found to support the multiplication of the grunt fin agent with resulting cytopathic eflect at both 20 C and 25 C (Ann. N.Y. Acad. Sci. 126:344.1964). A culture in the 72nd serial passage was submitted to the American Type Culture Collection in April I966.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 87.

Freeze Medium: Culture medium. 90% dimethyl sulfoxide (DMSO), 10% antibiotic-free.

Viability: Approximately 93% (dye exclusion).

Culture tMedium: Basal medium (Eagle) with non-essential amino acids in Hanks'BSS. 85%: fetal bovine serum. 15%: antibiotic-free. Growth Characteristics of Thawed Cells: An inoculum of I0* viable cells/ml in the above culture medium at 25 C. multiplies approximately 3-4 fold in 7 days.

Ptating Efficiency: Approximately 6% in the above culture medium.

Morphology: Fibroblast-like.

Karyoiogy: Chromosome Frequency Distribution 50 Cells: 2n = I02 Cells:_I0 22I22I2 42 2 1 I 9 Chromosomes: 70-90-92 93 94 95 96 97 98 99-I0I-II l-l I5-I34-I83 No marker chromosomes. Minute chromosomes are present in every cell. Stemline number is 97 and the karyotype is unstable. All 45 of the chromosomes are small.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as goldfish by the cytotoxic-antibody dyc-cxclusion test.

Virus Susceptibility: Susceptible to infectious pancreatic necrosis virus of trout at 28 C. Not susceptible to polio type I or herpes simplex viruses.

Reverse Transcriptase: Not detected.

Submitted by: L. Moewus-Kobb. University of Miami School of Medicine. Department of Microbiology. Coral Gables. Florida. Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL n Detroit Sit_(Skin, Human) Galactosemia_ Detroit 510 is one of a series of fibroblast-like cell lines of human origin developed for the American Type Culture Collection by methods previously described in this Catalogue (sec CCL 54*. Detroit 532). it was derived by C.S. Stulberg. W.F. Simpson, and W. D.

Peterson. Jr., in June. 1962 from skin tissue obtained fror· a nine-month-old Caucasian ':m*le with galactosemia. The cells have been shown to be deficient in galactose metabolism by growth studies and by attempts to detect galactose-1 -phosphate transferase enzyme activity using the procedure of Η. M. Kalckar tt ai (Biochem. Biophys. Acta. 20:262,1956) on extracts of the cells. Detroit 510 cells. /·* <· υ a CERTIFIED CELL LINES - CCL ATCC CCL 72 (continued) without detectable transferase activity, have been shown to conven [ l-'*C]galactose to "carbon dioxide to the same extent as normal cells but at a significantly slower rate and that glucose inhibits galactose utilization in this system (Science 17S: 1368-1370. 1972).

Detroit 510 appears to be karyotypically normal, with 90% of the cell population having 46 chromosomes. Eagle, et al. have used this cell line to study mechanisms of contact inhibition, which showed the suppression of DNA. RNA. and protein synthesis in conjunction with the disappearance of free polyribosomes in the cytoplasm. These effects were reversed on subculture (Proc. Nat. Acad. Sci. 53: 350. 1965. Science 148: 42. 1965)’ This cell line has an apparent finite life expectancy of approximately 30 serial subcultures from the tissue of origin, with a subculture interval of approximately 4 days and a subcultivation ratio of I to 2 or 2 to 3.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 15.

Freeze Medium: Basal medium (Eagle). 80%: fetal bovine scrum, 15%: glycerol. 5%.: antibiotic-free.

Viability: Approximately 95% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids, sodium pyruvate (ImM per L). lactalbumin hydrolysate (0.1%). and Earle’s BSS. 90%: feta) bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of approximately 0.5 x 10s viable cells ml in above culture medium at 37 C. in an atmosphere of 5% carbon dioxide-95% air. multiplies 2-3 fold in 4 days, for the number of subcultures indicated above.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 100 Cells: 2n - 46 Cells:_I I I 2 4 90 I Chromosomes: 37-42 43 44 45 46 47 Approximately 90% of the cell population have the normal chromosomal number of 46. and the morphology appears to be normal. Sterility: Tests for mycoplasma, bacteria, and fungi were negative Species: Confirmed as human by immunofluorescence test and by karyology.

Virus Susceptibility: Susceptible to poliovirus type I.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: C.S. Stulberg. Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Resear;h Center of Michigan. Detroit. Michigan and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 73_Ch 1 Es (NBL-8)_(Esophagus, Goat, Copra kireus)_ TheCh I Es (NBL-8) cell line was initiated by A J. Kniazeff, W.A. Nelson-Rees. N.B. Darby, Jr., and R. Owens, on March 19.1965. (Cytogenetics 6:436-450. 1967) from the trypsinized esophagus of a 2 3 term, male goat fetus. The resulting cultures were confluent within 6 days and the cells were predominantly fibroblast-like. The cells have been grown continuously in Eagle's MEM with non-essential amino acids, and Earle's BSS with reduced bicarbonate (0.85 g per L). 90%; fetal bovine serum. 10%; antibiotic-free; pH 7.4-7.6.

This cell line was developed for use in studies of viruses that affect domesticated animals and has been used in scrapie virus studies (Rocky Mountain Laboratories). The reference seed stock was frozen on October 28. 1966. at the 68th passage, it has been demonstrated that the cells can be successfully propagated for at least 20-30 passages beyond the frozen reference seed stock. Cytological observations have consistently revealed marked chromosomal alterations at approximately the 80th passage and also in later passages.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 68.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%.; antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids, and Earle's BSS with reduced bicarbonate (0.85 g per L). 90%; fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 2 x 106 viable cells in a 16 oz bottle will yield more than 10 x IO cells in 6 days. (Fluid change required on 3rd day). Incubate at 37 C.

Plating Efficiency: Less than 1.0% in above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 60 Ceils:_1 1 I I 1 4 821 11 I Chromosomes: 46-50-53-55-57 58 59 60 61 62 Approximately 0.5% of the 500 cells examined were polyploid. Eighty percent have a number of chromosomes with ί I of the diploid and modal number. Approximately 26% of cells with 50-62 chromosomes have 1-2 atelocentric chromosomes uncommon to the species and not found in early passage cells.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed by chromosome analysis of cell samples from various passages including the 68th.

CERTIFIED CELL LINES - CCL Virus Susceptibility: At passage 23. susceptible to herpes simplex, vaccinia and vesicular stomatitis (Ogden Strain) viruses. Not susceptible to adenovirus type 5. Coxsackie A-9 and B-5 viruses, and poliovirus type 3.

Reverse Transcriptase: Not detected.

Submitted by: A.J. Kniazeff. W.A. Nelson-Rees. N.B. Darby. Jr. and R. Owens. University of California. School of Public Health.

Naval Biological Laboratory. Berkeley. California.

Prepared and characterized by: University of California. Naval Biological Laboratory. Berkeley. California and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 74_PI 1 Ut (NBL-9)_(Uterus, Raccoon, Procyon lotor)________________ The Pl I Ut (NBL-9) cell line was initiated by A.J. Kniazeff, W.A. Nelson-Rees. N.B. Darby. Jr., and R. Owens, on November 6. 1964. from trypsinized uterine tissue of an adult female raccoon. The cells have been grown continuously in minimum essential medium (Eagle) with non-essential amino acids, and Earle's BSS with reduced bicarbonate (0.85 g per L). 90%; fetal bovine serum. 10%; antibiotic-free; pH 7.4-7.6. Early passages consisted of cells which were predominantly epithelial-like. Patches of small close knit fibroblast-like cells were noticed at passage 10 and were successfully separated from the remainder of the cell population by partial trypsinization. The small fibroblast-like cells were carried as the main line and icached a proliferation peak at the 15th passage. Beyond this passage the growth rate has been slower.

This cell line was developed for studies of feline and canine viruses since the raccoon is one of the few known animals which is susceptible to both of these groups of viruses. The reference seed stock was frozen on February 16. 1967. at the 65th serial passage. It has been demonstrated that the cells can be successfully propagated for at least 20 passages beyond the frozen reference seed stock; however the rate of growth is very slow.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 65.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%. antibiotic-free.

Viability: Approximately 80% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle), with non-essential amino acids, and Earle's BSS with reduced bicarbonate (0.85 g per L). 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 2 x 10* viable cells in a 16 oz bottle will yield 6.0 χ 10* cells within 10-14 days.

(Fluid change required on days 3 and 7).

Plating Efficiency: Approximately 6.4% in above culture medium.

Morphology: Fibrobiast-like.

Karyology: Chromosome Frequency· Distribution 69 Cells: 2n = 38 Cells:_* 2 43 5 I I I 13 2 I Chromosomes: 37 38 39 40-W-75 76 77 78 Approximately 50% of the 500 cells examined were tet raploid. A satellite is seen on one or both members of the shortest pair of teloor sub-telocentric chromosomes in ca. 95% of all cells.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as raccoon by chromosome analysis of cell samples from various passages including the 65th.

Virus Susceptibility Susceptible to herpes simplex, reovirus type 3. and vesicular stomatitis (Ogden Strain) viruses. Not susceptible to adenovirus types 2 and 5. vaccinia. Coxsackie A-9 and B-5 viruses, and poliovirus type 2.

Reverse Transcriptase: Not detected.

Submitted by: A.J. Kniazeff. W.A. Nelson-Rees. N.B. Darby, Jr., and R. Owens. University of California. School of Public Health.

Naval Biological Laboratory. Berkeley. California.

Prepared and characterized by: University of California, Naval Biological Laboratory. Berkeley. California and American Type Culture Collection. Rockville, Maryland.

ATCC CCL 75_WI-38_ (Lung, diploid. Human)__ The W|-38 human diploid cell line was derived by L. Hayflick from normal embryonic (3 month gestation) lung tissue of a Caucasian female. The growth medium used was Eagle’s medium in Earle's balanced salt solution supplemented with 10% calf serum < Exp. Cell Res. 25: 585. 1961). The medium should be prewarmed to 37 C before use. The pH should be brought to 7.2 before addition of the serum. The final pH of the medium must be less than 7.4. WI-38 cells have a finite lifetime of 50 plus or minus 10 population doublings with a doubling time of 24 hours (Exp. Cell Res. 37:614. 1965). It has been shown to have one of the broadest human virus spectra of any cell population that has been tested and is especially useful for isolation of rhinoviruses. The cells are free of contaminating viruses, mycoplasma* or any other microorganism and do not form turnon when inoculated into the cheek pouch or subcutaneously into terminal human cancer patients. It has a diploid karyotype except at the very late passages. The cells do not grow •n suspension but form a multilayered membrane when held for long periods at 37 C with intermittent pH adjustments. WI-38 fibroblasts produce collagen and have been used for the preparation of a number of human virus vaccines (Am. J. Hyg. 73:240,1962; First International Conference on Vaccines Against Viral and Rickettsial Diseases of Man, Pan American Health Organization. Publication No. 147: 581. May. 1967).

The 8th passage ampule from which the reference seed stock was derived was found to contain a bacterial contaminant. The cell line *·ι subsequently cured by several passages ii the presence of antibiotics.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 10 (Approximately 12-14 cell doublings).

**·**· Medium: Culture medium. 95%; glycerol, 5% antibiotic-free. €6 CERTIFIED CELL LINES - CCL ATCC CCL 75 (continued) Viability: Approximately 90% (dye exclusion).

Culture Medium; Basal medium (Eagle) (diploid). 90%; fetal bovine serum (not inactivated). 10%. antibiotic-free.

Growth Characteristic» of Thawed Cells: An inoculum of 2 x 10* viable cells, ml in the above culture medium at 37 C multiplies 9-10 fold in 7 days Plating Efficiency: Approximately 10% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells. 2n - 46 Cells:_1 I 3 2 5 I 35 I I Chromosomes: 33 39 41 43 44 45 46 86 93 Stemline number of 46 chromosomes. The karyotype is that of a normal diploid female Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by starch-gel electrophoresis analysis of LDH and G6PD isoenzymes.

Virus SuseeptibiUty: Susceptible to poliovirus type I. herpes simplex, pseudorabies and vesicular stomatitis (Indiana Strain) viruses. Reverse Transcriptase: Not detectedIsoenzymes: G6PD type B.

Submined by: L. Hayfbck. Department of Medical Microbiology. Stanford University. Palo Alio. California.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 75.1 WI-38 VA13 sublinc 2RA (Lung, Human) SV40 virus-transformed_ Wl-38 VA13. Subline 2R A. a SV40 virus-transformed derivative of the Wl-38 cell line (See CCL 75). was derived in March. 1964. by AJ. Girardi. D. Weinstein and P.S. Moorhead (Ann. Med. Exp. Biol. Fenn. 44: 242-254.1966). Wl-38 cells cultured in Eagle's basal medium (BME) with twice the concentration of amino acids and vitamins with Earle's BSS and 10% fetal bovine serum were infected at passage 23 (Phase II) with 0.1 ml of SV40 virus (10' virus particles). The loss of contact inhibition 48 days after infection was the earliest sign of transformation followed by a departure from euploidy 57 days post-infection. Twenty weeks after infection "crisis’^. Nat. Cancer Inst. 32:917, 1964) occurred followed by the subsequent recovery and survival of several sublines. Subline 2RA ceased producing virus after 66 weeks although infectious virus can be recovered by cell fusion with African green monkey cells. The transformed cells contain both S V40 neo (T) and transplantation antigens and appear to be capable of unlimited proliferation. The ceil line was submitted to the American Type Culture Collection io the 2S3rd passage.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 260.

Freeze Medium: Culture medium. 95% dimethyl sulfoxide (DMSO). 5% antibiotic-free.

Viability: Approximately 90% (dye-exclusion).

Culture Medium: Basal medium (Eagle) with twice the concentration of amino acids and vitamins in Hanks' BSS. 90%; fetal bovine serum. 10% antibiotic-free.

Growth Characteristics of Thawed Celb: An inoculum of 1 x IP cells ml in the above culture medium at 37 C yields a 10-15 fold increase in 7 days.

Plating Efficiency: Approximately 15% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n - 46 Cells:_II1II2122157 11 641111 Chromosomes. 45 46 51 55 62 65 66 68 70 72 73 74 76 77 78 79 80 81 89 Karyotype unstable within hyperdiploid stemline range 73-78. Ninety percent of the cells examined have 2 or 3 large chromosomes with subterminal centromeres and 1-6 microchromosomes. Secondary constrictions were observed in 59% of the cells. 21% had breaks.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by agar microimmunodiffusion test.

Virus Susceptibility: Susceptible to herpes simplex, vesicular stomatitis (Indiana Strain) and poliovirus type 2.

Reverse Transcriptase: Not detectedisoenzymes: G6PD type B.

Submined by: AJ. Girardi. Wistar Institute. Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medica) Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 76 CttniHinemia_(Skin, Human)_ This human diploid fibroblast cell line was derived from a skin biopsy of a Caucasian female infant with citrullinemia in November. 1965. by W J. Mellman (Proc. Nat. Acad. Sci. 57:829.1967)- The cells were cultured in basal medium (Eagle) with twice the standard concentrations of amino adds and vitamins in Earle's BSS. 90% fetal bovine sc~um, 10% The celb grow poorly when citrulline u substituted for arginine in the above medium and they incorporate very little ’*C citrulline into cell protein. The cell line also has an abnormally low affinity for citrulline as a substrate in an bt vitro assay of arginosuccinate synthetase.

CERTIFIED CELL LINES - CCL This cell strain has an apparent finite life expectancy of approximately 34 serial subcultures from the tissue of origin. A culture in the 4th passage was submitted to the American Type Culture Collection in December. 1966.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: I2.

Freeze Medium: Culture medium. 90%; glycerol. 10%; antibiotic-free.

Viability: Approximately 88% (dye exclusion).

Culture Medium: Basal medium (Eagle) containing twice the standard concentrations of amino acids and vitamins with Hanks' BSS. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 10* viable cells/ml in the above culture medium at 37 C. multiplies 8-fold in 7 days for the number of subcultures indicated above.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 49 Cells: 2n = 46 Cells:_I I 2 40 2 I I I Chromosomes: 43 44 45 46 47 48-82-92 Stemline is diploid. Karyotype is that of a normal human diploid female with no breaks or rearrangements noted.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dye-exclusion test.

Vina Susceptibility: Susceptible to poliovirus type I. vesicular stomatitis (Indiana Strain) and herpes simplex viruses.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: WJ. Mellman. School of Medicine. University of Pennsylvania. Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 77_Ehrlich-Lettre Ascites, strain E (Ehrlicb-Lettre Ascites carcinoma, Mouse) Ehrlich-Lettre Ascites, strain E was derived in July, 1962. by C.W. Boone, ere/. (J. Nat. Cancer Inst. 34:725.1965) as an explant of a day-old tumor from the parental Ehrlich-Lettre Ascites carcinoma. Prior to development, strain E was subjected to a schedule of seven mouse passages and six in vitro passages over a period of 17'months. The cells exhibit an unusually high mean chromosome numberand possess the marker chromosomes present in the parental Ehrlich tumor. This line may be of use in comparative testing of antitumor agents in vivo and in vitro. The reference seed stock was frozen in February 1967. at the 13th serial subculture from the tissue of origin. The cells have been grown continuously in culture for more than 40 serial subcultures following explantation.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 13.

Freeze Medium: Culture medium. 95%; glycerol. 5%: antibiotic-free.

Viability: Approximately 70-75% (dye exclusion).

Culture Medium: NCTC 135. 90%. fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of I x 10* via ble cells in 3 ml of the above culture medium per Τ-15 flask yields a 10-12 fold increase within 7 days at 37 C. provided the medium is renewed thrice weekly and the pH is adjusted to 7.4 with a humidified mixture of 5% CO] in air during this determination.

Plating Efficiency: Approximately 35% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 40 Cells:_II22I2I2I2III42I I 4 I 3 I_ Chromosomes: 53 64 72 75 78 80 81 83 85 88 90 93 97 98 99 100 101 102 103 104 105 _3 3 2 I I 2 I I I I 106 107 108 109 III 116 118 119 123 208 Chromosome analyses indicated that the line is of mouse origin. The number of chromosomes range from 53 to 208. Two to three metacentric markers. 2 acrocentrics with secondary constrictions and 3 or more minute chromosomes are found in all cell*.

Sterility: Test* for mycoplasma, bacteria, and fungi were negative.

Specie: Confirmed as mouse by immunofluorescence test.

Virus Susceptibility: Not susceptible to poliovirus type 3. Susceptible to polyoma virus. •’•rse Transcriptase Positive.

Submitted hy: C.W. Boohe. National Cancer Institute. NIH. Bethesda. Maryland. vrspved aad characterized by: American Type Culture Collection. Rockville. Maryland. fc » CERTIFIED CELL LINES - CCL ATCC CCL S3 (continued) Morphology: Epithrlial-likc Karyology: Chromosome Frequency Dtsiribuiion 50 Cells: 2n 1 40 Cells_I 2 7 21 14 I I I I I Chromosomes 42 4? 44 45 4S-48-6O-7O-82-89 Stemline number is hyperdiploid. Karyotype relatively stable within stemline number. Marker chromosomes: One very large chromosome with a median centromere, two large chromosomes with submedian centromeres and one minute chromosome. 50% of cells also had a smaller chromosome with a median centromere.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as mouse by the cytotoxic-antibody dye-exclusion test Virus Susceptibility: Susceptible to vesicular stomatitis (Indiana Strain), herpes simplex, vaccinia, and pseudorabies viruses. Not susceptible to poliovirus type I.

Reserve Transcriptase: Positive.

Hormone Production: Steroid secretion continues for ai least 60 passages after recovery from the frozen state. At passage 83. an average of 26’ (range 210-330) nanograms of delta 4-3-ketosteroids and 4.6 (2.3 - 7.3) nanograms of progesterone were secreted per mg of cell protein per hour. Delta 4-3-ketosteroids were measured spectrophotomeiieallv and progesterone by radioimmunoassay. A 4-hour exposure to 1.0 χ IO-4 M dibutryl cyclic AMP stimulated steroid secretion 4- to 5-fold.

Submitted by: G. Sato. Department of Biochemistry. Brandeis University. Waltham. Massachusetts.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 84_Detroit S39_(Skin, Human) Down's syndrome, female_ Detroit 539 is one of a series of fibroblast-like cell lines with abnormal (aneuploid) chromosomes developed from such individuals for the American Type Culture Collection by methods previously described in this Catalogue (see CCL 54. Detroit 532). It was derived by W.E. Simpson. U .D. Peterson. Jr., and C.S. Stulberg in December, 1964. from a female Caucasian child with Down's syndrome. Karyotypic analysis of the cell population shows that a major portion of the cell population (approximately 90%) possesses 47 ch*omosomes. with 5 chromosomes belonging to the G group. These karyotypic findings have been found to persist essentially unchanged through at least 30 serial subcultures.

This cell line has an apparent finite life expectancy.of approximately 30 serial subcultures from the tissue of origin, with a subculture interval of approximately 4 days and a subcultivation ratio of I to 2 or I to 4. A culture in the 10th passage was submitted to the American Tvpe Culture Collection.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 10.

Freeze Medium: Basal medium (Eagle). 80%: fetal bovine serum. 15%: glycerol. 5%: antibiotic-free.

Viability: Approximately 93% (dye exclusion).

Culture Medium: Minimum essential medium (Eaglet with non-esseniial amino acids, sodium pyruvate (lmM per L. lactalbumin hydrolysate (0.1%). and Earle's BSS. 90%: fetal bovine serum. 10%: antibiotic-free.

Growih Characteristics of Thawed Cells: An inoculum of 0.5 χ I0-* viable cells, ml in the above culture medium at 37 C. in an atmosphere of 5% carbon dioxide-95% air. multiplies 3-4 fold in 4 days, for the number of subcultures indicated above.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 100 Cells: 2n = 46 Cells: _3 6 88 I 2 Chromosomes: 44-46 47 48-92 Trisomy of 21-22 group (G) found in 92% of cells examined.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by immunofluorescence test and karyology.

Virus Susceptibility: Susceptible to poliovirus type I and vesicular stomatitis (Indiana Strain) virus.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: C.S. Stulberg. Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 85_EB-3_(Burkttt lymphoma. Human)_ The EB-3 line of lymphoblast-like cells was derived from a 3 year-old Negro male with Burkitt lymphoma hy M.A. Epstein and Y.M. Barr in November. 1964 (Lancet /.-252.1964; Wistar Institute Symp. Monogr.4;59.1965). The initial culture was established in basal medium (Eagle). 90%; human serum. 10%. A subculture was received by the Virus Laboratory, Children’s Hospital of Philadelphia on April 5. 1965. and was maintained on basal medium (Eagle). 90%; fetal bovine serum, 10%. The medium was later changed to RPMI medium 1629. with 10% fetal bovine serum, plus antibiotics. The cells grow in suspension as single cells an<| as CERTIFIED CELL LINES - CCL microscopically visible clumps containing many hundreds of cells. The cells harbor a herpes-like virus particle detected by electron microscopy. The cells are resistant to challenge with vesicular stomatitis virus. This resistance is not transferred to other normally susceptible test cultures. Only insignificant levels of interferon are produced when stimulated by Newcastle disease virus (T rans. N.Y. Acad. Sci. 29: 71.1966). Patients with infectious mononucleosis have been shown to develop antibodies to the herpes-type virus (EBV) found in EB-3 cells (Proc. Nat. Acad. Sci. 59:94.1968). The cell line was submitted to the American Type Culture Collection in March. 1967 in the 100th passage.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 104.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%; antibiotic-free.

Viability: Approximately 70% (dye exclusion).

Culture Medium: RPMI medium 1629. 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 10s viable cells; ml in the above culture medium at 37 C. multiplies 4 to 6 fold in 5 days. The cells do not attach to glass surfaces, but grow freely in the fluid phase.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyoiogy: Chromosome Frequency Distribution 49 Cells; 2n = 46 Cells:_I I 3$ 9 I I I Chromosomes; 44 45 46 47-58-89-93 Karyoty pe stability 100% within male diploid number of 46. Cells with 47 chromosomes frequently contained an extra C group chromosome. There is 4% polyploidy and in 4 of 10 cells karyotyped there was a disparity in size of the homologs of number 4 chromosome.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dve-exciusion test.

Virus Susceptibility: The cells are partially resistant to poliomyelitis and -.esicular stomatitis viruses as previously demonstrated by Henle and Henle (J. Bact. 39: 252. 1965 and Trans. N.Y. Acad. Sci. 29: 71. 1966). The EB-3 cells contain the EB virus as evident by immunofluorescent staining after recovery of the cells from the frozen state. Approximately 2-3%. of the cells show fluorescence. This corresponds to the number observed before freezing.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 0: EA. 3%; EAC. 7%.

HLA Profile: A3. Aw32. Cw2.

EBNA: Positive.

Isoenzymes: G6PD. type A.

Submitted by: W. Henle. Department of Virology. Children's Hospital of Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 86_Raji_ (Burkitt lymphoma. Human)__ The Raji line of lymphoblast-like cells was established by R .J.V. Pulvertaft in 1963 from a Burkitt lymphoma of the left maxilla of an 11 year-old Negro male (Lancet /: 238. 1964). After 16 months ofcontinuous cultivation the cell line was sent to M.A. Epstein who cultured the cells in either basal medium (Eagle). 70%; human serum. 30% or medium 199. 70%; human serum. 30% (J. Nat. Cancer Inst. 34: 231. 1965). The Raji cell line was received at the Virus Laboratory. Children's Hospital of Philadelphia on June 3. 1965 and was transferred to medium RPMI 1629 supplemented with 10-25% fetal bovine serum plus antibiotics. This cell line grows in suspension as single cells without attachment to glass and as macroscopicaily visible clumps containing many hundreds of cells. Cells of the Raji line do not contain virus particles as demonstrated by electron microscopy and although the cells are resistant to vesicular stomatitis virus this resistance is not transferred to other normally susceptible test cultures and an interferon-like inhibitor has not been found (J. Nat. Cancer Inst. 37: 547. 1966; Trans. N.Y. Acad. Sci. 29:61.1966). The cell line was submitted to the American Type Culture Collection in the 100th passage in March. 1967.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 106.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%; antibiotic-free.

Viability: Approximately 84% (dye exclusion).

Culture Medium: RPMI 1629. 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 109 viable cells, ml in the above culture medium at 37 C. multiplies 4 to 6 fold in 5 days. The cells do not attach to glass surfaces, but grow freely in the fluid phase.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyoiogy: Chromosome Frequency Distribution 50 Cells; 2n : 46 Cells:_I 4 32 8 2 I I 1 Chromosomes: 43-45 4 6 4 7 48-77-IS.,-192 Karyof pe 100% stable within male diploid stemtine of 46. Cells with 47 chromosomes frequently contained an extra "E group chromosome. There is 6% polyploidy and occasional disparity in the size of the homolop of the number I chromosome and the number 4 chromosome. Ο CERTIFIED CELL LINES - CCL ATCC CCL 86 (continued) Sterility.· Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: The cells are partially resistant to poliomyelitis and vesicular stomatitis viruses as previously demonstrated by Henle and Henle (J Bact-89. 252.1965 and J. Nat Cancer Inst. 37:549. 1966). The Raji cells did not contain the EB virus as evident by immunofluorescent staining after recovery of the cells from the frozen state.

Reserse Transcriptase: Not detected Erythrocyte Rosette Test: E. 0. EA. 1%. EAC. 34% EBNA: Posinse.

Isoenzymes: G6PD type B.

Submitted by: U. Henle. Department of Virology. Children's Hospital of Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Roclvillc. Maryland.

ATCC CCL 87_Jiyoye (P-2003)_(Burkitt lymphoma, Human)_ The Jiyoye cell line was derived in May. 1965. by RJ. Pulvenaft (J. Clin. Path. 18:261. 1965) from the ascitic fluid of an African Negro boy with Burkitt lymphoma of the liver. The cells were sent to R.A. Manakerat the National Cancer Institute in August. 1965. and were maintained on Morgan. Monon, and Parker's medium 199. 70%: human serum. 30%: with aureomycin. and later, on minimum essential medium (Eagle) with non-essential amino acids. 70%: human serum. 30%: with aureomycin. The antibiotic was subsequently discontinued and fetal bovine serum was substituted for the human serum. The cell line was sent to the John L. Smith Memorial for Cancer Research. Chas. Pfizer Company. Maywood. New Jersey in March. 1966. A subculture was then obtained by the Virus Laboratory. Children's Hospital of Philadelphia, where it was maintained on RPMI medium 1629.90%; fetal bovine serum. 10%: plus penicillin and streptomycin. Chromosomal analysis of the cell line indicated (hat one extra chromosome was present in the C group in 5% of the cells analyzed (J. Nat. Cancer Inst. 38:209.1967). The cells contain an unidentified herpes-like virus. The cell line has been used in co-cultivation experiments with peripheral leukocytes from healthy female infants to establish the latter cells as long-term suspension cultures which acquired viral antigen and a sub-terminal secondary constriction in the no. 10 chromosome (lit Vitro 4: 165. 1969). The cell line was submitted to the American Tvpe Culture Collection in the 53rd passage in March. 1967.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 57.

Freeze Medium: Culture medium. 90%: glycerol. 10%: antibiotic-free.

Viability: Approximately 65% (dye exclusion).

Culture Medium: RPMI medium 1629. 90%: feta) bovine serum (not inactivated). 10% antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 103 viable cells/ml in the above culture medium at 37 C multiplies 10 fold in 7 davs. The cells do not attach to the surface of the flask, but grow freeiv in the fluid phase.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyology: Chromosome Frequency Distribution 60 Cells: 2n = 46 Cells:_I 5 43 i 3 I I I I I I I Chromosomes: 42-45 46 47 48-53-55-57-64-88-91 92 Stemline number is diploid. Karyotype is male and stable. There is one extra large chromosome with terminal centromere in D group. One cell showed endoreduplication. 2 with chromosome breaks and 4 with fragments.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by agar microimtnunodiffusion test.

Virus Susceptibility: The cells are partially resistant to polioviruses and vesicular stomatitis viruses as previously demonstrated by the Drs. Henle for Burkitt cell lines (J. Bact.£9;252.1964: J. Nat. Cancer Inst. 37:549.1966). EB Virus: The Jiyoye cells contain the EB virus as evidenced by itnmunofluorescent staining after recovery from the frozen state. Less than 0.1 % of the cells show fluorescence. This corresponds to the number observed before freezing.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 2%: EA. 1%; EAC, 13%.

HL A Profile: A32. Β17. B w37.

EBNA: Positive.

Isoenzymes: G6PD type B.

Submitted by: W. Henle. Depanment of Virology. Children's Hospital of Philadelphia. Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection, Rockville. Maryland.

ATCC CCL 88_Tb 1 Lu (NBL-12)_(Lung, Bat, Tedarida brasiliensis)_.

The Tb I Lu (NBL-12) cell line was initiated by A.K. Kniazeff. D. Constantine. W.A. Nelson-Rees, and D. Schmidt in October. 1965. from the trypsinized lung of an adult female bat. The resulting cultures were confluent in 10 days with predominantly epithelial-like cells. The cells have been grown continuously in minimum essential medium (Eagle) with oon-essentiai amino acids and Earle's BSS with reduced bicarbonate (0.8S g per L), 90% fetal bovine serum. 10% antibiotic-free·, at a pH of 7.4-7.6. l CERTIFIED CELL LINES - CCL ATCC CCL 94 CRFK_(Kidney. Cut, Fete catus)__ CRFK cells were initialed from the conical portion of the kidneys of a 10-12 week-old normal female domestic cat in June of 1964 Primary cultures were prepared by trypsin digestion and grown in Hanks' BSS supplemented with essential amino acids, vitamins.

L-glutamine and 10% calf serum plus antibiotics. Since the I46th passage the cells have been cultivated on MEM with 0.5r, lactalbumin hydrolysate with Earle's BSS and 10% fetal bovine serum. The line was contaminated with mycoplasma and was treated with tetracyclines (R. A. Crandel) et a!.. In Vitro 9: 176-185. 1973). CRFK has been extensively employed in feline virus research (J. Am. Vet. Med. Assoc. /58/976-980. 1971: J. Nat. Cancer Inst. 4//55-60. 1972). The cell line has been shown to be susceptible to six herpes viruses and eight feline picornaviruses with demostrable cytopathic effects.

An ampule of CRFK cells was originally submitted to the ATCC at the 166th passage by W.A. Nelson-Rees in May. 1975. Following deposition it was ascertained that the CRFK line was infected with bovine viral diarrhea virus(BVD). In subsequent years various stocks of CRFK obtained from various laboratories were tested by R.A. Van Deusen at the National Veterinary Services Laboratories (N VSL). USDA in Ames. Iowa in hopesof finding a source of BVD-free CRFK cells. In 1984 Dr. VanDeusen informed the ATCC that a BVD-free culture of CRFK cells had been found. The cells were received at NVSL in March. 1983 at passage 165 as a frozen ampule which had been prepared in February' 1976 at the Naval Biosciences Laboratory. Oakland. California. Extensive testing by the NVSL found no evidence of any viral contamination in the CRFK cells from this frozen ampule. Seed stock prepared from this material was submitted to the ATCC by R.A. VanDeusen at passage 176 in February. 1985.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 181.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO), 5%: antibiotic-free.

Viability: Approximately 85% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids and Earle's BSS. 90%: heat-inactivated fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 4 x KP cells ml in the above culture medium provides a 8-10 fold increase within 7 days at 37 C provided the medium is renewed twice weekly.

Plating Efficiency: Approximately 20% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 38 Cells:_31 16 3 Chromosomes: 36 37 38 The stemline chromosome number is hypodiploid with the modal number at 36(62%) and the polyploidy occurring at 2.2%. Sixteen to 17 marker chromosomes are present in most cells, of which t( A lq; Aj), A2p- A^„ i( B^l. Dtq- and X p- are easily identifiable, and M13 and M15 are not found in some cells. The Aj, Ay and D| are nullisomic. There are two X chromosome components, one is morphologically normal, the other X^.

Sterility: Tests for mycoplasma, bactena. and fungi were negative.

Species: Confirmed as cat by isoenzyme analysis.

Virus Susceptibility: Susceptible to feline herpes virus, feline calisivirus. feline panleukopenia, feline reovirus. canine parvovirus, and rabies.

Reverse Transcriptase: Not detected.

Submitted by: R.A. VanDeusen. National Veterinary Services Laboratories. USDA. Ames. Iowa.

Prepared and characterized hy: National Veterinary Services Laboratories. Ames. Iowa and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 9i WI-26_(Lung, Human)_ WI-26 is a fibroblast-like cell line derived from the normal embryonic lung tissue of a 3-month gestation. Caucasian male. WI-26 is a reference cell line and is the male counterpart of ATCC CCL 7S(Wl-38). The line was originated by L. Hay flick in July l962(Exp. Cell Res. J7/6I4-636.1965) and ampules of frozen cells at passage 19 were submitted to the ATCC in March 1978. Derived populationsat passage 23 and approximate population doubling (FDL) 25 arc available for distribution. Progeny were found to undergo an - additional 11 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK 5q Number of Serial Subcultures from Tissue of Origin: 23 (approximate population doubling 25).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 84% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x 109 viable cells/ml in the above culture medium will increase approximately 2-fold in 8 days.

Plating Efficiency: 3.6% at passage 23 (approximate PDL 25) in the above culture medium.

Morphology: Fibroblast-like. 2 CERTIFIED CELL LINES - CCL Karyology: Chromosome Frequency Distribution SO Cells: 2n = 46 Cells:_1 122134262 23 III Chromosomes: 33 37 38 39 40 41 42 43 44 45 46 47 48 64 Human karyotype with diploid stemline.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative. Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Developed by: L. Hayflick. Children's Hospital Medical Center. Oakland. California. Prepared and characterized by: American Type Culture Collection, Rockville. Maryland.

ATCC CCL 95.1 Wl-26 VA4_ (Lung, Human) SV40 virus-transformed_ The WI-26 VA4cell line was derived by A.J. Girardi. F.C. Jensen and H. Koprowski in December, 1963 (J. Cell. Comp. Physiol. 65: 69-84.1965). The cell line is a SV40 virus-transformed derivative of Wl-26 cells, a human diploid cell line established from embryonic lung tissue of a male Caucasian (Exp. Cell Res. 25/585-621.1961: ibid.. 37: 614-636.1965). The Wl-26 cells, cultured in Eagle's basal medium (BME) with twice the concentration of amino acids and vitamins with Earle's BSS and 10% fetal bovine serum, were exposed to SV40 virus in phase III of their in vitro life span.

Cytopathicand proliferative changes collectively termed "transformation(J. Nat. Cancer Inst. 32:917-937,1964) were first noted 2-4 weeks after exposure to virus. In the initial stage of transformation 10 to 20% of the cells in the culture underwent lysis. The second stage of transformation was marked by a rapid proliferation of most of the remaining cells. The proliferation stage lasted for 9 weeks before the onset of the third of "crisis stage. The crisis stage was characterized by a massive degeneration of the culture and was accompanied by abnormal cell division, the appearance of giant and multinucleated cells, and a progressive decline in cell proliferation. After 5 months a few cells recovered, proliferated rapidly, and were designated as the Wl-26 VA4 cell line. The cells contain both SV40 neo (T) antigen and SV40 transplantation antigen, but infectious virus has not been rescued by any means including cell fusion. The cell line, which has been subcultured for more than 200 passages, was submitted to the American Type Culture Collection in the 145th passage.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 152.

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 85% (dye exclusion).

Culture Medium: Basal medium (Eagle) with twice the concentration of amino acids and vitamins in Hanks' BSS. 90%: fetal bovine serum. 10% antibiotic-free. * Growth Characteristics of Thawed Cells: An inoculum of I x 10s viable cells, ml in the above culture medium yields a 10-15 fold increase within 7 days at 37 C.

Plating Efficiency: Approximately 13% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 49 Cells: 2n = 46 Cells:_2187 10 664221 Chromosomes: 65 66 67 68 69 70 71 73 74 75 137 Karyotype unstable within triploid stemline range of 67 to 71. Ninety six percent of the cells have a large chromosome with a submedian centromere. Approximately 52% of the cells have one or more secondary constrictions. 42% of the cells examined had breaks.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by agar microimmunodiffusion test.

Virus Susceptibility: Susceptible to vesicular stomatitis (Indiana Strain), herpes simplex, sindbis and poliovirus type 2.

Rtvtnt Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: AJ. Girardi, Wistar Institute. Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 96_3T6-Swjss albino _(Embryo, Mouse) Collagen-secreting fibroblasts_ The 3T6cell line is a collagen and hyaluronic acid secreting line established by G. Todaroand H. Green in 1963 from disaggregated Swiss mouse embryos (J. Cell Biol. 17: 299-313.1963). The cells were cultured in Dulbecco-Vogt's modification (Virology /6/41-51. 1962) of Eagle's medium containing approximately a four-fold concentration of the amino acids and vitamins with serine and glycine and 10% bovine serum. The cells became heteroploid between the 31st and 39th generation and the generation time decreased from 29 to 15 hours. The cells continued to remain differentiated for collagen and hyaluronic acid synthesis although a shift in the chromosome and growth characteristics occurred (Nature212:631-633.1966). A culture in the 75th serial passage was submitted to the Am rican Type Culture Collection in October. 1968.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 81. 3 CERTIFIED CELL LINES - CCL Growth Characteristics of Thawed Cells: An inoculum of I x IP viable cells/ml in the above culture medium, multiplies approximately 10-fold in 10 days.

Plating Efficiency: Approximately 18% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 48 Cells: 2n = 42 Cells:_I 30 7 2 I I 3 I I I Chromosomes: 41 42 43 44-80-83 84-127-155-171 Stemline number is diploid. Karyotype is stable within the stemline number and is that of a normal male. Three cells with breaks: one with a secondary constriction, one with a dicentric, one with a rearrangement and four with terminal or centromere associations.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as rat by the cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to vesicular stomatitis(lndiana Strain) virus, herpes simplex and vaccinia viruses. Not susceptible to poliovirus type 3.

Reverse Transcriptase: Not detected.

Protein Production: S-100 production continues in C6 glial cells after recovery from the frozen state.

Submitted by: G. Sato, Department of Biochemistry. Brandeis University. Waltham. Massachusetts.

Prepared and characterized by: Institute for Medical Research, Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 108 IgH-2_(Heart, Iguana, /guana iguana) _ The cell line IgH-2 (iguana heart) was initiated from the heart of a normal immature male iguana by H.F. Clark and C. Gray in August. 1966 (Experientia 23:769-771, 1967). The cells were cultured in basal medium (Eagle). 90%; fetal bovine serum. 10%. In the above studies analysis of primary cultures revealed the diploid chromosome number of the species to be 34 including 12 macro- and 22 microchromosomes. Later studies (Proc. Soc. Exp. Biol. Med. 133:1039-1047. 1970) showed that the cell line remained diploid for 40 passages: however, in later passages an extra acrocentric marker chromosome was observed. The cells were also found to support the replication of herpes simplex, pseudorabies, vaccinia and Iguana viruses at 36 C. This is the only reported reptilian cell line to be established and serially propagated at an incubation temperature as warm as 36 C. A culture in the 70th serial passage was submitted to the American Type Culture Collection in June. 1968.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures front Tissue of.Origin: 75.

Freeze Medium: Culture medium, 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Basal medium (Eagle) with non-essential amino acids in a modified Hanks' BSS. 90%; fetal bovine serum (not inactivated), 10%: antibiotic-frce.

Growth Characteristics of Thawed Ceils: An inoculum of 109 viable cells/ml in the above culture medium at 36 C multiplies approximately 10-12 fold in 7 days.

Plating Efficiency: Approximately 5% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 34 Cells:_I I I 13 28 2 I I I I Chromosomes: 30-32 33 34 35 36-60 61-63 64 The karyotype is stable. There is one large marker chromosome with a terminal centromere appearing in all cells in addition to 22 minute chromosomes. 10 large chromosomes with a median centromere and 2 large chromosomes with a submedian centromere.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as iguana by agar microimmunodiffusion test.

Virus Susceptibility: Not susceptible to poliovirus type I or vesicular stomatitis (Indiana Strain) virus at 36 C.

Reverse Transcriptase: Not detected.

Submitted by: H.F. Clark. Wistar Institute. Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 110_Detroit $S1_(Sltin, Human) Normal diploid female_ Detroit 551 is a cell line derived from the skin of a Caucasian female embryo by W.F. Simpson. W.D. Peterson. Jr., and C.S. Stulberg in 1965. It is a typical diploid human fibroblast-like line which was established in the same manner as were lines with abnormal chromosomal configuration developed for the American Type Culture Collection (See CCL 54. Detroit 532; CCL 65. Detroit 525; CCL 66. Detroit 529). The Detroit 551 cells may be considered to be normal and may serve as cont'ols for the study of cells having mutant chromosomes. The cell line has a finite life span characteristic of this type of cell and can be maintained for approximately 25 serial subcultures from the tissue of origin. The cells support the growth of herpes viruses and SV40 virus can induce transformation. 4 CERTIFIED CEH. LINES - CCL ATCC CCL 110 (continued) DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: h Freeit Medium: Basal medium lEaplel with Hanl.v' BSS. 8CV.. trial bovine scrum. 15%. glycerol. fci. antibiotic-frcc Viability; Approximately 9(Y, (dye excluMoni Culture Medium: Minimum essential medium tfaplci with non-cwcnnal amino acids, sodium pyruvate (ImM per Lt. lactalbumin hvdrolvsate (0.1% I. in Earle’s BSS. 90'.. trial honni vrrum. 10',. aniibiotic-frct Growth Characteristics of Thawed Cells: An inoculum of 2 x Iri1 cells ml w ill increase 4-5 (old in 6-7 days at C. in an atmosphere of %carbon dioxide-95% air. The cells have a life expectancy ot approximately 17 passages beyond the Iroren reference stock. Plating Efficiency: Less than 1% in the above culture medium Morphology: Fibroblast-like Karyology: Chromosome Frequency Distribution HX: Cells 2n - 46 Cells:_2 4 289 2 I Chromosomes: 4? 44 45 4h 47 >100 Stcmfine is diploid. Karyotype is that of a normal human lemaic.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by immunofluorescence test Virus Susceptibility: Susceptible to poliovirus type 1 and vesicular stomatitis (Indiana Strain) virus, and can be transformed by SV40 virus.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: C.S. Stulberg. Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 111 Gekko lung-1 (GL1)_(Lung. Lizard, Gekko gecko)_ The Gekkolung-I (GLI > cell line was derived by H.F. Clark in June. 1965( Exper ientia 23:769-771. 1967) from the lung of an adult male Tokay gekko(a lizard indigenous to Southeast Asia land has been propagated in tissue culture at 30 C for more than four years. The cells were grown in basal medium (Eagle) supplemented with 10% fetal bovine serum and passaged with trypsin. Gekko cell lines in culture were observed to undergo spontaneous chromosomal alterations from a normal diploid number of 38 to a bimodal distribution of chromosome numbers 38 and 40 (Cytogenetics 7:16-26. 1968). The cells are susceptible to a number of mammalian viruses at 36 C( Proc. Soc. Exp. Biol. Med. 133:1039-104'. 1970». The cell line was submitted to the American Type Culture Collection in June. 1968. in the 65th passage.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 79.

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSOi. 5%: antibiotic-free Viability: Approximately 88% (dye exclusion!.

Culture Medium: Basal medium (Eagle) with non-essential amino acids in modified Hanks' BSS. 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Celb: An inoculum of 10' viable cells ml in the above culture medium multiplies 5-6fold in 7 davs at 30 C.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 59 Cells: 2n = 38 Cells:_I 2 5 14 17 2 2 I I 2 2 3 7 Chromosomes: 34 35 36 ?7 38 39 4O-42-48-69-7I-7? (74-135) Bimodal stemline number of 37 and 38 chromosomes. Stable pseudo-diploid karyotype in 38 chromosome stemline number. The change from normal is a constant deletion in one of the largest chromosomes. Slightly unstable karyology in 37 chromosome stemlinc number.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as gckko by the agar microimmunodiffusion test.

Virus Susceptibility: Susceptible to vesicular stomatitis (Indiana Strain) and vaccinia viruses at 37 C. Not susceptible to poliovirus type I.

Reverse Transcriptase: Not detected.

Submitted by: H.F. Clark. School of Medicine. State University of New York at Buffalo. Buffalo. New York.

Prepared and characterized by: Institute for Medica) Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

CERTIFIED CELL LINES - CCL ATCC CCL 113_RPMI 6666_(Lymphoblasts, Hodgkin’s disease. Human)___ RPMI 6666 from a 29 year-old, Caucasian male patient with Hodgkin's disease is one of a large series of apparently permanent ceil ines derived by G.E. Moore from leukocytes in the peripheral blood of donors with and without malignancies (G.E. Moore, et of.. New York State J. Med. 66:2757.1966). Cells grow in stationary suspension cultures and do not attach to glass or plastic surfaces. The ormation of large cell clusters floating in the medium is characteristic of their growth. They have the appearance of immature or primitive leukocytes and are described as lymphoblastoid''cells. The RPMI 6666 line has a cell-associated Epstein-Barr virus as demonstrated by thin section electron microscopy and produces immunoglobulins.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown: Child Research Center of Michigan. 4.

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: Approximately 75% (dye exclusion).

Culture Medium: RPMI 1640 medium. 80%; fetal bovine serum. 20%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 5 x I O’ cells / ml multiplies 4-fold in 5 days, in the above culture medium. The reference cells have undergone IS additional passages and show no indication of senescence.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyoiogy: Chromosome Frequency Distribution 50 Cells; 2n = 46. XY Cells:_I 3 46 Chromosomes: 44 45 46 No marker chromosomes noted.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by immunofluorescence test.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 0: EA. 8%: EAC. 10%.

HLA Profile: A2. A3. B7. BI8.

EBNA: Positive.

Submitted by: G.E. Moore, Department of Surgery. Denver General Hospital. Denver. Colorado.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 114 RPMI 1666_(Normal lymphoblasts, Human)_ RPMI 7666 is one of a large series of apparently permanent cells lines derived by G E. Moore from leukocytes in the peripheral blood of donors with and without malignancies. This cell line was initiated from the leukocytes obtained from a 32 year-old. Caucasian male having no known malignancy (G.E. Moore, et al.. J.A.M.A. 199: 519. 1967). Cells m culture are lymphoblasts and grow in suspension in stationary or spinner cultures. Growth is characterized by the formation of large clusters of cells that are suspended :n the medium. Epstein-Barr virus particles are found in the cells by thin section electron microscopy, and it has been suggested (see above reference) that this agent may promote differentiation of the lymphocytes, resulting in multiplication. These cells also produce mmunoglobulin in vitro (see above reference).

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown: 10 and 14 at Child Research Center ol Michigan.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; aniibiotic-lree.

Viability: Approximately 80% (dye exculsion).

Culture Medium: RPMI 1640 medium. 80%: fetal bovine serum. 20%: antibiotic-free.

Growth Characteristics of Tha wed Cells: An inoculum of 5 x 10s cells ml will increase 4-5 fold in 5-6 days when grown at 37 C ar.d pH 7.2 maintained by 5% COy-95% air. The reference cells have undergone 10 additional passages and have shown no indication of senescence.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyoiogy: Chromosome Frequency Distribution 100 Cells; 2n = 46. XY Cells:_3 92 2 2 I Chromosomes: 45 46 47 48 polyploid No markers noted.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative. Epstein-Barr virus particles can be observed in the cells by thin-section electron microscopy.

Species: Confirmed as human by immunofluorescence test.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 0: EA. 3%; EAC. 19%.

HLA Profile: AJ. Aw29. B7. BI2.

EBNA: Positive.

Isoenzymes: G6PD type 8.

Blood Group: B*. 6 CERTIFIED CELL LINES - CCL ATCC CCL 114 (cont’mied) Submitted by: G.E Moore. Department of Surgery. Denver General Hospital. Denver. Colorado.

Prrpared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland ATCC CCL 116 Detroit 548_(Skin, Human) Partial D trisomy, translocation_ Detroit 548 is one of a series of fibroblast-like cell lines wiih abnormal (aneuploid) chromosomes developed for the American Type Culture Collection by methods previously described in this Catalogue (See CCL 54. Detroit 532). The line was derived by W.F. Simpson in October of 1966 from a skin biopsy of a Caucasian female infant exhibiting anomalies associaied with D trisomy syndrome (W.W. Zuelzer, et al.. J. Pediatrics 72. 367,1968). Karyologic analysis showed that 94% of the cell population is46.XX.C«.D-. The appearance of the extra C chromosome is compatible with a translocated D on a partial extra D as shown in blood and marrow specimens. A small (2%) population of fibroblast cells is present having 3 extra D-D translocated chromosomes (chromosome number = 48). The karyoty pe is stable for J2 or more transfers beyond the frozen seed stock when cells are transferred at an inoculum of 2 x JO* cells ml. However, it was found cells having 48 chromosomes multiply at a faster rate than the 46 chromosome cells. W'hen the cells are transferred at twice the above inoculum, it was found that the percentage of cells having 48 chromosomes increased rapidly from 2% to about 25% of the cell population in 5 transfers, and 40% bv transfer 10.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 9.

Freeze Medium: Basal medium (Eagle) with Hanks' BSS. 80%; feial bovine serum. 15%: glycerol. 5%: antibiotic-free.

Viability: Approximately 85% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle), non-essential amino acids, sodium pyruvate (I mM per L). lactalbumin hydrolysate (0.1%). Earle's BSS. 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 2 x IO4 cells ml in the above culture medium at 37 C. in 5% carbon dioxide-95% air. multiplies 3-4 fold in 7 days. These cells have a life expectancy of more than 12 passages beyond the frozen reference stock.

Plating Efficiency: Not measurable in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n - 46 Cells:_2 47 | Chromosomes: 45 46 47 Stemline number is diploid, however 94% of the cells have an extra C chromosome and are minus a D chromosome: 46.XX.C*\D-.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the immunofluorescence test.

Virus Susceptibility: Susceptible to poliovirus type 1 and vesicular stomatitis (Indiana Strain) virus.

Reverse Transcriptase: Not detected Isoenzymes: G6PD type B.

Submitted by: C.S. Stulberg. Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 117 Detroit S73_(Skin. Human) B/D translocation_ Detroit 573 is one of a series of fibroblast-like cell lines with abnormal (aneuploid) chromosomes developed for the American Type Culture Collection by methods previously described in this Catalogue (See CCL 54. Detroit 532). The line was initiated by W'.F. Simpson in January. 1967 from a skin biopsy of a deceased newborn Caucasian female with multiple congenital anomalies. Karyologic examination showed that approximately 94% of the cell population is 45.XX.t (Bp-: Dq*). The translocated B D chromosome morphologically resembles a group A-2 chromosome. Autoradiographic studies suggest that the translocation involves chromosomes 5 and 14. The above karyologic findings have persisted through more than 8 transfers beyond the reference seed stock without change.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 5.

Freeze Medium: Basal medium (Eagle) with Hanks' BSS. 80%.: human serum. 15%: glycerol. 5%; antibiotic-free.

Viability: Approximately 95% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids, sodium pyruvate (I mM per L). lactalbumin hydrolysate (0.1%) in Earle's BSS. 90%.; fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 2-3 x IO4 cells, ml in the above culture medium at 37 C. in 5% carbon , dioxide-95% air. multiplies 3-foid in 7days. The cells have a life expectancy of at least 17 passages beyond the frozen reference stock.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibrobjast-like. 7 CERTIFIED CELL LINES - CCL Karyology: Chromosome Frequency Distribution 52 Ceils: 2n - 46 Cells:_2 2 47 I Chromosomes: 4] 44 45 46 Stemline is hypodiploid. Cells are missing a D and B group chromosome each. An extra A group chromosome is present.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by immunofluorescence test.

Virus Susceptibility: Susceptible to poliovirus type I and vesicular stomatitis (Indiana Strain) virus.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: C.S. Stulberg. Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 119 CCRF-CEM_(Peripheral blood. Human) Acute lymphoblastic leukemia CCRF-CEM is a T lymphoblastoid cell line derived by G.E. Foley et al. (Cancer 18: 522-529. 1965). Cells were obtained in November. 1964 from peripheral blood buffy coat of a four-year-old Caucasian female with acute lymphoblastic leukemia. The cells were cultured at a high population density in spinner-type suspension cultures with minimum essential medium (Eagle) modified for suspension cultures. 90%: fetal bovine serum. 10%. Cultures were maintained at 2-3 x 10* cells,'ml by the addition of 50-100% fresh medium daily. A cell population has been maintained that morphologically resembles lymphoblastic cells. The cells are apparently free of virus-like particles as determined by electron microscopy. (Cancer 19: 1725-1742. 1966) and apparently do not synthesize immunoglobulins and are karyotypically "near-diploid" (Exp. Cell Res. 40: 197-200. 1965). Implantation of I x 10* cells intraperitoneally in newborn Syrian hamsters resulted in a progressively growing malignant lymphoma which converted to leukemia in a significant number of animals (Cancer Res. 27: 772-783. 1967).

The reference seed stock was prepared at the Children's Cancer Research Foundation. Boston from cells frozen in January. 1965 and reinitiated into culture in May. 1968. These cultures were continuously maintained in spinner culture, and thus passage number is not applicable.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown: Grown in spinner culture for three months, then frozen. Reinitiated in May. 1968 and grown until June. 1968.

Freeze .Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) modified for suspension cultures. 90%: fetal bovine serum. 10%: antibiotic-free Crowth Characteristics of Thawed Ceils: An inoculum of 5 χ 103 cells< ml will increase 4-5 fold in 4-5 days when incubated at 37 C. providing the pH is maintained at 7.0 and fresh medium is added every other day. Maintenance of the cell population at 2-3 x 10* cells, ml is optimal for growth. Reference cells have been carried in stationary suspension cultures for 10 additional passages after recovery from the frozen state.

Plating Efficiency: Not determined.

Morphology: Lymphoblast-like.

Karyology: Chromosome Frequency Distribution 93 Cells: 2n = 46 Cells:_I 2 39 4 32 2 I 2 8 I I Chromosomes: 41^4 45 46 4 7 48-75-89 90-94-95 Fifty karyotypes showed no consistent loss or gain of particular chromosomes. 28% of the cells with 45 chromosomes were C-: 53% of all cells had an extra Dand 35% had an extra F. Only 41 and 418 chromosomes were not affected by gain or loss. No marker chromosomes noted.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative. Virus-like particles were not seen in cells by thin-section electron microscopy.

Species: Confirmed as human by immunofluorescence test.

Virus Susceptibility: No determinations.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: G.E. Foley. The Children s Cancer Research Foundation. Boston. Massachisetts.

Prepared and characterized by: The Children's Cancer Research Foundation. Boston. Massachusetts: The Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 129 CCRF-SB_(Peripheral blood. Human) Acute lymphoblastic leukemia CCRF-SB is one of a series of B lymphoblastoid cell lines derived by G.E. Foley ttal. (M.D. Anderson Hospital and Tumor Inst.

Monograph 21. 1967). Cells were obtained in April. 1966 from peripheral blood buffy coat of an 11½ year-old Caucasian mate with acute lymphoblastic leukemia and either inoculated into hamsters (Sec CCL l20.t.CCRF-HSB-2)orfrozen. After 4 months storage a *P>nncr-t>pc suspension culture having a high population density of 1-2 x 10* cells, ml was initialed in minimum essential medium 8 CERTIFIED CELL LINES - CCL ATCC CCL 120 (continued) (Eagle) modified for suspension culture. 90%: fetal bovine scrum. 10% CCRF-SB cells are characterized b> a morphological resemblance to lymphoblastic cells in vivo and possess a normal human diploid karyotype The cells appear to be free of virus-like particlesas determined by electron microscopy and do not synthesize globulins I Cancer Res. J.7,2479-2482.1967). CCRF-SB has not been transplanted into newborn Syrian hamsters, as has the CCRF-HSB-2 line.

The reference seed slock was prepared at the Childrens Cancer Research Foundation. Boston, from cells originally frozen in December. 1966. and reinitiated in April. 1968. These cultures were continuously maintained in spinner culture and thus passage number is not applicable.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown: Grown in spinner culture for six months in 1966. then frozen. * Culture reinitiated in April. 1968. and grown until June. 1968 Frene Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO) 5%: antibiotic-free Viability: Approximately 75%· (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) modified ior suspension culture. 90% : fetal bovine serum. 10%; antibiotic-free. Growth Characteristics of Thawed Cells: An inoculum of 5 x 10·' cells ml will increase 3-4 fold in 4-5 days when incubated at 37 C provided the pH is maintained at 7.2 and fresh medium is added every 3 days. Maintenance of the cell population at 1-2 x IO4 cells/ml is optimal for growth. Reference cells were grow-n in stationary suspension culture for an additional 16 passages (3 months) after recovery from the frozen state.

Plating Efficiency: Not determined.

Morphology: Lymphoblast-like.

Karyology: Chromosome Frequency Distribution 95 Cells: 2n - 46 Cells:_I 2 I 584 I I Chromosomes: 42 43 44 45 46 47-99 Karyotypes appeared normal in fourteen diploid cells examined Sterility: Tests for mycoplasma, bacteria, and fungi were negative. Virus-like particies not observed in cells examined by thin-section electron microscopy.

Species: Confirmed as human by immunofluorescence test.

Virus Susceptibility: No determinations.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 0: EA. 6%: EAC. 23%.

HLA Profile: Al. A2. BI2. BI7. Cw2.

EBNA: Positive.

Isoenzymes: G6PD type B.

Submitted hy: G.E. Foley. The Children's Cancer Research Foundation. Boston. Massachusetts: The Child Research Center of Michigan. Detroit. Michigan.

Prepared and characterized hy: The Children's Cancer Research Foundation. Boston. Massachusetts: The Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 120.1 CCRF-HSB-2 (Human tumors implanted in hamsters) __Peripheral blood, acute lymphoblastic leukemia__ CCR F-HSB-2 is a T lymphoblastoid cell line derived by G.E. Foley ti al. (M.D. Anderson Hospital and Tumor Inst. Monograph 21. 1967). The cells were obtained in September. 1966 from minced tumors in the 8th passage in newborn Syrian hamsters (Adams. R.A.. Proc. Am. Assoc. Cancer Res. 8.-1.1967) and established in suspension culture with minimum essential medium (Eagle) modified for suspension culture. 90%; fetal bovine serum. 10%. The serially implanted tumor was initiated in April. 1966 by R.A. Adams from a peripheral blood buffy coat of an 11 'Λ year-old Caucasian mate with acute lymphoblastic leukemia (Cancer Res. 28:1121.1968). The cells are maintained at 1-2 x 10* by the addition of 50-150% fresh medium each 48 hours. The cells are characterized by a morphological resemblance to lymphoblastic cells in vivo, a normal (2n = 46) karyotype, and the capacity to produce malignant lymphomas in newborn Syrian hamsters following intraperitoneal implantation of I x 10* cells. The cells appear to be virus-free as determined by electron microscopy and they do not appear to synthesize immunoglobulins.

The reference seed stock was prepared from cells frozen in October. 1966 and reinitiated into culture in February. 1968. These cultures were continuously maintained in spinner culture and thus passage number is not applicable.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subculture* from Tissue of Origin: Unknown: Grown in suspension culture for one month in 1966. then frozen. Culture reinitiated in February, 1968. and grown until June. 1968.

Free» Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 70% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) modified for suspension culture. 90%: fetal bovine serum. 10%: antibiotic-free. Growth Characteristic* of Thawed Cells: An inoculum of 5 x 10s cells/ml will increase 3-4 fold in 5-6 days when grown at 37 C. provided the pH is maintained at 7.0 and fresh medium is added every other day. Maintenance of the cel) population at 1-2 x 10* cells/ml it optimal. Reference celts were grown in stationary suspension culture for ten passages (2 months) after recovery from the frozen state.

Plating Efficiency: Not determined.

Morphology: Lymphoblast-like. 3 CERTIFIED CELL LINES - CCL Karyology9 Chromosome Frequency Distribution 100 Cells: 2n = 46 Cells:_I I 494 Chromosomes: 40-44 45 46 Karyotypes appeared normal in thirteen diploid cells examined.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative. Virus-like particles not observed in cells examined by thin-section electron microscopy.

Species Tests: Confirmed as human by immunofluorescence test.

Virus Susceptibility: No determinations.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 0: EA. 1%: EAC. 12%.

HLA Profile: Al. A2. BI2. BI7. Cw2.

Isoenzymes: G6PD type B.

Submitted by: G.E. Folev. The Children’s Cancer Research Foundation. Boston. Massachusetts.

Prepared and characterized by: The Children's Cancer Research Foundation. Boston. Massachusetts: The Child Research Center of .Michigan. Detroit. Michigan and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 121 HT-1080_(Fibrosarcoma, Human)_ The HT-1080 tumor cell line was established in July. 1972 by S. Rasheed. et al. (Cancer 33:1027-1033. 1974), from a fibrosarcoma arising adjacent to the acetabulum of a 35 year-old Caucasian male. The cells were cultured on minimum essential medium (Eagle) with nonessential amino acids in Earle s BSS supplemented with 10% inactivated fetal bovine serum and antibiotics. Subcultivation was carried out in such a way so as to eliminate the growth of fibroblasts and favor the proliferation of epithelial cells. Once established, the epithelial-like ceils proliferated rapidly with loss of contact inhibition, exhibited a doubling time of 26 hours, and reached saturation densities of 1-2 x 10* cells/cm2. Chromosome analysis on the HT-1080 cell line revealed a stemline number of 46. Pseudodiploidy and the presence of marker chromosomes was noted, however. Tumors developed in all subcutaneously inoculated NIH Swiss mice immunosuppresscd with anti-thymocytic serum (ATS) within 7 days and the developing fibrosarcomas could be serially propagated in ATS treated mice. The cells were also found to be susceptible to RNA tumor viruses. RD 114 and FeLV. A frozen ampule of HT-1080 cells in the 10th passage was submitted to the American Type Culture Collection in July. 1973.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 15.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 95% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids with Earle's BSS. 90%: inactivated fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 109 viable cells, ml in the above culture medium at 37 C multiplies 12-14 fold within 7 days provided the medium is renewed 3 limes weekly.

Plating Efficiency: Approximately 3% in the above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:I 3 38 7 I Chromosomes: 44 45 46 47 48 Pseudodiploidy was frequently noted. About 40% of the cells had rearranged karyotypes with an extra E-group chromosome and a group C chromosome, probably chromosome 11, was missing.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by starch-gel electrophoresis analysis of LDH and G6PD isoenzymes.

Virus Susceptibility: Susceptible to poliovirus type I and vesicular stomatitis (Indiana Strain) virus.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: S. Rasheed. University of Southern Cilitornia. Los Angeles. California.

Prepared and characterized by: American Type Culture Collection. Rockville. Marvland.

ATCC CCL 122 HG 261_(Skin, Human) Fanconi's anemia___ The HG 261 cell line was derived by J. German m November. 1966 from a skin biopsy obtained from a 6-year-old Caucasian male with Fanconi's anemia. Fanconi's anemia is associated with a high incidence of leukemia. The cells were grown in minimum essential medium I Eagle) with non-essential amino acids in Earle's salts and 10% fetal bovine serum. HG 261 cultures show a tendency toward spontaneous cytogenetic abnormalities which include breakage and complex rearrangement in metaphase chromosomes and chromatic bridging or lagging at anaphase and telophase (Annales de Genetique 9: 143. 1966). An important characteristic of Fanconi's anemia cells in vitro is that they exhibit a higher percentage of transformed colonies following SV40 virus infection than normal diploid cell cultures (NCI Monograph 29: 271. 1968). The cells were frozen in the sixth subculture generation in February. *967. recovered in October. 1968 and submitted to the American Ty pe Culture Collection in the 9th sub. ulture generation. It has been demonstrated that the cell line has a life expectancy of at least 35 serial subcultures. e CERTIFIED CELL LINES - CCL ATCC CCL 122 (continued) DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subculture* from Tissue of Origin: 17.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle), with non-essential amino acids and Earle's BSS. 90%. fetal bovine serum (inactivated). 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 5 x 101 viable cells in the above culture medium at 37 C. in an atmosphere of' 5% carbon dioxide-95% air. multiplies 8-10 fold in 6 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyoiogy: Chromosome Frequency Distribution 45 Cells. 2n = 46 Cells:_I 4 5 26 2 I I I 1 I I I Chromosomes: 43 44 45 46 47 48 49 50-84-86-94-102 Karyotype is that of a normal human diploid male. 20% of the cells examined had breaks. Secondary constrictions were observed in 9% of the cells. 9% had gaps. 4.5% had minute chromosomes and 9% rearrangements.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. vesicular stomatitis (Indiana Strain), herpes simplex and vaccinia viruses. Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: J. German. The New York Blood Center. New York. New York.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 123 C211 (Skin. Human) Partial deletion of chromosome 4, Cri du Chat_ The C2IJ cel! line was derived by U.R. Breg in October. 1968 from a skin biopsy obtained from an 11 year-old Caucasian male with Cridu Chat Syndrome. Autoradiographic studies (Cytogenetics J: 137.1966: Am J. Human Genetics /9:399.1967) demonstrated that a distinction could be made between chromosome 4 and 5 in the Cri du Chat syndrome by alternative DNA replication pattern and length of long and short arms. The C 211 cell line (case No. 4 in 1967 reference above) has a partial deletion of the short arm of chromosome 4 (4p-) which was determined by late DNA replication pattern of the long arms of the deleted chromosome. Chromosome number 5. previously described with Cri du Chat, exhibits an early replication pattern. C 211 cells were established in McCoy's 5a medium with 20% fetal bovine serum with penicillin and streptomycin. A culture in the 5th serial subculture was submitted to the American Type Culture Collection in November. 1968. It has been demonstrated that the cell line has a life expectancv of at least 30 serial subcultures.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 15.

Freeze Medium: Culture medium. 90%: glycerol. 10%: antibiotic-free.

Viability: Approximately 70% (dye exclusion).

Culture Medium: McCoy's 5a medium (modified). 80%: fetal bovine serum (not inactivated). 20%,: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 5 x 10* viable cells in the above culture medium at 37 C. in an atmosphere of 5% carbon dioxide-95% air. multiplies 3-4 fold in 7 days.

Ptating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyoiogy: Chromosome Frequency Distribution 49 Cells: 2n = 46 Cells:_1 I 1 2 6 27 4 2 I I I I 1 Chromosomes: 39-41-43 44 45 46 47 48-79-86-90-92-95 Karyotype is that of a normal human diploid male with one 4 or 5 chromosome with a deleted short arm in all cells. The four cells with 47 chromosomes all had an extra G group chromosome.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type 1. vesicular stomatitis (Indiana Strain), herpes simplex and vaccinia viruses. Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: U'.R. Breg. Southbury Training School. Southbury. Connecticut.

Prepared and characterized by: Institute for Medical Research. Camden, New Jersey and American Type Culture Collection. Rockville. Maryland. 1 CERTIFIED CELL LINES - CCL ATCC CCL 131 Neuro-2a_(Neuroblastoma, Mouse)____ Clone Neuro-2a was established by RJ. Klebeand F.H. Ruddle (J. Cell Biol. 43:69k. 1969) from a spontaneous tumor of a strain A albino mouse. This tumor line, designated Cl300. was obtained from the Jackson Laboratory. Bar Harbor. Maine. The cells were cloned in Fl2 medium (Ham), agamma bovine serum. 10%. penicillin and streptomycin and 0.125% agarose. The cloned cells were maintained in F12( Ham) or minimum essential medium (Eagle) and 10%agamma bovine serum. Neuronal cell types and small round stem cells were observed. Neuro-2a cells produce large quantities of microtubular protein which is believed to play a role in a contractile system which is responsible for axoplasmic (low in nerve cells. The cell line has been used for studies on the mechanism of vinblastine precipitation of microtubular protein, the kinetics of GTP binding to isolated protein, (he turnover of microtubules in vivo, and the synthesis and assembly of microtubular protein in vivo and in vitro (Proc. Nat. Acad. Sci. 65:129-136.1970). A culture in approximately the 150th serial passage was submitted to the American Tvpe Culture Collection in May. 1969.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Approximately 167.

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: Approximately 80% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids and Hanks* BSS. 90%: fetal bovine serum (not inactivated). 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 109 viable cells., ml in the above culture medium at 37 C. multiplies 15-fold in 7 days.

Plating Efficiency: Approximately 1% in the above culture medium.

Morphology: Neuron-like and amoeboid-like.

Karyology: Chromosome Frequency Distribution 53 Cells: 2n = 40 Cells:_I2I12II3I3242I46424II I I I I I I Chromosomes: 59-70-75 76-81 82 83 84 85 86 87-89-92 93 94 95 96 97 98 99-106-128-174-181 -185-190-193 Karyotype unstable within a stemline range of 94 to 98 chromosomes. All the cells contain 6 to 10 large chromosomes with median or submedian centromeres and 2 to 4 minute chromosomes.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as mouse by the cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to vesicular stomatitis (Indiana Strain) and herpes simplex viruses. Not susceptible to poliovirus type I.

Reverse Transcriptase: Not detected.

Tumorigenicity: Tumors formed in 4.4 strain A albino mice 7 days after subcutaneous injection of 4 x 10* cells.

Submitted by: R.J. Klebe and F.H. Ruddle. Department of Biology. Yale University. New Haven. Connecticut.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 132 CHP3 (M.W.)_(Sltin, Human) Symptomatic galactosemia_ This fibroblast-like cell line was established by W J. Mellman from a skin biopsy of a 6-year-old male Negro with galactosemia. This child demonstrated a classic galactosemia picture in infancy and lacks galactose-1-phosphate uridyl transferase activity in his circulating red cells. His older sibling. W. W. (See CCL 133) lacks the same enzyme but exhibited no clinical symptoms of galactosemia (J. Pediatrics 63: 551. 1966). The CHP 3 cells were cultured in basal medium (Eagle) with twice the concentration of vitamins and amino acids. 10% fetal bovine serum and antibiotics. The cells are deficient in galactose-1-phosphate uridyl transferase and possess the A type electrophoretic variant of gIucose-6-phosphate dehydrogenase, whereas the sibling cells. (CCL 133) possess the B type. The CHP 3 cells retain all of the above special characteristics for at least 30 serial passages.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 12.

Freeze Medium: Culture medium. 90%: glycerol. 10%: antibiotic-free.

Viability: Approximately 80% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with twice the concentration of amino acids and vitamins in Hanks' BSS, 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 103 viable cells ml in the above culture medium at 37 C multiplies approximately 7-fold in 10 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-likc.

Karyology: Chromosome Frequency Distribution 51 Cells: 2n = 46 Cells:_3 14 32 2 Chromosomes: 44 45 46 47 Normal human diploid male, stable karyotype.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. vesicular stomatitis (Indiana Strain). ECHO 11, herpes simplex and taccmia viruses. 2 CERTIFIED CELL LINES - CCL ATCC CCL 132 (continued) Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type A.

Submitted by: WJ. Mellman. Department of Pediatrics and Medical Genetics. University of Pennsy lvania School of Medicine and Hospital of Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 133_CHF 4 (W.W.)_(Skin. Human) Asymptomatic galactosemia__ This fibrobiast-like cell line was established by WJ. Mellman from a skin biopsy of an 8-year-old male Negro with "asymptomatic" galactosemia. This child had never exhibited any signs of symptoms of galactosemia although he lacked galactose-1-phosphate uridyl transferase activ ity in his circulating red cells. Metabolic studies appear to place him in a subgroup of atypical "galactosemie patients" as described by Segal et al. (Am. J. Med. 38: 62. 1965). His 6-year-old sibling M.W. (See CCL 132) demonstrated the classic galactosemie picture in infancy (J. Pediatrics 68: 551. 1966). The CHP 4 cells were grown in basal medium (Eagle) with twice the concentration of vitamins and amino acids. 10% fetal bovine serum and antibiotics. The cells are deficient in galactose-l-phosphate dehydrogenase and possess the B type (electrophoretic) of glucose-6-phosphate dehydrogenase, whereas the sibling cells (CCL 132) possess the A tvpe variant. The CHP 4 cells retain all of the above special characteristics for at least 30 serial passages.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 11.

Freeze Medium: Culture medium. 90%: glycerol. 10%: antibiotic-free.

Viability: Approximately 85ζ< (dye exclusion).

Culture Medium: Minimum essential medium (Eaglet with twice the concentration of amino acids and vitamins in Hanks* BSS. 90%. fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Ceils: An inoculum of 5x IO1 viable cells in the above culture medium at 37 C multiplies 7-fold in 10 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 51 Cells: 2n = 46 Cells:_I 3 46 I Chromosomes: 43 45 46 47 Normal human diploid male, stable karyotype.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dye-exclusion test and agar microimmunodiffusion technique.

Virus Susceptibility: Susceptible to poliovirus type I. vesicular stomatitis (Indiana Strain). ECHO type 11. herpes simplex and vaccinia viruses.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: WJ. Mellman. Department of Pediatrics and Medical Genetics. University of Pennsylvania School of Medicine and Children's Hospital of Philadelphia. Philadelphia. Pennsylvania.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 134 LL 29 (AnHa)_(Lung, diploid, Human)_ The LL 29 cell line was initiated in March 1975 by K. Bradley from a biopsy of lung tissue taken from a 26 year-old. female Caucasian with idiopathic pulmonary fibrosis. A frozen ampule of cells at passage 2 (and estimated population doubling[PDL] 6) was submitted to the American Type Culture Collection in June 1977. Derived populations at passage 7 (approximately 18 PDL) are available for distribution. Progeny were found to undergo an additional 11 doublings in longevity trials performed during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 7 (approximately 18 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 96% (dye exclusion).

Culture Medium: FI2K. 85%: fetal bovine serum. 15%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of I 0 χ 10s cells.' ml in the above medium will increase 2-3 fold in 7 days. Plating Efficiency: 18% at passage 7 (approximate PDL 18) in the above medium.

Morphology: Fibroblast-1,ke.

S3 CERTIFIED CELL LINES - CCL Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_12 1 I 6 4 3 I 31 Chromosomes: 37 39 40 41 42 43 44 45 46 Stemline number is diploid with a relatively unstable karyotype. Structural chromosome abnormalities are present in 8% of the cell population. There is no Y chromosome as indicated by the quinacrine fluorescence technique. Giemsa banding shows no cross-conta mi nation.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: R.G. Crystal. Pulmonary Branch. National Heart. Lungand Blood Institute. National Institutes of Health. Bethesda. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 135 LL 47 (MaDo)_(Lung, diploid. Human)__ This cell line was initiated by K. Bradley in November 1975 from a biopsy taken from a normal region of a lung of a 16 year-old. Black male with osteogenic sarcoma. An ampule of cells frozen at passage 3 and estimated population doubling (PDL) 5 was submitted to the American Type Culture Collection in June 1977. Cells at passage 9 (approximate PDL 14) are available for distribution. Progenv were found to undergo 20 additional population doublings in longevity trials performed during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 9 (approximately 14 population doublings).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 75% (dye exclusion).

Culture Medium: FI2K. 85%; fetal bovine serum. 15%; 3ntibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x 10’ cells per ml in the3bove medium will increase 2-3 fold in 7 days. Plating Efficiency: 15% at passage 9 (approximate PDL 14) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I 3 I 2 39 2 I Chromosomes: 40 42 43 44 45 46 47 52 λ Stemline number is diploid with stable karyotype. One chromatid break was noted in 50 metaphase cells. The karyotype contains a brightly fluorescent Y chromosome as revealed by the quinacrine mustard fluorescence technique. Giemsa banding indicated no cross-contamination. ' Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: R.G. Crystal. Pulmonary Branch, National Heart. Lung and Blood Institute. National Institutes of Health. Bethesda. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 136 RD_(Rhabdomyosarcoma, embryonal. Human)_ The RDcell line was established by R.M. McAllister from a malignant embryonal rhabdomyosarcoma of the pelvis of a 7-year-old Caucasian female in February. 1968 (Cancer 24:520-526.1969). The cells grew as monolayers in liquid medium and formed colonies in agar in minimum essential medium (Eagle) supplemented with 10% fetal bovine scrum or in Freeman's medium (J. Virol. Z.-326.1967). The culture consists of two cytologic types resembling those of the original tumor-spindle cells and large multinucleated ceils. No myofibrils could be demonstrated in the cells by light or by electron microscopy nor were virus particles detected. The cells contain myoglobin and myosin-A TPase activity. The RD cell line is the first human rhabdomyosarcoma cell line characterized and studied in detail. The ceils were submitted to the American Type Culture Collection in the 22nd passage in September. 1969. It has been demonstrated that the cells grow well in culture through at least 56 serial subcultures. NOTE: This line has also been designated TE32 and I30T in the literature.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 32.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%. antibiotic-free.

Viability: Approximately 80% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with twice the standard concentrations of amino acids and vitamins with Hanks' BSS. 90%; fetal bovine serum (not inactivated). 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 103 viable cells ml m the above culture medium at 37 C. multiplies 3-4 fold in 8 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Spindle cells and large multinucleated cells.

CERTIFIED CELL LINES - CCL ATCC CCL 134 (continued) Karyology: Chromosome Frequency Distribution 51 Cells. 2n = 46 Cells_I 2 3 4 9 10 4 3 I I I I I I I I I 6 Chromosomes. 45 46 47 48 49 50 51 52 53 54-58-60 61-68-84-87 88 91-97 Karyotype unstable within a hyperdiploid bimodal stemline number of 49 and 50. Twenty-two cells had chromosome associations. 15 cells microchromosomes, two cells had fragments, two cells with breaks, two cells with achromatic gaps and one cell with a secondary constriction.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dye-exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. vesicular stomatitis (Indiana Strain), herpes simplex and vaccinia viruses. Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submined by: R.M. McAllister. Professor of Pediatrics. U.S.C. School of Medicine and Head. Division of Virology. Children's Hospital of Los Angeles. Los Angeles. California.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 137 HEL 299_(Lung, embryonic. Human) Diploid, G6PD type A H EL 299 is one of a series of diploid fibroblast-like cell lines initiated by R.G. Brackett for potential use in vaccine development. It is one of the few human diploid fibroblast-like cell lines in the American Type Culture Collection to contain the A type electrophoretic variant of glucose-6-phosphate dehydrogenase (W.D. Peterson. Jr. et al. Proc. Soc. Exp. Biol. Med. 129:772. 1968,. The line was derived from embryonic lung tissue of a Negro male in September. 1965. The lung tissue was trypsinized and the cells were planted in glass flasks in a medium consisting of minimum essential medium (Eagle) 85% and fetal bovine serum. 15%; with penicillin and streptomycin. One transfer, using trypsin, was made and the resultant second passage monolayer, antibiotic-free, was frozen in liquid nitrogen. After three years in storage, reference seed stock was prepared for the American Type Culture Collection from ampules of second passage material. Cells were then grown in MEM. 90%; fetal bovine serum. 10%; amibiotic-free and multiplied 10 or more fold in seven days for 10 transfers. After an additional 9 transfers the growth rate became slower and evidence of senescence was observed. The type A G6PD persisted and no apparent change in karyotype was noted during the additional transfers. The life expectancy of the cells was determined to be approximately 20 serial subcultures from tbe tissue of origin.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subculture* from Tissue of Origin: 4.

Freeze Medium: Basal medium (Eagle) in Hanks* BSS. 80%: feta) bovine serum. 15%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: Approximately 90% (dye exclusion,.

Culture Medium: Minimum essentia) medium (Eagle, with non-essential amino acids, sodium pyruvate (I mM per L). lactalbumin hydrolysate (0.1%) and Earle's balanced salt solution. 90%; fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 4 x 10* cells per ml in the above culture medium at 37 C. in an atmosphere of % carbon dioxide-95% air will multiply approximately 20-fold in seven days for the first ten transfers. After this a slower growth rate should be expected, leading to senescence in approximately 9 more transfers.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution of 100 Cells: 2n = 46 Cells;_I 1 692 Chromosomes: 42-44 45 46 Stemline is diploid. Karyotype is that of alTonnal human male.

SteriUty: Tests for mycoplasma, bacteria, and fungi were negative.

Specie»: Confirmed as human by immunofluorescence test and karyotype.

Vlra» Susceptibility: Susceptible to vesicular stomatitis (Indiana Strain, virus and poliovirus type I.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type A.

Submitted by: R.G. Brackett. Parke-Davis and Company, Detroit. Michigan.

Prepared and characterized by: Child Research Center of Michigan. Detroit. Michigan and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 138 Detroit $62_(Carcinoma, pharynx, Human) Heteroplold, G6PD type > .

Detroit 562 was derived from metastatic carcinomatous cells in pleural fluid obtained from an adult Caucasian female who had a primary carcinoma of the pharynx (Peterson. W.D.. Jt..etal. Proc. Soc. Exp. Biol. Med. /36.· 1187.1971). Approximately 8 x IO9 cells were centrifuged from the original pleural fluid and were inoculated in each of two flasks in minimum essential medium (Eagle) supplemented with non-essential amino acids, sodium pyruvate (I mM per L). lactalbumin hydrolysate (0.1 %). 80%: and feta! bovine' scrum, 20%. Although the culture contained some fibroblast-like cells when fmt inoculated, beteroploid epithelial-like cells S CERTIFIED CELL LINES - CCL Karyoiogy: Chromosome Frequency Distribution 50 Cells: 2n = 42 Cells:_I1I2I7IS245II4 3II Chromosomes: 49 62 67 68 69 70 71 72 73 74 75 76 77 78 80 85 Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as rat by immunofluorescence and isoenzymology (G6PD and LDH). Reverse Transcriptase: Not detected.

Submitted by: M.E. Kaighn. Pasadena Foundation for Medical Research. Pasadena. California. Prepared and characterized by: American Type Culture Collection. Rockville, Maryland.

ATCC CCL ISO A K-D_(Lung, Cat)___ The AK-D line is a clonal derivative obtained from mass cultures of fetal feline lung after passage 14 by A. Kniazeff et aL (Lab. Invest. 34:494-500.1976). Clones were initially propagated using a mixture of Eagle's MEM with 10% fetal bovine serum and a similar medium conditioned by incubation for 24 hours with feline lung cells. At passage 26 post cloning, dense membrane bound bodies with concentric lamellae were reportedly observed on examination of cell pellets by electron microscopy.

Cultures were submitted at clonal passage 20 by A. Kniazeff to the American Type Culture Collection in June. 1976. While lamellar inclusions can be observed through examination by transmission electron microscopy, these are not found in high frequency. Rates of phosphatidylcholine synthesis are less than those exhibited by fibroblasts from feline tongue (See CCL 176) or epithelia from feline kidney (See CCL 94). The line is therefore certified as indicated below, but cannot be definitively characterized as of type II origin or function.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures front Tissue of Origin: 30.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%; antibiotic-free.

Viability: 90% (dye exclusion).

Culture Medium: FI2K. 85%; fetal bovine serum. 15%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 3 x 10* cells/ ml of the above culture medium increases 12-fold in 10-12 days. Plating Efficiency: Approximately 28% in the above culture medium.

Morphology: Epithelial-like.

Karyoiogy: Chromosome Frequency Distribution 50 Cells: 2n = 38 Cells:_1 I 3 5 3 7 I 10 4 4 3 2 I I 1 I I 1 Chromosomes: 29 30 31 34 35 36 37 38 39 40 41 42 43 44 45 49 52 70 The stemline is diploid with unstable karyotype. .Most metaphases lack a member of the pair one of E group chromosomes. Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as feline by immunofluorescence and isoenzymology (G6PD and LDH).

Virus Susceptibility: Donor states that the line is susceptible to panleucopenia. feline herpes and several feline picornaviruses. Reverse Transcriptase: Not detected.

Submitted by: A. Kniazeff. University of California School of Medicine, San Diego. La Jolla. California.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 151 LL 24_(Lung, diploid, Human)_ The LL 24 line is one of several fibroblast-like lines derived by K. Bradley from human lung. This line was initiated in January 1975 from apparently normal autopsy tissue from the lung of a 5 year-old male. An ampule of cells frozen after one passage and estimated population doubling (PDL) 2 was submitted to the American Type Culture Collection in June 1977. Derived populations at passage 6 and approximately 14 PDL are available for distribution. Progeny were found to undergo an additional 25 population doublings in longevity trials performed during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 6 (approximately 14 population doublings).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 92% (dye exclusion).

Culture Medium: FI2K. 85%; fetal bovine serum, 15%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x I O’ ceils, ml in the above medium will increase jpproximately 2-fold in 7 days.

Plating Efficiency: 8% at passage 6 (approximate PDL 14) in the above medium.

Morphology: Fibroblast-like.

CERTIFIED CELL LINES - CCL ATCC CCL 151 (continued) Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I 2 2 4 831 I Chromosomes: 33 34 41 43 44 45 46 48 Stemline number is diploid with stable karyotytpe. No gross structural chromosome abnormalities were detected. The karyotype contains a brightly fluorescent Y chromosome as revealed by the quinacrine mustard fluorescence technique. Giemsa banding revealed no cross-contamination.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: R.G. Crystal, Pulmonary' Branch. National Heart. Lung and Blood Institute. National Institutes of Health. Bethesda. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville, Maryland.

ATCC CCL 153 HFLI_(Lung, diploid, Human)_ The cell line was initiated from lung tissue of a 16-18 week-old human fetus in March 1975 by K. Bradiey (J. Biol. Chem. 255. 5250-5260. 1980). A frozen ampule of cells al passage 2 and estimated population doubling (PDL) 3 was submitted to the American Type Culture Collection in June 1977. Derived populations at passage 7 are available for distribution and can be carried through at least an additional 46 serial subcultivations. The deriving investigator indicates that the line will undergo a total of at least 57 PDL.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 7 (approximately 11 population doublings).

Freeze Medium: Culture medium. 95%; dimethy) sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 96% (dye exclusion).

Culture Medium: FI2K. 85% fetal bovine serum. 15%; antibiotic-free.

Growth Cbaracteristicsof Thawed Cells: An inoculum of 1.0 χ 109 cells ml in the above medium will increase approximately 7-fold in 7 days.

Plating Efficiency: 7% at passage 7 (approximate PDL 11) in the above medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I 1223 1344 26 2 1 Chromosomes: 36 37 38 39 40 42 43 44 45 46 47 48 Stemline number is diploid with a relatively stable karyotype One chromosome break was noted in 50 metaphase cells. Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: R.G. Crystal. Pulmonary Branch. National Heart. Lung and Blood Institute. National Institutes of Health. Bethesda.

Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 154 WI-1003_(Lung, Human)_ WI-1003 is one of several fibroblast-like strains derived by L. Hayflick from human adult lungs (Exp. Cel) Res. J7/6I4.1965). The donor was a 67 year-old with cause of death reported as dissecting aneurysm. Standard mass culture procedures and Eagle's basal medium supplemented with 10% calf serum were used during derivation and cultivation. The strain was found to be propagable through about 24 population doublings at a 1:2 split ratio.

Cells frozen in April 1973 at the 8th population doubling level were submitted to the American Type Culture Collection in February' 1977.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 12 (12.6 population doublings).

Freeze Medium: Culture medium. 95% dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 90% Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90% fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 10s cells/ml in FI2K.85%and fetal bovine serum. 15% will increase 3-4 fold in 8 days.

Plating Efficiency: 9% at PDL 12.6 in FI2K. supplemented with 15% fetal bovine serum.

Morphology: Fibroblast-like.

CERTIFIED CELL LINES - CCL Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells_I I 6 14 27 I Chromosomes 41 42 44 45 46 47 Stemline number of 46 chromosomes with diploid karyotype. No marker chromosomes noted with trypsin-Giemsa banding technique. The strain is female in origin since no Y chromosome was detected after quinacrine mustard fluorescent staining.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by immunofluorescence and isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: L. Hayflick. Children's Hospital Medical Center, Oakland. California.

Prepared and characterized by: American Type Culture Collection, Rockville. Maryland.

ATCC CCL 155 RPMI 8226 (Myeloma. Human) IgG lambda-type light chain secreting_ The RPMI 8226 cell line is one of a series of human hematopoietic cell lines established by G. Moore, et al. (Proc. Soc. Exp. BioL Med. 125:1246-1250. 1967). The cells were obtained from the peripheral blood of a 61 year-old male with multiple myeloma. The Ί5 culture was initiated in RPMI medium 1640 supplemented with 10% fetal bovine serum in June 1966 and became established 66 days later. The cultured cells resembled the lymphoblastoid cells of other human lymphocyte cell lines developed from peripheral blood but no typical mature plasma cells were noted, only immature cells with deep staining cytoplasm. Immunoglobulin studies revealed that the RPMI 8226 cells produce and secrete free lambda-type light chains of immunoglobulin. No evidence was obtained either from the cells or the medium to indicate the presence of any heavy chain production. The cells secreted approximately ISug lambda-chain per 24 hours per 10* cells (45 x 107 molecules per cell per day). RPMI 8226 was shown to grow without an adaptation period in RPMI media 1640.I634and I603intheabsenceofserum(N.Y.StateJ. Med. 68:2054-2060.1968). The replication ofthe cells in chemically defined medium provides a promising means for studies relating to the synthesis of immunoglobulins. The RPMI 8226 cell line was submitted to the American Type Culture Collection in February, 1971.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown.

Freeze Medium: Culture medium. 90%; glycerol. 10%; antibiotic-free.

Viability: Approximately 55% (dye exclusion).

Culture Medium: RPMI medium 1640. 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Ceils: An inoculum of 5 x 10s viable cells, ml in the above culture medium will increase 8-9 fold within 7 days when incubated at 37 C. provided fresh medium is added every 2-3 days.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyology: Chromosome Frequency Distribution 55 Cells: 2n = 46 Cells:_I I 1 I I 6 2 I I 6 11 11 11 2 I I I I I Chromosomes: 57 58 59 60 61 62 63 64 65-67 68 69 70-72 73-91 92-120-135 Unstable karyotype in triploid range of 68-70 chromosomes. Two large marker chromosomes with terminal centromeres. Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by cytotoxic-antibody dye exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. vesicular stomatitis (Indiana Strain), herpes simplex and vaccinia viruses.

Reverse Transcriptase: Not detected.

Erythrocyte Rosette Tests: E. 0: EA. 1%; EAC. 13%.

HLA Profile: Aw 19. Β15. B37. Cwl EBNA: Negative.

Isoenzymes: G6PD type A.

Submitted by: G.E. Moore. Roswell Park Memorial Institute. Buffalo. New York.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 1S6 RPMI I78B_(Peripheral blood, Human) IgM secreting_ The RPMI 1788 cell line is one in a series of hematopoietic cell lines developed by G. Moore, et al. (J. Nat. Cancer Inst. 43: 50 1119-1128.1969). The culture was originated in October. 1968 from peripheral blood leukocytes of an apparently normal 33 year-old Caucasian male and became established in December of 1968. The cell line replicated rapidly and was maintained in either static suspension culture or spinner flasks on RPMI medium 1640 supplemented with 20% fetal bovine serum. The RPMI 1788 has been shown to secrete IgM-lambda chains and to be positive for HLA 2.7 antigens. The ceil line was submitted to the American Type ' Culture Collection in 1971.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown.

Freeze Medium: Culture medium. 87.5%: dimethyl sulfoxide (DMSO). 12.5%; antibiotic-free.

Viability: Approximately 70% (dye exclusion).

Culture Medium: RPMI medium 1640. 30%: fetal bovine serum. 20%; antibiotic-free.

CERTIFIED CELL LINES - CCL ATCC CCL 16S (continued) Reverse Transcriptase: Not detected.

Submitted by: G. Baer. Center for Disease Control. Lawrenceville Facility. Lawrenceville. Georgia.

Prepared and characterized by: The Institute for Medical Research. Camden. New Jersey and American Type Culture Collection. Rockville. Maryland.

ATCC CCL 169 CCBQ _(Sternum. Goose, Anser anser)_ This cell line was derived by Coon and Williams (Carnegie Year Book 67. 421.1968) from the sternum of a 15-17 day embryo of the domestic goose (Anser anser). The tissue was dissociated with a mixture of collagenase. trypsin and chicken serum (CTC). and a primary colony of fibroblast-like cells was isolated to develop the cell line. A modified version of Ham's FI2 (Coon and Weiss. Proc. Nat. Acad. Sci. 62: 852-859. 1969) supplemented with 5% fetal bovine serum was used during clonal isolation and for subsequent propagation.

The cell line was submitted to the American Type Culture Collection at passage 151 in January. 1972. Jr was propagated for the Collection in Hams FIO medium supplemented with 5% fetal bovine serum and can be subcultivated by standard treatment with 0.25% trypsin.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 157.

Freeze Medium: Ham's FIO. 90%; fetal bovine serum. 5%; glycerol. 5%. antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Ham's FIO. 95%; fetal bovine serum. 5%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 3.5 χ I O' cells in a T 25 flask increases approximately 3 fold in 9-12 days with fluid renewals (5 ml/T25) every 3-4 days.

Reverse Transcriptase: Not detected.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 25 Cells: 2n = 76 Cells:_21121211123111)121 Chromosomes: 80 83 84 94 96 ) 00 104 105 107 108 112 114)16 117 119 125 130 145 Exact chromosome count to determine the modal number is difficult to achieve owing to the large number of microchromosomes which complicate the picture. There are 20-27 macrochromosomes.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed by precipitin line formation using the agar immunodiffusion method.

Virus Susceptibility: Susceptible to vesicular stomatitis, herpes simplex and sindbis viruses. Not susceptible to poliovirus type I. Reverse Transcriptase: Not detected.

Submitted by: H.G. Coon. Laboratory of Cell Biology . National Cancer Institute. NIH, Bethesda. Maryland.

Prepared and characterized by: Institute for Medical Research. Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CCL 171 MRC-S_(Lung, diploid. Human)_ The MRC-5 cell line was derived from normal lung tissue of a 14 week-old male fetus by J.P. Jacobs in September of 1966 (Nature 227:168-170.1970). The growth medium used was Eagle’s basal medium in Earle's balanced salt solution supplemented with 10% calf serum. Following the initial cultivation of the cells subcultures were prepared twice weekly at a 1:2 ratio. When the cells reached approximately the 7th cell doubling the majority of the cultures were harvested io prepare a frozen cell stock. Subsequent observations revealed the MRC-5 cells are capable of attaining 42-46 population doublings before onset of the decline in proliferation usually experienced with human fibroblast lines. Comparative studies (Proc. Symp. Human Diploid Cells, Yugoslav Acad. Sci. Ans. Zagreb.. pp. 43-55, 1970) showed that MRC-5 cells replicate more rapidly and are less sensitive to adverse environmental factors than Wl-38 cells. The MRC-5 cel) line, like WI-38 (ATCC CCL 75). is susceptible to a wide range of human viruses, is suitable for the production of viral vaccines, and has been useful in senescence studies (Nature 236:26.1972; ibid.. 239:316,1972). A culture of the MRC-5cell line was submitted to the American Type Culture Collection in the 9th passage in June. 1972.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 14.

Freeze Medium: Eagle's basal medium in Hanks* BSS. 77%; fetal bovine serum, 15%; dimethyl sulfoxide (DMSO), 8%. antibiotic-free.

Viability: Approximately 95% (dye exclusion). ’ Culture Medium: Eagle's basal medium in Hanks* BSS, 90%: fetal bovine serum (not inactivated), 10%; antibiotic-free.

Growth Characteristics of Thawed Celb: An inoculum of 4 x 10* viable cells/ml in the above culture medium at 37 C multiplies 3-5 fold in 7 days.

Plating Efficiency: Less than 1% in the above culture medium.

Morphology: Fibroblast-like. 9 CERTIFIED CELL LINES - CCL Karyology: Chromosome Frequency Distribution 46 Cells: 2n = 46 Celts:_2 5 35 3 I Chromosomes: 44 45 46 47 92 Stemline is diploid. Karyotype is that of a normal human male.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as human by the cytotoxic-antibody dye exclusion test.

Virus Susceptibility: Susceptible to poliovirus type I. herpes simplex and vesicular stomatitis (Indiana Strain) viruses.

Reverse Transcriptase: Not detected.

Isoenzymes: G6PD type B.

Submitted by: J.P- Jacobs. National Institute for Medical Research, London. England.

Prepared and characterized by: Institute for Medical Research, Camden. New Jersey and American Type Culture Collection.

Rockville. Maryland.

ATCC CL 173 3T3-L1_(Embryo, Mouse) See ATCC CCL 92.1.

ATCC CCL 176 Fc3Tg_(Tongue, Cat, Fela catus)_ The Fc3Tgcell line was established from normal embryonal tongue tissue of a female feline by AJ. Kniazeff. W.A. Nelson-Reesand N.B. Darby, Jr. in August. 1966 by mincing the tissue into I mmJ fragments and overlaying with culture medium. The Fc3Tghas been cultured on antibiotic-free Earle's minimum essential medium (Earle's salts) supplemented with non-essential amino acids and 10% fetal bovine serum. It has a history of being free of any microbial contamination. Studies carried out at the Naval Biological Laboratory in 1967 indicated the Fc3Tgceil line compares favorably with other newly initiated feline cells in replicating a wide variety of known feline viruses.

The ceil line was submitted to the American Type Culture Collection in June. 1975. in the 6th passage. It has been demonstrated that the cells can be successfully propagated for at least 35-40 passages bevond the frozen reference seed stock.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 16.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO),*5%: antibiotic-free.

Viability: Approximately 90% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids, sodium pyruvate, and Earle's BSS with reduced bicarbonate (0.85 g/ L). 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 4 x 10* viable cells, ml in the above culture medium at 37 C. in a closed system, multiplies approximately 3-4 fold in 7 days.

Plating Efficiency: Approximately 33% in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 38 Cells:_2 4 2 2 2 I 531 I Chromosomes: 30 31 33 34 35 36 37 38 76 The stemline number is stable. No structural chromosome abnormalities noted in stemline. The largest pair. El. has a deep secondary constriction on the short arm.

Sterility: Tests for mycoplasma, bacteria, and fungi were negative.

Species: Confirmed as feline by chromosome analysis and starch-gei electrophoresis analysis of LDH and G6PD isoenzymes.

Virus Susceptibility: Susceptible to feline conjuctivitis vims, picornavirus. and herpesvirus.

Reverse Transcriptase: Not detected.

Submitted by: W.A. Nelson-Rees. University of California. School of Public Health. Naval Biological Laboratory. Berkeley.

California.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CL 177_XB-2_(Mouse teratomai keratinocytes)__ XB-2 was deposited with the American Type Culture Collection for patent purposes. It is available for distribution, but it has not been characterized by the ATCC. Reference: U.S. Patent 4.016.036.

ATCC CCL 183 D-17_(Primary osteogenic sarcoma. Canine, Canis familiaris)_ The D-17 cell line was derived from an osteosarcoma, metastatic to the lung in an 11 year-old. female poodle. The line was initiated in March. 1969 by J. Riggs et al. (J. Gen. Virol. 25: 21-29. 1974) after trypsinization of the tumor biopsy. Recovered cells were propagated in Eagle's minimal essential medium supplemented with 10% fetal bovine serum plus antibiotics. The line has been used for CERTIFIED CELL LINES - CCL ATCC CCL IM IMR-90_(Lung, diploid. Human)_______ The human diploid fibroblast strain IM R-90 was derived by W. W. Nichols and associates (Science 196:60-63. 1977) from the lungs of a 16-week female fetus. The division potential, viral susceptibilities and other properties have been thoroughly studied such that the line may be considered as an alternate for WI-38 and other standard human lung cell strains.

Cells at passage 4. population doubling (PDL) 10. were submitted to the American Type Culture Collection by W.W. Nichols in September. 1976. Derived populations at PDL 20 and above are available for general distribution. Earlier passage material from this stock can be made available only under special circumstances and with approval of both the American Type Culture Collection and the National Institutes of Health.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 7 (20.1 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO), 5%: antibiotic-free.

Viability: 93%.

Culture Medium: Minimal essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%: fetal bovine serum. 10% antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 5 x 10* cells, ml in the above culture medium will increase approximately 10 fold in 7 days.

Plating Efficiency: Approximately 18% at PDL 20.1 in the above culture medium.

.Morphology: Fibrobiast-like.

Karyology: Chromosome Frequency Distribution 40 Cells: 2n = 46 Cells:_2 I 4 40 I 2 Chromosomes: 34 41 45 46 47 48 Stemline number is diploid with stable karyotype.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymoiogy (C6PD type B and typical LDH banding).

Virus Susceptibility: Donor indicates the cells are susceptible to polio types 1-3. herpes simplex I and 2. varicella zoster, vesicular stomauc. cytomegalo and vaccinia viruses.

Reverse Transcriptase: Not detected.

Submitted by: W.W. Nichols. Institute for .Medical Research. Camden. New Jersey.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CL 187_LS 180_(Colon, adenocarcinoma, Human)_ LS 180 and LS I74T (CL 188) were both derived from the same patient, a 58 year-old female with Duke's type B adenocarcinoma of the colon (B.H.Tom. et at.. In Vitro 12:180-191. (976). The tissue was minced and incubated without transfer for ten months. Then some flasks were subcultured by scraping with a rubber policeman to produce the LS 180 line which has been maintained for over 30 passages in that fashion. The variant line (CL 138-LS 174T) was produced by trypsinization of companion cultures of those used to establish LS 180.

LS 180 secretes carcinocmbryonic antigen *CEA) and mucin. It is tumorigenic in nude mice.

A culture at passage 34 was submitted to the American Type Culture Collection in 1977 under a patent agreement. The LS. Patent 4.228.236 was issued in December of 1980 and ihe line is now available for general distribution.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 34.

Freeze Medium: Culture medium. 90%: dimethyl sulfoxide (DMSO). 10%: antibiotic-free.

Viability: Approximately 80% (dye-exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%; teial bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 3 x 10* v iable cells, ml in the above culture medium will increase 27 fold in days provided the medium is renewed three times.

Plating Efficiency: Approximately 27% in ihe above culture medium.

Morphology: Epithelial-like.

Karyology: Chromosome Frequency Distribution 100 Cells: 2n =46 Cells:_4 5 17 69 4 I Chromosomes: 42 43 44 45 46 47 The stemline karyotype was45.t(X:5)(qi2:qJI) with tet raploid-like cells occurring at 2.2 percent. Occasional changes in karyotypes were also noted as a result of balanced translocations producing new marker chromosomes. In conjunction with this, decreases in chromosomes involving interchromosomal exchanges were seen. The karyotype was exactly the same as that originally described by the depositor.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by immunofluorescence and isoenzyme analysis (G6PD type B and typical LDH).

Reverse Transcriptase: Not detected.

Tumorigenicity: Tumors developed within two weeks at 100% frequency (5,· 5) in nude mice inoculated subcutaneously with IO7 cells. 1 CERTIFIED CELL LINES - CCL ATCC CL 187 (continued) Blood Group: O.

HLA Profile: A 2: BI3.B50 Production of Carcinoembryonic Antigen: 1916 ng/10* cells in 10 days.

Colon Antigen 3: Positive.

Isoenzymes: ADA. I: G6PD. B: PGM,. I: PGM,. 2: PGD. A: EST-D. I: PEPD. I.

Submitted by: B.H. Tom. Northwestern University Medical School. Chicago. Illinois.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CL 188_LS 174T_(Colon, adenocarcinoma. Human)_ LS I74T is the trypsinized variant of LS 180(CL 187) colon adenocarcinoma line. It is more easily subcultivated than that parent line and. like LS 180. produces large amounts of carcinoembryonic antigen (CEA). It is tumorigenic in nude mice.

The karyotype is similar to that of LS 180 with a missing X chromosome in a majority of the cells. Electron microscopic studies revealed abundant microvilli and intracytoplasmic mucin vacuoles (B.H. Tom. et al.. In Vitro 12:180-191. 1976).

A culture at passage 100 was submitted to the American Type Culture Collection in 1977 under a patent agreement. The U.S. Patent 4.228.236 was issued in December of 1980 and the line is now available for general distribution.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 104.

Freeze Medium: Culture medium. 90%: dimethyl sulfoxide (DMSO). 10%: antibiotic-free.

Viability: Approximately 90% (dye-exclusion) Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%.: feta! bovine scrum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 3 x 10* viable cells ml in the above culture medium multiplies approximately I? fold within 7 days provided the medium is renewed twice.

Plating Efficiency: Approximately 7% in the above culture medium.

Morphology: Epithelial-like.

Karyoiogy: Chromosome Frequency Distribution 100 Cells. 2n =46 Cells:_13 6 3 1 I 10 9 16 49 I Chromosomes 36 3" 38 39 40 41 42 43 44 45 46 The karyotype is 45.X with one of the sex chromosomes missing. No apparent chromosome aberrations were found.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by immunofluorescence and isoenzyme analysis (G6PD type Band typical LDH).

Reverse Transcriptase: Not detected.

Tumorigenicity: Tumors developed within one month at 100% frequency (5 5) in nude mice inoculated subcutaneously with 10 cells. Blood Group: O.

HLA Profile: A2: BI3.B5O Production of Carcinoembryonic Antigen: 1944 ng I O' cells in 10 days.

Colon Antigen 3: Positive. isoenzymes: ADA. I: G6PD. B: PGM,. 1: PGM;. 2: PGD. A: EST-D. I: PEPD. 1.

Submitted by: B.H. Tom. Northwestern University Medical School. Chicago. Illinois.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CL 189_PEG-1-6_(Mouse hybridoma, anti-influenza antibody producing)_ PEG-1-6 was deposited with the American Type Culture Collection for patent purposes. It is available for distribution, but it has not been characterized by the ATCC. Reference: U.S. Patent 4.196.265.

ATCC CCL 190 LL 86 (LeSa)_(Lung, diploid. Human)_ This ceil line was derived from biopsy material taken from a normal area of the lung of an 18 year-old male Caucasian with osteogenic sarcoma. The line was initiated in December 1976 by K. Bradley. A frozen ampule of cells at passage 3 and estimated population doubling (PDL) 5 wassubmittcd to the ATCC in June 1977. Derived populations at passage 9 (approximate PDL 15) are available for distribution. Progeny were found to undergo an additional 13 doublings in longevity trials performed during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 9 (approximately IS population doublings).

Freeze Medium: Culture medium. 95%: dir'ethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 86% (dye exclusion).

Culture Medium: FI2K. 85%; fetal bovine serum. 15%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.3 x 10s cells/ ml in the above culture medium will increase approximately 4 fold in 7 days.

Plating Efficiency: 9% at passage 9 (approximate population doubling 15) in the above culture medium.

Morphology: Fibroblast-like.

CERTIFIED CELL LINES - CCL Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_1 I 1 I I I I 1 3 5 6 3 24 I Chromosomes: 26 31 32 33 34 36 38 41 42 43 44 45 46 47 The karyotype is that of human male as confirmed by quinacrine fluorescence studies.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: R.G. Crystal. Pulmonary Branch. National Heart. Lung and Blood Institute, National Institutes of Health. Bethesda. θ Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 191 LL 97A (AlMy)_(Lung, diploid, Human)_ Cell line LL 97A was initiated in April 1977 by K. Bradley from a biopsy of lung tissue taken from a 48 year-old, male Caucasian with idiopathic pulmonary fibrosis. A frozen ampule of cells at passage 4 and estimated population doubling (PDL) 6 was submitted to the American Type Culture Collection in June I977. Derived populationsat passage 8 and approximately 13 PDL are available for distribution. Progeny were found to undergo an additional 11 doublings in longevity trials performed during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 8 (approximately 13 population doublings).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 85% (dye exclusion).

Culture Medium: FI2K. 85%; fetal bovine serum. 15%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 4.0 x 10* cells ml in the above medium will increase approximately 5 fold in 7 days.

Plating Efficiency: 24% at passage 8 (approximate PDL 13) in the above medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 25 Cells: 2n = 46 Cells:_2 I I I 17 1 I I Chromosomes: 34 36 42 45 46 48 58 92 Stemline number is diploid with a relatively unstable karyotype. There is a brightly fluorescent Y chromosome in each cell. Giemsa 30 banding indicated no cross-contamination.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative. f Species: Confirmed as human by isoenzymology (G6PD type B and typical LDH banding).

Reverse Transcriptase: Not detected.

Submitted by: R.G. Crvstal. Pulmonarv Branch. National Heart. Lung and Blood Institute. National Institutes of Health. Bethesda. 35 Maryland.

Prepared and characterized by: American Type Cuiture Collection. Rockville. Mary land.

ATCC CCL 192 RFL-6_(Lung, Rat)_ RFL-6 is a fibroblast-like cell line derived from lung tissue of normal, germ-free. 18-day gestation. Sprague-Dawley rat fetus. This cell line was initiated in March 1978 by M. Macy at the American Type Culture Collection from enzymatically dispersed tissue.

Derived populations at passage 3 and approximate population doubling (PDL) 4 are available for distribution. Progeny were found to undergo at least 45 additional doublings in longevity trials performed during characterization.

DESCRIPTION OF RESPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 3 (approximately 4 population doublings).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 73% (dye-exclusion).

Culture Medium: FI2K. 85%; fetal bovine serum. 15%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.4 x 105 cells ml in the above culture medium will increase almost 2-fold in 7 days.

Plating Efficiency: 6% at passage 3 (approximate PDL 4) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 42 Cells:_224II3I25 113III12 Chromosomes: 30 32 36 37 39 40 41 42 46 47 54 58 63 74 '6 84 The stemline number is 42 with a relatively stable karyotype.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as rat by isoenzymology (G6PD and LDH). 3 CERTIFIED CELL LINES - CCL Reverse Transcriptase: Not detected.

Submitted by: B.C. Starcher and J. Madaras. Department of internal Medicine. Pulmonary Disease Division. Washington University Medical Center. St. Louis. Missouri.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 199 HLF-t_(Lung, Human)_ This fibroblast-like cell line was derived from the peripheral lung tissue of a 54 year-old. Black female with epidermoid carcinoma of the lung. The line was initiated in February 1976 by G. Stoner using tissue explants taken away from the region of the carcinoma. Cultures of cells at passage 4 and approximate population doubling (PDL) 15 were submitted to the American Type Culture Collection in March 1978. Derived populations at passage 9 (approximate PDL 21) are available for distribution. Progeny were found to undergo an additional 14 PDL in longevity trials performed during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 9 (approximately 21 population doublings).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 83% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%; fetal bovine scrum. 10%; amibioiic-free.

Growth Characteristics of Thawed Cells: An inoculum of 7.0 x 10* viable cells - ml in the above medium will increase approximately 2-fold in 7 days.

Plating Efficiency: 3.7% -t passage 9 (approximate PDL 21) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I 2 I I I 6 9 28 I Chromosomes: 38 40 4142 43 44 45 46 47 Human female karyotype. Stemline number is diploid and stable.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: G.D. Stoner. National Cancer Institute. National Institutes of Health. Bethesda. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 200 CCD-13Lu_(Lung, Human)_ This fibroblast-like ceil line was derived from the lung tissue of a 7! year-old. Black male. The donor had pancreatic carcinoma with neoplastic invasion of the spleen and stomach, and a mild case of emphysema. Additional clinical information on the donor is available. The line was initiated in December I978at the American Type Culture Collection from enzyme-dispersed tissue. Derived populations at passage 2 and approximate population doubling (PDL) 7 are available for distribution. Progeny were found to undergo an additional 20 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 2 (approximately 7 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 68% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle's) with non-essential amino acids in Earle's BSS. 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x 10s viable cells, ml in the above culture medium will increase 5-7 fold in 7 days.

Plating Efficiency: 17% at passage 2 (approximate PDL 7) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n - 46 Cells:_2 I 3 1031 3 Chromosomes: 42 43 44 45 46 47 Human karyotype. Stemline is diploid and stable. Y chromosome present as revealed by quinacrine fluorescence.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: M.l. Cour. Cell Culture Department. American Tyoe Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Mary land. 4 CERTIFIED CELL LINES - CCL ATCC CCL 201 CCD-SLu_(Lung. Human)_ This fibroblast-likc cell line was derived from normal lung tissue of a 48 year-old. Caucasian male with cerebral thrombosis The cause of death was a cardiovascular accident. Additional clinical data are available on the donor who was maintained lot organ transplantation prior to removal of the lung The line was initiated in November I97g at the American Type Culture Collection from tissue explants Derived populations at passage 3 and approximate population doubling (PDL) 15 are available for distribution. Progeny were found to undergo an additional 16 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subculture* from Tissur of Origin: 3 (approximately 15 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 78% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle $ BSS. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of I.Ox 10·' viable cells ml in the above culture medium will increase 3-4 fold in 7 days.

Plating Efficiency: < 1% at passage 3 (approximate PDL 15) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n - 46 Cells:_I I 4 3 33 8 Chromosomes: 34 41 42 44 46 47 Human karyotype. Stemiine is diploid and stable. Brightly fluorescent Y chromosome is present.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative Species: Confirmed as human by isoenzymologv (G6PD and LDH).

Reverse Transcriptase: Not delected.

Submitted by: G.P. Maxwell. Cell Culture Department. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 202 CCD-1 lLu_(Lung. Human)_._ This fibroblast-likc cell line was derived from normal lung tissue of a 9 year-old. Oriental male who died as a result of head trauma. Additional clinical information is available on the donor who was maintained for organ transplantation prior to removal of the lung. The line was initiated in November 1978 at the American Type Culture Collection from tissue explants. Derived populations at passage 3 and approximate population doubling (PDL) 19 are available for distribution. Progeny were found to undergo an additional 30 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 3 (approximately 19 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 97% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Celb: An inoculum of 1.0 χ 10-" viable cells ml will increase 9-10 fold in 7 days.

Plating Efficiency: < )% at passage 3 (approximate PDL 19) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n - 46 Cells:_1 I I 4 I 3 I 36 2 Chromosomes: 36 38 40 42 43 44 45 46 47 Stemline is diploid and stable. Human, mate karyotype as revealed by the presence of Y chromosome using quinacrine fluorescence technique.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: G.P. Maxwell. Cell Culture Department. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 203 CCD-14Br_(Bronchiole, Human)_* This fibroblast-like cell line was derived from normal bronchiolar tissue of a 34 year-old. Caucasian female who died of a cere bra aneurysm. Additional clinical information is available on the donor who was maintained for organ transplantation prior to removal ol the lung. The line was initiated in Deceir Ser 1978 at the American Type Culture Collection from tissue expknts. Derived population: at passage 5 and approximate population doubling (PDL) 15 are available for distribution. Progeny were found to undergo at. additional 11 doublings in longevity studies conducted during characterization.

CERTIFIED CELL LINES - CCL DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 5 (approximately 15 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free. -5 Viability: 93% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%: fetal bovine scrum. 10%; antibiotic-free.

Growth Characteristics of Thawed Ceils: An inoculum of 1.0 x I O’ viable cells/ ml in the above culture medium will increase 2-3 fold in 8 days.

Plating Efficiency: 4.5% at passage 5 (approximate PDL 15) in the above culture medium.

Morphology’ Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I I 2 3 633 3 Chromosomes: 39 41 42 43 44 45 46 47 Human female karyotvpe. The stemline is diploid and stable.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: J.L. Caputo. Cell Culture Department. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 204 CCD-I6Lu_(Lung, Human)_ This fibroblast-like cell tine was derived from the normal lung tissue of a 35 year-old. Caucasian male who died of a class 1-2 astrocytoma. Additional clinical information is available on the donor who was maintained for organ transplantation prior to removal of the lung. The line was initiated in January 1979 at the American Type Culture Collection from tissue explants. Derived populations at passage 3 and approximate population doubling (PDL) 15 are available for distribution. Progeny were found to undergo an additional 14 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 3 (approximately IS population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO), 5%; antibiotic-free. 3Q Viability: 81% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Tbawed Cells: An inoculum of 1.0 x 103 viable cells, ml in the above culture medium will increase approximately 4-fold in 7 days.

Plating Efficiency: 3.1% at passage 3 (approximate PDL 15) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I I 1 1 2 1 7 34 I Chromosomes: 37 39 40 41 42 43 44 45 46 48 Human karyotype. Stemline is diploid and stable. Brightly fluorescent Y chromosome was noted with quinacrine fluorescence technique.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: J.L. Caputo. Cell Culture Depanment. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 20$ CCD-I8LU_(Lung, Human)_ This fibroblast-like cel] line was derived from the lung tissue of a 2 month. 17 day-old. Black female. The donor had cerebral anoxia, cardiac anomaly, sepsis, endocardial cushion defect and fetal alcoholic syndrome. Additional clinical information on the donor is available. The line was initiated in January 1979 at the American Type Culture Collection from enzyme-dispersed tissue. Derived populations at passage 2 and approximate population doubling (PDL) 10 are available for distribution. Progeny were found to undergo an additional 24 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 2 (approximately 10 population doublings).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 96% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%: fetal bovine serum. 10%; antibiotic-free. 9β CERTIFIED CELL LINES - CCL ATCC CCL 295 (continued) Growth CharacteristiA of Thawed Cells: An inoculum of I.Ox 10'viable cells ml in the above culture medium will increase 15-20 fold in 7 days.

Plating Efficiency: 329; at passage 2 (approximate PDL 10) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I I 2 I 4 36 4 Chromosomes. 35 36 39 40 44 45 46 47 Stemline number, is diploid and stable. Karyotype is that of a human female.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH) Reverse Transcriptase: Not detected.

Submitted by: M.l. Cour. Cell Culture Department. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 20b MLg_(Lung. Mouse, ddY strain)_ MLg was derived from the normal lung tissue of a newborn, random-bred. ddY strain mouse. The line was originated in January1964 by Y. Hirokawa. Induced and spontaneous release of C-type panicles by this line has been reported (H. Yoshikura and Y. Hirokawa. J. Virol. 13:1319-1325. 1974). Cultures of cells at passage 48 were submitted to the American Type Culture Collection in September 1978. Derived populations at passage 53 are available for distribution.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 53.

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 82% (dye exclusion).

Culture Medium: Minimum essential medium (Eagie) with non-essential amino acids in Earle's BSS. 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of J.Ox I0-* viable cells ml in the above culture medium will increase 10-15 fold in 7 days.

Plating Efficiency: 11.6% at passage 5? in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 66 Cells:_II22I2I54 1O 37 3 I321I Chromosomes: 51 54 56 57 58 59 60 62 63 64 65 66 67 68 69 72 75 76 The stemline chromosome number is hypertriploid with 2S component occurring at 2.4%. All chromosomes were acrocentric.

Usually there was a small acrocentric chromosome per S cel! genome that was composed of a large centromeric heterochromatin (based on C-banding analysis) and a small segment of euehromatin. No Y-like chromosomefs) was detected (based on Q- and C-bandings).

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and cytopathogenic viruses were negative.

Species: Confirmed as mouse by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Positive.

Submitted by: Y. Hirokawa. Department of Pathology. National Institutes of Health. Tokyo. Japan.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 207 CPA_(Pulmonary artery endothelium, Bovine. Bos taurus)_ CPA is a cell line of endothelial morphology isolated from the main pulmonary artery of a normal, very young, unweaned, bovine calf. The line, which also contains smooth muscle cells, was initialed from enzyme-dispersed tissue in January 1979 by U. Ryan. Cultures exhibit angiotensin-converting enzyme activity and react with antibodies to human factor VI11 and alpha 2 macrogiobulin (Ryan « al.. Tissue and Cell 10:535-554, 1978).

A culture of CPA at passage 7 was submitted to the American Type Culture Collection in February 1979. Derived populations at passage 12 are available for distribution. The depositor has found that progenv of the distribution material are also functionally active.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 11 Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO), 5%; antibiotic-free.

Viability: 49%> (dye exclusion).

Culture Medium: Medium 199, 80%; fetal bovine serum. 20%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of I.Ox KPviablecells/ml in theaboveculture medium will increase4-5fold in days at passage 14. Growth rate decreases at higher passages (18-20).

Plating Efficiency: < 1% at passage 12 in the above culture medium.

Morphology: Endothelial. ar CERTIFIED CELL LINES - CCL ATCC CCL 209 (continued) Reverse Transcriptase: Not detected Submitted by: PJ. Del Vecchio. Department of Medicine. University of Miami. School of Medicine. Miami. Uondj Ρπ-μγιιι address: W. Alton Jones Cell Science Center. Old Barn Road. Lake Placid. New York Prepared and characterized by: American Type Culture Collection. Rockville. Maryland ATCC CCL 210 CCD-I9Lu_(Lung. Human)__ This fibroblast-like cell line was derived from the normal lung tissue of a 20year-old. Caucasian female. Head trauma wav the cauw of death. Additional clinical information is available on the donor who was maintained for organ transplantation prior to removal ol the lung. The line was initiated in February 1979 at the American Type Culture Collection from tissue explants. Derived populations at passage 2 and approximate population doubling (PDL) 17 are available for distribution. Progeny were found to undergoat least an additional 19 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 2 (approximately 17 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 91% (dye exclusion).

Culture Medium: CRCM 30. 90%. fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x 10-' via ble cells ml in the above culture medium will increase 9-12 fold in 7 days.

Plating Efficiency: 19% at passage 2 (approximate PDL 17) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells. 2n = 46 Cells:_I 2 3 2 2 36 4 Chromosomes: 38 42 43 44 45 46 47 Stemline number is diploid and stable. The human karyotype is that of a female since no Y chromosome was evident with the quinacrine fluorescence technique.

SteriUty: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (C6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: S. Dilworth. Cell Culture Department. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 211 Hs888Lu_(Lung. Human)_ This fibroblast-like cell line was derived from a region of normal lung tissue of a 20 year-old. Caucasian male with osteosarcoma metastatic to the lung. The line was initiated in August 1975 by R.B. Owens and W.A. Nelson-Rees from enzyme-dispersed tissue. An ampule of cells at passage 5 was submitted to the American Type Culture Collection in October 1978 by W.A. Nelson-Rees. Derived populations at passage 10 and approximate population doubling (PDL) 11 are available for distribution. Progeny were found to undergo an additional 11 doublings in longevity studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 10 (approximate population doubling 11).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide (DMSO). 5%: antibiotic-free.

Viability: 86% (dye exclusion).

Culture Medium: Dulbecco's modified Eagle medium. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x 10s viable cells/ml in the above culture medium will increase 8-14 fold in 7 days.

Plating Efficiency: 20% at passage 10 (approximate PDL 11) in the above culture medium.

Morphology: Fibroblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I I 1 I 5 33 7 Chromosomes: 38 39 41 42 43 45 46 47 Human male karyotype. The siemline number is diploid and stable.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: W.A. Nelson-Rees. Cell Culture Department, University of California. Naval Biosciences Laboratory. Naval Supply Center. Oakland. California.

Prepared and characterised by: American Type Culture Collection. Rockville. Maryland. 3 CERTIFIED CELL LINES - CCL ATCC CCL 212 MRC-9_(Lung, Human)__ MRC-9 is a fibrobiast-like cell line derived from the normal lung tissue of a 15 week-old female Caucasian fetus by J.P. Jacobs in May. 1974 (Jacobs et al.. J. Biol. Stand. 7:113-122. 1979). This cell line is fully characterized according to the internationally agreed requirements of the Cell Culture Committee of the Permanent Section on Microbiological Standardization (International Association of Microbiological Services). An average life span of 44 PDL has been demonstrated. MRC-9 cells, like MRC-5. are. susceptible to a wide rangeof human viruses. Tests for tumorigenicity have proved to be negative. These and other reported properties (see above reference) indicate that this line is suitable for the production of viral vaccines. Cultures of M RC-9 at population doubling (PDL) 10 were submitted to the ATCC in March. 1979.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Approximate population doubling 22 (2nd passage at ATCC).

Freeze Medium: Culture medium. 95%; dimethyl sulfoxide (DMSO). 5%; antibiotic-free.

Viability: 93% (dye exclusion).

Culture Medium: Minimum essential medium (Eagle) with non-essential amino acids in Earle's BSS. 90%; fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 χ 105 viable cells/ml will increase 14-16 fold in 7 days.

Plating Efficiency: 9.5% at PDL 22.

Morphology: Fibrobiast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I I 4 39 5 Chromosomes: 40 43 45 46 47 Human female karyotype with stemline number of 46 chromosomes.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa 3nd viruses were negative.

Species: Confirmed as human by isoenzymology (C6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: J.P. Jacobs. Naiional Institute for Biological Standards and Control. Holly Hill. Hampstead. London. England. Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 213 Daudi_(Burkitt lymphoma. Human)_ The Daudi line was derived from a 16 year-old Negro male with Burkitt ly mphoma by E. Klein and G. Klein in May. 1967(Cancer Res. 28:1300-1310. 1968). It has been demonstrated that the cells are positive for EBNA and VC A and exhibit surface markers for the Fc fragment of IgG. complement receptors and surface bound immunoglobulin (Clin. Exp. Immunol. 25: 367-378, 1976). The cells also produce tumors in nude mice and are capable of forming colonies in agarose (Int. J. Cancer /9:337-344, 1977). The Daudi is a well characterized B Ivmphoblast cell line which has Seen empioved extensivelv in studies of mechanisms of leukemogenesis.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%; antibiotic-free.

Viability: Approximately 85% (dye exclusion).

Culture Medium: RPMI medium 1640. 80%: fetal bovine serum. 20%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 3 x HP viable cells per ml in the above culture medium at 37 C will increase 11-12 fold within 10-14 days provided fresh medium is added at 48-72 hour intervals.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_2 5 5 33 5 Chromosomes: 43 44 45 46 47 Male human karyotype with stemline number of 46. The karyotype is diploid in 66% of the cells and is stable within the stemline. Sterility: Tests for mycoplasma, bacteria and fungi were negative.

Species: Confirmed as human by immunofluorescence test.

Surface Immunoglobulins: Positive. 8eta-2-microglobulins: Negative.

Erythrocyte Rosette Test: E.6%; EA, 34%-; EAC. 5%.

Reverse Transcriptase: Not detected.

EBNA: Positive.

Isoenzymes: G6PD type B.

Submitted by: G. Klein. Karolinska Institute. Stockholm. Sweden.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

CERTIFIED CELL LINES - CCL ATCC CCL 214 NC-37_(Peripheral blood, lymphoblast. Human)__ The NC-37 cell line was initiated at the Pfizer Laboratories. Maywood. New Jersey by W. Korol in February. 1967 from peripheral blood obtained from an apparently healthy 34 year-old male Caucasian (Int. J. Cancer 6.-436-449. 1970). The cell line w-as established from a donor whose serum was positive for EBV antibodies as determined by immunofluorescence and virus coaling test (Cancer Res. 27: 2020-2024. 1967). Each cell contains an average of 60 EBV genome copies.

The line has been utilized as a target cell for EBV superinfection studies and has proven useful in chemical induction studies of the latent EBV genome and in the propagation of various (retroviruses) oncornaviruses. The consistency of the line's characteristics has made it a useful tool in a wide variety of biochemical, immunological, virological and cell biological studies.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: Unknown.

Freeze Medium: Culture medium. 90%: dimethyl sulfoxide (DMSO). 10%: antibiotic-free.

Viability: Approximately 80% (dye exclusion).

Culture Medium: RPMI medium 1640. 90%: fetal bovine serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 3 x 10* viable cells ml in the above culture medium will increase 7-8 fold within 7 days when incubated at 37 C. provided fresh medium is added every 2-3 days.

Plating Efficiency: The cells cannot be plated.

Morphology: Lymphoblast-like.

Karyoiogy: Chromosome Frequency Distribution 50 Cells: 2n - 46 Cells:_I I 3 10 19 2 3 I Chromosomes: 40 42 46 47 48 49 50 51 Sterility: Tests for mycoplasma, bacteria and fungi were negative.

Species: Confirmed as human by isoenzymology (G6PD. NP and LDH).

Reverse Transcriptase: Not detected.

EBNA: Positive.

Erythrocyte Rosette Test: E. 0: EA. 2%: EAC. 60%.

Surface Immunoglobulins: Negative.

Isoenzyenes: G6PD type B.

Submitted biy: J. Wolff. Pfizer Incorporated. Groton. Connecticut.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 21S CCD-25Lu_(Lung, Human)_ This fibroblast-like cell line was derived from the normal lung tissue of a 7 year-old. Caucasian male who died of a high grade glioma of the brain stem. The line was initiated in March 1979 at the American Type Culture Collection from tissue explants. Derived populations at passage 2 and approximate population doubling (PDL) 15 are available for distribution. Progeny were found to undergo at least an additional 14 doublings in longevin studies conducted during characterization.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 2 (approximately 15 population doublings).

Freeze Medium: Culture medium. 95%: dimethyl sulfoxide. 5%: antibiotic-free.

Viability: 94% (dye exclusion).

Culture Medium: CRCM 30. 90%: fetal bovine serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 1.0 x 10s viable cells ml in the above culture medium will increase 2*3 fold in 7 days.

Plating Efficiency: 5.5% at passage 2 in the above culture medium.

Morphology: Fibroblast-like.

Karyoiogy: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I 2 8 36 3 Chromosomes: 39 44 45 46 47 Human male karyotype. Stemline number is 46 and diploid. The karyotype is stable within the diploid number.

Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by isoenzymology (G6PD and LDH).

Reverse Transcriptase: Not detected.

Submitted by: S. Dilworth. Cell Culture Department. American Type Culture Collection. Rockville. Maryland.

Prepared and characterized by: American Type Culture Collection. Rockville, Maryland.

ATCC CCL 216 4/4 R.M.-4 _(Visceral pleura, Rat)_ This presumptive mesothelial cell line was derived from the visceral pleura of a 2-3 month-old female Fi cher 344 rat by J. Aronson. in April, 1979 (In Vitro /5:214.1979). Cells were obtained by tryptic digestion of the lung surface, and the line was initiated from a single isolate on glass cover slip fragments. The depositor indicates that the line is probably derived from epithelial cells lining the pleura based oa their morphology and relatively high primary plating efficiency.

ICO CERTIFIED CELL LINES - CCL Reverse Transcriptase: Not detected.

Production of Carcinoembryonic Antigen: 908 ng/10* cells in 10 days.

Colon Specific Antigen (CSAp): Negative.

Colon Antigen 3: Negative.

Isoenzymes: G6PD. B; PGM,. 2: PGMj. 1-2: PGD. A: EST-D. 1.

Submitted by: M. Romsdahl. M.D. Anderson Hospital &. Tumor Center. Houston. Texas. Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 230 SW403_(Colon, adenocarcinoma, Human)___ SW403 is one of eleven colorectal adenocarcinoma cell lines isolated and described by A. Leibovitz and associates (Cancer Res. 36: 4562-4569.1976). An adenocarcinoma of Grade 111 almost encircled the bowel of the 51 year-old white female donor who provided the source tissue. The cells produce carcinoembryonic antigen (CEA), show prominent Golgi apparatus under electron microscopy and are tumorigenic in nude mice (Fogh. J. et al.. J. Nat. Cancer Inst. 59: 221-226. 1977). A culture at passage 82 was submitted to the American Tvpe Culture Collection by A. Leibovitz in November 1978.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number of Serial Subcultures from Tissue of Origin: 91.

Freeze Medium: Culture medium. 90%; dimethyl sulfoxide (DMSO). 10%; antibiotic-free.

Viability: Approximately 80% (dye exclusion).

Culture Medium: L-I5 medium. 90%; bovine calf serum. 10%: antibiotic-free.

Growth Characteristics of Thawed Ceils: An inoculum of 7 x IO4 cells ml in the above culture medium multiplies approximately 3-fold within 7 days at 37 C provided the medium is renewed after 3 days.

Plating Efficiency: Approximately 2% in the above culture medium.

Morphology’ Epithelial-like.

Karyology: Chromosome Frequency Distribution 50 Cells: 2n = 46 Cells:_I 13 1 1 I 4 21 10 7 I Chromosomes: 59 62 63 64 65 66 67 68 69 70 73 The stemline chromosome number is near triploid with 2S component occurring at about 1.4% and 10 marker chromosomes were common to S metaphases. Except for monosomic I. 13 and 22. and pentasomic 20. most normal chromosome types ranged from disomy to tetrasomy. The ceil line is karyotypically very homogeneous and stable.

U Sterility: Tests for mycoplasma, bacteria, fungi, protozoa and viruses were negative.

Species: Confirmed as human by immunofluorescence and isoenzyme analysis (G6PD type B and typical LDH).

Blood Group: O.

Tumorigenicity: Tumors developed within one month at 100% frequency (5· 5) in nude mice inoculated subcutaneously with 10’cells. Reverse Transcriptase: Not detected.

Production of Carcinoembryonic Antigen: 155 ng. 10* cells in 10 days.

Colon Specific Antigen (CSAp): Negative.

Colon Antigen 3: Positive.

Isoenzymes: G6PD. B: PGM,. I. PGMj. 1-2: PGD. A: EST-D. I; PEP-D. I.

Submitted by: A. Leibovitz. Scott White Clinic. Temple. Texas.

Prepared and characterized by: American Type Culture Collection. Rockville. Maryland.

ATCC CCL 231 SW48_(Colon, adenocarcinoma. Human)_ SW48 was isolated with ten other colorectal adenocarcinoma cell linesduringa period from I97I-I975(A. Leibovitz eta!.. Cancer Res. 36: 4562-4569. 1976). The large ulcerating Grade IV tumor encircled the bowel of the 82 year-old white female patient (blood type AB. Rh·»). Little carcinoembryonic antigen (CEA) is produced and the cells are tumorigenic in nude mice (Fogh. J. ere/.. J. Nat.

Cancer Inst. 59: 221-226. 1977).

A culture at passage 89 was submitted to the American Type Cultuie Collection by A. Leibovitz in November 1978.

DESCRIPTION OF REPOSITORY REFERENCE SEED STOCK Number nf Serial Subcultures from Tissue of Origin: 96.

Freeze Medium: Culture medium. 90%: dimethyl sulfoxide (DMSO). 10%: antibiotic-free.

Viability; Approximately 85% (dye exclusion).

Culture Medium: L-I 5 medium. 90%; bovine calf serum. 10%; antibiotic-free.

Growth Characteristics of Thawed Cells: An inoculum of 6 x 10* cells, ml in the above culture medium multiplies approximately 3-fold within 7 days at 37 C provided the medium is renewed after 5 days.

Plating Efficiency: Appro imately 12% in the above culture medium.

Morphology: Epithelial-'ike.

CELL REPOSITORY LINES - CRL ATCC CRL 1412 C3H/MCA clone 16 (Mouse embryo) * Passage Frozen: 39. Additional Information: Clone IS and 16 are malignant counterpans of C3H/ Ι0ΤI / 2 clone 8. They were derived by treating C3H/ I0TI/2 clone 8 cells with 3-methylcholanthrene for 24 hours. They have lost the propeny of contactinhibition of growth and arc said to produce fibrosarcomas when I09 or more cells are inoculated into syngeneic mice. References: Cancer Res. JJ:3231-3238and 3239-3249.1973: Nature 253:548-549.1975: ibid.. 260:710-711.1976: ibid.. 204:442-444.1976and Virology 65:392-409. 1975. Submitted by: C. Heidelberger. LAC-USC Comprehensive Cancer Center. Los Angeles. Calif.

ATCC CRL 1414 RAB-9 (Female rabbit, skin fibroblast) fPassage Frozen: 26. Additional Information: RAB-9 is a skin fibroblast cell line initiated from a normal adult female New Zealand white rabbit. It has been demonstrated that the cell line can be cultured for at least 45 passages at weekly intervals with a subcultivation ratio of 1:3. Submitted by: E.M. Earley. FDA. Bethesda. Md.

ATCC CRL 1420 MIA PaCa-2 (Human pancreatic carcinoma) * Passage Frozen: Approximately 125. Additional Information: The MIA PaCa-2 cell line was established by A. Yunis ttal. in 1975 from tumor tissue of the pancreas obtained from a 65 year-old. Caucasian male using Dulbccco's modified Eagle's medium fortified with 10% fetal bovine serum and 2.5% horse serum. The established cell line reportedly has a doubling time of about 40 hours and a colony-forming efficiency in soft agar of approximately 19%. The cells possess the G6PD type B phenotype and are sensitive to asparaginase. Reference: Int. J. Cancer 19: 128-135. 1977. Submitted by: A. Yunis. University of Miami School of Medicine. Miami. Fla.

ATCC CRL 1423 G-292, clone A141B1 (Female Caucasian, osteosarcoma) ‘Passage Frozen: 13. .Additional Information: The cell line was initiated from a primary bone tumor (osteosarcoma) of a 9 year-old female Caucasian. The cells exhibit the type B phenotype forG6PDand the karyotype issubtetraploid with chromosome markers. Reference: Pediatric Res. /2:485. 1978. Submitted by: P.T. Peebles. NTH. Bethesda. Md.

ATCC CRL 1424 G-361 (Male Caucasian, malignant melanoma) 'Passage Frozen: 16. Additional Information: The cell line was established from a malignant melanoma of a 31 year-old male Caucasian. The cells have been reported to produce melanin (2-5%) for up to 50 passages. The cell line exhibits the G6PD type B phenotype, is subtetraploid with chromosome markers and is missing the Y chromosome. Reference: Pediatric Res. /2:485. 1978. Submitted by: P.T. Peebles. NTH. Bethesda. Md.

ATCC CRL 1427 MG-63 (Male, osteosarcoma) ‘Passage Frozen: 88. Additional Information: MG-63. a line derived from an osteosarcoma of a 14 year-old male. It reportedly produces high yields of interferon following superinduction with polyinosinic acid - polycytidilic acid, cycloheximide and actinomycin D. Antigemcally. MG-63 interferon is said to be more closely related fo human fibroblast than to leukocy te interferon. Reference: Antimicrob. Ag. Chemother. 12:11-15. 1977. Submitted by: A. Billiau. Rega Inst. Med. Res.. University of Leuven. Leuven. Belgium.

ATCC CRL 1430 Cf2Th (Canine thymus. Cana familiaris) " Passage Frozen: 57. Additional information: This cell line has been used extensively as a substrate for the growth of type C viruses associated with normal cat embryos, normal baboon lung and kidney cells and a recent virus isolate from a patient with acute myelogenous leukemia. In addition it has been described as being permissive for theS-trophic(xenotrophic) viruses induced from ceils derived from Balb.c and AKR mice. Reference: In Vitro /2:665-669. 1976. Submitted by: W.A. Nelson-Rees. University of California. Naval Bioscience Laboratory. Oakland. Calif.

ATCC CRL 1432 Namalwe (Human lymphoblastoid, Burkitt lymphoma) ‘Passage Frozen: Unknown. Additional Information: Namalwa was deposited with the American Type Culture Collection for patent purposes. It is available for distribution but has not been characterized by the ATCC. USDA permit (VS Form 16-3) is required for distribution. Reference: Int. J. Cancer 12: 396-408. 1973. Submitted by: N.B. Finter. Wellcome Research Laboratories. United Kingdom.

ATCC CRL 1435 PC-3 (Prostate adenocarcinoma, human) ‘Passage Frozen: 17. Additional Information: The PC-3 was initiated from a grade IV prostatic adenocarcinoma from a 62 year-old male Caucasian. The cells grow in soft agar and produce tumors in nude mice. The cells exhibit a low acid phosphatase and iestosterone-5-alpha reductase activity and can be readily adapted to growth in suspension culture systems. The HLA profile is A I. A9. References: Invest. Urology /7: 16-23. 1979; Cancer Res. 40: 524-534. 1980. Submitted by: M.E. Kaighn. Pasadena Foundation for Medical Research. Pasadena. Calif.

ATCC CRL 1439 Clone 9 (Normal rat liver) ‘Passage Frozen: 17. Additional Information: The cell line has been used for studies of in vitro carcinogenesis and is useful in screening sera and other nutrient requirements by a clonal assay. Reference: Gene Expression and Carcinogenesis in Cultured Liver, pp. 441-459. 1975. Academic Press. New York. Submitted by: M.E. Kaighn. Pasadena Foundation for Medical Research. Pasadena. Calif.

The passage number listed applies to material available for distribution as of June I. 1985.

Claims (43)

1. A method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which Is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100), which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus; and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a mlnlsatellite which is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100).

2. A method as claimed in claim 1 wherein the said DNA fragment which contains a minisatellite from a mlnlsatellite region or hypervariable locus which region or locus has an allelic variation (as herein defined) of at least 3(500).

3. A method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a mlnlsatellite which Is specific as to a particular region or locus in the genome, said region or locus being of human origin and having a degree of polymorphism of at least 3 (as herein defined), which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic mlnlsatellite region or hypervariable locus; and preparing therefrom a polynucleotide capable of hybridising to DNA fragment which contains a minisatellite 10 3 which is specific as to a particular region or locus in the genome, said region or locus having a degree of polymorphism of at least 3 (as hereinbefore defined).

4. A method as claimed in any one of the preceding claims wherein the polynucleotide probe comprises with the inclusion of a labelled or marker component, a polynucleotide comprising at least three tandem repeats (there being on average at least 70% homology between all tandemly repeated sequences) of sequences which are homologous with a minisatellite region of the genome to a degree enabling hybridisation of the probe to a corresponding DNA fragment obtained by fragmenting the sample DNA with a restriction endonuclease, wherein: a) the repeats each contain a core which Is at least 70% homologous with a consensus core region of similar length present in a plurality of minisatellites from different genomic loci; b) the core is from 6 to 16 nucleotides long; c) the total number of nucleotides within the repeating unit which do not contribute to the core is not more than 15.

5. A method as claimed In any one of the preceding claims wherein the polynucleotide probe comprises at least three tandem repeats of the sequence (including complementary sequences):(A)AGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent) or the sequence (including complementary sequences):— AGAGGTGGGCAGGTGG (wherein T is T or U); there being on average at least 70% homology between all tandemly repeated sequences.

6. A method as claimed in claim 5 wherein the polynucleotide probe comprises any one sequence selected 5 from:AGGAATAGAAAGGCGGGYGGTGTGGGCAGGGAGRGGC 3 GTGGAYAGG 4 TGGGAGGTGGRYAGTGTCTG 5 GAATGGAGCAGGYGRCCAGGGGTGACTCA 6 10 GGGCTGGGGAGATGGTGGAGGAGGTGTTGG 7 AGGCTGGGGAGATGGTGGAGGAAGAGTAC 8 TGTGTGTAATGGGTATAGGGAGGGCCCCGGGAAGGGGGTGTGGYX 9 (wherein Y is C, T or U, X is G or C , R is A or G and T is T or U) or tandem repeat(s) thereof; 15 or a sequence complementary thereto.

7. A method as claimed in any one of the preceding claims wherein the polynucleotide Is cloned in bacteriophage A , with the proviso that Inserts comprising the polynucleotide are stabilised by propagation of phage in a 20 rec BC E. coll host.

8. A method as claimed in any one of the preceding claims wherein pooled human DNAs are used to clone 6-15kb Sau 3A fragments. 1C5

9. A method as claimed in any one of the preceding claims wherein the nucleotide sequence Is homologous with the mlnlsatellite of the mlnlsatellite containing DNA fragment to an extent enabling hybridisation of the nucleotide sequence therewith.

10. A polynucleotide, in Isolated or cloned form, which comprises a nucleotide sequence which is specific as to a single mlnlsatellite region or hypervarlable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a mlnlsatellite from said minisatellite region or hypervarlable locus, wherein:1) said region or locus has an allelic variation (as herein defined) of at least 3(100) and 2. ) said region or locus is detectable by a polynucleotide probe comprising at least three tandem repeats of the sequence (including complementary sequences):(A)AGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent) or the sequence (including complementary sequences):AGAGGTGGGCAGGTGG 2 (wherein Τ is Τ or U).

11. A polynucleotide as claimed in claim 10 wherein the DNA fragment contains a mlnlsatellite from a mlnlsatellite region or hypervariable locus which region or locus has an allelic variation (as herein defined) of at least 3(500).

12. A polynucleotide, in Isolated or cloned form, which comprises a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a mlnlsatellite from said mlnlsatellite region or hypervariable locus, wherein;1) said region or locus is of human origin and has a degree of polymorphism of at least 3 (as herein defined) and 2) said region or locus is detectable by a polynucleotide probe comprising at least three tandem repeats of the sequence (including complementary sequences):— (A)AGGGCTGGAGG 1 (wherein T is T or U and (A) may be present or absent) or the sequence (including comlementary sequences):AGAGGTGGGCAGGTGG 2 (wherein T is T or U) ·

13. A polynucleotide as claimed in any one of claims 10 to 12 wherein the DNA fragment contains a minisatellite from a mlnlsatellite region or hypervariable locus which region or 107 locus is specifically identifiable by a polynucleotide probe comprising any one sequence selected fromi— AGGAATAGAAAGGCGGGYGGTGTGGGCAGGGAGRGGC 3 GTGGAYAGG 4 5 TGGGAGGTGGRYAGTGTCTG 5 GAATGGAGCAGGYGRCCAGGGGTGACTCA 6 GGGCTGGGGAGATGGTGGAGGAGGTGTTGG 7 AGGCTGGGGAGATGGTGGAGGAAGAGTAC 8 TGTGTGTAATGGGTATAGGGAGGGCCCCGGGAAGGGGGTGTGGYX 9 10 (wherein Y is C, T or U, or U, X is G or C , R is A or G and T is T or U) or tandem repeat(s) thereof or sequence complementary thereto.

14. A polynucleotide as claimed in any one of claims 10 to 12 wherein the said DNA fragment contains a 15 minisatellite from-a mlnlsatellite region or hypervariable locus which region or locus is detectable by a polynucleotide probe comprising the sequence of formula 3 or tandem repeat(s) thereof.

15. A polynucleotide as claimed in any one of claims 10 20 to 12 wherein the said DNA fragment contains a mlnisatelllte from a mlnisatelllte region or hypervariable locus which region or locus is detectable by a polynucleotide probe comprising tandem repeats of any one sequence selected from the sequences of formulae 4 to 9. 10 8

16. A polynucleotide as claimed in any one of claims 10 to 15 wherein the nucleotide sequence is homologous with the minisatellite of the DNA fragment to an extent enabling hybridisation of the nucleotide sequence therewith.

17. A polynucleotide as claimed in claim 14 wherein the nucleotide sequence comprises the sequence of formula 3 or tandem repeat(s) thereof (there being on average at least 702 homology between all tandemly repeated sequences).

18. A polynucleotide as claimed in claim 15 wherein the nucleotide sequence comprises of any one sequence selected from formulae 4 to 9 or tandem repeat(s) (there being at least 702 homology between all tandemly repeated sequences) or a sequence complementary thereto.

19. A polynucleotide as claimed in claim 17 or claim 18 wherein there is on average at least 802 homology between all tandemly repeated sequences.

20. A polynucleotide as claimed in claim 19 wherein there is on average at least 902 homology between all tandemly repeated sequences.

21. A polynucleotide as claimed in claim 20 wherein the tandemly repeated sequences are repeated exactly.

22. A process of preparing a polynucleotide first prepared by a method as defined in any one of claims 1 to 9 or of preparing a polynucleotide as defined in any one of claims 10 to 21, which process comprises the microbiolglcal reproduction of cloned material.

23. A process of preparing a polynucleotide first prepared by a method as defined in any one of claims 1 to 9 or of preparing a polynucleotide as defined in any one of claims 10 to 21, by direct synthesis.

24. A polynucleotide probe which comprises a polynucleotide as defined in any one of claims 10 to 21 or as prepared by a method as defined in any one of claims 1 to 9, said polynucleotide having a labelled or marker component. ί Θ9

25. A polynucleotide probe as claimed In claim 24 wherein the polynucleotide is wholly in single stranded form.

26. A method of preparing a polynucleotide probe as defined in claim 24 or claim 25 which comprises labelling or marking a polynucleotide as claimed in any one of claims 10 to 21 or as prepared by a method as defined in any one of claims 1 to 9.

27. A method of preparing a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus in the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100), which method comprises cloning a DNA fragment identified by hybridisation of fragments of genomic DNA with a polynucleotide probe as claimed in claim 24 or claim 25 or a polynucleotide probe prepared by the method of claim 26, and preparing therefrom a polynucleotide capable of hybridising to a DNA fragment which contains a minisatellite which is specific as to a particular region or locus on the genome, said region or locus having an allelic variation (as herein defined) of at least 3(100); the method being effected under hybridisation conditions effective to render the probe capable of differentiating DNA by reference to more than one polymorphic minisatellite region or hypervariable locus.

28. A polynucleotide, in isolated or cloned form, which comprises a nucleotide sequence which is specific as to a single mlnlsatelllte region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment obtained by fragmenting sample genomic DNA with a restriction endonuclease, the said DNA fragment containing a 11 ο mlnlsatellite from said minisatellite region or hypervarlable locus, wherein:1) said region or locus has an allelic variation (as herein defined) of at least 3(100) and 2) said region or locus is detectable by a polynucleotide probe as claimed in claim 24 or claim 25 or a polynucleotide probe prepared by the method of claim 26.

29. A modification of a method as defined in claim 27 or a polynucleotide as claimed in claim 28 wherein the said region or locus is of human origin and has a degree of polymorphism of at least 3.

30. A method of characterising a test sample of genomic DNA by reference to one or more controls which method comprises fragmenting sample DNA with one or more restriction enzymes which do not cleave to any relevant extent a sequence corresponding to a tandem repeat, probing the DNA fragments with a polynucleotide or polynucleotide probe comprising a nucleotide sequence which is specific as to a single minisatellite region or hypervarlable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment containing a mlnlsatellite from said single mlnlsatellite region or hypervarlable locus, detecting hybridised fragments of DNA, and comparing the hybridised fragments with a said control or controls wherein:— 1) said mlnlsatellite region or hypervarlable locus has an allelic variation of at least 3(100) and 2) said region or locus is detectable by a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic mlnlsatellite region or hypervarlable locus.

31. A method of characterising a test sample of genomic DNA by reference to one or more controls vhich method comprises fragmenting sample DNA with one or more restriction enzymes which do not cleave to any relevant extent a sequence corresponding to a tandem repeat, probing the DNA fragments with a polynucleotide or polynucleotide probe comprising a nucleotide sequence which is specific as to a single minisatellite region or hypervariable locus and which is homologous therewith to a degree enabling hybridisation of the nucleotide sequence to a corresponding DNA fragment containing a mlnlsatelllte from said single mlnlsatelllte region or hypervariable locus, detecting hybridised fragments of DNA, and comparing the hybridised fragments with a said control or controls wherein:1) said mlnlsatelllte region or hypervariable locus is of human origin and has a degree of polymorphism of at least 3; and 2) said region or locus is detectable by a polynucleotide probe which is capable of differentiating DNA by reference to more than one polymorphic mlnlsatelllte region or hypervariable locus.

32. A method as claimed in claim 30 or claim 31 wherein the polynucleotide or polynucleotide probe used is as defined in any one of claims 10 to 21 or as prepared in any one of claims 1 to 9.

33. A method as claimed in any one of claims 30 to 32 wherein the sample DNA is human DNA.

34. A method according to any one of claims 30 to 33 for establishing the Identity or otherwise of the test sample donor with one or more control sample donors, in which the control sample(s) are similarly fragmented and a comparison is made of the hybridised fragments from the respective samples.

35. A method according to any one of claims 30 to 33 for establishing a family connection between the test sample donor and one or more control sample donors, in which the control sample(s) are similarly fragmented and a comparison 1 I s is made of the hybridised fragments from the respective samples.

36. A method as claimed in any one of claims 30 to 35 wherein probing is effected using at least two polynucleotide 5 probes as claimed in claim 24 or claim 25 either in a sequence of tests or in a single test using a mixture of the said probes.

37. A method as claimed in claim 30 or claim 31 for the diagnosis of an inherited disease, abnormality or trait 10 which comprises probing the test sample with at least one polynucleotide probe as claimed in claim 24 or claim 25, said probe, which need not necessarily carry a labelled or marker component, being associated with a particular inherited disease, abnormality or trait. 15

38. A polynucleotide probe which comprises any one sequence selected from AGGAATAGAAAGGCGGGYGGTGTGGGCAGGGAGRGGC 3 GTGGAYAGG 4 TGGGAGGTGGRYAGTGTCTG 5 GAATGGAGCAGGYGRCCAGGGGTGACTCA 6 GGGCTGGGGAGATGGTGGAGGAGGTGTTGG 7 AGGCTGGGGAGATGGTGGAGGAAGAGTAC 8 TGTGTGTAATGGGTATAGGGAGGGCCCCGGGAAGGGGGTGTGGYX 9 (wherein Y is C, T or U, X is G or C, R is A or G and T is It 3 T or U) or tandem repeat(s) thereof or sequence(s) complementary thereto.

39. A polynucleotide probe vhlch comprises the sequences of formula 3 (as defined in claim 38) or a tandem repeat 5 thereof.

40. A method of characterising a test sample of genomic DNA by reference to one or more controls which method comprises fragmenting sample DNA with one or more restriction enzymes vhlch do not cleave to any relevant extent a sequence 10 corresponding to a tandem repeat, probing the DNA fragments with a polynucleotide probe as defined in claim 38 or claim 39 detecting fragments of DNA which have hybridised with the probe and comparing the hybridised fragments with a said control or controls. 15

41. A polynucleotide according to any one of claims 10, 12 and 28 substantially as described herein with reference to any one of the Examples.

42. A polynucleotide probe according to any one of claims 24, 38 and 39 substantially as described herein 20 with reference to one of pXg3, XMS1, XMS31, XMS32, XMS8(1), XMS8(2) and XMS43.

43. A method of genetic characterisation as claimed in any one of claims 30, 31 and 40 substantially as described herein.