CN112680447B - Goldfish gene editing technology and method for creating new variety of goldfish by using same - Google Patents

Abstract

The invention relates to a fish molecular design breeding technology, in particular to a goldfish gene editing technology and a method for creating a novel goldfish variety by using the same. The method comprises the steps of target design knockout, microinjection, fertilization hatching, gynogenesis and high-temperature sex reversal. According to the invention, a CRISPR/Cas9 gene editing technology is established on goldfish, so that a target phenotype is generated on F0-generation goldfish, efficient gynogenesis conditions of the Goldfish in Bairuyi lion are established through experiments, homozygotes are obtained on F1-generation, and mass population expansion of F2-generation is realized through temperature-induced reversion. The invention can rapidly realize the transfer of single-purpose characters by a molecular breeding means, can be used for creating new goldfish varieties, provides technical support for molecular design breeding of goldfish, and is beneficial to promoting the development of molecular breeding technology of goldfish.

Description

Goldfish gene editing technology and method for creating new variety of goldfish by using same

Technical Field

The invention relates to a fish molecular design breeding technology, in particular to a goldfish gene editing technology and a method for creating a novel goldfish variety by using the same.

Technical Field

The tetraploid crucian carp originated in China is an ornamental fish which is formed by manual selection for hundreds of years, and is called Chinese 'national extract'. In the development history of goldfish, the body color, body shape and almost all external organs of goldfish are obviously changed due to mutation, and the mutation is preserved due to artificial selection, and then the mutation is recombined through hybridization to form various complex mutation goldfish; today, goldfish has more than 300 varieties.

The traditional goldfish is cultivated in a fish basin, and the breeding of the variety is mainly overlooking and ornamental. The popularization of fish tanks makes the side viewing trend, wherein goldfish of several varieties such as ruffled Tashi and Lanshou are favored by more and more goldfish lovers. The ruffle Thai-lion goldfish is named as ruffle because of the fact that the tail fins are folded like the ruffle, the tail fins are upwarp and upright, the body is strong, the head tumor is developed, and the feeling of Wittig and overlooking is given to people. These characteristics of the ruffled Thai-Goldfish largely determine its ornamental and market value. The traditional goldfish has a plurality of high-quality ornamental properties, and the properties are transferred to the side-looking goldfish of the Bairuffled lion and can only be purified continuously through hybridization. However, the hybridization technology takes a long time and has unsatisfactory effects, and the hybridization technology can sacrifice the original important ornamental properties of the Thai lion, such as body shape, tail exhibition and the like, while obtaining the target properties, so that the desired effects cannot be obtained.

With the development of molecular breeding technology, CRISPR/Cas9 gene editing technology is continuously developed and perfected after establishment, and more genes related to characters are positioned, so that the regulation and control of biological characters by using the gene editing technology becomes a high-value research direction, and the characters regulated and controlled by a single gene can be directionally changed by using the gene editing technology. However, no effective goldfish gene editing technology is established at present, and a rapid and efficient systematic method for regulating and controlling the phenotype of goldfish and obtaining offspring with stable phenotype by using the gene editing technology does not exist.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides a high-efficiency goldfish gene editing technology and a method for creating a novel goldfish variety by using the technology.

The invention adopts the following technical scheme:

a method for creating a new goldfish variety by using a gene editing technology comprises the following steps:

s1, designing a target point: carrying out gene sequencing on the Goldfish in the Bairuffled lion to obtain a target character regulation and control gene DNA sequence, obtaining an exon and an intron of the gene for regulating and controlling the character of the dragon eye according to the obtained gene DNA sequence, designing a proper knockout target point on the exon by using a wild card GG [ G/A ] GG or CC [ T/C ] CC, and carrying out in vitro transcription on the target point sequence to obtain gRNA;

s2, microinjection: spreading eggs of the Goldfish in a sterile culture dish, adding an appropriate amount of ovarian liquid to prevent the eggs from drying and improving the survival rate, taking 2 mu L of mRNA of CRISPR/Cas9 protein and gRNA respectively, uniformly mixing, injecting the mixed mRNA to an egg animal pole by using a microinjection instrument, and injecting 200-3000 eggs into 4 mu L of the mixed mRNA;

s3, parent cultivation: dripping sperm of male Goldfish in the injected roe, mixing, adding water, fertilizing, spreading in a hatching jar, and incubating with oxygen to obtain the final product F0 chimeric Goldfish containing target gene regulatory property;

s4, gynogenesis: and (3) taking sperm of the carp, mixing the sperm with F0 generation female Fu-ruffled Goldfish ovum for fertilization after the sperm is inactivated by ultraviolet irradiation, and carrying out shock treatment, wherein the fish after the successful fish egg hatching by the shock artificial gynogenesis treatment is the sub-generation of the phenotype containing the target gene regulation and control character, namely the F1 generation homozygous Fu-ruffled Goldfish.

Further, the method further comprises a step of high Wen Kuoqun, wherein in the method of high Wen Kuoqun, half of fishes are raised at a high temperature of 27-28 ℃ in the early stage after F1 generation is out of membranes, so that female fishes are sex-reversed into male fishes, the sex-reversed female fishes and normally raised F1 generation female fishes are propagated, and the homozygous second generation F2 generation Bairuffle Tashi goldfish is obtained in batches.

Preferably, in the step S1, after the target sequence is obtained, before in vitro transcription, the target sequence is utilized to construct a genome local database, and blast software is used to search and determine the uniqueness of the target, so as to avoid knockout and miss.

Preferably, in step S3, during the fertilized egg hatching process, the method further comprises the operation of detecting the knockout efficiency, randomly selecting 10 fertilized eggs before membrane removal, extracting DNA in the fertilized eggs as a template, amplifying DNA sequence sequencing near the knockout target point and comparing with a normal sequence, calculating the knockout efficiency according to a comparison result, and keeping the batch of fertilized eggs for continuous hatching if the knockout efficiency reaches 20% or more, otherwise, terminating hatching.

Preferably, the extraction and amplification of DNA in fertilized eggs are specifically as follows: putting the selected fertilized eggs into a PCR tube, adding 70-100 mu L of 50mM NaOH solution, and reacting for 20min at 95 ℃ in a PCR instrument to serve as a DNA template; designing PCR amplification primers near the knockout target point, selecting 10 target clones for sequencing after PCR amplification, transformation and cloning, and comparing with a normal sequence to check whether the knockout site is knocked out successfully; the vicinity of the target point is a 200-300bp region on the upstream and downstream of the target point.

Preferably, in the step S4, the female squid eggs are obtained from the same F0 female squid.

Preferably, in the step S4, the deactivation of sperm of the carp is performed by using an ultraviolet irradiation method.

Preferably, in the step S4, the shock treatment method of the fertilized egg is heat shock, and the fertilized egg is developed at a constant temperature of 24 ℃ for 43-47min and then placed in water at 41 ℃ for heat shock for 2 min.

Preferably, in the step S4, the shock treatment method of the fertilized egg is cold shock, the fertilized egg is developed at a constant temperature of 24 ℃ for 3-7min, and then the fertilized egg is placed in ice water at 0 ℃ for cold shock for 2 min.

The invention has the beneficial effects that:

1. the invention designs 2 wild cards GG [ G/A ] GG or CC [ T/C ] CC suitable for knocking out target spots, and the wild cards can quickly and efficiently find out target spots suitable for knocking out on exons in word. After a target point of a target gene is designed, a local blast database of the goldfish genome is constructed, the sequence of the target point is compared with the whole genome, and gRNA is synthesized in vitro after the uniqueness of the target point is verified, so that the off-target phenomenon is effectively avoided, and the knockout accuracy is improved.

2. The invention adopts the method of insemination after injecting the fish eggs, so that RNA is translated into protein to generate effect in advance, and the gene editing efficiency is improved. Meanwhile, the injection is carried out on the fish eggs with weak viscosity, so that the phenomenon that the injection needle is blocked by the viscosity generated after fertilization of the fish eggs is effectively avoided, and microinjection is successfully carried out. In addition, knock-out efficiency can be effectively increased by increasing the injection concentration of mRNA for CRISPR/Cas9 protein (400-600 ng/. Mu.L) and gRNA (150-300 ng/. Mu.L). The technology realizes F0 generation to obtain a large number of chimera goldfish with the Dragon's eye character.

3. The invention creates a high-efficiency batch breeding technology of goldfish in earlier stage work, which provides high-quality roe for gene knockout of goldfish and necessary experimental materials for fumbling of gynogenesis conditions; the invention can reduce background difference by using the same fish to spawn for multiple times, thereby being beneficial to finding out the optimal condition of gynogenesis.

4. The invention is based on CRISPR/Cas9 gene editing technology, phenotype is generated on F0 generation goldfish, efficient gynogenesis condition and high Wen Kuoqun condition of the goldfish are established through experiments, homozygote is obtained in F1 generation, and the yield time of the goldfish with stable character is greatly shortened through temperature-induced sex reversal and mass population expansion of F2 generation. The invention can quickly realize the transfer of single-purpose characters by a molecular breeding means, creates a new goldfish variety, provides technical support for molecular design breeding of goldfish, and is beneficial to promoting the development of the molecular breeding industry of goldfish.

Drawings

FIG. 1 is a normal eye of a ruffled Tashirttail goldfish;

FIG. 2 shows a Goldfish with the Dragon's eye character, which is created in example 3 of the present invention, it can be seen that the eyes of the Goldfish with the Dragon's eye character are protruded, while the ornamental character in the aspects of head tumor, dorsal fin, tail and body shape is consistent with that of the Goldfish with the Dragon's eye character of normal eyes, and the Goldfish with the Dragon's eye character is not lost;

fig. 3 shows a jade rabbit character of a ruffle tilapia goldfish according to embodiment 5 of the present invention, wherein eyes and body colors of the jade rabbit ruffle tilapia are light, actual body colors are white to light yellow, eyes are red, and ornamental characters in aspects of head tumor, dorsal fin, tail, body shape and the like are consistent with those of a normal body color ruffle tilapia, and the jade rabbit ruffle tilapia is not lost.

Detailed Description

For easy understanding, the following description will make more specific use of the technical solution of the present invention in conjunction with the examples:

example 1: efficient breeding of Goldfish in Bairuurus

S1, cultivating seedlings: the newly opened fries are raised in a turnover box, the water temperature is 24-26 ℃, 3 times of live artemia are fed every day, the length of the turnover box is 60-100cm, the width of the turnover box is 40-60cm, the height is 20-30cm, and the water level is 15-20 cm. And a sponge filter is arranged at one side of the turnover box for filtering, and an oxygenation head is arranged beside the turnover box for oxygenation, so that the air quantity is proper. The sponge filter was washed once a week.

After the fish fry body length exceeds 2cm, selecting four fish fries in overlooking mode, removing fish fries with deformed and folded fin strips in side view, and placing the selected high-quality fish fries into a new container for breeding, wherein the density of the selected high-quality fish fries is about 2 fish fries per liter of water; a small 7-watt water pump is arranged in the container, water is added in a dripping way, the daily water inflow is about 1/5 of the total water volume, and the dripping boxes of the three-layer turnover box are used for filtering. 1 time of artemia is fed manually every day, 5 times of feeds with 48% protein content are fed by the automatic feeder, and the feeding amount is preferably 10 minutes each time. The first layer of the turnover box drip box is provided with a filtering pad material such as a magic blanket and filtering cotton, the second layer and the third layer are provided with bacterial balls, liquid digestive viable bacteria are added on the day of seedling placement to help fish fries to quickly establish a digestive system, and the adding amount is 100mL of liquid digestive viable bacteria added per 100L of water. The magic blanket is a filter blanket with long fluff on one side, and can be cleaned repeatedly.

When the fish fry length exceeds 4cm, the fish fry with long side view selection body, strong body, back peak, upturned tail and round tail tip is put into a fish tank, the fish tank is over 80cm long, over 50cm wide, the water depth is 30-40cm, and the density is 1 fish per liter of water. Continuously filtering by using a transfer box drip box, adjusting the hourly flow of the water pump to be 3-5 times of the total water body, feeding 5 times of feed with 46% of protein content by using an automatic feeder every day, wherein the feeding amount is preferably 5 minutes, and meanwhile, manually feeding midday and evening midge larvae, wherein the feeding amount is 15 minutes.

When the fish fry is longer than 8cm, the fish with strong and symmetrical body and round tail and turnup is selected, the fish with turnup is put into a fish tank, the length of the fish tank is more than 80cm, the width is 50 cm-60 cm, the water depth is 40 cm-50 cm, the automatic feeder feeds 5 times per day with the feed with 46% protein content, the feeding is completed every 10min, meanwhile, the brine shrimp is fed for supplementing calcium in noon, the midnight is fed for increasing the bodies of the midge larvae, and the feeding amount is 15 min. The fish tank is irradiated by the light of the three-base color lamp beads with lenses, the power of the three-base color lamp beads is 80w, the lighting time is 7:30-24:00, and green algae are attached to the bottom of the fish tank and spread into a moss shape through the light irradiation.

S2, parent cultivation: when the fish body is over 12cm in length, the fish with healthy and uniform physique, round and upwarp tail and ruffled tail is selected as a parent, 5 times of feeds with the protein content of 44% are fed every day, the feeding is completed every 5 minutes, and meanwhile, the feeding amount is 15 minutes after feeding the brine shrimp in noon.

A bottom filtration system with strong filtration is selected for filtering water, water is changed 2-3 times per week at the water temperature of 24-26 ℃ in summer, 1/3 of water is changed each time, 1-2 times per week at the water temperature of 21-23 ℃ in winter, and 1/4-1/3 of water is changed each time; when water is added, chlorine-removed tap water is added, or tap water can be directly added, but the water inflow is slow, the water inflow is controlled to be full of water in half an hour, and the temperature difference is large in winter, so that the water inflow is prolonged properly. The filter cotton in the filter system is replaced and cleaned while water is changed, preferably in the noon in sunny days, the chlorine in tap water can be effectively removed, the water temperature is improved, and the damage of temperature difference to fish is reduced. The filter cotton is dried in the sun for sterilization after being washed by a high-pressure water gun.

The algae lamp or the lovely insect lamp is additionally provided with the 3 lenses, and the algae lamp is turned on for 12 hours every day at regular time, so that after green algae grow fully on the bottom layer and form green moss, organic residues such as fish feces and the like in the green moss are cleaned by a brush every two days, the green algae can serve as plant bait to provide rich vitamins, dietary fibers and other nutrients for the breeding fish, and can absorb substances such as nitrogen, phosphorus and the like in the water body.

In the step, when the parents are used for cultivating special body colors, the body colors are also needed to be considered in parent selection, black fish in a normal scale system is selected from black to chin and belly, and red and white are preferably selected to be skillful colors, such as twelve red, fin gill red, deer and the like, and full red is not recommended. Selecting transparent scale fish, except for the sakura color system, the other color systems are not mixed with red as much as possible; the kylin color system is pure blue; the color of the other color system is not selected from point-like, preferably block-like or strip-like.

S3, artificial insemination: when a male fish is observed to overtake a female fish, fishing out the female fish, manually squeezing eggs, collecting the eggs at the position of a reproduction hole by using a 10mL centrifuge tube, adding semen into the centrifuge tube, covering a tube cover, slightly reversing the top and bottom to complete full mixing of sperms and the eggs, placing a hatching bed into a hatching box, controlling the water depth of the hatching box to be 10-30cm and the water temperature to be 22-24 ℃, pouring the fully mixed eggs into the hatching bed, evenly spreading, oxygenating and hatching, and preferably hatching by using running water.

The 10mL centrifuge tube is used for collecting the roes, so that all the roes are collected, waste is avoided, the roes cannot be adhered to the goldfish fin, the roes are prevented from being brought back to the fish tank by the fin to pollute the water quality, the roes can be stored for half a day at room temperature in the centrifuge tube, and the experimental use is convenient. When insemination is needed, semen is directly extruded into a centrifuge tube, or the semen is sucked by a gun head of a liquid-transferring gun and added into the centrifuge tube, a tube cover is covered, and the mixing is slightly reversed from top to bottom, so that the sufficient mixing of sperms and roes is completed. At this time, the fish eggs evenly mixed with the semen are poured into the basin, evenly spread and hatched, and the insemination rate is up to 99%.

S4, postpartum care: and (3) within 3 hours after spawning of the goldfish, changing water of the fish tank by 1/4 in winter and 1/3 in summer, cleaning and changing the sun-dried clean filter cotton, so as to prevent bacteria from destroying water quality due to excessive semen and ovary liquid in the water body and prevent the death of the fish after spawning.

In the cultivation process, stock salt, baking soda, methylene blue, white spot cleaner, heating rod and the like are used for preventing and treating fish diseases. If the fish is found to be in a bad state, after 1/4 of water is changed, adding salt according to the water standard of 3g/L for sterilization, adding sodium bicarbonate in proper amount to adjust the pH value to 8, and keeping the water temperature at 25-27 ℃ so as to be beneficial to the rapid recovery of the fish.

Example 2: exploration of gynogenesis conditions

Two gynogenesis methods are established, the proportion of normal fish produced by the two methods is compared, and the optimal gynogenesis condition of the Tachypleus cyrtonema with high homozygote obtaining rate is selected.

1. Meiosis gynogenesis

The method comprises the steps of taking carp sperms for inactivation, mixing the inactivated sperms with the Goldfish eggs of the Bairuyi lion for fertilization, and then carrying out cold shock treatment, wherein the cold shock treatment method comprises the steps of keeping the fertilized eggs at the constant temperature of 24 ℃ for 3-7min, and then placing the fertilized eggs in ice water at the temperature of 0 ℃ for cold shock for 2min to inhibit the discharge of a second diode, so that the two gametes are combined into a tetraploid. The fertilized eggs after cold shock treatment are hatched to obtain the meiosis Tay lion goldfish with the Dragon's eye character.

2. Mitotic gynogenesis

The method comprises the steps of inactivating carps, mixing the inactivated sperms with the Goldfish eggs of the Fulvi, and then carrying out heat shock treatment, wherein the heat shock treatment method comprises the steps of developing the fertilized eggs at the constant temperature of 24 ℃ for 43-47min, and then placing the fertilized eggs in 41 ℃ water for heat shock for 2min so as to destroy the formation of spindle threads. The fertilized eggs after heat shock treatment are hatched to obtain the mitotic Tachypleus gigas with the Dragon's eye character.

The above-mentioned used ovum of Goldfish in Bairuffle is preferably the ovum produced from the same Goldfish in Bairuffle so as to reduce background difference.

The fertilization rate, the membrane-out rate and the normal rate of the Tachypleus gigas produced by meiosis and mitosis were counted, and the results are shown in Table 1. As can be seen from Table 1, the number of normal fish obtained by heat shock after fertilization for 47min is higher than that of other combinations and reaches 3.34%, and the number of normal fish obtained by cold shock after fertilization for 6min is higher than that of other combinations and reaches 45.52%, so that meiosis gynogenesis is preferable as the optimal gynogenesis condition of the Tachypleus gigas.

TABLE 1 statistics of F1 generation homozygote under mitotic and meiotic conditions

Example 3: preparation of Goldfish with Dragon's eyes, bairuurus and Thai lion

The character of the dragon eye is similar to eyes of a dragon in a myth legend because the character of the dragon eye is externally protruded, so that the character of the dragon eye occupies an important position in overlooking the goldfish, and the transfer of the character of the dragon eye from the traditional ornamental fish to the Thai lion is a dream of many goldfish farms and goldfish fans. However, the traditional method of continuous hybridization and purification can not realize the transfer of single dragon eye character, after the dragon eye character is transferred to the Goldfish of the Bairuffle through hybridization, other important ornamental characters of the Goldfish of the Bairuffle are changed, such as a tail included angle is reduced, no fold exists, and the body type is not strong, thereby losing the original ornamental value of the Goldfish of the Bairuffle.

The goldfish gene editing technique provided by the invention in this example 3 successfully creates the goldfish of the Dragon's eye and the Bairuffled Thai lion by knocking out the related genes of the Dragon's eye, and the steps are as follows:

s1, designing a target point: carrying out gene sequencing on the Goldfish in the Bairuffled lion to obtain the DNA sequence and the amino acid sequence of the Dragon's eyes character gene and the structural information of the Dragon's eyes character gene; copying DNA sequence of the Dragon's eye character gene into word, annotating exon and intron, designing proper knocked-out target spot on the exon of the DNA sequence of the Dragon's eye character regulating gene with wildcard GG [ G/A ] GG or CC [ T/C ] CC, constructing local genome database after obtaining target spot, searching and verifying the uniqueness of the target spot with blast software, and transcribing the sequence of the target spot into gRNA in vitro after determining the uniqueness; in wildcards "? "represents an arbitrary base," [ ] "represents a match to any base within [ ], and"/"represents" or ".

The Dragon's eye character gene is lrp2a, namely low density lipoprotein 2 gene, the number of the target points is five, and the target point sequences are respectively:

GGGTCTTTCCGCTGTGGGAC, GGAGCTGAGGTGTGCTAACG, GGATGACTGCGAGGACAATG, TCTTCTGGTGTTTGCATCCC and GGGACGTCCCACTGTCCGGA;

s2, microinjection: spreading eggs of the Goldfish in a sterile culture dish, adding an appropriate amount of ovarian liquid to prevent the eggs from drying, taking 2 mu L of each of CRISPR/Cas9 protein and gRNA mRNA, uniformly mixing, injecting the mixed mRNA into the eggs by a microinjection instrument, and injecting 200-3000 eggs into 4 mu L of the mixed mRNA;

s3, fertilization and hatching: adding sperm of a male Parafrican Tashi goldfish into a culture dish after injection operation is completed, transferring fertilized eggs to a hatching nest for hatching after the fertilization of the fish eggs, putting 10 fertilized eggs just before membrane emergence into a PCR tube, adding 70-100 mu L of 50mM NaOH solution, and reacting for 20min at 95 ℃ in a PCR instrument to serve as a DNA template. Designing PCR amplification primers near the knockout target point, selecting 10 target clones for sequencing after PCR amplification, transformation and cloning, comparing with a normal sequence to check whether the knockout site is knocked out, and calculating the knockout efficiency according to the comparison result.

The specific method for selecting 10 target clones for sequencing after PCR amplification, transformation and cloning comprises the following steps: the DNA sequence near the target was PCR amplified using 10 DNA templates, and the PCR product was recovered, ligated into the vector and transformed into competent cells, and 10 positive clones were selected for sequencing after overnight incubation at 37℃in Amp medium to examine whether the knockout site was knocked out.

In this step, "near the target" refers to a 200-300bp region upstream and downstream of the target.

If the fertilized egg rate of the knocked out target point reaches 20% or above, keeping the fertilized eggs to continue hatching, and obtaining the Bairuffle Tashi goldfish with the Dragon's eye character. Otherwise, the hatching is stopped, the knocking out is carried out again, the mRNA injection concentration of CRISPR/Cas9 and gRNA is increased when the knocking out is carried out again, or the target sequence is transcribed again in vitro, and then the steps S2 and S3 are repeated.

S4, fry rearing and parent selection

After hatching out the fish fry, raising the fish fry in large scale in early 1 month, raising water temperature not exceeding 24 deg.c for about 2-3 months, and raising to obtain the Goldfish with the characteristic of knocking out target gene; the good-quality and eye-bulged Bairuyi lion is selected and marked as F0 generation as a parent.

S5, gynogenesis: the method comprises the steps of taking sperm of a carp, mixing the inactivated sperm with F0 female Japanese giant salamander ovum for fertilization, and then carrying out cold shock treatment, wherein the cold shock treatment method comprises the steps of keeping the fertilized ovum at the constant temperature of 24 ℃ for 3-7min, then placing the fertilized ovum in ice water at the temperature of 0 ℃ for 2min, and incubating the fertilized ovum to obtain the F1 homozygote with the Dragon's character.

S6, high Wen Kuoqun, raising half of female fishes at a high temperature of 27-28 ℃ in the early stage after F1 generation is subjected to membrane formation, so that the female fishes are sex-reversed into male fishes, and breeding the sex-reversed female fishes and the normally raised F1 generation female fishes to obtain homozygous filial generations in batches, wherein the homozygous filial generations have the characteristics of Loongjing rupa.

Example 4 creation of Dragon's eyes, bairuyi Thai lion goldfish

The method of creating this example 4 is the same as that of example 3, except that in step S5, heat shock treatment is performed on fertilized eggs, and specific operations of S5 are as follows:

s5, gynogenesis: the F0 generation male Bai-ruffle Tashi Goldfish sperm is taken for inactivation, the inactivated semen and the F0 generation female Bai-ruffle Tashi Goldfish ovum are mixed and fertilized, and then heat shock treatment is carried out, wherein the heat shock treatment method comprises the steps of developing the fertilized ovum at the constant temperature of 24 ℃ for 43-47min, then placing the fertilized ovum in ice water at the temperature of 41 ℃ for 2min, and incubating the fertilized ovum after treatment to obtain the first generation F1 generation homozygous Bai-ruffle Tashi Goldfish with the Dragon eye character.

Example 5 preparation of Jade Rabbit ruffle Tashi Goldfish

In goldfish, there is a phenomenon of yellowing or whitening, which is manifested by a general white or yellowish color, and a transparent red color of eyes, similar to rabbits, called "rabbits". The former report of goldfish only appears on very few varieties of goldfish with normal scales, which shows a soft and beautiful ornamental feature, but is almost blank in the market. Although many fishing grounds have been tried, at best, the fish body color can be purified to white, and the eyes are still black, not truly yellowish/whitened. At present, if there are few individual varieties of jade rabbits and goldfish, the character of the jade rabbits is transferred to the Bai-ruffled Tai lion goldfish strain, and the method of continuous purification after hybridization can only be adopted. However, the hybridization weakens or even loses many original characters of the target fish, and the transfer of single target characters cannot be realized.

The method for creating the ruffled Tashi goldfish of the embodiment 5 is the same as the embodiment 3, except that in the step S1, the gene for regulating and controlling the properties of the jade rabbits is a pigment gene oca, 1 target point is provided, and the target point sequence is as follows: GGAGTATATTCTGATCCAGG.

According to the embodiment, through knocking out the pigment gene oca2, the jade rabbit character is successfully transferred to the Fu-ruffled tilapia without changing other ornamental characters, so that a new jade rabbit Fu-ruffled tilapia variety is successfully created, and the ornamental value is extremely high.

The above embodiments are only for illustrating the technical scheme of the present invention, and are not limiting to the present invention; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (6)

1. The method for creating the new goldfish variety by using the gene editing technology is characterized by comprising the following steps:

s1, designing a target point: carrying out gene sequencing on the Goldfish in the Bairuffled lion to obtain a DNA sequence for regulating and controlling a target character gene, obtaining an exon and an intron of the gene for regulating and controlling the character of the dragon eye according to the DNA sequence, designing a proper knockout target point on the exon by using a wild card GG [ G/A ] GG or CC [ T/C ] CC, and carrying out in vitro transcription on the sequence of the target point to form gRNA;

of the wildcards, "? "represents an arbitrary base," [ ] "represents a match to any base within [ ],"/"represents" or ";

s2, microinjection: spreading eggs of the Goldfish in a sterile culture dish, adding a proper amount of ovarian liquid, taking 2 mu L of CRISPR/Cas9 protein and gRNA mRNA respectively, uniformly mixing, injecting the mixed mRNA into the eggs by an injector, and injecting 200-3000 eggs into 4 mu L of mRNA;

s3, fertilization and hatching: adding sperm of male Goldfish in the Fusarium into injected roe, mixing, fertilizing the roe, incubating the fertilized roe, and obtaining the Goldfish in the Fusarium, namely F0 generation chimeric Goldfish in the Fusarium with the characteristics of knocking out the target gene;

s4, gynogenesis: mixing the inactivated sperm of the carp with F0-generation female Japanese croaker eggs for fertilization, and then carrying out shock treatment, wherein the fish after the fish eggs are hatched successfully after the shock treatment is the first generation of the F1-generation homozygous Japanese croaker with the phenotype of the target gene regulation and control character; the shock treatment method comprises cold shock, wherein fertilized eggs develop at constant temperature of 24 ℃ for 3-7min, and then are placed in ice water at 0-5 ℃ for cold shock for 30 min;

s5. Height Wen Kuoqun: raising partial fishes at a high temperature of 27-28 ℃ in the early stage after F1 generation is out of the membrane, so that the female fishes in the fishes are reversed into male fishes; and breeding the male fish obtained by sex reversal and the F1-generation female fish which are normally bred, and obtaining homozygous filial generation in batches, namely the F2-generation Bairuyi lion goldfish.

2. The method for creating new goldfish variety by gene editing technology as claimed in claim 1, wherein in step S1, after obtaining the target sequence, a local database of goldfish genome is constructed before in vitro transcription, and blast software is used to search and determine the uniqueness of the target, so as to avoid knockout and miss.

3. The method for creating new goldfish variety by gene editing technology as claimed in claim 1, wherein in step S3, during the hatching of fertilized eggs, further comprising the operation of detecting the efficiency of knocking out, randomly selecting 10 fertilized eggs before membrane removal, extracting DNA in fertilized eggs as a template, amplifying DNA sequence sequencing near the knocking out target point and comparing with normal sequence, calculating the knocking out efficiency according to the comparison result, keeping the batch of fertilized eggs for continuous hatching if the knocking out efficiency reaches 20% or more, otherwise terminating hatching.

4. The method for creating a new strain of goldfish by gene editing technique as claimed in claim 3, wherein the extraction and amplification of DNA in fertilized eggs is: putting the selected fertilized eggs into a PCR tube, adding 70-100 mu L of 50mM NaOH solution, and reacting for 20min at 95 ℃ in a PCR instrument to serve as a DNA template; PCR amplification primers are designed near the knockout target point, 10 target clones are selected for sequencing after PCR amplification, transformation and cloning, and the sequence is compared with a normal sequence to check whether the knockout site is knocked out successfully.

5. The method according to claim 1, wherein in the step S4, the female goldfish eggs are obtained from the same F0 female goldfish.

6. The method for creating a new strain of goldfish by gene editing technology as claimed in claim 1, wherein in said step S4, the deactivation of sperm of the carp is performed by ultraviolet irradiation.