CN112680447A - Goldfish gene editing technology and method for creating new goldffish variety by using same - Google Patents

Abstract

The invention relates to a fish molecular design breeding technology, in particular to a goldfish gene editing technology and a method for creating a new goldfish variety by using the gene editing technology. The method comprises the steps of target knockout design, microinjection, fertilization and incubation, gynogenesis and high-temperature reversion. The invention establishes a CRISPR/Cas9 gene editing technology on goldfish, so that a target phenotype is generated on the goldfish of the F0 generation, the high-efficiency gynogenesis condition of the goldfish of the ruffle Taishi is established through experiments, homozygote is obtained in the F1 generation, and a large amount of colony expansion is carried out in the F2 generation through temperature induced reversion. The invention quickly realizes the transfer of single-purpose characters by means of molecular breeding, can be used for creating new goldfish varieties, provides technical support for designing and breeding goldfish molecules, and is beneficial to promoting the development of goldfish molecular breeding technology.

Description

Goldfish gene editing technology and method for creating new goldffish variety by using same

Technical Field

The invention relates to a fish molecular design breeding technology, in particular to a goldfish gene editing technology and a method for creating a new goldfish variety by using the gene editing technology.

Technical Field

The goldfish is originated from tetraploid crucian carps in China, is an ornamental fish formed by artificial selection for hundreds of years, and is named as Chinese essence in China. In the goldfish development history, the color, body type and almost all external organs of the goldfish are obviously changed due to mutation, the mutation is reserved due to artificial selection, and then the mutation is recombined through hybridization to form a plurality of goldfish with composite variation; nowadays, goldfish have more than 300 varieties.

The traditional method for breeding goldfish in fish pot mainly aims at overlooking and viewing. The popularization of the fish tank leads the side view appreciation to become a trend, wherein several varieties of goldfishes such as hundred-shire Tai lion, orchid longevity and the like are favored by more and more goldfish amateurs. The ruffle Taishi goldfish is named after the ruffle of the ruffle, and the ruffle is more like a ruffle, and the ruffle is upwarp and upright, has strong physique and developed head tumor, and gives people a sense of fierce and strong smell. These characteristics of the ruffle lion goldfish determine to a large extent its ornamental and market value. The traditional goldfish has a plurality of high-quality ornamental characters, and the characters are transferred to the lateral-looking ruffle lion goldfish and can only be hybridized and continuously purified. But the time is long, the effect is not satisfactory, the hybridization technology can sacrifice the original important ornamental characters of the Taishi such as body type, tail exhibition and the like while obtaining the target characters, and the desired effect cannot be obtained.

With the development of molecular breeding technology, the CRISPR/Cas9 gene editing technology is continuously developed and perfected after being established, more and more genes related to traits are positioned, the regulation and control of biological traits by using the gene editing technology become a high-value research direction, and the traits regulated and controlled by a single gene can be directionally changed by using the gene editing technology. However, no effective goldfish gene editing technology is established at present, and no rapid and efficient systematic method exists how to utilize the gene editing technology to regulate the phenotype of goldfish and obtain offspring with stable phenotype.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides an efficient goldfish gene editing technology and a method for creating a new goldfish variety by using the technology.

The invention adopts the following technical scheme:

a method for creating a new goldfish variety by using a gene editing technology comprises the following steps:

s1, target point design: carrying out gene sequencing on the golden fish of the Bairuu Taishi lion to obtain a gene DNA sequence for regulating and controlling the target character, obtaining an exon and an intron of the gene for regulating and controlling the dragon-eye character according to the obtained gene DNA sequence, designing a proper knockout target point on the exon by using a wildcard GG [ G/A ] GG or CC [ T/C ] CC, and transcribing the sequence of the target point into gRNA in vitro;

s2, microinjection: flatly paving roes of the golden sea bream lion in an aseptic culture dish, adding a proper amount of ovarian liquid to prevent the roes from being dry and astringent, improving the survival rate, taking 2 mu L of each mRNA of CRISPR/Cas9 protein and gRNA, uniformly mixing, injecting the mixed mRNA into an roe animal by using a microinjection instrument, and injecting 200-3000 roes into 4 mu L of the mixed mRNA;

s3, parent cultivation: dripping the sperms of the male plectrum rufimbriae taiyang on the injected roes, uniformly mixing, adding water for fertilization, spreading in an incubation cylinder for oxygenation and incubation, and obtaining the plectrum rufimbriae taiyang, namely the F0 generation chimeric plectrum ruffle taiyang goldfish containing target gene regulation and control characters;

s4, gynogenesis: taking carp sperms, inactivating the carp sperms by ultraviolet irradiation, mixing the carp sperms with eggs of female plectrum auricle of Tai lion of F0 generation for fertilization, and performing shock treatment, wherein the fish after the eggs are hatched successfully by shock artificial gynogenesis treatment is the next generation of the F1 generation homozygous plectrum auricle goldfish containing the target gene regulation character phenotype.

Further, the method also comprises a high-temperature group expanding step, wherein half of the fishes are raised at the high temperature of 27-28 ℃ in the early stage after the membrane is generated from F1, so that the female fishes are sex-reversed to male fishes, and the sex-reversed female fishes and the normally raised female fishes of the F1 generation are bred, and the second generation of homozygote, namely the golden fish of the F2 generation Bairuxue lion is obtained in batches.

Preferably, in step S1, after obtaining the target sequence, before in vitro transcription, a local genome database is constructed using the target sequence, and blast software is used to search and determine uniqueness of the target, so as to avoid knocking out off the target.

Preferably, in step S3, during the incubation of the fertilized eggs, the method further includes a knockout efficiency detection operation, wherein 10 fertilized eggs before membrane emergence are randomly selected, DNA in the fertilized eggs is extracted as a template, DNA sequences near the knockout target are amplified and sequenced and compared with normal sequences, the knockout efficiency is calculated according to the comparison result, if the knockout efficiency reaches 20% or more, the fertilized eggs in the batch are kept for continuous incubation, and otherwise, the incubation is terminated.

Preferably, the extracting DNA from fertilized eggs and the amplifying are specifically: putting the selected fertilized eggs into a PCR tube, adding 70-100 mu L of 50mM NaOH solution, reacting in a PCR instrument at 95 ℃ for 20min, and taking the mixture as a DNA template; designing a PCR amplification primer near a knockout target, selecting 10 target clones after PCR amplification, transformation and cloning, sequencing and comparing with a normal sequence to test whether the knockout site is successfully knocked out; the vicinity of the target point is 200-300bp upstream and downstream of the target point.

Preferably, in the step S4, the female golden fish egg of the ruffle tao is obtained from the same F0 generation female golden fish of the ruffle taffle.

Preferably, in step S4, the carp sperm is inactivated by ultraviolet irradiation.

Preferably, in step S4, the shock treatment method of the fertilized egg is heat shock, and the fertilized egg is developed at a constant temperature of 24 ℃ for 43-47min, and then placed in water of 41 ℃ for heat shock for 2 min.

Preferably, in step S4, the fertilized egg is subjected to cold shock, and the fertilized egg is subjected to cold shock for 2min in ice water at 0 ℃ after being developed at a constant temperature of 24 ℃ for 3-7 min.

The invention has the beneficial effects that:

1. the invention designs 2 wildcard GG [ G/A ] GG or CC [ T/C ] CC which can quickly search for suitable target spots for knockout, and the wildcard can quickly and efficiently find out the suitable target spots for knockout on exons in the word. After a target gene target is designed, a local blast database of a goldfish genome is constructed, the target sequence is compared to the whole genome, and after the uniqueness of the target is verified, the gRNA is synthesized in vitro, so that the off-target phenomenon is effectively avoided, and the knockout accuracy is improved.

2. The invention uses the method of inseminating after injecting the fish eggs, so that RNA is translated into protein in advance to generate the effect, and the gene editing efficiency is improved. Meanwhile, the injection is carried out on the fish eggs with weak viscosity, so that the phenomenon that the injection needle is blocked by the viscosity generated after the fish eggs are fertilized is effectively avoided, and the microinjection is successfully carried out. In addition, the injection concentration of mRNA of CRISPR/Cas9 protein (400-600 ng/. mu.L) and gRNA (150-300 ng/. mu.L) is improved, so that the knockout efficiency can be effectively increased. The technology realizes F0 generation to obtain a great amount of chimera goldfish with dragon eye character.

3. The invention creates a goldfish efficient batch propagation technology in earlier work, provides high-quality roe for gene knockout of goldfish, and also provides necessary experimental materials for groping of gynogenesis conditions; the invention can reduce background difference by using multiple spawning experiments of the same fish, and is beneficial to exploring the optimal conditions for gynogenesis.

4. The invention is based on CRISPR/Cas9 gene editing technology, a phenotype is generated on F0 generation goldfish, the high-efficiency gynogenesis condition and high-temperature group expansion condition of the ruffle taoisesh are established through experiments, homozygote is obtained in F1 generation, and the yield time of the ruffle taoisesh goldfish with stable character is greatly shortened through temperature induction reversion and large group expansion of F2 generation. The invention can rapidly realize the transfer of single target characters by means of molecular breeding, creates a new goldfish variety, provides technical support for designing and breeding goldfish molecules and is beneficial to promoting the development of the goldfish molecular breeding industry.

Drawings

FIG. 1 is a ruffle Taishi goldfish with normal eyes;

fig. 2 is a ruffle tay goldfish with a shape of dragon eye created in example 3 of the present invention, which shows that the eyes of the ruffle tay goldfish are prominent, and the ornamental characters in the aspects of head tumor, dorsal fin, tail and body type are consistent with those of the ruffle tay goldfish with normal eyes, and are not lost;

fig. 3 shows the white rabbit-shaped pleated skirt taishi goldfish produced in example 5 of the present invention, which has light eyes and body color, white to light yellow body color, and red eyes, and has the same ornamental properties as the normal body color pleated skirt taishi goldfish in head tumor, dorsal fin, tail, body type, etc., without loss.

Detailed Description

For easy understanding, the technical solution of the present invention is described in more detail with reference to the following embodiments:

example 1: efficient breeding of golden fish of Bairuu Taishi

S1, seedling cultivation: feeding newly opened fry in a turnover box with water temperature of 24-26 deg.C, feeding live fairy shrimp 3 times per day, and the turnover box has length of 60-100cm, width of 40-60cm, height of 20-30cm, and water level of 15-20 cm. One side of the turnover box is provided with a sponge filter for filtration, and an oxygen increasing head is arranged beside the turnover box for oxygenation, and the oxygen amount is appropriate. The sponge filter was cleaned once a week.

After the body length of the fry exceeds 2cm, selecting four fries in a overlooking mode, removing the fries with deformed and folded fin lines in a side view, and feeding the selected high-quality fries in a new container with the density of about 2 fishes per liter of water; the container is internally provided with a 7-watt small-sized water pump for dripping and adding water, the daily water inflow is 1/5 of the total water volume, and the three layers of turnover box dripping boxes are used for filtering. The fairy shrimp is fed manually for 1 time every day, the automatic feeder feeds the fodder with 48 percent of protein content for 5 times, and the feeding amount is preferably 10min for each time. The first layer of the circulation box is provided with a filter pad material such as a magic blanket and filter cotton, the second layer and the third layer are provided with bacterial balls, liquid digestive live bacteria are added on the day of fry placement to help fries to quickly establish a digestive system, and the adding amount is 100mL of liquid digestive live bacteria added in every 100L of water. The magic blanket is a filtering blanket with long fluff on one side, and can be cleaned repeatedly.

When the length of the fry exceeds 4cm, the fry with longer body length, stout body, back peak, upwarping tail and round and moist tail tip is selected and put into a fish tank, the length of the fish tank is more than 80cm, the width of the fish tank is more than 50cm, the water depth is preferably 30-40cm, and the density is 1 fish per liter of water. And continuously filtering by using a drop box of a turnover box, adjusting the hourly flow of a water pump to be 3-5 times of the total water body, feeding the feed with 46 percent of protein for 5 times every day by using an automatic feeder, wherein the feeding amount is suitable for 5min to finish feeding every time, and meanwhile, manually feeding Chironomus larvae at noon and evening, wherein the feeding amount is 15min to finish feeding.

When the body length of a fry exceeds 8cm, selecting a fish with strong and uniform body, round and upwarping tail and ruffles, putting the fish into a fish tank, wherein the fish tank is over 80cm long, 50-60 cm wide and 40-50 cm deep in water, feeding the feed with 46% of protein content for 5 times by an automatic feeder every day, feeding the feed for 10min each time, feeding the shrimps to supplement calcium at noon, feeding the midnight midge larvae to increase bodies, and feeding the midge larvae for 15 min. Irradiating the fish tank with lamp light of three-primary-color lamp beads with a lens, wherein the power of the three-primary-color lamp beads is 80w, the lamp-on time is 7: 30-24: 00, and the green algae are attached to the bottom of the fish tank and fully spread to form a moss shape through the lamp light irradiation.

S2, parent cultivation: when the fish body is more than 12cm in length, selecting the fish with strong and uniform physique, round and smooth tail and upwarping and with ruffles as a parent, feeding the fish with feed with 44% of protein content 5 times every day, feeding the fish with feed for 5min each time, feeding the fish with brine shrimp for supplementing calcium at noon, and feeding the fish with feed for 15 min.

A bottom filtration system with strong filtration is selected to filter the water body, and water is changed 2-3 times per week when the water temperature is 24-26 ℃ in summer, 1/3 water is changed every time, and water is changed 1-2 times per week when the water temperature is 21-23 ℃ in winter, 1/4-1/3 water is changed every time; when water is added, the dechlorinated tap water is added, or the tap water can be directly added, but the water inlet flow is slow and is controlled to be full in half an hour, and the temperature difference is large in winter, so that the time is prolonged properly. The filter cotton in the filter system is replaced and cleaned when water is replaced, preferably, the filter cotton is replaced at noon in a fine day, the chlorine in tap water can be effectively removed and the water temperature can be improved due to high temperature, and the damage of the temperature difference to the fish is reduced. The filter cotton is cleaned by a high-pressure water gun and then dried in the sun for sterilization.

The method is characterized in that 3 lenses are additionally arranged on an algae exposure lamp or a worm-germinating lamp, algae exposure is started for 12 hours every day, green algae grow on a bottom layer gradually and form a green coating, organic residues such as fish feces and the like in the green coating are cleaned by a brush every two days, the green algae can be used as plant baits to provide rich nutrients such as vitamins and dietary fibers for breeding fishes, and nitrogen, phosphorus and other substances in a water body can be absorbed.

In the step, when parents are used for cultivating special body colors, the body colors of the parents need to be considered for parent selection, black fish seeds and belly fish seeds in a normal scale system need to be selected, red and white fish seeds are preferably skillful, such as twelve red fish, fin gill red fish, deer seeds and the like, and the selection of full red fish is not recommended. The selection of transparent scale fish species does not mix with red as much as possible except for cherry blossom color systems; the kylin color is selected to be pure blue; the colors of the other color systems are not selected to be dot-like as much as possible, and are preferably block-like or stripe-like.

S3, artificial insemination: when the male fish and the female fish with rear-end collision are observed, fishing out the female fish, manually extruding eggs, collecting the eggs at the cloaca by using a 10mL centrifuge tube, adding semen into the centrifuge tube, covering a tube cover, slightly turning upside down to complete the sufficient mixing of the sperm and the eggs, putting the incubation bed into an incubator, controlling the water depth of the incubator to be 10-30cm, controlling the water temperature to be 22-24 ℃, pouring the sufficiently mixed eggs into the incubation bed, uniformly spreading, carrying out oxygen-charging incubation, and preferably using running water for incubation.

The 10mL centrifuge tube is used for collecting roes, all roes are collected conveniently, waste is avoided, the roes cannot be stuck to the goldfish fin, the roes are prevented from being brought back to the fish tank by the fin to pollute water, the roes can be stored in the centrifuge tube at room temperature for half a day, and the experiment is convenient to use. When insemination is needed, semen is directly extruded into a centrifuge tube, or the semen is sucked by a pipette tip and added into the centrifuge tube, a tube cover is covered, and the semen and the roe are mixed by slightly reversing the upper part and the lower part. At the moment, the roes with the semen mixed evenly are poured into a basin and laid out evenly for hatching, and the insemination rate reaches up to 99 percent.

S4, postnatal care: in 3 hours after the goldfish lays eggs, water is changed from the fish tank 1/4 in winter and from the fish tank 1/3 in summer, and the dried clean filter cotton is cleaned and replaced, so that the situation that the water quality is damaged due to breeding of bacteria caused by excessive semen and ovarian fluid in the water body is avoided, and the death of the goldfish after laying is avoided.

During the culture process, salt, baking soda, methylene blue, white-point agent, heating rod and the like are prepared for preventing and treating fish diseases. If the fish is found to be in a bad state, 1/4 g/L water is replaced, salt is added for sterilization, sodium bicarbonate is added in a proper amount to adjust the pH value to 8, and the water temperature is maintained at 25-27 ℃, so that the fish can be quickly recovered.

Example 2: exploration of gynogenesis conditions

Two gynogenesis methods are established, the proportion of normal fish generated by the two methods is compared, and the optimal gynogenesis condition of the Taishi goldfish with high homozygote yield is selected.

1. Meiotic gynogenesis

Inactivating the sperm of the carp, mixing the inactivated sperm with the ovum of the golden fish of the hundred-shire Taishi lion for fertilization, and then carrying out cold shock treatment, wherein the cold shock treatment method comprises the steps of developing the fertilized ovum at the constant temperature of 24 ℃ for 3-7min, and then placing the fertilized ovum in ice water at the temperature of 0 ℃ for cold shock for 2min to inhibit the discharge of a second diode, so that two gametes are combined into a whole to form the tetraploid. And hatching the fertilized eggs after cold shock treatment to obtain the meiosis Taishi goldfish with the characteristics of dragon eyes.

2. Mitotic gynogenesis

Inactivating the sperm of the carp, mixing the inactivated sperm with the eggs of the hundred-pleated Taishi goldfish for fertilization, and then carrying out heat shock treatment, wherein the heat shock treatment method comprises the steps of developing the fertilized eggs at the constant temperature of 24 ℃ for 43-47min, and then placing the fertilized eggs in water at the temperature of 41 ℃ for 2min so as to destroy the formation of spindle threads, so that the two steps are combined into one. Hatching the fertilized eggs after heat shock treatment to obtain the mitotic lion goldfish with the characteristics of dragon eyes.

The egg of the golden fish of the ruffle tao lion used above is preferably the egg produced from the same ruffle tao golden fish to reduce the background difference.

The fertilization rate, the membrane emergence rate and the normal rate of the tai-shi goldfish generated by meiosis and mitosis are counted, the results are shown in table 1, and as can be seen from table 1, the number of the normal fish obtained by heat shock 47min after fertilization is higher than that of other combinations and reaches 3.34%, and the number of the normal fish obtained by cold shock 6min after fertilization is higher than that of other combinations and reaches 45.52%.

TABLE 1 statistics of F1 generation homozygote under mitotic and meiotic conditions

Example 3: creation of Longjing Bairufu Taishi goldfish

The Bairuu Taishi is one of the most important ornamental species in the lateral-looking goldfish, and the shape of the dragon-eye is similar to the eyes of dragon in mythology legends because of the outward bulging of the two eyes, so the shape of the dragon-eye occupies an important position in overlooking the goldfish, and the transfer of the shape of the dragon-eye from the traditional ornamental fish to the Taishi is the dream of a plurality of goldfish farms and goldfish lovers. However, the transfer of the single dragon-eye character can not be realized by the traditional method of continuous hybridization and purification, and the transfer of the dragon-eye character to the golden fish of the ruffle tao can be accompanied with the change of other important ornamental characters of the golden fish of the ruffle tay through hybridization, such as the small included angle of the tail, no folds and no stout body shape, thereby losing the original ornamental value of the ruffle tay.

In this example 3, a longjing ruffle lion taishi goldfish was successfully created by knocking out longjing trait-related genes by using the goldfish gene editing technology provided by the present invention, and the steps are as follows:

s1, target point design: performing gene sequencing on the golden fish of the Bairuu Taishi lion to obtain a DNA sequence and an amino acid sequence of the Longjing character gene and structural information of the Longjing character gene; copying a DNA sequence of a dragon eye character gene into a word, annotating an exon and an intron, designing a proper knockout target on the exon of the DNA sequence of the gene for regulating and controlling the dragon eye character by using a wildcard GG [ G/A ] GG or CC [ T/C ] CC, constructing a genome local database after obtaining the target, searching and verifying the uniqueness of the target by using blast software, and transcribing the sequence of the target into a gRNA in vitro after determining the uniqueness; in wildcard "? "represents an arbitrary base," [ ] "represents a match with any one of the bases within [ ],"/"represents an" or ".

The dragon eye character gene is lrp2a, namely a low density lipoprotein 2 gene, the target points are five, and the target point sequences are respectively as follows:

GGGTCTTTCCGCTGTGGGAC, GGAGCTGAGGTGTGCTAACG, GGATGACTGCGAGGACAATG, TCTTCTGGTGTTTGCATCCC and GGGACGTCCCACTGTCCGGA;

s2, microinjection: flatly paving roes of the golden sea bream lion in an aseptic culture dish, adding a proper amount of ovarian liquid to prevent the roes from being dry, taking 2 mu L of each mRNA of CRISPR/Cas9 protein and gRNA, uniformly mixing, injecting the mixed mRNA into an egg animal pole by using a microinjection instrument, and injecting 200-3000 roes into 4 mu L of the mixed mRNA;

s3, fertilization and incubation: and adding male plectrum unijugum and Taishi goldfish sperms into a culture dish after injection operation is completed, transferring fertilized eggs to an incubation nest for incubation after fertilization of the fish eggs, putting 10 fertilized eggs which are just before membrane removal into a PCR (polymerase chain reaction) tube, adding 70-100 mu L of 50mM NaOH solution, and reacting in a PCR instrument at 95 ℃ for 20min to obtain a DNA template. Designing PCR amplification primers near the knockout target, selecting 10 target clones after PCR amplification, transformation and cloning, sequencing, comparing with a normal sequence to check whether the knockout site is knocked out, and calculating the knockout efficiency according to the comparison result.

The specific method for selecting and sequencing 10 target clones after PCR amplification, transformation and cloning comprises the following steps: and performing PCR amplification on DNA sequences near a target by using 10 DNA templates, recovering PCR products, connecting the recovered PCR products to a vector, transforming the vector into competent cells, and selecting 10 positive clones for sequencing after overnight culture at 37 ℃ in an Amp culture medium so as to test whether the knockout site is knocked out.

In this step, "near the target" refers to the 200 and 300bp regions upstream and downstream of the target.

If the fertilized egg rate of the knocked-out target spot reaches 20% or more, the fertilized eggs are kept for further hatching, and the obtained golden fish of the ruffle-skirt Taishi is the golden fish of the ruffle-skirt Taishi with the dragon-eye character. Otherwise, the incubation is terminated, the knockout is carried out again, the mRNA injection concentration of CRISPR/Cas9 and gRNA is increased when the knockout is carried out again, or the steps S2 and S3 are repeated after the target sequence is transcribed in vitro again.

S4, fry feeding and parent selection

After the fertilized eggs are hatched to produce fry, raising the fry to be large, wherein the raising water temperature does not exceed 24 ℃ in the early 1 month, and the eyes begin to bulge outwards when the fry is raised for about 2-3 months, and the obtained plectrum rufimbriae tai golden fish is the chimeric plectrum ruffle golden fish with the character after the target gene is knocked out; select good and eye-bulging Baikui Taishi as parent, and record as generation F0.

S5, gynogenesis: inactivating the sperm of the carp, mixing the inactivated sperm with the ovum of the female plectrum thyesti of the F0 generation for fertilization, and then carrying out cold shock treatment, wherein the cold shock treatment method comprises the steps of developing the fertilized ovum at the constant temperature of 24 ℃ for 3-7min, then placing the fertilized ovum in ice water at the temperature of 0 ℃ for 2min, and hatching the treated fertilized ovum to obtain the F1 generation homozygote with the dragon-eye character.

S6, high-temperature group expanding, namely feeding half female fishes at the early stage after the membrane generation of F1 at the high temperature of 27-28 ℃ to ensure that the female fishes are sex-reversed to male fishes, breeding the sex-reversed female fishes and the normally fed F1 female fishes, and obtaining pure zygote offspring of the golden fish of the Baiyan skirt lion with the dragon character in batches.

Example 4 creation of Longjing Baikui skirt Taishi goldfish

The preparation method of example 4 is the same as that of example 3, except that in step S5, the fertilized egg is subjected to heat shock treatment, and the specific operations of S5 are as follows:

s5, gynogenesis: taking F0 generation male plectrum pernicicum Thailand sperm to inactivate, mixing the inactivated sperm with F0 generation female plectrum pernicicum ovum, fertilizing, and performing heat shock treatment, wherein the heat shock treatment method comprises the steps of developing fertilized eggs at a constant temperature of 24 ℃ for 43-47min, then placing the fertilized eggs in ice water at 41 ℃ for 2min, and hatching the fertilized eggs to obtain the first filial generation with the dragon character, namely the F1 generation homozygous plectrum pernicicum.

Example 5 creation of Rabbit and hundred-skirt Taishi goldfish

In goldfish, there is a phenomenon of yellowing or whitening, which is manifested as white or yellowish color of the whole body, and the eye becomes transparent red, and is called a rabbit like rabbit. Previous reports of this goldfish appeared only on a very small variety of goldfish of normal scales, which showed a delicate ornamental feature but were almost vacant in the market. Although many fisheries have tried, at best, fish body color can only be purified to white, and the eyes are still black, not truly yellowed/whitened. At present, if a few kinds of rabbit goldfishes of individual varieties exist, the characters of the rabbits are required to be transferred to a hundred-shirts Tai lion goldfishes line, and only a method of continuous purification after hybridization is available. However, the hybridization can weaken and even lose many original characters of the target fish, and the transfer of single target characters cannot be realized.

The creation method of the ruffle lion-gold fish of the embodiment 5 is the same as the embodiment 3, except that in the step S1, the gene for regulating the rabbit character is pigment gene oca2, the number of targets is 1, and the sequence of the target is as follows: GGAGTATATTCTGATCCAGG are provided.

In the embodiment, the pigment gene oca2 is knocked out, so that the character of the rabbit is successfully transferred to the golden fish of the Baidu skirt Tai lion without changing other ornamental characters, a new variety of the rabbit, Baidu skirt Tai lion goldfish is successfully created, and the ornamental value is extremely high.

The above embodiments are only used to illustrate the technical solutions of the present invention, and do not limit the present invention; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that: any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (9)

1. A method for creating a new goldfish variety by using a gene editing technology is characterized by comprising the following steps:

s1, target point design: performing gene sequencing on the golden fish of the Bairuu Taishi lion to obtain a DNA sequence of a character gene for regulating and controlling the target character, obtaining an exon and an intron of the gene for regulating and controlling the characteristics of the dragon eye according to the DNA sequence, designing a proper knockout target on the exon by using a wildcard GG [ G/A ] GG or CC [ T/C ] CC, and transcribing the sequence of the target into gRNA in vitro;

s2, microinjection: flatly paving roes of the golden fish of the Bairuu Taishi in a sterile culture dish, adding a proper amount of ovarian fluid, taking 2 mu L of each mRNA of CRISPR/Cas9 protein and gRNA, uniformly mixing, injecting the mixed mRNA into an egg animal pole by using an injection instrument, and injecting 200-3000 roes of 4 mu L of mRNA;

s3, fertilization and incubation: adding male plectrum rufimbriae Taishi goldfish sperms onto the injected roes, uniformly mixing, fertilizing the roes, and incubating the fertilized roes to obtain the plectrum ruphlus rupestris goldfish, namely the F0 generation chimeric plectrum ruphlus Goldfish with the characteristics after target genes are knocked out;

s4, gynogenesis: taking carp sperms, inactivating the carp sperms, mixing the inactivated carp sperms with eggs of female plectrum auricle golden fish of F0 generation, fertilizing, and performing shock treatment, wherein the fish after the eggs are incubated successfully through shock treatment is the first filial generation containing the target gene regulation character phenotype, namely the F1 generation homozygous plectrum auricle golden fish.

2. The method of claim 1, further comprising a high-temperature population expansion step of feeding a part of the goldfish at a high temperature of 27-28 ℃ at an early stage after the generation of the membrane at F1 to reverse the sex of female goldfish into male goldfish. And breeding the male fish obtained by sex reversion and the female fish of the F1 generation which is normally bred, and obtaining the homozygous offspring namely the F2 generation golden fish of the Bairuu lion in batches.

3. The method of claim 1, wherein after obtaining the target sequence in step S1, before in vitro transcription, a local database of goldfish genome is constructed, and blast software is used to search and determine uniqueness of the target to avoid knockout off-target.

4. The method according to claim 1, wherein in step S3, the fertilized egg hatching process further comprises a knockout efficiency detection operation, wherein 10 fertilized eggs before membrane emergence are randomly selected, DNA in the fertilized eggs is extracted as a template, DNA sequences near the knockout target are amplified and sequenced and compared with normal sequences, the knockout efficiency is calculated according to the comparison result, and if the knockout efficiency reaches 20% or more, the fertilized eggs are kept for hatching, otherwise, hatching is terminated.

5. The method of claim 4, wherein the extracting DNA and amplifying DNA in fertilized eggs are specifically: putting the selected fertilized eggs into a PCR tube, adding 70-100 mu L of 50mM NaOH solution, reacting in a PCR instrument at 95 ℃ for 20min, and taking the mixture as a DNA template; designing PCR amplification primers near the knockout target, selecting 10 target clones after PCR amplification, transformation and cloning, sequencing and comparing with a normal sequence to test whether the knockout site is successfully knocked out.

6. The method of claim 1, wherein in step S4, the eggs of female golden fish are obtained from the same F0 generation female golden fish of Bai Ku jin Shi.

7. The method according to claim 1, wherein in step S4, the inactivation of sperm of carp is performed by ultraviolet irradiation.

8. The method of claim 1, wherein the step of S4, the fertilized egg is heat shock, and the fertilized egg is heat shock treated in 40-41 deg.C water for 2min after development at 24 deg.C for 43-49 min.

9. The method of claim 1, wherein the shock treatment of the fertilized egg in step S4 is cold shock, and the fertilized egg is cold shocked in ice water at 0-5 ℃ for 30min after 3-7min at 24 ℃.

Images