CA2202553A1 - Lipase, microorganism producing same, method for preparing said lipase and uses thereof - Google Patents

Abstract

A lipase from a Pseudomonas strain is disclosed. The lipase is active in a broad alkaline pH range. Novel microorganism strains producing the lipase, and methods for preparing said lipase, are also disclosed. In addition, the uses of the lipase and compositions containing same are disclosed.

Description

CA 02202~3 1997-04-11 -"LIPASE, M~KuuKG~NISM ~UUU~L~G SAME, METHOD FOR PR$PARING SAID
LIPASE AMD USES T~R~"

The invention relates to a new lipase. The invention also relates to a new strain of micro-organism producing this llpase .

The invention also relates to processes to prepare this lipase, to the uses thereof and to compositions comprising it.

It is known to include lipases in detergent compositions in order to eliminate fatty deposits from the tissues (Enzyme Microb. Technol., 1993 (3), pages 634-645). These fatty deposits contain triglycerides contained, for example, in sebum, yarious foodstuffs (oil, sauce, butter, fats), cosmetic products. The lipases hydrolyze the triglycerides, forming substances which are more readily soluble in water, mono- and diglycerides, glycerol and free fatty acids.

Lipases which may be used in detergent compositions are known, such as, in particular, the lipases originating from Pseudomonas strains, for example the lipase produced by the Pseudomonas stutzeri strain (British patent application 1372034), the lipase produced by Pseudomonas mendocina strain (European patent application 0 571 982), the lipase produced CA 02202~3 lss7-04-ll -by the Pseudomonas alcaliqenes strain (US patent 5,063,160), and the lipase produced by the Pseudomonas pseudoalcaliqenes strain (European patent application 0 218 272). Yet, despite the properties of these lipases, the detergent compositions containing these enzymes would appear not to be very effective.

Consequently, there is currently a need for a lipase which may be used in the detergent field, which is highly stable and, likewise, highly active in a broad pH and temperature range.
In addition, there is also a need for a lipase which is particularly effective on grease stains, and this on a low enzyme dose. In addition, there is also a need for a lipase which is particularly effective on grease stains from the very first washing cycle.

The object of the present invention is to provide a new lipase which is active in a broad range of temperatures, active in a broad alkaline pH range, and which is effective from the first washing cycle.

A further object of the invention is to identify, isolate and provide a strain, in particular a strain of Psçudomonas, which produces said lipase naturally.

A further object of the invention is to prepare and provide a composition and, in particular, a detergent composition which contains said lipase.

CA 02202~3 1997-04-11 To this end, the present invention relates to a lipase, isolated and purified, which originates from a strain of Pseudomonas wisconsinensis. The present invention also relates to a lipase, isolated and purified, which originates from a derivative or a mutation of a strain of Pseudomonas wisconsinensis which is capable of producing this lipase. The lipase according to the invention is preferably derived from the strain Pseudomonas wisconSinensis T 92.677/1 or from a derivative or a mutation of this strain which is capable of producing this lipase. The lipase of the invention is derived from the strain Pseudomonas wisconsinensis T 92.677/1. The lipase is classified in the international system under the number E.C. 3.1.1.3; it is a glycerol ester hydrolase.

The lipase, isolated and purified, preferably has a relative molecular mass of about 30 kDa. It is essentially extracellular.

The N-terminal amino acid sequence (SEQ ID NO:l) of the lipase according to the invention is as follows:
Asn Tyr Thr Lys Thr Lys Tyr Pro Ile Val Leu Val His Gly Val Thr Gly Phe Asn Thr Ile Gly Gly Leu The invention relates to a lipase which is derived from an aerobic bacterium which is capable of producing the lipase in an appropriate nutritive medium containing sources of carbon .

CA 02202~3 1997-04-11 and nitrogen and mineral salts under aerobic conditions.

The invention relates to a lipase, isolated and purified, which comprises the amino acid sequence from 1 to 286 amino acids (SBQ ID NO:4) or a derived modified sequence thereof. The amino acid sequence and the nucleotide sequence (SEQ ID NO:2) coding for the mature lipase, as well as its translation into amino acids (SEQ ID NO:3), is given in Figure 1 (Figures la and lb).

The lipase according to the invention is synthesized in the form of a precursor. The precursor contains 308 amino acids (SEQ ID NO:7). The nucleotide sequence (SEQ ID NO:5) coding for the precursor of the lipase is identified, together with its translation into amino acids (SEQ ID NO:6). Figure 2 (Figures 2a and 2b) show the sequence of nucleotides (SEQ ID
NO:5) of the coding part of the lipase as well as its translation into amino acids (SEQ ID NO:6).

The precursor contains the sequence of 286 amino acids (SEQ

ID NO:4) of the mature lipase and the sequence of 22 amino acids (SEQ ID NO:10) of the presequence.

The sequence of the mature lipase is preceded by a presequence.
This is an additional sequence of 22 amino acids (SEQ ID
NO:10). The corresponding sequence o~ nucleotides (SEQ ID
NO:8), as well as its translation into amino acids (SEQ ID
NO:9), is identified. This presequence codes for the peptide CA 02202~3 1997-04-11 signal of the lipase according to the invention.

In a preferred manner, said lipase has an estimated iso-electric point of between about 9.8 and about 10.1. In a particularly preferred manner, said lipase has an estimated iso-electric point of about 9.95.

The lipase according to the invention is active in a broad temperature range. The isolated and purified lipase according to the invention develops an optimal enzymatic activity, measured at a pH of 9.5, in a temperature range above about 40 C. The isolated and purified lipase according to the invention develops an optimal enzymatic activity, measured at a pH of 9.5, in a temperature range below about 60 C. More particularly, the lipase according to the invention develops an optimal enzymatic activity, measured at a pH of 9.5, in a temperature range of between about 40 C and about 60 C. In a particularly preferred manner, the lipase according to the invention develops an optimal enzymatic activity, measured at a pH of about 9.5, at a temperature of about 55 C.

The isolated and purifi.ed lipase according to the invention develops an enzymatic activity in excess of 50 ~ of the maximum enzymatic activity in a temperature range of between about 40 C and about 60 C, at a pH of about 9.5, the maximum enzymatic activity being measured at a temperature of 55 C and at a pH
of 9.5.

CA 02202~3 lss7-04-ll The lipase according to the invention is active in a broad alkaline pH range. The isolated and purified lipase according to the invention usually develops an optimal enzymatic activity, measured at a temperature of about 30 C, in a pH
range of more than or equal to about 8. The isolated and purified lipase according to the invention develops an optimal enzymatic activity, measured at a temperature of about 30 C, in a pH range of less than or e~ual to about 10. More particularly, the lipase according to the invention develops an optimal enzymatic activity, measured at a temperature of about 30 C, in a pH range of between about 8 and about 10.
In a particularly preferred manner, the lipase according to the invention develops an optimal enzymatic activity, measured at a temperature of about 30 C, in a pH range of between about 8 and about 9.5.

The isolated and purified lipase according to the invention develops an enzymatic activity of more than 85 ~ of the maximum enzymatic activity in a pH range of between about 8 and about 10 at a temperature of about 30 C, the maximum enzymatic activity being measured at a temperature of 30 C and at a pH
of 9.5.

The lipase according to the invention is thermostable at an alkaline pH. Indeed, the isolated and purified lipase according to the invention displays a relative enzymatic activity of at least 55 ~ measured after an incubation of 160 minutes at a temperature of 55 C and at a pH of 10 in a buffer CA 02202~3 1997-04-11 solution with a hardness of 15. It displays a relative enzymatic activity of at least 70 ~ measured after an incubation of 80 minutes under the same conditions.

The term 'relative enzymatic activity' is understood to mean the relationship between the enzymatic activity, measured during a test under the given conditions regarding pH, temperature, substrate and duration, and the maximum enzymatic activity measured during the same test, the enzymatic activity being measured after the hydrolysis of the triolein and the maximum enzymatic activity being fixed arbitrarily at a value of 100.

The invention also relates to a modified lipase, i.e. an enzyme, the amino acid sequence of which differs from that of the crude enzyme by at least one aminated acid. It is possible for these modifications to be obtained by known DNA mutagenesis processes, such as the exposure to ultraviolet rays, to chemical substances, such as ethyl methane sulphonate (EMS), N-methyl-N-nitro-N-nitrosoguanidine (MNNG), sodium nitrite or O-methylhydroxyl amine, or by genetic engineering techniques, such as, for example, controlled mutagenesis or random mutagenesis. These techniques are known to the person skilled in the art and are described, in particular, in MOLECULAR

CLONING - a laboratory manual - SAMBROOK, FRITSCH, MANIATIS -Second Edition, 1989, Chapter 15.

The invention also relates to a mutated lipase obtained by CA 02202~3 l997-04-ll modification of the nucleotide sequence of the gene which codes for the lipase. The techniques to obtain such mutated lipases are known to the person skilled in the art and are described, in particular, in MOLECULAR CLONING - a laboratorY manual -SAMBROOK, FRITSCH, MANIATIS - Second Edition, 1989, Chapter 15.

The invention also relates to a lipase which has immuno-chemical properties identical or partially identical to the lipase obtained from the Pseudomonas wisconsinensis T 92.677/1 strain. The immuno-chemical properties may be determined in an immunological manner by identity tests, in particular by using specific polyclonal or monoclonal antibodies. Identity tests, such as, in particular, the Ouchterlony immunodiffusion method, or the immuno-electrophoresis method, are known to the person skilled in the art. Examples of such methods are described by Axelsen N.H. ~Handbook of Immunoprecipitation Gel Techniques", Blackwell Scientific Publications, 1983, Chapters 5 and 14, the terms "antigenic identity~ and ~partial antigenic identity" being described in that document in Chapters 5, 19 and 20. A serum containing the specific antibody is prepared according to the described method by immunizing animals (for example mice, rabbits or goats) with a preparation of purified lipase. This preparation may be mixed with an additive, such as the Freund adjuvant, and the mixture obtained is injected into the animals. The polyclonal antibody is obtained after one or more immunizations. An example involves injecting, subcutaneously at two-weekly intervals, four parts each containing 150 micrograms of purified lipase, the immunization CA 02202 j j3 1997 - 04 -11 ' thus extending over 8 weeks. The serum is taken after the immunization period and the immunoglobulin may be isolated according to the method described by Axelsen N.H. (1983).

The present invention also relates to the isolation, the identification and the supplying of a new bacteria which produces the lipase. This aerobic bacteria is isolated and purified. It generally belongs to the Pseudomonadaceae family.
It preferably belongs to the Pseudomonas genus. In a particularly preferred manner, it is a strain of Pseudomonas wisconsinensis. Good results were obtained with a strain of Pseudomonas wisconsinensis T 92.677/1 or a derivative or mutation of this strain.

The term "derivative of this strain" is understood to mean any naturally modified bacteria, i.e. modified by natural selection. The term "mutation of this strain" is understood to mean any artificially modified bacteria. The mutations of this strain may be obtained by known modification techniques, such as ultraviolet radiation, X-rays, mutagenic agents or genetic engineering. These techniques are known to the person skilled in the art and are described, in particular, in SAMBROOK et al., 1989, Chapter 15. Examples of mutagenic agents are described, in particular, by R. Scriban, Biotechnoloqie (Technique et Documentation Lavoisier), 1982, pp 365-368.

The strain of Pseudomonas wisconsinensis T 92.677/1 was CA 02202~3 1997-04-11 ,, .

submitted to the collection entitled BELGIA`N COORDINATED
COLLECTIONS OF MICROORGANISMS (LMG culture collection, Université de Gand, Laboratoire de Microbiologie - K.L.
Ledeganckstraat 35, B-9000 Gand, Belgium) in accordance with the Budapest Treaty under number LMG P-15151 on 12th October, 1994). The invention relates to an isolated and purified culture of the Pseudomonas wisconsinensis strain and a culture derived or mutated therefrom. More particularly, the invention relates to an isolated and purified culture of the strain of Pseudomonas wisconsinensis T 92.677/1 and a culture derived or mutated therefrom.

The strain of the present invention was identified by its biochemical characteristics. It is an aerobic Gram-negative bacteria. It does not develop in anaerobiosis. No spores are formed. The oxidase test is positive in the presence of 1 (p/v) of tetramethyl-1,4-phenylene diammonium dichloride. This bacteria is not thermophilic. It does not produce gas from glucose.

The invention also relates to the isolation and supplying of a DNA molecule comprising the nucleotide sequence (SEQ ID NO:2) which codes for the mature lipase of Pseudomonas wisconsinensis T 92.677/1 or a derived modified sequence thereof.

The term 'derived modified sequence of the DNA molecule' is understood to mean any DNA molecule obtained by modification of one or more nucleotides of the gene which codes for the CA 02202~3 1997-04-11 lipase according to the invention. The techniques to obtain such sequences are known to the person skilled in the art and are described, in particular, in MOLECULAR CLONING - a laboratory manual - SAMBROOK, FRITSCH, MANIATIS - Second Edition, 1989, Chapter 15. The derived modified sequence of the DNA molecule usually comprises at least 70 ~ homology with the sequence of nucleotides (SBQ ID NO:2) of the gene which codes for the lipase according to the invention, i.e. at least 70 ~ identical nucleotides and having the same position in the sequence. The derived modified sequence of the DNA molecule preferably comprises at least 80 ~ homology with the nucleotide sequence (SEQ ID NO:2) of the gene which codes for the lipase according to the invention. In a particularly p~eferred manner, the derived modified sequence of the DNA molecule comprises at least 90 ~ homology with the nucleotide sequence (SEQ ID NO:2) of the gene which codes for the lipase according to the invention.

According to the invention, the DNA molecule usually comprises at least the nucleotide sequence (SEQ ID NO:5) which codes for the precursor of the lipase or a derived modified sequence thereof. This nucleotide sequence (SEQ ID NO:5) comprises the nucleotide sequence (SEQ ID NO:2) which codes for the mature lipase of Pseudomonas wisconsinensis T 92.677/1 and its signal sequence (presequence) (SEQ ID NO:8). This DNA molecule preferably comprises the entire gene of the Pseudomonas wisconsinensis T 92.677/l lipase.

CA 02202jj3 1997-04-11 The present invention also relates to a process for the production of a lipase. This process comprises the culture of an aerobic bacteria which is capable of producing the lipase in an appropriate nutritive medium containing sources of carbon and nitrogen and mineral salts under aerobic conditions, and the collection of the lipase thus obtained. This culture medium may be a solid or a liquid. The culture medium is preferably a liquid medium. The aerobic bacteria is usually a strain of Pseudomonas or a derivative or mutation of this strain which is capable of producing the lipase. More particularly, the aerobic bacteria is a strain of Pseudomonas wisconsinensis or a derivative or mutation of this strain capable of producing the lipase. The aerobic bacteria is preferably a strain of Pseudomonas wisconsinensis T 92.677/1 or a derivative or mutation of this strain capable of producing the lipase.

The culture conditions for these bacteria, which will permit obtaining the lipase according to the invention, such as the components of the nutritive medium, culture parameters, temperature pH, ventilation, agitation, are well known to the person skilled in the art Examples of the culture conditions are described, in particular, in European patent application 0 571 982.

The techniques for the collection of the lipase are well known to the person skilled in the art and are selected in terms of the proposed use of the lipase. Usually, centrifugation, CA 02202~3 l997-04-ll filtration, ultrafiltration, evaporation, microfiltration, crystallization or a combination of the one or the other of these techniques, such as centrifugation followed by ultrafiltration, are used. Examples of such techniques are described, in particular, by R. Scriban, Biotechnoloqie, (Technique et Documentation Lavoisier), 1982, pp 267-276.

It is then possible for the lipase to be purified, if necessary, and depending on the proposed uses. The techniques for the purification of enzymes are well known to the person skilled in the art, such as precipitation with the aid of a salt, such as ammonium sulphate, or with the aid of a solvent, such as acetone or an alcohol. Examples of such techniques are described, in particular, by R. Scriban, Biotechnoloqie, (Technique et Documentation Lavoisier), 1982, pp 267-276. It is also possible for the lipase to be dried by atomization or lyophilization. Examples of such techniques are described, in particular, by R. Scriban, Biotechnoloqie. (Techniuue et Documentation Lavoisier), 1982, pp 267-276. The present invention also relates to enzymatic compositions which comprise the lipase according to the invention and at least one additive. Depending on the proposed uses, the enzymatic compositions which comprise the lipase according to the present invention may be in solid or in liquid form.

The additives which are contained in the composition according to the invention are known to the person skilled in the art and are selected in terms of the proposed use of the composition.

CA 02202~3 1997-04-11 They must be compatible with the lipase and must not affect the enzymatic activity of the lipase. These additives are usually enzyme stabilizers, preservatives and formulation agents.
Bxamples of additives are described, in particular, in European patent application 0 218 272. The following may be mentioned as examples of additives: ethylene glycol, glycerine, 1,2-propane diol, starch, a sugar such as glucose and sorbitol, a salt such as sodium chloride, calcium chloride, potassium sorbate and sodium benzoate, or a mixture of two or more of these substances. Good results were obtained with 1,2-propane diol. Good results were also obtained with sorbitol.

.
There are numerous openings in various industries, such as, for example, the foodstuffs lndustry, the pharmaceutical industry or the chemical industry, for a lipase according to the invention.

The lipase may, in particular, be used for cleaning. The present invention also relates to the use of the lipase, as defined above, for cleaning. An example of a use of this kind is described, in particular, in British patent application 1372034 and in Buropean patent application o 218 272. Within this framework, it forms part of the detergent compositions.
The present invention thus also relates to detergent compositions which contain the lipase. The components of detergent compositions are known to the person skilled in the art and are adapted depending on the proposed use of the composition. Such compounds are, in particular, enzymes such CA 02202~3 lss7-04-ll as, for example, proteases, amylases and/or cellulases;
fillers, such as sodium tripolyphosphate; bleaching agents, such as perborate; formulation additives; surface-active agents. The detergent compositions according to the invention may be used, depending on their formulation, in powder form, in granular form or as a washing liquid for household washing;
as a stain-removing substance to remove stains or grease from items or to remove stains from washing prior to cleaning; and in powder form, granular form or liquid form to wash dishes.

The lipase may be used, in particular, for the treatment of waste paper in order to remove oil-based inks. An example of such use is described, in particular, in the summary Chemical Abstract 113/154607.

The lipase may be used, in particular, during the processing of paper pulp to prevent sticky deposits which are known as "pitch". An example of such use is described, in particular, in the document Enzyme Microb. Technol., 1993 (3), pages 634-645.

The lipase may be used, in particular, in the foodstuffs industry in order to develop the aroma of certain food products, such as cheeses; and during the production of special margarines. An example of such use is described, in particular, in the document Enzyme Microb. Technol., 1993 (3), pages 634-645.

CA 02202~3 1997-04-11 The present invention is illustrated by the following Examples.

Figure 1 (Figures la and lb) shows the amino acid sequence and the nucleotide sequence (SEQ ID NO:2) coding for the mature lipase, as well as its translation into amino acids (SEQ ID
NO:3).

Figure 2 (Figures 2a and 2b) shows the nucleotide sequence (SEQ
ID NO:5) of the coding part of the lipase as well as its translation into amino acids (SEQ ID NO:6).

Example 1 Isolation and characterization of the Pseudomonas wisconsinensis T 92.677/l strain The Pseudomonas wisconsinensis T 92.677/1 strain was isolated from a soil sample taken in the United States in the State of Wisconsin.

1 g of soil is placed in suspension in 10 ml of demineralized water which contains 9 g/l of NaCl. This suspension is diluted 10 times with demineralized water containing 9 g/1 of NaCl.

1 ml of the suspension of diluted soil is spread out on an agar-agar nutritive medium A.

i The medium A contains 10 g/l of tryptone (Difco), 5 g/l of yeast extract, 5 g/1 of NaCl, 20 g/1 of agar, 2.5 g/l of CA 02202~3 1997-04-11 NaHCO3, 7.5 g/l of Na2CO3, 10 g/l of olive oil, 1 g/l of polyvinyl alcohol (25/140) and 0.01 g/l of rhodamine B (Sigma 6626).

The medium A is prepared as follows.

An olive oil emulsion is first prepared as follows. 50 ml of distilled water is heated to 80 C. 1 g of polyvinyl alcohol is added in small quantities to this heated water. Then 10 of olive oil is added to the polyvinyl alcohol suspension.
An emulsion is then provided by means of an Ultra-turax mixer operating at 13500 revolutions per minute (shaft 18 GM). The emulsion obtained is sterilized at 121 C for 30 minutes.

.
A gelose is then prepared as follows. 10 g of tryptone, 5 g of yeast extract, S g of NaCl, 20 g of agar-agar are added to 850 ml of distilled water. The gelose suspension obtained is sterilized at 121 C for 30 minutes.

1 l of carbonate buffer (pH 9.5), containing 25 g/l of NaHCO3 and 75 g/l of Na2CO3, was prepared, then sterilized at 121 C
for 30 minutes.

Then, 1 ml of an aqueous solution of [0.01 ~ (p/v)] rhodamine B (Sigma 6626) is prepared. This solution is sterilized by filtration through a 0.45 ~ sterilizing membrane (MILLIPORE).

The sterilized olive oil emulsion and the sterilized gelose CA 02202~3 1997-04-11 are cooled to 60 C, then mixed under sterile conditions. The sterilized rhodamine solution is then added. Then, 100 ml of sterilized carbonate buffer is added in a manner so as to obtain a pH of 9.5. The suspension thus obtained is then emulsified by means of an Ultra-turax mixer at 13500 revolutions per minute (shaft 18 GM).

The medium A, on which the soil suspension was spread out, is incubated at 30 C for 48 hours. The micro-organisms which produce lipase are detected by means of an ultraviolet light, they are encircled by a fluorescent halo.

The micro-organisms detected as producing lipase are cultured on a gelose nutritive medium B.

The medium B contains 10 g/l of tryptone (Difco), 5 g/l of yeast extract, 5 g/l of NaCl, 20 g/l of agar-agar, 2.5 g/l of NaHCO3, 7.5 g/l of Na2CO3. The tryptone, yeast extract, NaCl, agar-agar, which form the medium B, are mixed with 900 ml of distilled water, then sterilized at 121 C for 30 minutes.
The pH is adjusted to 9.5 by the addition of 100 ml of previously sterilized carbonate buffer (containing 25 g/l of NaHCO3 and 75 g/l of Na2CO3).

The micro-organism was identified by its biochemical characteristics: Gram-negative bacteria, aerobic. No spores are formed.

CA 02202~3 1997-04-11 The dimensions of the vegetative cells are 0.5-0.7 ~m x 1.5-4.0 ~m. The mobility of the vegetative cells is positive. The lysis test by 3 ~ (m/v) of KOH is positive. The catalase test is positive in the presence of 10 ~ (v/v) hydrogen peroxide.
The oxidase test is positive in the presence of 1 ~ (m/v) of tetramethyl-1,4-phenylene-diammonium dichloride. The urease test is negative. The test for the reduction in nitrate is positive. Comparable tests have been described, in particular, in European patent application 0 218 272.

This strain is aerobic, i.e. it develops in aerobiosis. It does not develop in anaerobiosis, i.e. in an atmosphere of 84 ~ (v/v) of N2, 8 ~ (v/v) of CO2, 8 ~ (v/v) of H2 at 37 C.

The abbreviation '~ (v/v)' represents a percentage expressed in terms of volume per volume. The abbreviation '~ (v/m)' represents a percentage expressed in terms of volume by mass.
The abbreviation '~ (m/v)' represents a percentage expressed in terms of mass per volume. The abbreviation '~ (m/m)~
represents a percentage expressed in terms of mass by mass.

This strain is not thermophilic. It exhibits a normal development after incubation on the gelose medium B at 20 C, 30 C, 37 C and 41 C.

The strain does not produce gas from glucose.

The strain uses azelate, caprate, citrate, glucose, gluconate, CA 02202~3 1997-04-11 L-arginine, L-histidine, betaine and geraniol. The strain does not use adipate, phenylacetate, L-arabinose and maltose. It does not hydrolyze gelatine, starch and esculin.

The strain belongs to the genus Pseudomonas and to the RNA-I
group.

The biochemical characteristics clearly differentiate the Pseudomonas wisconsinensis strain and, in particular, the Pseudomonas wisconsinensis T 92.677/1 strain, from a Pseudomonas mendocina strain, a Pseudomonas ~seudoalcaliqenes strain, a Pseudomonas alcaliqenes strain and from a Pseudomonas stutzeri strain. This will be clearly demonstrated in Table 1 which sets out the main biochemical characteristics of these S strains.

CA 02202~3 1997-04-11 Table 1 Characteristics Pseudomonas wisconsinensis stutzeri mendo- alcali- ~seudoalcali-T 92.677/1 cina aenes qenes Dimensions ~m x 0.5-0.7 0.7-0.8 0.7-0.8 0.5 0.7-0.8 ~m 1.5-4.0 1.4-2.8 1.4-2.8 2.0-3.0 1.2-2.5 Yellow pigment + - + d Starch hydrolysis - +
Arginine dehydrolase - - + + d Use of glucose + + +
Use of gluconate + d + - d Use of geraniol + - +
Use of L-histidine + - + d d Use of L-arginine + - + + +
Use of betaine + - + - +

+ = test positive in respect of 90 % or more of the strains - = test negative in respect of 90 % or more of the strains d = test positive in respect of more than 10 % but less than 90 % of the strains The isolated bacteria thus belongs to the genus Pseudomonas; no known species could be determined.

The strain of Pseudomonas wisconsinensis T 92.677/1 was submitted to the collection entitled BELGIAN COORDINATED COLLECTIONS OF
MICROORGANISMS (LMG culture collection) under number LMG P-15151 on 12th October, 1994.

CA 02202~3 1997-04-11 Example 2 Production of the lipase by the Pseudomonas wisconsinensis T
92.677/1 strain The Pseudomonas wisconsinensis T 92.677/1 strain was cultured at 30 C for 24 hours in a Petri dish containing the gelose medium B.

Then, from this culture, a culture is prepared in 25 ml of a liquid medium C. The medium C contains 10 g/l of tryptone (Difco), 5 g/l of yeast extract, 10 g/l of NaCl, the pH of the medium is adjusted to 7.0 with NaOH 0.lN, the medium is sterilized at 121 C for 30 minutes. The culture is produced at 30 C under orbital agitation at a rate of 200 revolutions per minute, with an amplitude of about 2.54 cm.

After an incubation of 16 hours, this culture is introduced into a 20 litre capacity fermentation vessel which contains 13 lites of the sterillzed liquid medium D.

The medium D contains 2.5 g/l of K2HPO~, 2.5 g/l of KH2 PO~
1 g/l of MgSO4.7H2O, 2 g/l of (NH~)2SO~, 2 g/l of (NH2)2CO, g/l CaCl2, 20 g/l of soya bean meal, 2 g/l of yeast extract, 20 g/l of glucose, 5 g/l anti-foam oil (Mazuol, from Mazes Chemicals). The pH is adjusted to 7.4 (using ordinary phosphoric acid and ordinary caustic soda) prior to and after sterilization in the fermentation vessel (30 minutes at 121 CA 02202~53 Iss7-04-C). The glucose is sterilized separately at pH 4.0 (pH
adjusted with ordinary phosphoric acid) at 121 C for 30 minutes. The medium is sterilized in the fermentation vessel at 121 C for 30 minutes.

The culture in the fermentation vessel is produced at a temperature of 23 C, at a pressure of 0.1S x 105 Pa (Pa =
Pascal) (0.15 bar), with ventilation at 0.3 VVM (volume of air per volume of culture medium per minute), with an axial agitation of 200 revolutions per minute, the control of the dissolved oxygen being fixed at 10 ~ (v/v) by controlling the agitation rate.

After 24 hours of fermentation, the enzymatic activity of the culture thus obtained is measured, using the following method.

The hydrolysis of the triolein is quantified by neutralizing the fatty acids freed by the action of the lipase. This step is carried out with the aid of an automatic titrating apparatus, an apparatus which maintains the pH at a constant at a set value by adding NaOH 0.01 N.

A lipase unit (LU) is defined as the quantity of enzyme which catalyses the freeing of one micromol of fatty acid per minute under the standard test conditions described above.

10 g of triolein (Roth 5423.1) and 10 g of gum arabic (Fluka 51200) are mixed in 100 ml of distilled water. This mixture CA 02202~3 1997-04-11 is emulsified by means of a Ultra-Turrax mixer at 13500 revolutions per minute (axial agitation) three times for 5 minutes, maintaining the mixture under nitrogen and in an ice bath.

A dilution buffer, which contains 2.34 g/l of NaCl, 2.94 g/l of CaCl2.2H2O and 0.61 g/l of tri(2-amino-2-hydroxymethyl-1,3-propane diol), is prepared.

An automatic titrating apparatus, which is equipped with a burette containing NaOH 0.01N, a temperature sensor and a pH
probe and with a thermostat-controlled reactor, is used.

A small magnetic agitation bar, 10 ml of triolein emulsion and 20 ml of dilution buffer are introduced into the thermostat-controlled reactor. The pH of the solution thus obtained is adjusted to 9.5 with NaOH 0.lN. Then, 0.5 ml of the sample to be tested and containing the lipase are introduced, the sample possibly having been diluted such that it contains only a maximum of 5 LU. The pH is controlled with NaOH 0.01N for the first two minutes. Subsequently, the consumption of soda between 2 and 4 minutes is recorded, while maintaining the pH
constant (volume of soda consumed between 2 and 4 minutes = Vl in ~l).

Subsequently, the same test is carried out, but the sample containing the lipase is replaced by 0.5 ml of dilution buffer (volume of soda consumed between 2 and 4 minutes = V2 in ~l).

CA 02202~3 lss7-04-ll One lipase unit (LU) is determined as follows:
1 LU/ml = (V1-V2) x possible dilution of the sample x 10 According to this method, a lipase activity is detected in the culture.

Example 3 Preparation of a concentrated lipase solution The pH of the culture, as obtained upon completion of the fermentation of Example 2, is adjusted to a pH of 8, using the concentrated caustic soda 10 N.

Then, 1 ~ (v/v) of Triton X-114 (SERVA 37214) is added to this culture. The mixture is stirred gently at 15 C for 2 hours.

Subsequently, 1 ~ (v/v) of Optifloc FC205 (SOLVAY) in the form of a 10 ~ (v/v) solution is added to the mixture. The mixture is stirred gently at 15 C for 1 hour.

The mixture is centrifuged for 15 minutes at 9000 revolutions per minute (BECKMAN J21, rotor JA10) at a temperature of 4 C.
The supernatant from the centrifugation is retained.

The centrifugation supernatant is heated to 40 C for 5 minutes. A separation of the phases is observed. The top phase is removed. 35 ~ (v/v) of acetone at 4 C is added to CA 02202~3 1997-04-11 the bottom phase. The suspension is incubated at 4 C for 15 minutes with moderate stirring.

The suspension is then centrifuged at 9000 revolutions per minute (BECKMAN J21, rotor JA10) for 15 minutes at a temperature of 4 C. The supernatant from the centrifugation is retained.

Acetone is added to the centrifugation supernatant at 4 C
until an acetone concentration of 65 ~ (v/v) is obtained. The mixture is incubated at 4 C for 16 hours.

Subsequently, the mixture is centrifuged at 9000 revolutions per minute (Beckman J21, rotor JA10) for lS minutes at a temperature of 4 C. The precipitate from the centrifugation is retained and is suspended in 150 ml of a buffer (pH 7) which contains 5 mM of Brij 58 (ICI), 25 mN of CaCl2 and 20 mM of Tris.

The suspension, which contains the precipitate, is then centrifuged at 9000 revolutions per minute (Beckman J21, rotor JA10) at 4 C for 15 minutes. The supernatant from the centrifugation which forms a concentrated lipase solution is retained.

CA 02202~3 1997-04-11 Example 4 Purification of the lipase In order to purify the concentrated lipase solution as obtained in Example 3, the purification method which employs a hydrophobic interaction chromatography is used, followed by the purification method which employs a molecular filtering chromatography.

While following the direction for use as specified by the supplier (Pharmacia) with regard to the hydrophobic interaction chromatography column, a 16/10 Phenyl-Sepharose Pharmacia Hiload column (Ref. 17-10~5-01) is charged with 140 ml of the concentrated lipase solution as obtained in Example 3.

As the equilibrium buffer, a 20 mM phosphate buffer at a pH of 7.2 is used; as the elution buffer, a 20 mM phosphate buffer at a pH of 7.2 and containing 30 ~ (v/v) of isopropanol is used. The flow rate is fixed at 1.5 ml per minute.

The lipase with the eluted fraction is collected with the phosphate buffer containing the isopropanol.

The enzymatic activity of the fraction is measured according to the method described in Example 2.

The eluted fraction containing the lipase is diafiltered in CA 02202~3 lss7-04-ll an Amicon cell provided with a YM10 membrane, with 10 volumes of a buffer (pH 7) containing 25 mM CaCl2 and 20 mM Tris.

The diafiltered fraction is then concentrated to 0.5 ml by ultrafiltration by means of the same Amicon cell which is provided with a YM10 membrane.

Subsequently, the concentrated fraction (0.5 ml) is injected into a molecular filtering chromatography column (Pharmacia Superdex 75 HR 10/30 column, Ref. 17-1047-01). The separation is initiated by an input of 0.5 ml per minute of a buffer (pH
7) containing 25 mM CaCl2 and 20 mM Tris.

Three absorption peaks at 280 nm are separated. The lipase corresponds to the first absorption peak at 280 nm. The corresponding fraction, which contains the purified lipase, is retained.

Example 5 Determination of the N-terminal sequence The method descri~ed by Vandekkerhove J. et al., Eur. J.
Biochemistry, 152 9 (1985) is used to determine the N-terminal sequence of the lipase.

The fraction containing the purified lipase as obtained in Example 4 is used.

CA 02202~3 1997-04-11 The N-terminal sequence (SEQ ID NO:1) is the following:
Asn Tyr Thr Lys Thr Lys Tyr Pro Ile Val Leu Val His Gly Val Thr Gly Phe Asn Thr Ile Gly Gly Leu This sequence differs from the N-terminal sequences of the other lipases secreted by the other strains of Pseudomonas, which sequences are published, in particular, in Enzyme Microb.
Technol., 1993 (3), pages 634-645.

.

Bxample 6 Amino acid sequence The amino acid sequence of the lipase according to the present invention is determined indirectly from nucleotide sequence (SEQ ID NO:5) of the gene which codes for said lipase, the ~ethod whereby it is obtained being described in Example 17.
This is carried out by means of the computer program IntelliGenetics Suite Software for Molecular Biology (Release No. 5.4) from IntelliGenetics, Inc., USA.

Figure 2 (Figures 2a and 2b) show the nucleotide sequence (SEQ
ID NO:5) of the coding part of the lipase as well as its translation into amino acids (SEQ ID NO:6).

The lipase is synthesized in the form of a precursor. The precursor of the lipase contains 308 amino acids (SEQ ID NO:7).

CA 02202~3 1997-04-11 The nucleotide sequence (SEQ ID NO:5) coding for the precursor of the lipase, as well as its translation into amino acids ~SEQ
ID NO:6) is identified.

The presequence of the synthesized lipase is identified in the form of a precursor. It is a sequence of 22 amino acids (SEQ
ID NO:10) which constitutes the signal peptide. The corresponding nucleotide sequence (SEQ ID NO:8) is identified.

Subsequently, the amino acid se~uence of the mature lipase is identified. The mature lipase contains 286 amino acids (SEQ
ID NO:4).

Figure 1 (Figure la and Figure lb) represents the nucleotide sequence (SEQ ID NO:2) coding for the mature lipase, as well as its translation into amino acids (SEQ ID NO:3).

Example 7 Amino acid distribution The distribution of amino acids in the mature lipase, determined from the amino acid sequence (SEQ ID NO:4) of the lipase (Example 6) is set out in Table 2.

Symbol Amino Acids Number % mol (relative molecular mass~
A alanine 28 9.790 B aspartic acid 0 0 C cysteine 2 0.699 D aspartic acid 10 3.497 E glutamic acid 7 2.448 F phenyl alanine 7 2.448 G glycine 35 12.238 H histidine 10 3.497 isoleucine 14 4.895 K Iysine 9 3.147 L leucine 22 7.692 M methionine 1 0.350 N asparagine 25 8.741 P pr~line 11 3.846 Q glutamine 6 2.098 R arginine 13 4.545 S serine 24 8.392 T threonine 18 6.294 V valine 29 10.140 W tryptophan 5 1.748 X unknown o o Y tyrosine 10 3.497 Z glutamine 0 0 glutamic acid Example 8 Calculation of relative molecular mass The relative molecular mass of the lipase is estimated, by calculation, from the amino acid sequence of the mature form of the lipase and from the amino acid sequence of the lipase CA 02202~3 1997-04-11 including the signal peptide, as described in Bxample 6.

From the calculation, a relative molecular mass of 30093 Daltons is deduced in respect of the mature form, and a relative molecular mass of 32365 Daltons in respect of the form comprising the signal peptide.

Example 9 Determination of the relative molecular mass of the lipase bv SDS-PAGE analysis .

A polyacrylamide gel electrophoresis under denaturing conditions (SDS-PAGE) is carried out on the fraction which contains the purified lipase as obtained in Example 4. The gel system used is the system known as PHASTSYSTEM of PHARMACIA LKB
BIOTECHNOLOGY (File of use No. 110), with the gels containing a polyacrylamide gradient of 10-15 ~ (v/v). The conditions of the electrophoresis are those specified by the supplier. As reference, the molecular mass markers PHARMACIA LMW (Low Molecular Weight), reference 17-0446-01 are used. The markers used are phosphorylase b (94 kD), albumin (67 kD), ovalbumin (43 kD), carboanhydrase (30 kD), trypsin inhibitor (20.1 kD~
and alpha-lactalbumin (14.4 kD).

The gel thus obtained shows that the fraction which contains the purified lipase as obtained in Example 4 is pure.

A Coomassie blue staining (Fast Coomassie staining, Pharmacia, CA 02202~3 1997-04-11 file of use No. 200) of the gel shows a polypeptide having a relative molecular mass of about 30 (+/- 0.5) kD.

Example 10 Bstimation of the iso-electric point The iso-electric point of the lipase is calculated on the basis of the amino acid sequence of the mature form of the lipase and on the basis of the amino acid sequence of the lipase, including the signal peptide, as described in Example 6.

An iso-electric point of 9.95 is deduced for the mature form and 10.12 for the form comprising the signal peptide.

Exam~le 11 Determination of the optimal pH of the li~ase The enzymatic activity of the lipase at different pH values is measured according to the method described in Example 2. Thus, the hydrolysis of the substratum (triolein emulsion) is determined after the action of the lipase at different pH
values, all the other conditions being identical to the standard conditions, as described in Example 2, i.e. at a temperature of 30 C and a duration of two minutes.

The fraction containing the purified lipase as obtained in Example 4 is used.

CA 02202~3 l997-04-ll The results are set out in Table 3.

Table 3 Temperature Relative Activity C

During the test, the maximum enzymatic activity was measured for the specimen set at a pH o~ about 9.5 and at a temperature of about 55 C. By that very fact, a relative enzymatic activity of 100 ~ was thus allocated to that sample.

This Example shows that the lipase according to the invention has an optimal enzymatic activity measured at a pH of 9.5 within a temperature range of between about 40 and about 60C.

CA 02202~3 l997-04-1l This Example also shows that the lipase according to the invention develops an optimal enzymatic activity, measured at a pH of 9.S, at a temperature of about 55 C.

The lipase according to the invention develops an enzymatic activity of more than 50 ~ of the maximum enzymatic activity in a temperature range of about 40 to 60 C, for a pH of about 9.5.

Exam~le 12 Determination of the oP~imal pH of the lipase The enzymatic activity of the lipase is measured at different pH values according to the method described in Example 2.

Thus, the hydrolysis of the substratum (triolein emulsion) is determined after the action of the lipase at different pH

values, all the other conditions being identical to the standard conditions, as described in Example 2, i.e. at a temperature o~ 30 C and a duration of two minutes.

The fraction containing the purified lipase as obtained in Example 4 is used.

The results are set out in Table 4.

CA 02202~3 1997-04-11 Table 4 pH Relative Activity 7.0 17 ~.0 100 9,O 100 9.5 100 10.O 91 10.5 71 11.0 72 12.0 47 This Example shows that the lipase according to the invention develops an optimal enzymatic activity, measured at a temperature of about 30 C, in a pH range of between about 8 and 10.

During the test, the maximum enzymatic activity was measured for the sample set at a pH of about 9.5 and a temperature of about 30 C. By this very fact, a relative enzymatic activity of 100 ~ was thus allocated to this sample.

The lipase according to the invention develops an enzymatic activity of more than about 90 ~ of the maximum enzymatic activity in a pH range between about 8 and about 10, at a temperature of about 30 C.

CA 02202~3 1997-04-11 The lipase according to the invention develops an en~ymatic activity of more than about 70 ~ of the maximum enzymatic activity in a pH range of between about 8 and about 11, at a temperature of about 30 C.

Example 13 Stability of the lipase with respect to ~he temperature The part of the fraction which contains the purified lipase, as obtained in Example 4, at a pH of 10 and at 55 C, is incubated in an aqueous buffer with a hardness of 15 (the buffer containing calcium chloride 1.98 mM, magnesium chlbride 0.69 mM and sodium bicarbonate 2.5 mM).

At regular intervals, as shown in detail in Table 4 (incubation time in minutes), a sample is taken and its enzymatic activity is measured according to the method described in Example 2.

The results are set out in Table 5.

CA 02202~3 1997-04-11 Table 5 Incubation time - minutes Relative Activity -o 100 The deactivation constant (k) over the period 0-260 minutes is 0.000333 min-l. [The deactivation constant k is obtained according to the definition ln (At/Ao) = -k.t, t being the incubation time, Ao the activity relative to the incubation time 0 and At being the activity relative to the incubation time t.]

During this test, the maximum enzymatic activity was measured for the sample at the time 0. By this very fact, a relative CA 02202~3 1997-04-11 enzymatic activity of 100 ~ was thus allocated to this sample.

It is concluded, from this Bxample, that the lipase according to the invention shows a relative enzymatic activity of less than 55 ~ measured after an incubation of 160 minutes at a temperature of 55 C and at a pH of 10 in a buffer solution having a hardness of 15. It shows a relative enzymatic activity of at least 70 ~ measured after an incubation of 80 minutes under the same conditions.

Example 14 Use of a deterqent composition containinq the lipase A piece of white woven fabric (R. Hoppe GmbH), of cotton (65 ~) and polyester (35 ~) and measuring 10 cm by 10 cm, is prepared and impregnated with bacon fat and Sudan red dye. The fabric is impregnated as follows.

A homogeneous solution of Sudan red 7B (SIGMA Cat. No. F 1000) and bacon fat (Laru GmbH) is prepared by adding 0.1 ~ (m/m) of Sudan red dye to the bacon fat The mixture is heated to 90 C until the Sudan red has dissolved completely. A roll of fabric is immersed in the solution of Sudan red and bacon fat maintained at 90 C and is continuously displaced in this solution at a rate of 0.5 m/minute. Subsequently, the fabric is dried by passing it through a roller mangle under a constant linear pressure. The fabric thus impregnated contains 31.5 ~
(m/m) of fats. The impregnated fabric is kept at -18 C for CA 02202~3 1997-04-11 22 hours until the fats are completely crystallized. The fabric is cut into pieces of 10 cm by 10 cm. The pieces of impregnated fabric are then stored at -18 C in the dark.

A liquid detergent composition containing 4 g/l of a solld washing powder (Eurocompact powder from UNILEVER) and diverse lipase concentrations of 500, 1000 and 2000 LU/l is prepared in water having a hardness of 15 (water which contains calcium chloride 1.98 mM, magnesium chloride 0.69 mM and sodium bicarbonate 2.5 mM). The initial pH of the liquid detergent composition is about 10. Use is made of the lipase, as obtained in Example 4, and this is diluted with water having a hardness of 15, in order to obtain the desired concentrations.

The fabric impregnated with the bacon fat and the Sudan red dye is then washed with 200 ml of the liquid detergent composition in a 250 ml reactor. The washing takes place at 35 C for 45 minutes with an agitation of 40 r.p.m. (to and fro agitation in 20-second cycles). After washing, the fabric is rinsed three times with 200 ml of distilled water, then dried at 22 C between two sheets of paper for 24 hours.

Subsequently, the reflectance (RL) is determined at 460 nm of the dried fabric by means of a colour measuring instrument (Tricolor LFM 3).

.

This test is repeated three times, i.e. the washing cycle, CA 02202~3 1997-04-11 using the liquid detergent composition which contains the lipase, and the rinsing cycle are then repeated three times on the same fabric sample without impregnating it with Sudan red and bacon fat between cycles. Upon completion of each cycle, the reflectance at 460 nm of the dried fabric is determined.

An exactly identical test is carried out with a detergent composition which does not contain lipase. At the end of each cycle, the reflectance (RO) at 460 nm of the dried fabric is determined.

The washing performance is defined in ~ as the difference between the reflectance (RL) obtained with washing in the presence of lipase and the reflectance (RO) obtained with washing in the absence of lipase, i.e. RL - RO expressed in ~.

The results of this Example show that the lipase according to the invention is effective at a low dose of enzyme in the detergent composition.

The results of this Example also show that the lipase according to the invention is particularly effective starting with the second washing cycle, and that it retains an enhanced effectiveness after three and four washing cycles.

In particular, the lipase is particularly effective at the concentration of 500 LU/l after three washing cycles.

CA 02202~3 1997-04-11 In addition, the lipase is found to be particularly effective at the concentration of 1000 LU/l from the first washing cycle.
The lipase is found to be most particularly effective at the concentration of 1000 LU/l during all the washing cycles.

Example 15 Cloning of the qene of Pseudomonas wisconsinensis T 92.677/1 gene 1. Extraction of the chromosomal DNA from the Pseudomonas wisconsinensis T 92.677/1 strain The DNA genome is prepared by following the method described by WILSON, 1990, Current Protocols in Molecular Biology, Vol.
1 (Unit 2.4), with the modifications described below.

Using the culture as obtained in Example 2, a culture of 200 ml of the Pseudomonas wisconsinensis T 92.677/1 strain is produce-d in an LB growth medium at 37 C for 16 hours. The LB growth medium is the following: 10 g/l of TR~PTONE (DIFCO), 5 g/l of yeast extract, 10 g/l of NaCl.

The culture obtained is Gentrifuged !soRvALL R~ SC Plus centrifuge, SS-34 rotor) at 2000 G for 15 minutes. The centrifugation residue thus obtained is taken up in a solution which contains 9.5 ml of the TE buffer at a pH of 8.0; 500 ~l of a solution of SDS (sodium dodecyl sulphate) at 10 ~ (m/v);
and 50 ~l of a K proteinase solution (marketed by BOEHRINGER, of Mannheim) at 20 mg/ml (prepared extemporaneously).

CA 02202~3 1997-04-11 The TE buffer (pH 8.0) is composed of 10 mM TRIS-HCl (TRIS-HCl = tris(hydroxymethyl)amino methane)-HCl) and 1 mM EDTA
(ethylene diamine tetra-acetic acid).

The suspension thus obtained, containing the centrifugation residue, is incubated at 65 C for 90 minutes.

Subsequently, 1.8 ml of a solution of NaCl 5 M and 15 ml of a CTAB/NaCl solution at 10 ~ (m/v) are added to this suspension (CTAB = cetyltrimethyl ammonium bromide, NaCl at 0.7 M). A
lysate is obtained.

Using this lysate, an extraction is carried out with 15 ml of a mixture of chloroform/isoamylic alcohol (3-methyl-1-butanol) 24/1 under the conditions and according to the procedures described in Molecular Cloninq - a laboratory manual SAMBROOK, FRITSCH, MANIATIS - Second Edition, 1989, page E.3, until an neat interface is obtained, as is described therein.

0.6 volumes (v/v) of isopropanol are added to the aqueous phase recovered, and a viscous suspension is obtained.

The DNA contained in the viscous suspension is precipitated according to the method described in SAMBROOK et al., 1989, p.
9.18. The precipitated DNA is wound around a Pasteur pipette, then washed three times with 70 ~ (v/v) of ethanol. The washed DNA is air-dried for 5 minutes at ambient temperature. The CA 02202~3 1997-04-11 dried DNA is suspended in 2.5 ml of TE buffer at a pH of 8Ø

2. Construction of a ~enomic library of Pseudomonas wisconsinensis T 92.677/1 Using the suspension obtained as above, the chromosomic DNA 915 ~g) of Pseudomonas wisconsinenSis T 92.677/1 is cleaved partially by the restriction enzyme Sau3AI. The method applied is that of successive dilution of the restriction enzyme and the restriction conditions are those described in SAMBROOK et al., 1989, pages 5.28-5.32.

Cleavage is partially inhibited by the addition of 1 ~l of EDTA
0.5 M at a pH of 8.0 in the presence of ice.

Agarose gel electrophoresis is used to determine the fractions, obtained after cleavage, which contain fragments having dimensions of between 20 and 40 kpb.

All the fragments thus obtained are then subjected to a precipitation process according to the method described in SAMBROOK et al., 1989, p. 9.18.

The DNA fragments are then ligated according to the method described by SAMBROOK et al., 1989, pages 1.68-1.69, with the pRG930 plasmid (750 ng), first cut at the BamHI site, as described by SAMBROOK et al., 1989, pages 1.60-1.61. A
collection of plasmids, which are named pRG930::WI, is CA 02202 j j3 1997 - 04 -11 obtained.

The process to obtain the pRG930 plasmid is described in Molecular Plant-Microbe Interactions, 1992, Vol. 5 (3) pages 228-234.

The ligation thus obtained is used for the transfection of the cells of E. coli HB101 (PROMEGA), by using the kit sold under the name of GIGAPACK II PACKAGING EXTRACT KIT (STRATAGENE) and following the manufacturer's recommendations regarding the use thereof.

The transfected cells of E. coli HB101 are cultured in a Petri dish containing the gelose LB medium, 25 ~g/ml of streptomycin and 50 ~g/ml of spectinomycin, for about 24 hours at 37 C.
A collection of transfected strains, which are referred to as E. coli HB101 (pRG930::WI) is obtained.

Using 12 randomly selected colonies of E. coli HB101 (pRG930::WI), the DNA fragments are isolated according to the method described in SAMBROOK et al., 1989, page 1.85.

A restriction analysis of these DNA fragments is carried out (SAMBROOK et al., 1989, page 1.85) after cleavage with the restriction enzymes EcoRI and PstI.

This analysis indicates that the dimensions of the inserted fragments present in the pRG930::WI plasmids is between about CA 02202~3 1997-04-11 20 and 30 kpb (kpb = 1000 pairs of bases) and that these fragments differ from one another. This indicates that the genomic library which has been set up is representative.

1500 colonies of E. coli HB101 (pRG930::WI) are then cultured in a Petri dish containing the gelose LB medium, 25 ~g/ml of streptomycin and 50 ~g/ml of spectinomycin, for 24 hours at 37 C. These 1500 colonies of E. coli HB101 (pRG930::WI) constitute the genomic library.

3. Obtaininq a chromosomic fraqment containinq the qçne of the Pseudomonas wisconsinensis T 92.677/1 lipase In order to establish the nucleotide sequence of a probe capable of screening the genomic library, the N-terminal sequence of the Pseudomonas wisconsinensis T 92.677/1 lipase, as obtained in Example 5, is taken as the initial reference base.

In order to raise the ambiguity maximum in the translation of the amino acids toward the nucleotides, on the one hand, the nucleotide sequences of a plurality of lipases produced by different strains of Pseudomonas and published in Gilbert J.
et al., Enzyme Microbioloqical Technoloqy, 1993, 15, pp. 634-645, and, on the other hand, the property known by the name "codon usage" of the Pseudomonas aeruqinos strain, published in West S. et al., Nucleic Acid Research, 1988, 16, pp. 9323-9335, are taken into account.

CA 02202 j j3 1997 - 04 -11 On the basis of these elements, the sequence of a synthetic oligonucleotide of 72 pb (pb = base pairs) is established.
This synthetic oligonucleotide is prepared according to the method described in BEAUCAGE et al. (1981), Tetrahedon Letters, 22, pp. 1859-1882, and using ~-cyanoethyl phosphoro-amidites [sic.] in a CYCLONE SYNTHESIZER apparatus from BIOSEARCH.

The sequence of this synthetic oligonucleotide is the following: SEQ ID NO:ll 5' - AACTACACCAAGACCAAATACCCCATCGTGCTGGTCCA -- CGGCGTGACCGGCTTCAACACTATCGGCGGGCTC - 3' This synthetic oligonucleotide is marked at its termination by means of ~2p ATP with a kinase polynucleotide T4 enzyme, following the method described in the SEQUITHERM CYCLE
SEQUENCING KIT (BYOZYME).

A screening of the genomic library is carried out by the method referred to as "colony blot" (AMERSHAM), using the synthetic oligonucleotide as prepared above as the probe.

The 1500 colonies of the genomic library (E. coli HB101 (pRG930::WI)) are cultured for 18 hours at 37 C on membranes referred to as "hybond-N~" (AMERSHAM), following the method given by the manufacturer.

The membranes (400 m2) are placed in plastic bags containing 45 ml of prehybridization solution.

CA 02202~3 Iss7-04-The prehybridization solution contains 15 ml of 20X SSC (3 M
NaCl and 0.3 M o sodium citrate, pH of 7.0), 5 ml of Denhardt solution and 500 ~g of the DNA of denatured and fragmented salmon sperm (AMERSHAM).

500 ml of the Denhardt solution contain 5 g of FICOL~ of the 400 type (PHARMACIA), 5 g of polyvinyl pyrrolidone and 5 g of bovine serum albumin.

The membranes placed in the plastic bags are incubated at 68 C in a water-bath under stirring (100 revolutions per minute, amplitude of about 2.54 cm) for 4 hours.

The membranes are then incubated at 68 C with a hybridization solution in a water-bath under stirring (100 revolutions per minute, amplitude of about 2.54 cm) for 18 hours;

The hybridization solution is prepared by mixing 5 ml of the prehybridization solution heated to 68 C and the marked synthetic oligonucleotide, and, having been incubated in the water-bath for 5 minutes, the final concentration of the synthetic nucleotide is 0.3 pMol.

The membranes are subsequently collected. The membranes are then washed with a solution which contains 100 ml of 2X SSC
(0.3 M NaCl and 0.03 M of sodium citrate, pH of 7.0) and 0.1 (m/v) of SDS for 5 minutes at ambient temperature.

-CA 02202~3 1997-04-11 The washed membranes are then dried between two sheets of absorbent paper. The dried membranes are covered with a foodstuff-quality transparent plastics sheet. They are then subjected to X-ray autoradiography (AMERSHAM).

The Pseudomonas wisconsinensis T 92.677/1 strain is used as positive control and the E. çoli HB101 and E. çoli HB101 (pRG930) strains are used as negative control.

The E. coli HB101 (pRG930) strain was obtained by the transformation method described in Moleçular Cloninq, a laboratory Manual - MANIATIS et al., 1982, Cold Spring Harbor Laboratory, pp. 150-151, using the E. coli HB101 strain and the pRG930 plasmid.

A clear and strong signal is observed for the wild strain of Pseudomonas wisconsinensis T 92.677/1 and no signal is observed for the E. coli HB101 and E. coli HB101 (pRG930) strains. The screening of the genomic library displays 80 colonies which give a signal.

This is con~irmed by a fresh hybridization test.

A colony, which presents a strong signal, from the genomic library is isolated and cultured in a Petri dish containing the gelose LB medium, 25 ~g/ml of streptomycin and 50 ~g/ml of spectinomycin, for 24 hours at 37 C. This colony is CA 02202~3 1997-04-11 designated as E. coli HB101 (pRG930::WI12).

A hybridization test is carried out afresh with the E. coli HB101 (pRG930::WI12) colony, in order to confirm the results obtained.

Example 16 Analysis of the pRG930::WI12 plasmid present in the E. coli HB101 (pRG930::WI12) strain - Analysis by ~he "Southern Blot"
method The DNA is isolated from the E. coli HB101 (pRG930::WI12) strain, obtained in Example 15, according to the method described by SAMBROOK et al., 1989, pp. 1.25-1.28, and a restriction analysis is carried out using the EcoRI restriction enzyme. The DNA fragments obtained are separated by agarose gel electrophoresis, according to the method described in SAMBROOK et al., 1989, pp. 6.01-6.19.

This analysis demonstrates that the DNA fragment inserted in the pRG930::WI12 plasmid has a dimension of about 27 kpb.

The DNA is then transferred to a membrane known as "hybond-N~"
(AMERSHAM) and hybridization is carried out according to the method indicated by the manufacturer, as illustrated in Example 15. The pRG930 plasmid is used as the neyative control.

A single band is observed giving a hybridization signal with CA 02202~3 lss7-04-ll the synthetic oligonucleotide (SEQ ID NO:11) on the gel electrophoresis. The fragment carried by this band has a dimension of about 24.5 kpb, it is tied to the pRG930~vector.

Example 17 Nucleotide sequence of the çompletç qene which codes for the Pseudomonas wisconsinensis T 92.677/1 lipase 1. Obtaininq the Pseudomonas wisconsinensis RC13 strain A restriction analysis of the pRG930::WI12 plasmid is carried out, using the EcoRI restriction enzyme. The DNA fragments obtained are separated by agarose gel electrophoresis.

An analysis is carried out by the Southern Blot method, as described in Example 16.

This shows that the fragment inserted in the pRG930::WI12 plasmid is formed, on the one hand, by 4 fragments which together have a dimension of about 18.5 kpb and, on the other hand, by a fragment attached to the pRG930 vector. This fragment has a dimension of about 8.5 kpb.

The 8.5 kpb fragment, attached to the pRG930 vector, gives a hybridization signal with the synthetic oliyonucleotide (SEQ
ID NO:ll), the 4 other fragments give no signal.

The 8.5 kpb fragment attached to the pRG930 vector is then ligated on itself according to the method described by SAMBROOK

CA 02202~3 1997-04-11 et al., 1989, pp. 1.68-1.69. The plasmid pRG930::WI13 is obtained.

The ligation thus obtained is used to transform the E. coli DH5~ (GIBCO) cells, as described in SAMBROOK et al., 1989, pp.
1.82-1.84.

A colony of E, coli DH5~ (pRG930::WI13) is obtained and is isolated and cultured in a Petri dish containing the gelose LB
medium, 25 ~g/ml of streptomycin and 50 ~g/ml of spectinomycin, for about 24 hours at 37 C.

A map of the partial restriction of the pRG930::WI13 plasmid is established, using the method described in Molecular Cloninq, a laboratory Manual - MANIATIS et al., 1982, Cold Spring Harbor Laboratory, pp. 374-379, and using the ClaI, EcoRI, NcoI, SalI, HindIII, BglII, XhoI, BamHI, SmaI, SacI, SacII, RpnI, SphI, XbaI, EcoRV and SpeI restriction enzymes.

2. Identification of the nucleotide se~uence of the lipase A restriction analysis of the pPRG930::WIl3 [sic.~ plasmid is carried out using the PstI restriction enzyme. The DNA
fragments obtained are separated by agarose gel electrophoresis.

An analysis according to the Southern Blot method is carried out, as described in Example 16.

CA 02202~3 1997-04-11 This shows that the fragment inserted in the pRG930::WI13 plasmid is formed, on the hand, by 5 fragments and, on the other hand, by one small fragmen~. This small fragment has a dimension of about 2.5 kpb.

The 2.5 kpb fragment gives a hybridization signal with the synthetic oligonucleotide (SEQ ID N0:11), while the other 5 fragments do not give a signal.

The 2.5 kpb fragment is ligated with the pPRG930 [sic.] vector according to the method described by SAMBROOK et al., 1989, pp.
1.68-1.69. The plasmid pRG930::WI14 is obtained.

From the pRG930:WI14 plasmid, the 2.5 kpb fragment is inserted in the pBLUESCRIPT plasmid.

The pBLUESCRIPT plasmid is obtainable from the company STRATAGENE.

The plasmid pBLUESCRIPT::WI14 is obtained.

The sequence of the 2.5 kpb fragment inserted in the pBLUESCRIPT::WI14 plasmid is obtained using the SEQUITHERM
CYCLE SEQUENCING KIT (BIOZYM) and following the method specified by the manufacturer.

In order to complete and verify the nucleotide sequence CA 02202~3 1997-04-11 obtained, the above Example is repeated with the following modification. The restriction analysis of the pPRG930::WI14 plasmid is carried out, successively using the SalI, KpnI or SacII restriction enzymes, instead of the PstI restriction enzyme.

The nucleotide sequence of the Pseudomonas wisconsinensis T
92.677/1 lipase is identified. The amino acid sequence and the nucleotide sequence (SEQ ID N0:2) coding for the mature lipase, as well as its translation into amino acids (SBQ ID
N0:3), are given in Figure 1 (Figures la and lb).

It is shown that the first amino acids of the sequence of the lipase, thus identified, correspond to the N-terminal sequence determined in Example 5.

The lipase is synthesized in the form of a precursor. The precursor contains 308 amino acids (SEQ ID NO:7). The nucleotlde sequence (SEQ ID N0:5) coding for the precursor of the lipase is identified, as is its translation into amino acids (SEQ ID NO:6).

The precursor contains the sequence of 286 amino acids (SEQ
ID N0:4) of the mature lipase and the sequence of 22 amino acids (SEQ ID N0: 10) of the presequence.

The sequence of the mature lipase is preceded by a presequence.
It is an additional sequence of 22 amino acids (SEQ ID NO:10).

The corresponding nucleo~ide sequence (SEQ ID NO:8) is identified, as is its translation into amino acids (SEQ ID
NO:9). This presequence codes for the signal peptide of the Pseudomonas wisconsinensis T 92.677/1 lipase.

CA 02202~53 1997-04-11 LIST OF SEQUENCES
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: SOLVAY (Société anonyme) (B) STREET: rue du Prince Albert, 33 (C) TOWN: Brussels (E) COUNTRY: Belgium (F) POSTAL CODE: 1050 (ii) TITLE OF THE INVENTION: Lipase, micro-organism producing it, process to prepare said lipase, and uses thereof (iii) NUMBER OF SEQUENCES: 11 (iv) COMPUTER-LEGIBLE FORMAT:
(A) TYPE OF SUPPORT: Floppy disc (B) COMPUTER: IBM PC compatible (C) USER SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (OEB) (2) INFORMATION FOR THE SEQ ID NO: 1:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 24 amino acids (B) TYPE: amino acid (C) NUMBER OF STRANDS:
(D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: N-terminal (vi) ORIGIN:
(A) ORGANISM: Pseudomonas (B) STRAIN: Pseudomonas wisconsinensis (C) INDIVIDUAL/ISOLATED: T 92.677/1 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:
Asn Tyr Thr Lys Thr Lys Tyr Pro Ile Val Leu Val His Gly Val Thr Gly Phe Asn Thr Ile Gly Gly Leu (2) INFORMATION FOR THE SEQ ID NO: 2:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 861 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (genomic) (v) TYPE OF FRAGMENT: internal (vi) ORIGIN:
(A) ORGANISM: Pseudomonas (B) STRAIN: Pseudomonas wisconsinensis (C) INDIVIDUAL/ISOLATED: T 92.677/1 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:

AACTACACCA AGACCAAGTA TCCGATCGTG CTGGTACACG GCGTGACCGG GTTCA~T~CC 60 GCCCGGCAGA TCGTGCCCTG GGCCGCAG~C GGAGGCGGCA AGGTCAACCT GATCGGCCAC 240 AGTCAGGGCT CGCCGACCTC GCGCGTGGCG G~l-lC~ll~C GGCCGGATCT GGTGGCATCG 300 GTGACCTCGA TCAACGGCGT CAACAAGGGC TCCAAGGTCG CCGATGTGGT GCGCGG~l~ 360 CTGCCACCGG GTAGCGGTAT CGAAGGCGGC GCCAATGCCA TCGCCAACGC C~-lCG~l~CG 420 GTGATCAATC TG~l~l~l~G CTCAAGCAAC CCGCAAAACG GTATCAACGC GCTAGGCACC 480 CTGACCACCG CGG~CACCAG TGCGCTGAAC AGTCGCCACC C~l~GGGCGT CAACACCAGC 540 TCCTGGACCG GTAATGCCGC CTATACCAAC GTGCTCGATG CGGCCG~TCC ~l-lC~-l~GCC 660 TTCACCGGCC l~l~ll~GG CAGCGAGAAG AACGACGGTC TGGTGGGCGT ATGTTCCACC 720 ~l~llC~GCA TTCGTGGCTG GACCGAACCG GTGTCGCTGT ATCGCCAGCA CGCCAACCGC 840 CTGAAGAACA AGGGCGTCTG A a 61 (2) INFORMATION FOR THE SEQ ID NO: 3:
(i) CHARACTERISTICS OF THE SEOUENCE:
(A) LENGTH: 861 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS:
(A) NAME/K~Y: CDS
(B) LOCATION: 1..858 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 Asn Tyr Thr Ly~ Thr Lys Tyr Pro Ile Val Leu Val His Gly Val Thr Gly Phe Asn Thr Ile Gly Gly Leu Val Asn Tyr Phe His m r Ile Pro Trp Asn Leu Glu Arg Asp Gly Ala Arg Val His Val Ala Ser Val Ala Ala Phe Asn Asp Ser Glu Gln Arg Gly Ala Glu Leu Ala Arg Gln Ile Val Pro Trp Ala Ala Gly Gly Gly Gly Ly6 Val A~n Leu Ile Gly ~is Ser Gln Gly Ser Pro Thr Ser Arg Val Ala Al~ Ser Leu Arg Pro Asp Leu Val Ala Ser Val Thr Ser Ile Asn Gly Val Asn Lys Gly Ser Lys 100 105 110 ~

Val Ala Asp Val Val Arg Gly Val Leu Pro Pro Gly Ser Gly Ile Glu Gly 61y Ala Asn Ala Ile Ala Asn Ala Leu Gly Ala Val Tl e Asn Leu CTG TCT GGC TCA AGC AAC CCG CAA ~AC GGT ATC AAC GCG CTA GGC ACC 480 Leu Ser Gly Ser Ser Asn Pro Gln A~n Gly Ile Asn Ala Leu Gly Thr Leu Thr Thr Ala Gly Thr Ser Ala Leu Asn Ser Arg His Pro Trp Gly Val Asn Thr Ser Ser Tyr Cys Ala Lys Ser Thr Glu Val His Asn Val CA 02202553 l997-04-ll CGC GGT CAC AGC ATC CGC TAC TAC TCC TGG ACC G~T AAT GCC GCC TAT 624 Arg Gly His Ser Ile Arg Tyr Tyr Ser Trp Thr Gly Asn Ala Ala Tyr Thr Asn Val Leu Asp Ala Ala Asp Pro Phe Leu Ala Phe Thr Gly Leu GTG TTC GGC AGC ~AG AAG AAC GAC GGT CTG GTG G~C GTA TGT TCC ACC 720 Val Phe Gly Ser Glu Lys Asn Asp Gly Leu Val Gly Val Cys Ser Thr Tyr Leu Gly Gln Val Ile Asp Asp Ser Tyr Asn Met Asn His Val Asp 245 250 2'5 Ala Ile Asn His Leu Phe Gly Ile Arg Gly Trp Thr Glu Pro Val Ser Leu Tyr Arg Gln His Ala Asn Arg Leu Lys Asn Lys Gly Val (2) INFORMATION FOR THE SEQ ID NO: 4:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 286 amino acids (B) TYPE: amino acids (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4:

Asn Tyr Thr Lys Thr Lys Tyr Pro Ile Val Leu Val His Gly Val Thr 1 5 lO 15 ly Phe Asn Thr Ile Gly Gly Leu Val Asn Tyr Phe His Thr Ile Pro Trp Asn Leu Glu Arg Asp Gly Ala Arg Val His Val Ala ser Val Ala ~5 la Phe Asn A~p Ser Glu Gln Arg Gly Ala Glu Leu Ala Arg Gln Ile . 55 60 Val Pro Trp Ala Ala Gly Gly Gly Gly ~ys Val Asn Leu Ile Gly His er Gln Gly Ser Pro Thr Ser Arg Val Ala Ala Ser Leu Arg Pro Asp ._ ~, .

Leu Val Ala Ser Val Thr Ser Ile Asn Gly Val Asn Ly6 Gly Ser Ly6 Val Ala A6p Val Val Arg Gly Val Leu Pro Pro Gly Ser Gly Ile Glu Gly Gly Ala Asn Ala Ile Ala Asn Ala Leu Gly Ala Val Ile Asn Leu Leu Ser Gly Ser Ser Asn Pro Gln A~n Gly Ile Asn Ala Leu Gly Thr Leu Thr Thr Ala Gly Thr Ser Ala Leu Asn Ser Arg His Pro Trp Gly Val Asn Thr Ser Ser Tyr Cy6 Ala Lys Ser Thr Glu Val His Asn Val Arg Gly ~is Ser Ile Arg Tyr Tyr Ser Trp Thr Gly Asn Ala Ala Tyr Thr Asn Val Leu Asp Ala Ala Asp Pro Phe Leu Ala Phe Thr Gly Leu Val Phe Gly Ser Glu Ly6 Asn Asp Gly Leu Val Gly Val Cys Ser Thr Tyr Leu Gly Gln Val Ile Asp Asp Ser Tyr Asn ~et A~n Hi6 Val A~p Ala Ile Asn His Leu Phe Gly Ile Arg Gly Trp Thr Glu Pro Val Ser Leu Tyr Arg Gln ~i6 Ala Asn Arg Leu Lys Asn Lys Gly Val (2) INFORMATION FOR THE SEQ ID NO: 5:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 927 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5:

CAGGCCAACT ACACCAAGAC CAAGTATCCG ATCGTGCTGG TACACGGCGT GA~--GG~llC 120 AATACCATCG GCGGGCTGGT CAATTA-TTC CATACCATTC CCTGGAACCT AG~GCGCGhT 180 CA 02202553 l997-04-ll GAGCTGGCCC GGCAGATCGT GCC'L1GGGCC GCAGGCGGAG GCGGCAAGGT CAACCTGATC 3 0 0 GGCCACAGTC AGGGCTCGCC GACCTCGCGC GTGGCGGCTT L~1-1~CGGCC GGATCTGGTG 360 GCATCGGTGA CCTCGATCAA CGGCGTCAAC AAGGGCTCCA AGGTCGCCGA 1~1~1~CGC 420 GGCGTGCTGC CACCGG~1AG CGGTATCGAA GGCGGCGCCA ATGCCATCGC CAACGCCCTC 480 CTGGCCTTCA CCGGCCTGGT GTTCGGCAGC GAGAAGAACG AC~ G1 GGGCGTATGT 7 8 0 (2) INFORMATION FOR THE SEQ ID NO: 6:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 927 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS:
(A) NAME/KEY: sig peptide (B) LOCATION: 1..66 (ix) CHARACTERISTICS:
(A) NAME/KEY: mat_peptide (B) LOCATION: 67..924 (ix) CHARACTERISTICS:
(A) NAME/KEY: CDS
(B) LOCATION: 1..924 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6:

ATG CGT CGC GTC TAT ACC GCT GCC CTG GCA ACA CTC GC'T CTG CTT GGC 4 8 Met Arg Arg Val TYr Thr A1a A1a Leu A1a Thr Leu A1a Leu Leu G1Y
-22 -20 _ -15 -10 CA 02202~3 1997-04-11 Ala Val Glu Ala Gln Ala Asn Tyr Thr Lys Thr Lys Tyr Pro Ile Val Leu Val His Gly Val Thr Gly Phe Asn Thr Ile Gly Gly Leu Val Asn Tyr Phe His Thr Ile Pro Trp Asn Leu Glu Arg Asp Gly Ala Arg Val CAÇ GTC GCC AGT GTC GCT GCC TTC AAT GAC AGC GAG CAG CGC GGC GCC 240 His Val Ala Se_ Val Ala Ala Phe Asn Asp Ser Glu Gln Arg Gly A1A

Glu Leu Ala Arg Gln Ile Val Pro Trp Ala Ala Gly Gly Gly Gly Lys Val Asn Leu Ile Gly Hi6 Ser Gln Gly Ser Pro Thr Ser Arg Val Ala ~75 80 85 90 Ala Ser Leu Arg Pro Asp Leu Val Ala Ser Val Thr Ser Ile Asn Gly Val Asn Lys Gly Ser Lys Val Ala Asp Val Val Arg Gly Val Leu Pro Pro Gly Ser Gly Ile Glu Gly Gly Ala Asn Ala Ile Ala Asn Ala Leu Gly Ala Val Ile Asn Leu Leu Ser Gly Ser Ser Asn Pro Gln Asn Gly Ile Asn Ala Leu Gly Thr Leu Thr Thr Ala Gly Thr Ser Ala Leu Asn Ser Arg His Pro Trp Gly Val Asn Thr Ser Ser Tyr Cy6 Ala Lys Se~

Thr Glu Val His Asn Val Arg Gly His Ser Ile Arg Tyr Tyr Ser Trp Thr Gly Asn Ala Ala Tyr Thr A~n Val Leu Asp Ala Ala Asp Pro Phe CTG GCC TTC ACC GGC CTG GTG TTC GGC AGC G~G AAG AAC GAC GGT CTG 768 Leu Ala Phe Thr Gly Leu Val Phe Gly Ser G1U Lys Asn Asp Gly Leu Val Gly Val Cys Ser Thr Tyr Leu Gly Gln Val Ile Asp Asp Ser Tyr Asn Mes Asn His Val Asp Ala Ile Asn His Leu Phe Gly Ile Arg Gly Trp Thr Glu Pro Val Ser Leu Tyr Arg Gln His Ala Asn Arg Leu Lys 270 275 2~0 AAC AAG G&C GTC TGA 927 Asn Lys Gly Val (2) INFORMATION FOR THE SEQ ID NO: 7:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 308 amino acids (B) TYPE: amino acids (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7:

Met Arg Arg Val Tyr Thr Ala Ala Leu Ala Thr Leu Ala Leu Leu Gly Ala Val Glu Ala Gln Ala Asn Tyr Thr Ly~ ~hr Lys Tyr Pro Ile Val eu Val His Gly Val Thr G~ Phe Asn Thr Ile Gly Gly Leu Val Asn yr Phe His Thr Ile Pro Trp Asn Leu Glu Arg Asp Gly Ala Arg Val His Val Ala Ser Val Ala Ala Phe Asn Asp Ser Glu Gln Ars Gly Ala Glu Leu Ala Arg Gln Ile Val Pro Trp Ala Ala Gly Gly Gly Gly Lys CA 02202~3 1997-04-11 >

Val Asn Leu Ile Gly His Ser Gln Gly Ser Pro Thr Ser Arg Val Ala Ala Ser Leu Arg Pro Asp Leu Val Ala Ser Val Thr Ser Ile Asn Gly 9S 100 lOS
Val Asn Lys Gly Ser Lys Val Ala Asp Val Val Arg Gly Val Leu Pro Pro Gly Ser Gly Ile Glu Gly Gly Ala Asn Ala Ile Ala Asn Ala Leu Gly Ala Val Ile Asn Leu Leu Ser Gly Ser Ser Asn Pro Gln Asn Gly Ile Asn Ala Leu Gly Thr Leu Thr Thr Ala Gly Thr Ser Ala Leu Asn lSS 160 16S 170 Ser Arg His Pro Trp Gly Val Asn Thr Ser Ser Tyr Cys Ala Lys Ser Thr Glu Val His Asn Val Arg Gly His Ser Ile Arg Tyr Tyr Ser Trp 190 l9S 200 Thr Gly.Asn Ala Ala Tyr Thr Asn Val Leu Asp Ala Ala Asp Pro Phe Leu Ala Phe Thr Gly Leu Val Phe Gly Ser Glu Lys Asn Asp Gly Leu Val Gly Val Cys Ser Thr Tyr Leu Gly Gln Val Ile Asp Asp Ser Tyr Asn Met Asn His Val Asp Ala Ile Asn His Leu Phe Gly Ile Arg~Gly Trp Thr Glu Pro V~l Ser Leu Tyr Arg Gln Hifi Ala Asn Arg Leu Lys Asn Ly6 Gly Val (2) INFORMATION FOR THE SEQ ID NO: 8:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 66 base pairs (B) TYPE: nucleotide (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (yenomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8:

ATGC~l~GCG TCTATACCGC TGC'C~-l~GCA ACA~lCG~lC TGCTTGGCGC CGTCGAGGCC 60 (2) INFORMATION FOR THE SEQ ID NO: 9-(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 66 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS:
(A) NAME/KEY: CDS
(B) LOCATION: 1..66 (ix) CHARACTERISTICS:
(A) NAME/KEY: sig_peptide (B) LOCATION: 1..66 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9:

Met Arg Arg Val Tyr Thr Ala Ala LRU Ala Thr Leu Ala Leu Leu Gly Ala Val Glu Ala Gln Ala (2) INFORMATION FOR THE SEQ ID NO: 10:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 22 amino acids (B) TYPE: amino acids (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10:

Met Arg Arg Val Tyr Thr Ala Ala Leu Ala Thr Leu Ala Leu Leu Gly Ala Val Glu Ala Gln Ala ., (2) INFORMATION FOR THE SEQ ID NO: 11:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 72 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: sim,ple (D) CONFIGURATION: linear .
(ii) TYPE OF MOLECULE: Further nucleic acid (A) DESCRIPTION: /desc = "synthetic oligonucleotide"
(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11:

Claims (28)

C L A I M S

1. Lipase, characterized in that it originates from a strain of Pseudomonas wisconsinensis or from a derivative or a mutation of this strain which is capable of producing this lipase.

2. Lipase, characterized in that it originates from a strain of Pseudomonas wisconsinensis T 92.677/1 (LMG P-15151) or from a derivative or a mutation of this strain which is capable of producing this lipase.

3. Lipase, characterized in that the amino acid N-terminal sequence (SEQ ID NO:1) is the following:

4. Lipase, isolated and purified, characterized in that it comprises the amino acid sequence of 1 to 286 amino acids (SEQ ID NO:4) or a modified sequence derived therefrom.

5. Lipase, isolated and purified, characterized in that the sequence of the mature lipase is preceded by a presequence of 22 amino acids (SEQ ID NO:10) which codes for the signal peptide of the lipase.

6. Lipase, isolated and purified, characterized in that it has a relative molecular mass of about 30 kDa.

7. Lipase, isolated and purified, characterized in that it has an iso-electric point of between about 9.8 and about 10.1.

8. Lipase, characterized in that it originates from an aerobic bacteria which is capable of producing the lipase in an appropriate nutritive medium which contains sources of carbon and nitrogen and mineral salts under aerobic conditions.

9. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a pH of 9.5, in a temperature range above about 40° C.

10. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a pH of 9.5, in a temperature range below about 60° C.

11. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a pH of 9.5, in a temperature range of between about 40° C and about 60° C.

12. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a pH of 9.5, at a temperature of about 55° C.

13. Lipase, characterized in that it develops an enzymatic activity in excess of 50% of the maximum enzymatic activity in a temperature range of between about 40° C and about 60° C for a pH of about 9.5, the maximum enzymatic activity being measured at a temperature of 55° C and at a pH of 9.5.

14. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a temperature of about 30° C, in a pH range of or above about 8.

15. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a temperature of about 30° C, in a pH range of or below about 10.

16. Lipase, characterized in that it develops an optimal enzymatic activity, measured at a temperature of about 30° C, in a pH range of between about 8 and about 10.

17. Lipase, characterized in that it develops an enzymatic activity of more than 85 % of the maximum enzymatic activity in a pH range of between about 8 and about 10, for a temperature of about 30° C, the maximum enzymatic activity being measured at a temperature of 30° C and at a pH of 9.5.

18. Lipase, characterized in that it shows a relative enzymatic activity of at least 55 % measured after an incubation of 160 minutes at a temperature of 55° C and at a pH of 10, in a buffer solution having a hardness of 15.

19. An isolated and purified culture of Pseudomonas wisconsinensis and a derived or mutated culture thereof.

20. An isolated and purified culture of Pseudomonas wisconsinensis T 92.677/1 (LMG P-15151) and a derived or mutated culture thereof.

21. DNA molecule comprising the nucleotide sequence (SEQ
ID NO:2) which codes for the mature lipase of Pseudomonas wisconsinensis T 92.677/1 (LMG P-15151) or a modified sequence derived therefrom.

22. DNA molecule according to claim 21, characterized in that it comprises the nucleotide sequence (SEQ ID NO:5) which codes for the precursor of the lipase of Pseudomonas wisconsinensis T 92.677/1 or a modified sequence derived therefrom.

23. Process for the production of a lipase according to any of claims 1 to 18, characterized in that it comprises the culture of a bacteria which is capable of producing the lipase in an appropriate nutritive medium which contains sources of carbon and nitrogen and mineral salts, and the collecting of the lipase thus obtained.

24. Process according to claim 23, characterized in that the aerobic bacteria is a strain of Pseudomonas.

25. Process according to claim 24, characterized in that the aerobic bacteria is the strain of Pseudomonas wisconsinensis T 92.677/1 (LMG P-15151) and a derivative or mutation of that strain which is capable of producing the lipase.

26. An enzymatic composition which contains the lipase according to any of claims 1 to 18 and at least one additive.

27. The enzymatic composition according to claim 26, characterized in that it is a detergent composition.

28. Use of the lipase according to any of claims 1 to 18 for detergent purposes.