WO1996012012A1 - Lipase, microorganism producing same, method for preparing said lipase and uses thereof - Google Patents

Lipase, microorganism producing same, method for preparing said lipase and uses thereof Download PDF

Info

Publication number
WO1996012012A1
WO1996012012A1 PCT/BE1995/000094 BE9500094W WO9612012A1 WO 1996012012 A1 WO1996012012 A1 WO 1996012012A1 BE 9500094 W BE9500094 W BE 9500094W WO 9612012 A1 WO9612012 A1 WO 9612012A1
Authority
WO
WIPO (PCT)
Prior art keywords
lipase
characterized
gly
ph
val
Prior art date
Application number
PCT/BE1995/000094
Other languages
French (fr)
Inventor
Christophe Andre
Lucien Charmoille
Pierre Cornelis
Manzour Hernando Hazbon
Original Assignee
Solvay S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BE9400930A priority Critical patent/BE1008783A3/en
Priority to BE9400930 priority
Priority to BE9500850 priority
Priority to BE9500850A priority patent/BE1008998A3/en
Application filed by Solvay S.A. filed Critical Solvay S.A.
Publication of WO1996012012A1 publication Critical patent/WO1996012012A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RPROCESSES USING MICROORGANISMS
    • C12R1/00Processes using microorganisms
    • C12R1/01Processes using microorganisms using bacteria or actinomycetales
    • C12R1/38Pseudomonas
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL AND VEGETABLE OILS, FATS, FATTY SUBSTANCES AND WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease, amylase
    • C11D3/38627Preparations containing enzymes, e.g. protease, amylase containing lipase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18Carboxylic ester hydrolases (3.1.1)
    • C12N9/20Triglyceride splitting, e.g. by means of lipase

Abstract

A lipase from a Pseudomonas strain is disclosed. The lipase is active in a broad alkaline pH range. Novel microorganism strains producing the lipase, and methods for preparing said lipase, are also disclosed. In addition, the uses of the lipase and compositions containing same are disclosed.

Description

Lipase. microorganism producing it, this process for preparing the liinpaassee e ett uttiilliissaattiinonnss d u c ceellllee dee - ccii

The invention relates to a new lipase. The invention also relates to a novel microorganism strain producing the lipase.

The invention also relates to this lipase preparation methods, uses thereof and compositions comprising thereof. It is known to include lipases in detergent compositions for removing fatty tissue deposits (Enzyme Microb. Technol., 1993 (3), 634-645 pages). These fatty deposits contain triglycerides made, for example, the sebum, different food products (oil, sauce, butter fat), cosmetics. Lipases hydrolyze triglycerides to form more soluble products in water, mono- and diglycerides, glycerol and free fatty acids.

Lipases for use in detergent compositions are known, such as in particular lipases from Pseudomonas strains, for example the lipase produced by the strain Pseudomonas stutzeri (british patent application 1,372,034), lipase produced by the strain of Pseudo¬ monas mendocina (European patent application 0,571,982), lipase produced by the strain Pseudomonas alcaligenes (U.S. patent 5,063,160), and the lipase produced by the strain Pseudomonas pseudoalcaligenes (European patent application 0218272). Despite the properties of these lipases, detergent compositions containing these enzymes seem ineffective.

Consequently, there is currently a need for a lipase used in the field of detergency, very stable and very active in a wide range of pH and temperature. In addition, there is also a need for a particularly effective lipase on greasy stains, and this low enzyme dosage. In addition, there is also a need for a particularly effective lipase on greasy stains from the first wash cycles.

The present invention aims to provide a novel lipase active in a wide temperature range, active in a wide range of alkaline pH, and effective from the first wash cycle. The present invention also aims to identify, isolate and provide a strain, in particular a strain of Pseudomonas which produces naturel¬ LEMENT said lipase.

The present invention also aims to prepare and deliver a composition containing the lipase, in particular a composition déter¬ gente.

To this end, the present invention relates to a lipase, isolated and purified from a strain of Pseudomonas wisconsinensis. The present invention also relates to a lipase, isolated and purified from a derivative or mutant of a strain of Pseudomonas wisconsinensis able to produce the lipase. Preferably the lipase of the invention derived from the strain Pseudomonas wisconsinensis T 92 677/1 or a derivative or mutant thereof capable of producing said lipase. The lipase of the invention is derived from the strain Pseudomonas wisconsinensis T 92 677/1. Lipase is classified in the international system under the EC number 3.1.1.3 .; it is a glycerol ester hydrolase.

Preferably, the lipase isolated and purified, has a molecular weight of about 30 kDa. It is mainly extracellular.

The N-terminal amino acid sequence (SEQ ID NO: l) of the lipase of the invention is:

Asn Thr Tyr Tyr Lys Thr Lys Pro Val Leu Ile Val His Gly Val Thr Gly

January 5 10 15

Phe Asn Thr Ile Gly Leu Gly 20 The invention relates to a lipase which is from an aerobic bacterium capable of producing the lipase in an appropriate nutrient medium containing carbon and nitrogen sources and inorganic salts under condition aero- biosis.

Disclosed is a lipase isolated and purified, comprising the amino acid sequence of 1-286 amino acids (SEQ ID NO: 4) or a modified sequence derived therefrom. The amino acid sequence and the nucleotide sequence (SEQ ID NO: 2) coding for the mature lipase, as well as its amino acid translation (SEQ ID NO: 3), is given in Figure 1 (Figures la and lb ). The lipase of the invention is synthesized as a precursor. The precursor contains 308 amino acids (SEQ ID NO: 7). the nucleotide sequence was identified (SEQ ID NO: 5) coding for the precursor of the lipase, as well as its amino acid translation (SEQ ID NO: 6). Figure 2 (2a and 2b) shows the nucleotide sequence (SEQ ID NO: 5) of the coding part of the lipase and its amino acid translation (SEQ ID NO: 6).

The precursor contains the 286 amino acid sequence (SEQ ID NO: 4) of the mature lipase and the sequence of 22 amino acids (SEQ ID NO: 10) of the presequence.

The mature lipase sequence is preceded by a presequence. It is an additional sequence of 22 amino acids (SEQ ID NO: 10). the corresponding nucleotide sequence was identified (SEQ ID NO: 8) and its translation into amino acids (SEQ ID NO: 9). This presequence codes for the lipase signal peptide of the invention.

Preferably, said lipase has an estimated isoelectric point between about 9.8 and about 10.1. Particularly preferably, said lipase has an estimated isoelectric point equal to about 9.95. The lipase of the invention is active over a wide range of tempéra¬ ture. Lipase, isolated and purified according to the invention develops an optimum enzymatic activity, measured at pH 9.5, in a temperature range above about 40 ° C. Lipase, isolated and purified according to the invention develops an optimum enzymatic activity, measured at pH 9.5, in a temperature range lower than about 60 ° C. More specifically, the lipase of the invention develops an optimum enzymatic activity, measured at pH 9.5, in a temperature range between about 40 ° C to about 60 ° C. Of particuliè¬ surely preferred way, the lipase of the invention develops an optimum enzymatic activity, measured at a pH of about 9.5 at a temperature of about 55 ° C.

Lipase, isolated and purified according to the invention develops an enzymatic activity of more than 50% of maximal enzyme activity in a temperature range between about 40 ° C to about 60 ° C to a pH of about 9, 5, the maximum enzyme activity being measured at a temperature of 55 ° C and at a pH of 9.5.

The lipase of the invention is active over a wide alkaline pH range. Usually, lipase, isolated and purified according to the invention develops an optimum enzymatic activity, measured at a temperature of about 30 ° C, - 4 -

in a range of pH greater than or equal to about 8. Usually, the lipase isolated and purified, the invention develops an optimum enzymatic activity, measured at a temperature of about 30 ° C, in a range of pH less than or equal to about 10. More specifically, the lipase of the invention develops an optimum enzymatic activity, measured at a temperature of about 30 ° C in a pH range between about 8 and about 10. Most preferably, the lipase of the invention develops an optimum enzymatic activity, measured at a temperature of about 30 ° C in a pH range between about 8 and about 9.5.

Lipase, isolated and purified according to the invention develops an enzymatic activity of more than 85% of maximal enzyme activity in a pH range between about 8 and about 10 for a temperature of about 30 ° C, the maximum enzyme activity being measured at a temperature of 30 ° C and at a pH of 9.5.

The lipase of the invention is heat stable at an alkaline pH. Indeed, the lipase isolated and purified, the invention shows a relative enzymatic activity of at least 55% measured after incubation for 160 minutes at a temperature of 55 ° C and at a pH of 10 in a buffered solution of hardness 15. It shows a relative enzymatic activity of at least 70% measured after incubation for 80 minutes under these conditions.

By relative enzymatic activity, the ratio between the enzymatic activity is defined as measured in a test carried out under conditions of pH data, temperature, and substrate length, and the maximum enzyme activity measured in the same test, the enzymatic activity is measured from the hydrolysis of triolein and the maximum enzymatic activity being arbitrarily set at the value of 100.

The invention also relates to a modified lipase, that is to say an enzyme whose amino acid sequence differs from that of the wild ^ enzyme by at least one amino acid. These modifications may be obtained by conventional mutagenesis techniques on the DNA, such as exposure to ultra-violet radiation, chemicals, such as ethyl methane sulfonate (EMS), N-methyl-N -nitro-N-nitrosoguani- dine (MNNG), sodium nitrite or O-méthylhydroxy lamine or by genetic engineering techniques, such as, for example, site-directed mutagenesis or random mutagenesis. These techniques are known to the art and are notably described in MOLECULAR CLONING - a laboratory manual - Sambrook, Fritsch, MANIAΗS - second edition, 1989, Chapter 15. The invention also concerns a mutated lipase obtained by modifi¬ cation the nucleotide sequence of the gene that encodes lipase. The techniques for obtaining such mutated lipases are known to the art and are notably described in MOLECULAR CLONING - a laboratory manual - Sambrook, Fritsch, MANIAΗS - second edition, 1989, Chapter 15.

The invention also relates to a lipase having immunochemical properties identical or partially identical to the lipase obtained from the strain Pseudomonas wisconsinensis T 92 677/1. The immunochemical properties can be determined immunologically by identity testing, including using specific polyclonal or monoclonal. Identity tests are known in the art, such as including the method of immunodiffusion, immunoelectrophoresis or method. Examples of such methods are described by Axelsen NH, Handbook of Immunoprecipitation Gel Techniques, Blackwell Scientific Publications, 1983, chapters 5 and 14, the terms "antigenic identity" and "partial antigenic identity" are described herein in Chapters 5, 19 and 20. a serum containing the specific antibody is prepared by the method described by immunizing animals (mice examples, rabbit or goat) with a preparation of purified lipase. This preparation may be mixed with an additive, such as Freund's adjuvant, and the resulting mixture is injected into animals. The polyclonal antibody is obtained after one or more immunizations. One example is to inject, of subcutaneously at two week intervals, four fractions each containing 150 micrograms of purified lipase, immunization then lasts 8 weeks. The serum is removed after the period of immunization and the immunoglobulin may be isolated according to the method described by Axelsen NH (1983).

The present invention also relates to the isolation, identification and provision of a new bacterium producing the lipase. This aerobic bacterium was isolated and purified. Usually it belongs to the family of 6 -

Pseudomonadaceae. Preferably it belongs to the genus Pseudomonas. More preferably, it is a strain of Pseudo¬ Monas wisconsinensis. Good results have been obtained with the strain of Pseudomonas wisconsinensis T 92 677/1 or a derivative or mutant thereof.

By derivative of this strain is any modified bacterium naturel¬ LEMENT, that is to say by natural selection. For mutant of this strain is any artificially modified bacterium. The mutants of this strain can be obtained by known modification techniques, such as ultraviolet radiation, X-rays, mutagens or genetic engineering. These techniques are known to the art and are notably described in Sambrook et al., 1989, Chapter 15. Examples of mutagens are described by R. Scriban, Biotechnology, (Technique et Documentation Lavoisier) 1982 p. 365-368. The strain of Pseudomonas wisconsinensis T 92 677/1 was filed with the named collection Belgian Coordinated Collections of Microorganisms (LMG Culture Collection, Ghent University, Laboratory of Microbiology - KL Ledeganckstraat 35, B-9000 Ghent, Belgium) under the Budapest Treaty under number LMG P-15151 on October 12, 1994. the invention relates to an isolated culture and purified strain of Pseudomonas wisconsinensis and derived culture or mutant thereof. More particularly, the invention concerns an isolated culture and purified strain of Pseudomonas wisconsinensis T 92 677/1 and a culture derived or mutated therefrom. The strain of the present invention was identified by its biochemical caractéris¬ ticks. This is a Gram-negative bacteria, aerobic. It does not grow anaerobically. No spore is formed. The oxidase test is positive in the presence of 1% (w / v) tetramethyl-4-ene-phenylene diammoniumdichlorure. This bacteria is not thermophilic. It does not produce gas from glucose.

The invention also relates to the isolation and provision of a DNA molecule comprising the nucleotide sequence (SEQ ID NO: 2) that codes for the mature lipase from Pseudomonas wisconsinensis T 92 677/1 or a modified sequence derived therefrom -this. By modified sequence derived from the DNA molecule is meant any molecule of DNA obtained by modifying one or more nucleotides - 7 -

the gene which codes for the lipase of the invention. The techniques for obtaining such sequences are known to the art and are notably described in MOLECULAR CLONING - a laboratory manual - Sambrook, Fritsch, MANIAΗS - second edition, 1989, Chapter 15. Usually, the modified sequence derived from the DNA molecule comprises at least 70% homology with the nucleotide sequence (SEQ ID NO: 2) of the gene encoding the lipase of the invention, that is to say at least 70% identical nucleotides and having the same position in the sequence. Preferably, the modified sequence derived from the DNA molecule comprises at least 80% homology with the nucleotide sequence (SEQ ID NO: 2) of the gene encoding the lipase of the invention. More preferably, the modified sequence derived from the DNA molecule comprises at least 90% homology with the nucleotide sequence (SEQ ID NO: 2) of the gene encoding the lipase of the invention.

Usually, the DNA molecule according to the invention comprises at least the nucleotide sequence (SEQ ID NO: 5) which codes for the precursor of the lipase or a modified sequence derived therefrom. This nucleotide sequence (SEQ ID NO: 5) comprises the nucleotide sequence (SEQ ID NO: 2) encoding the mature lipase from Pseudomonas wisconsinensis T 92 677/1 and its signal sequence (pre-sequence) (SEQ ID NO: 8). Preferably, said DNA molecule comprises any of the Pseudomonas lipase gene wisconsinensis T 92 677/1.

The present invention also relates to a method for producing a lipase. This method comprises culturing an aerobic bacterium capable of producing the lipase in an appropriate nutrient medium containing carbon and nitrogen sources and inorganic salts under aerobic conditions and harvesting the lipase thus obtained. This culture medium can be solid or liquid. Preferably the culture medium is liquid. Usually, the aerobic bacterium is a strain of Pseudomonas or a derivative or mutant thereof capable of producing the lipase. More particularly, the aerobic bacterium is a strain of Pseudomonas wiscon¬ sinensis or a derivative or mutant thereof capable of producing the lipase. Preferably, the aerobic bacterium is a strain of Pseudomonas wisconsinensis T 92 677/1 or a derivative or mutant thereof capable of producing the lipase. The culture conditions of these bacteria, which allow to obtain the lipase of the invention as components of the nutrient medium, culture parameters, temperature, pH, aeration, agitation, are well known in the art. Examples of culture conditions are described in particular in European patent application 0571982.

lipase harvesting techniques are well known to the skilled person and are selected according to the intended uses of the lipase. Habi¬ tuellement, employing centrifugation, filtration, ultrafiltration, evaporation, microfiltration, crystallization or a combination of either of these techniques such as centrifugation followed by ultrafiltration. Examples of such techniques are described by R. Scriban, Biotechnology, (Technique et Documentation Lavoisier), 1982, p. 267-276.

The lipase can then be purified, if necessary and according to the intended uses. Enzyme purification techniques are well known to those skilled in the art, such as precipitation with a salt, such as ammonium sulfate or solvent, such as acetone or an alcohol . Examples of such techniques are described by R. Scriban, Biotechnology, (Technique et Documentation Lavoisier), 1982, p. 267-276. The lipase may also be dried by atomization or lyophilization. Examples of such techniques are described by R. Scriban, Biotechnology, (Technique et Documentation Lavoisier), 1982, p. 267-276. The present invention also relates to enzyme compositions comprising the lipase according to the invention and at least one additive. According to the intended uses, the enzyme compositions comprising the lipase of the present invention may be in solid or liquid form.

The additives included in the composition according to the invention are known to those skilled in the art and are selected depending on the intended use of the composition. They must be compatible with lipase and not affect the enzymatic activity of lipase. Usually these additives are stabilizers of the enzyme, preservatives and formu¬ tion agents. Examples of additives are described in particular in European patent application 0 218 272. As examples of additives there may be mentioned ethylene gly col, glycerol, 1,2-propanediol, starch, a sugar such as glucose and sorbitol, a salt such as sodium chloride, calcium chloride, potassium sorbate and sodium benzoate or a mixture of two or more of these products. Good results have been obtained with 1, 2-propanediol. Good results were also obtained with sorbitol.

The lipase of the invention has multiple outlets in various industries, such as, for example, the food industry, the pharmaceutical or chemical industries.

The lipase may be used in particular in detergents. The present invention also relates to the use of lipase as defined above in detergents. An example of such use is described in particular in British Patent 1372034 and European Patent Application 0 218 272. In this context, it is part of compo¬ detergent sions. The present invention therefore also relates to compositions containing detergent lipase. The components of the detergent compo¬ sions are known to the skilled person and are tailored according to the intended use of the composition. Such components include enzymes, such as for example proteases, amylases and / or cellulases; fillers such as sodium tripolyphosphate; bleaches, such as perborate; formulation additives; surfactants. Detergency compositions of the invention may be used, depending on their formulation, such as powder, granule or liquid detergents for washing clothes; as stain remover for separating and degreasing objects or detach the machine prior to cleaning; and as a powder, granule or liquid dishwashing.

The lipase may be used in particular in the treatment of waste paper in order to remove oil-based inks. An example of such use is in particular described in the Chemical Abstract Abstract 113/154607.

The lipase may particularly be used in pulp treatment to avoid sticky deposits known as the "pitch". An example of such use is in particular described in Enzyme Microb. Technol., 1993 (3), 634-645 pages.

The lipase may be used in particular in the food industry to develop the aroma of certain foods, such as cheese; during the production of special margarines. An example of such use is in particular described in Enzyme Microb. Technol., 1993 (3), 634-645 pages. The present invention is illustrated by the following examples. Figure 1 (Figures la and lb) represents the amino acid sequence and the nucleotide sequence (SEQ ID NO: 2) coding for the mature lipase, as well as its amino acid translation (SEQ ID NO: 3). Figure 2 (2a and 2b) shows the nucleotide sequence

(SEQ ID NO: 5) of the coding part of the lipase and its amino acid translation (SEQ ID NO: 6). example 1

Isolation and characterization of the strain of Pseudomonas wisconsinensis T 92 677/1

The strain of Pseudomonas wisconsinensis T 92 677/1 was isolated from a soil sample collected in the United States in the state of Wisconsin.

1 g of soil was suspended in 10 ml of deionized water containing 9 g / 1 NaCl. This suspension was diluted 10 times with deionized water containing 9 g / 1 NaCl.

1 ml of the diluted clay suspension is spread on a nutrient agar medium A.

Medium A contains 10 g / 1 tryptone (Difco), 5 g / 1 yeast extract, 5 g / 1 NaCl, 20 g / 1 agar, 2.5 g / 1 of NaHCO 3, 7 , 5 g / 1 of Na 2 CO 3, 10 g / 1 of olive oil, 1 g / 1 polyvinyl alcohol (25/140) and

0.01 g / 1 of rhodamine B (Sigma 6626). The medium A is prepared as follows.

An olive oil emulsion is first prepared as follows. 50 ml of distilled water is heated to 80 ° C. 1 g of polyvinyl alcohol in small portions to the heated water. Then, 10 g of olive oil in polyvinyl alcohol suspension. means is then emulsified with an Ultra-Turrax mixer at 13,500 rpm (18 GM stem). Sterilizing the emulsion at 121 ° C for 30 minutes.

Agar is then prepared as follows. 10 g of tryptone, 5 g yeast extract, 5 g NaCl, 20 g agar were added to 850 ml of distilled water. The agar suspension was sterilized at 121 ° C for 30 minutes.

1 1 carbonate buffer (pH 9.5) containing 25 g / 1 to NaHCO β and 75 g / 1 of Na.sub.2CO.sub.3 is prepared, and then sterilized at 121 ° C for 30 minutes. Then, 1 ml of an aqueous solution [0.01% (w / v)] rhoda¬ Mine B (Sigma 6626). This solution is sterilized by fύtration on 1 to 11

sterilizing membrane (Millipore) of 0.45 μ.

The olive oil emulsion sterilized and the sterilized agar were cooled to 60 ° C and then mixed under sterile conditions. Then we add the sterilized solution of rhodamine. Then, 100 ml of buffer was added -carbo- nate sterilized so as to obtain a pH of 9.5. Is emulsified, then the suspension thus obtained by means of a Ultra-Turrax mixer at 13,500 rpm (18 GM stem).

Medium A on which the ground suspension was plated, is incubated 48 hours at 30 ° C. A lipase producing microorganisms are detected using an ultraviolet light, they are surrounded by a fluorescent halo. The microorganisms identified as producing a ϋpase, are cultured on a nutrient agar medium B.

Medium B contains 10 g / 1 tryptone (Difco), 5 g / 1 yeast extract, 5 g / 1 NaCl, 20 g / 1 agar, 2.5 g / 1 of NaHCO 3, 7 , 5 g / 1 of Na 2 CO 3. Tryptone, yeast extract, NaCl, agar, that make up the medium B, are mixed with 900 ml of distilled water, then sterilized at 121 ° C for 30 minutes. The pH is adjusted to 9.5 by the addition of 100 ml of carbonate buffer prélablement sterilized (containing 25 g / 1 of NaHCO 3 and 75 g / 1 of Na 2 CO 3). The microorganism was identified by its characteristic nomic biochi¬: Gram-negative bacteria, aerobic. No spore is formed.

The size of the vegetative cells is 0.5-0.7 x 1.5-4.0 microns microns. The mobility of vegetative cells is positive. The test lysis by 3% (w / v) of KOH is positive. The catalase test is positive in the presence of 10% (v / v) hydrogen peroxide. The oxidase test is positive in the presence of 1% (w / v) tetramethyl-l, 4-phenylene diammoniumdichlorure. The urease test is negative. The test for nitrate reduction is positive. Similar tests have notably been described in European patent application 0 218 272. This strain is aerobic, that is to say, it grows aerobically.

It does not grow under anaerobic conditions, that is to say under an atmosphere of 84% (v / v) N 2, 8% (v / v) CO 2, 8% (v / v) H 2-37 ° C.

The abbreviation% (v / v) represents a percentage expressed in volume per volume. The abbreviation% (v / w) represents a percentage expressed in weight by volume. The abbreviation% (w / v) represents a percentage expressed in weight per volume. The abbreviation% (w / w) is a Per cent expressed by weight per weight.

This strain is not thermophilic. It shows normal development after incubation on agar medium B at 20 ° C, 30 ° C, 37 ° C and 41 ° C. The strain does not produce gas from glucose.

The strain used azelate, caprate, citrate, glucose, gluconate, L-clays nine, L-histidine, betaine and geraniol. The strain does not use adipate, phenylacetate, L-arabinose and maltose. It does not hydrolyze gelatin, starch and esculin. The strain belongs to the genus Pseudomonas and RNA-I group.

The biochemical features differentiate strain of Pseudomonas wisconsinensis, and in particular the strain Pseudomonas wisconsinensis T 92 677/1, a strain of Pseudomonas mendocina, a strain of Pseudomonas pseudoalcaligenes, a strain of Pseudomonas alcaligenes and a strain Pseudomonas stutzeri. This clearly appears from reading the Table 1 together the main biochi¬ nomic characteristics of these 5 strains.

Table 1

Pseudomonas Features

wisconsinensis stutzeri mendo¬ alkali-pseudoalca- T 92 677/1 cina genes ligenes

Size microns x 0.7-0.8 0.7-0.8 0.5 0.7-0.8 0.5-0.7 1.5-4.0 1.4-2.8 .mu.m 1 , from 4 to 2.8 1 2.0-3.0, 2-2.5

Pigment Yellow + - + d -

hydrolysis - - -

+ Starch '

Arginine - - + 4- d déhydrolase

Using + + + - - Glucose

Using + d + - d Gluconate

Using + - + - - Geraniol

Using + - + dd L-histidine

Using + - + + + L-arginine

Using + - -1 ~ + Betaine

+ = Positive test for 90% or more strains

- = negative test for 90% or more of strains = test positive for more than 10% but less than 90% of strains / 12012 -.- "" -.

PCT / BE95 / 00094

- 14

The isolated bacteria thus belongs to the genus Pseudomonas, any known species could not be determined.

The strain of Pseudomonas wisconsinensis T 92 677/1 was deposited in the collection named Belgian Coordinated Collections of microrganisms (LMG Culture Collection) under number

LMG P-15151 12 October 1994.

example 2

Production of lipase by the strain Pseudomonas wisconsinensis

T 92 677/1 strain of Pseudomonas wisconsinensis T 92 677/1 is cultured on Petri dishes containing agar medium B at 30 ° C for 24 hours.

Then from this culture a culture is carried out in 25 ml of a liquid medium C. Medium C containing 10 g / 1 tryptone (Difco), 5 g / 1 yeast extract, 10 g / 1 NaCl, the medium pH is adjusted to 7.0 with

0 NaOH, 1N, the medium was sterilized at 121 ° C for 30 minutes. Culturing is carried out at 30 ° C with orbital shaking at 200 revolutions per minute with an amplitude of about 2.54 cm.

After 16 hours of incubation, we introduced this culture in a 20 liter fermenter containing 13 liters of the sterilized liquid medium D.

Medium D contains K 2 HPO 4 2.5 g / 1, KH 2 PO 4 2.5 g / 1 MgSO 4 .7H 2 0

1 g / 1, (NH 4) 2 SO 4 2 g / 1 (NH 2) 2 CO 2 g / 1, CaCl2 1 g / 1, soya flour

20 g / 1, yeast extract 2 g / 1, glucose 20 g / 1, antifoaming Mazuôl (Mazes

Chemicals) 5 g / 1. The pH is adjusted to 7.4 (by phosphoric acid normal and normal caustic soda) before and after sterilization in the fermentor (30 minutes at 121 ° C). The glucose is sterilized separately, at pH 4.0

(PH adjusted with the normal phosphoric acid) for 30 minutes at

121 ° C. The medium is sterilized in the fermenter for 30 minutes at 121 ° C. Culture in the fermenter is carried out at a temperature of 23 ° C, under a pressure of 0, 15.10 5 Pa (Pa = Pascal) (0.15 bar), with an aeration of 0.3 VVM (volume of air per volume of culture medium per minute), with an axial stirring of 200 revolutions per minute, the control of dissolved oxygen is set at 10% (v / v) by regulating the stirring rate. After 24 hours of fermentation, measuring the enzyme activity of the culture thus obtained by the following technique. - 15

The hydrolysis of triolein is quantified by neutralizing the fatty acids liberated under the action of the lipase. This measurement is performed using an automatic titration apparatus, the apparatus which maintains the pH constant at a desired value by the addition of NaOH 0.01 N. A lipase unit (LU) is defined as the amount of enzyme which catalyzes the release of one micromole fatty acid per minute under the standard conditions of the test described below.

Mixing 10 g of triolein (Roth 5423.1) and 10 g of gum ara¬ goat (Fluka 51200) oans 100 ml of distilled water. This mixture is emulsified using an Ultra-Turrax mixer at 13,500 revolutions per minute (axial stirring) for 3 times 5 minutes, maintaining the mixture under nitrogen in an ice bath.

Preparing a dilution buffer containing 2.34 g / 1 NaCl, 2.94 g / 1 of CaCl 2 .2H 2 0 and 0.61 g / 1 Tris (2-amino-2-hydroxymethyl-l, 3 -propane diol).

an automatic titrator is used, with a burette containing 0.01N NaOH, a temperature probe and a pH probe and equipped with a thermostated reactor.

In the reactor thermostatted at 30 ° C was charged a magnetically stirring bar tick, 10 ml of emulsion of triolein and 20 ml of dilution buffer. The pH of the solution thus obtained is adjusted to 9.5 with 0.1N NaOH. Then introduced 0.5 ml of the test sample containing the lipase, the sample is optionally diluted such that it contains a maximum of 5 LU. We control the pH during the first two minutes with 0.01 N NaOH. Then, it records the consumption of sodium hydroxide between 2 and 4 minutes, while keeping the pH constant (volume of sodium hydroxide consumed between 2 and 4 minutes = VI .mu.l).

Then, the same test is carried out by replacing the sample containing the lipase by 0.5 ml of dilution buffer (volume of sodium hydroxide consumed between 2 and 4 minutes = V2 .mu.l).

lipase unit is determined (LU) as follows: 1 LU / ml = (V1-V2) x optional dilution of the sample x 10 By this method, a lipase activity is detected in the culture. Example 3 Preparation of a concentrated solution of lipase

Adjusting the pH of the culture as obtained at the end of fermentation - 16

Example 2, at a pH of 8 with concentrated sodium hydroxide solution 10 N. Then, this culture is added 1% (v / v) Triton X-114 (SERVA 37214). The mixture is stirred gently for 2 hours at 15 ° C.

Then the mixture was added 1% (v / v) Optifloc FC205 (Solvay) in the form of a 10% solution (v / v). The mixture is stirred gently for 1 hour at 15 ° C.

The mixture was centrifuged 15 minutes at 9000 rpm (Beckman J21, JA10 rotor) at a temperature of 4 "C. retains the centrifugation supernatant. centrifuging the supernatant is heated to 40 ° C for 5 minutes.

phase separation is observed. the upper phase is removed. the lower phase was added 35% (v / v) of acetone at 4 ° C. The suspension was incubated 15 minutes at 4 ° C with moderate stirring.

Then, the suspension was centrifuged 15 minutes at 9000 rpm (Beckman J21, JA10 rotor) at a temperature of 4 ° C. It retains the centrifugation supernatant.

the centrifugation supernatant was added acetone at 4 ° C until an acetone concentration of 65% (v / v). The mixture was incubated 16 hours at 4 ° C. Then the mixture 15 minutes at 9000 rpm centrifuged

(Beckman J21, JA10 rotor) at a temperature of 4 ° C. It retains the centrifugation precipitate, which is suspended in 150 ml of a buffer (pH 7) containing 5 mM Brij 58 (ICI), 25 mM CaCl 2 and 20 mM Tris. Then, the suspension was centrifuged, containing the precipitate, 15 minutes

9000 rpm (Beckman J21, JA10 rotor) at a temperature of 4 ° C. It retains the centrifugation supernatant, which forms a concentrated solution of lipase. Example 4 Purification of lipase

To purify the lipase concentrated solution as obtained in Example 3, using the purification techmque involving a hydrophobic interaction chromatography, followed by cation purifi¬ technique employing a molecular sieve chromatography . Following the indications of use recommended by the supplier

(Pharmacia) on the hydro-interaction chromatography column - 17

phobe was charged with a Hiload 16/10 Pharmacia column Phenyl-Sepharose (ref 17-1085-01) with 140 ml of the lipase concentrated solution as obtained in Example 3.

Is used as equilibrium buffer, a 20 mM phosphate buffer at pH 7.2; as an elution buffer, a 20 mM phosphate buffer at pH 7.2 containing 30% (v / v) isopropanol. The flow rate is set at 1.5 ml per minute. Recovering the lipase with the fraction eluted with phosphate buffer containing isopropanol.

Enzyme activity measurement of the fraction by the method described in Example 2.

Diafilter is the eluted fraction containing the lipase, in an Amicon cell fitted with a YM10 membrane with 10 volumes of a buffer (pH 7) containing 25 mM CaCl 2 and 20 mM Tris.

Then, the concentrated diafiltered fraction up to 0.5 ml by ultrafiltration using the same Amicon cell fitted with a YM10 membrane.

Then injecting the concentrated fraction (0.5 ml) over a molecular sieve chromatography column (Superdex 75 HR 10/30 column

Reference Pharmacia 17-1047-01). The separation is initiated by a flow

0.5 ml per minute of a buffer (pH 7) containing 25 mM CaCl and 20 mM Tris.

Three peaks absorbing at 280 nm are separated. Lipase corresponds to the first peak absoφtion at 280nm. Stored the corresponding fraction containing the purified lipase. Example 5 Determination of the sequence N-terminaie

Using the method described by Vandekerkhove J. et al., Eur. J. Biochemistry, 152, 9 (1985), to determine the N-terminal sequence of the lipase.

It implements the fraction containing the purified lipase as obtained in Example 4.

The N-terminal sequence (SEQ ID NO: l) is as follows: Asn Thr Tyr Lys Thr Lys Tyr Ile Pro Leu Val Val Gly His Val Thr Gly

1 5 10 15

Phe Asn Thr Ile Gly Leu Gly 20

This sequence differs from the N-terminal sequences of other lipases 18 -

secreted by other strains of Pseudomonas, in particular sequences published in Enzyme Microb. Technol. 1993 (3), 634-645 pages. example 6

Amino acid sequence The amino acid sequence of the lipase of the present invention is indirectly determined from the nucleotide sequence (SEQ ID NO: 5) of the gene which encodes this lipase, whose production is described in example 17. This is done using the computer program IntelliGenetics Suite Software for Molecular Biology (Release # 5.4) of IntelliGenetics, Inc. USA.

Figure 2 (2a and 2b) shows the nucleotide sequence (SEQ ID NO: 5) of the coding part of the lipase and its amino acid translation (SEQ ID NO: 6).

Lipase is synthesized as a precursor. The precursor of the lipase contains 308 amino acids (SEQ ID NO: 7). the nucleotide sequence was identified (SEQ ID NO: 5) coding for the precursor of the lipase and its amino acid translation (SEQ ID NO: 6).

Identifying the presequence lipase synthesized as a precursor. This is a sequence of 22 amino acids (SEQ ID NO: 10) which constitutes the signal peptide. the corresponding nucleotide sequence was identified (SEQ ID NO: 8).

Then, identifying the amino acid sequence of the mature lipase. The mature lipase contains 286 amino acids (SEQ ID NO: 4).

Figure 1 (Figure la and Figure lb) shows the nucleotide sequence (SEQ ID NO: 2) encoding the mature lipase together with its translation into amino acids (SEQ ID NO: 3). Example 7 Distribution amino acid

The amino acid distribution of the mature lipase determined from the amino acid sequence (SEQ ID NO:) lipase (Example 6), is summarized in Table 2. ΓABLEAU 2

Symbol Amino Acids Number mol% (Molecular weight)

A 28 9,790 alanine

B aspartic acid 0 0

C 2 cysteine ​​0.699

D aspartic acid 10 3.497

E glutamic acid 2.448 7

F phenylalanine 7 2.448

G glycine 35 12,238

H histidine 10 3.497

I isoleucine 14 4.895

K lysine 9 3147

The leucine 22 692 7i

1 M methionine 0.350

N asparagine 25 8.741

P proline 11 3.846

Q glutamine 6 2,098

R arginine 13 4.545

S serine 24 8.392

Threonine T 18 6.294

V valine 29 10.140 5 1.748 w tryptophan

X Unknown 0 0

Y tyrosine 10 3,497 0 0 z glutamine glutamic acid

example 8

cu molecular weight estimate

It is estimated by calculating the molecular weight of the lipase from the amino acid sequence of the mature form of the lipase and from the amino acid sequence of the lipase including the signal peptide, as described in example 6.

Is deduced by calculating a molecular weight of 30093 Daltons for the mature form and a molecular weight of 32365 Daltons for the form comprising the signal peptide. Example 9 Determination of the molecular weight of the lipase by SDS-PAGE analysis

Is performed on the fraction containing the purified lipase as obtained in Example 4, a polyacrylamide gel electrophoresis under denaturing conditions (SDS-PAGE). The gel system used is the PhastSystem from PHARMACIA LKB BIOTECHNOLOGY (dossier use # 110), with gels containing a 10-15% polyacrylamide gradient (v / v). The electrophoresis conditions are those prescribed by the supplier. Is used as control molecular weight markers PHARMACIA LM (Low Molecular Weight) 17-0446-01 reference. The markers used are phosphorylase b (94 kD), albumin (67 kD), ovalbumin (43 kD), the carbonic anhydrase (30 kD), trypsin inhibitor (20.1 kD) and alpha-lactalbumin (14.4 kD).

The gel thus obtained showed that the fraction containing the lipase puri¬ fied as obtained in Example 4, is pure. Staining with Coomassie blue (Fast Coomassie staining,

Pharmacia, use record No. 200) of the gel revealed a polypep- tide having a molecular weight of about 30 (+/- 0.5) kD. example 10

Estimated isoelectric point is estimated isoelectric point of the lipase from the amino acid sequence of the mature form of the lipase and from the amino acid sequence of the lipase including the signal peptide, as described in example 6.

an isoelectric point of 9.95 is deduced for mature form and 10,12 for form comprising the signal peptide. Example 11 Determination of pH optimum of the lipase

Measuring the enzymatic activity of the lipase at different pH according to the method described in Example 2. It is therefore determines the hydrolysis of the substrate (triolein emulsion) following the action of the lipase at different pH values, all other conditions being identical to the standard conditions, as described in example 2, that is to say at a temperature of 30 ° C and a duration of two minutes.

Using the fraction containing the purified lipase as obtained in Example 4.

The results are summarized in Table 3. Table 3

Temperature ° C% Relative Activity

18 19 24 26

30 41 34 45

40 56 45 52

49 91 55 100

60 54 76 43

During the test, the maximum enzymatic activity was measured for the sample placed at a pH of about 9.5 and at a temperature of about 55 ° C. By definition, therefore attributed to this sample enzyme activity relative to 100%. This example shows that the lipase of the invention has an optimum enzymatic activity, measured at a pH of 9.5 in a temperature range between about 40 and about 60 ° C.

This example also shows that the lipase of the invention develops an optimum enzymatic activity, measured at a pH of 9.5, at a temperature of about 55 ° C.

The lipase of the invention develops an enzymatic activity of more than 50% of maximal enzyme activity in a temperature range between about 40 and 60 ° C to a pH of about 9.5. Example 12 Determination of pH optimum of the lipase

Measuring the enzymatic activity of the lipase at different pH according to the method described in Example 2.

is therefore determined hydrolysis of the substrate (triolein emulsion) following the action of the lipase at different pH values, all other conditions being identical to the standard conditions, as described in Example 2, that is, ie at a temperature of 30 ° C and a duration of two minutes.

Using the fraction containing the purified lipase as obtained in Example 4.

The results are summarized in Table 4.

Table 4

PH 1 Relative activity

%

7.0 17

8.0 100

9.0 100

9.5 100

10.0 91

10.5 71

11, 0 72

12.0 47

This example shows that the lipase of the invention develops an optimum enzymatic activity, measured at a temperature of about 30 ° C in a pH range between about 8 and 10.

During the test, the maximum enzymatic activity was measured for the sample placed at a pH of about 9.5 and at a temperature of about 30 ° C. By definition, therefore attributed to this sample enzyme activity relative to 100%. The lipase of the invention develops an enzymatic activity of greater than about 90% of maximal enzyme activity in a pH range between about 8 and about 10 for a temperature of about 30 ° C.

The lipase of the invention develops an enzymatic activity of more than about 70% of maximal enzyme activity in a pH range between about 8 and about 11 for a temperature of about 30 ° C. example 13

Lipase stability vis-à-vis the temperature was incubated part of the fraction containing the purified lipase as obtained in Example 4, at pH 10 and 55 ° C in an aqueous buffer of hardness 15 (buffer containing calcium chloride 1, 98 mM magnesium chloride and 0.69 mM sodium bicarbonate, 2.5 mM).

At regular intervals, as specified in Table 4 (minutes incubation time), we selected a sample of which is measured the enzymatic acti¬ vity by the method described in Example 2. The results are shown in Table 5.

Table 5

Incubation time activity relative minutes%

0100

October 84

20 81

30 79

40 93

50 86

60 80

80 72

100 59

120 59

130 60

140 61

160 61

260 39

1140 25

The deactivation constant (k) over the range 0-260 minutes is 0.000333 min-1. [The constant k is obtained according to deactivation défi¬ nition In (AJ A) = -kt where t is the incubation time, AQ activity relative to the incubation time 0 and A j activity for the time incubation t.] during this test the maximum enzymatic activity was measured for the sample at time 0. by definition, therefore assigned to this sample a relative enzymatic activity of 100%.

From this example it is concluded that the lipase of the invention shows a relative enzymatic activity of at least 55% measured after incubation for 160 minutes at a temperature of 55 ° C and at a pH of 10 in a buffered solution of hardness 15 . It shows a relative enzymatic activity of at least 70% measured after incubation for 80 minutes under these conditions. example 14

Use of a detergent composition containing the lipase

a piece of white cloth is prepared (R. Hoppe GmbH) based on cotton (65%) and polyester (35%) of 10 cm by 10 cm, impregnated with bacon grease and Sudan red. The impregnation of the fabric is performed as follows.

Preparing a homogeneous solution of Sudan Red 7B (SIGMA Cat. No. F 1000) and Bacon Grease (Laru Gmbh) by adding 0.1% (w / w) of Sudan red in the bacon fat. The mixture was heated at 90 ° C until complete dissolution of Sudan red. A cloth roll is immersed in the Sudan Red solution and bacon grease maintained at 90 ° C and continuously moved in this solution at a speed of 0.5 m / minute. Then, the tissue is drained at a constant linear pressure between two rolls. The fabric thus impregnated contains 31.5% (w / w) fat. The impregnated fabric is placed at -18 ° C for 22 hours until complete cristalli¬ zation of fat. The fabric is cut into pieces of 10 cm by 10 cm. Then, the pieces of impregnated fabric were stored at - 18 ° C in the dark.

Preparing a liquid detergent composition containing 4 g / 1 of a detergent powder compact (powder Eurocompact UNILEVER) and various lipase concentrations equivalent to 500, 1000 and 2000 LU / 1, a water hardness of 15 (water containing 1 calcium chloride, 98 mM magnesium chloride 0.69 mM and 2.5 mM sodium bicarbonate). The initial of the liquid detergent composition pH is about 10. It implements such lipase obtained in Example 4, which is diluted with water of hardness 15 to obtain concentrations desired.

Then, the tissue is washed impregnated bacon grease and Sudan red with 200 ml of the liquid detergent composition in a reactor

250 ml. The washing takes place at 35 ° C for 45 minutes with stirring at 40 RPM (stirring and fro 20 seconds). After washing, the tissue was rinsed three times with 200 ml of distilled water and then dried at 22 ° C between two papers for 24 hours. Then, one determines the reflectance (RL) at 460 nm of the dried fabric using a colorimeter (Tricolor LFM 3).

We reproduced this test three times, that is to say three times then performs the wash cycle with the liquid detergent composition containing the lipase and the rinse cycle in the same tissue sample without soak Sudan Red and bacon grease between each cycle. The end of each cycle, is determined at 460 nm reflectance of the dried fabric.

Strictly identical test is performed with a composition déter¬ gente containing no lipase. The end of each cycle, is determined reflectance (RO) at 460 nm of the dried fabric. wash performance is defined in% as the difference between the reflectance (RL) obtained with the washing in the presence of lipase and reflectors - 25

iance (RO) obtained with the washing in the absence of lipase, that is to say RL - RO expressed in%.

-the results of this example show that the lipase of the invention is effective at low enzyme dosage in the detergent composition. The results of this example also show that the lipase of the invention is particularly effective in the second wash cycle and that it retains increased efficiency after three and four wash cycles. In particular, the lipase is particularly effective at a concentration of 500 LU / 1 after three washing cycles. In addition, the lipase shows particularly effective in the concen¬ tration of 1000 LU / 1 from the first wash cycle. Lipase proves particularly effective at a concentration of 1000 LU / 1 for all wash cycles. Example 15 Cloning of the Pseudomonas lipase gene wisconsinensis T 92 677/1 1. Extraction of chromosomal APN from the strain Pseudomonas wisconsinensis T 92 677/1

Genomic DNA is prepared following the procedure described by Wilson, 1990, Current Protocols in Molecular Biology, vol. 1 (Unit 2.4), with the modifications described below.

From the culture, as obtained in Example 2, a 200 ml culture of the strain of Pseudomonas wisconsinensis T 92 677/1 is carried out in LB growth medium for 16 hours at 37 ° C. The composition of LB growth medium is as follows: TRYPTONE (DIFCO) 10 g / 1, yeast extract 5 g / 1 NaCl 10 g / 1.

The resultant culture was centrifuged (Sorvall RC 5C Plus, SS-34 rotor) at 2000g for 15 minutes. The resulting pellet is taken up in a solution containing 9.5 ml of TE buffer at pH 8.0; 500 .mu.l of a solution of SDS (sodium dodecyl sulfate) to 10% (w / v); and 50 .mu.l of proteinase K solution (sold by

BOEHRINGER Mannheim) at 20 mg / ml φréparée extemporaneously).

TE buffer (pH 8.0) consists of 10 mM TRIS-HC1 (TRIS-HC1 = Tris (hydroxymethyl) aminomethane) -HCl) and ImM EDTA (ethylenediaminetetraacetic acid). The suspension thus obtained, containing the pellet is incubated 90 minutes at 65 ° C. 26

Then, 1.8 ml are added to this suspension a solution of 5M NaCl and 15 ml of a solution of CTAB / NaCl in 10% (w / v) (CTAB = ammonium bromide cetyltriméthyle, NaCl 0 , 7 M). The suspension thus obtained is incubated 20 minutes at 65 ° C. A lysate is obtained. Is carried out from this lysate extracted with 15 ml of chloroform / isoamyl alcohol (3-methyl-l-butanol) 24/1 under the conditions and following the procedures described in Molecular Cloning - a laboratory manual - SAMBROOK , FRITSCH, MANIAΗS - second edition, 1989, on page E.3, until a clean interface, as described therein.

To the recovered aqueous phase was added 0.6 volumes (v / v) isopropanol, a viscous suspension is obtained.

DNA content is precipitated in the viscous suspension according to the technique described in Sambrook et al., 1989, p. 9.18. The precipitated DNA was wound around a Pasteur pipette, then washed three times with 70%

(V / v) ethanol. The washed DNA was dried 5 minutes in air at room temperature. The dried DNA was suspended in 2.5 ml of TE buffer at pH 8.0.

2. Construction of a genomic library of Pseudomonas wisconsinensis T 92 677/1

From the suspension obtained above, the chromosomal DNA (15 mcg) of Pseudomonas wisconsinensis T 92 677/1 is partially cleaved with the restriction enzyme Sau3AI. Is implemented by the serial dilution method of the restriction enzyme and the restriction conditions are those described in Sambrook et al. 1989, pages 5.28-5.32.

Cleavage is partially inhibited by the addition of EDTA iμl 0.5 M pH 8.0 in the presence of ice.

Is determined on the agarose gel fractions obtained after cleavage, which contain fragments having a size of between 20 and 40 kbp. All the fragments thereby obtained is then subjected to a precipitation according to the method described in Sambrook et al. 1989, p. 9.18.

The DNA fragments are then ligated according to the method described by Sambrook et al. 1989, pages 1.68-1.69, with plasmid pRG930 (750 ng), previously cut at the BamHI site as described by

Sambrook et al. 1989, pages 1.60-1.61. This gives a collection of 27

plasmids which are called pRG930 :: WI.

The method for obtaining plasmid pRG930 is described in Molecular Plant-Microbe Interactions, 1992, vol. 5 (3), 228-234 pages.

The ligation thereby obtained is used to transfect cells of E. coli HB101 (Promega) using the kit sold under the name

GIGAPACK π KIT PACKAGING EXTRACT (STRATAGENE) and following the manufacturer's recommendations for use.

The I transfected cells. coli HB101 were cultured on Petri dishes containing LB agar medium, 25 g / ml streptomycin and 50 mcg / ml spectinomycin, for about 24 hours at 37 ° C. Thus, a collection of transfected strains which are called E.coli HB101 (pRG930:: WI).

From 12 E colonies. coli HB101 (pRG930 :: WI) selected at random, are isolated DNA fragments according to the method described in Sambrook et al., 1989, page 1.85.

It performs a restriction analysis of these DNA fragments (Sambrook et al., 1989, p 1.85) after cleavage with EcoRI and PstI restriction enzymes.

This analysis indicates that the size of the inserted fragment present in plasmid pRG930:: W is between about 20 and 30 kbp (kbp = 1000 base pairs) and that these fragments are different from each other. This indicates that the genomic library which has been incorporated is representative.

1500 E colonies. coli HB101 (pRG930 :: WI) are then cultured on Petri dishes containing LB agar medium, 25 g / ml streptomycin and 50 mcg / ml spectinomycin, for about 24 hours at 37 ° C. These 1500 E colonies. coli HB101 (pRG930 :: WI) constitute the genomic library.

3. Obtaining chromosomal fragment containing the Pseudomonas lipase gene wisconsinensis T 92 677/1

Finally to determine the nucleotide sequence of a probe adapted to screen the genomic library, is taken as the initial baseline N-terminal sequence of the lipase from Pseudomonas wisconsinensis T 92 677/1, as obtained in Example 5 . to raise the maximum ambiguity in translation of amino acids to nucleotides, taking into account both the sequences of 28

nucleotide several lipases produced by various strains of Pseudomonas and published in J. Gilbert et al., Enzyme Microbiological Technology, 1993, 15, p. 634-645, and, secondly, the property known as the "codon usage" of the strain of Pseudomonas aeruginosa and published in West S. et al. , Nucleic Acid Research, 1988, 16, p. 9323-9335. Based on these elements is established the sequence of a synthetic oligonucleotide of 72 bp (bp = base pair). This synthetic oligonucleotide was prepared according to the procedure described in Beaucage et al. (1981), Tetrahedron Letters, 22, pages 1859 to 1882 and using / 3-cyanoethyl phosphoramidites in a Biosearch Cyclone apparatus SYNTHESIZER. aa sequence of this synthetic oligonucleotide is: SEQ ID NO: 11 '- AACTACACCAAGACCAAATACCCCATCGTGCTGGTCCA - - CGGCGTGACCGGCTTCAACACTATCGGCGGGCTC -

This synthetic oligonucleotide is labeled at the terminal by means of T - ^ 2 P ATP with T4 enzyme kinase polynucleotide following the procedure described in the kit SequiTherm CYCLE SEQUENCING KIT (BYOZYME). Screening is performed on the genomic library by the technique known as "colony blotting" (Amersham) using the synthetic oligonucleotide as a probe as prepared above.

1500 colonies from the genomic library (E. coli HB101 (pRG930:: WI)) were cultured for 18 hours at 37 ° C of said membranes "Hybond-N ^" (Amersham) following the technique indicated by the maker.

Membranes (400 cmr) are placed in plastic bags containing 45 ml of préhybridisation solution.

The solution

Figure imgf000030_0001
contains 15 ml 20X SSC (3 M NaCl and 0.3 M sodium citrate, pH 7.0), 5 ml of Denhardt's solution and 500 ug denatured salmon sperm DNA and fragmented (Amersham) .

500 ml of Denhardt's solution contains 5 g of 400 type FICOLL (Pharmacia), 5 g of polyvinylpyrrolidone and 5 g of bovine serum albumin.

The membranes placed in plastic bags are incubated at 68 ° C - 29 -

in a water bath with shaking (100 rpm, amplitude of about 2.54 cm) for 4 hours.

The membranes are then incubated with a solution of hybridization at 68 ° C in a water bath with stirring (1U0 rpm, amplitude of about 2.54 cm) for 18 hours.

The hybridization solution was prepared by mixing 5 ml of the solution préhybridisation preheated to 68 ° C and labeled synthetic oligonucleotide, and having been incubated in a water bath for 5 minutes, the final concentration of the synthetic oligonucleotide is 0.3 pMol. The membranes are then recovered. The membranes were then washed with a solution containing 100 ml of 2X SSC (NaCl 0.3 M and sodium citrate 0.03 M, pH 7.0) and 0.1% (w / v) SDS for 5 minutes at room temperature.

Then, the washed membranes were dried between two absorbent papers. The dried membranes are covered with a transparent plastic sheet of food grade. They are then subjected to autoradiography with X-ray (AMERSHAM).

The strain of Pseudomonas wisconsinensis T 92 677/1 is used as a positive control and E. coli strains. coli HB101 and E.. coli HB101 (pRG930) are used as negative control.

The strain of E. coli HB101 (pRG930) was obtained by the technique of the transformation described in Molecular Cloning, a Laboratory Manual - MANIAΗS et al. , 1982, Cold Spring Harbor Laboratory, pages 150-151, by using the strain E. coli HB101 and the plasmid pRG930. a clear and strong signal was observed for the wild strain

Pseudomonas wisconsinensis T 92 677/1 and no signal for E. coli HB101 and E.. coli HB101 (pRG930). Screening of the genomic library highlights 80 colonies giving a signal. This is confirmed by a new hybridization test. A colony of the genomic library having ur strong signal is isolated and cultured on Petri dishes containing LB agar medium, 25 g / ml streptomycin and 50 mcg / ml spectinomycin, for about 24 hours at 37 ° C. This colony is called E. coli HB101 (pRG930 :: WI12). A hybridisation test is again carried out with the E colony. coli HB101 (pRG930 :: WI12) to confirm the results. 30

example 16

Analysis plasmid pRG930 :: WI12 present in the strain of E. coli HB101 (pRG930 :: WI12) - Analysis by the technique known as Southern blotting DNA was isolated from the strain of E. coli HB101 (pRG930 :: WI12), obtained in Example 15, according to the technique described by

Sambrook et al., 1989, pages 1.25-1.28 and is carried out by restriction analysis using EcoRI restriction enzyme. The obtained DNA fragments are separated by electrophoresis on agarose gel according to the method described in Sambrook et al., 1989, pages 6.01-6.19. This analysis shows that the DNA fragment inserted into the plasmid pRG930 :: WI12 has a size of about 27 kbp.

Then, the DNA was transferred to a so-called membrane "Hybond-N +" (Amersham) and hybridization is carried out according to the technique described by the manufacturer as illustrated in Example 15. As a negative control, one uses plasmid pRG930 .

a single band giving a hybridization signal with the synthetic oligonucleotide is observed (SEQ ID NO: 11) on the electrophoresis gel. The fragment carried by this band has a size of about 24.5 kbp, it is linked to the vector pRG930. example 17

nucleotide sequence of the complete gene encoding the lipase of

Pseudomonas wisconsinensis T 92 677/1

1. Obtaining the strain Pseudomonas wisconsinensis RC13

restriction analysis of the plasmid pRG930 :: WI12 is carried out using the restriction enzyme EcoRI. The DNA fragments obtained were separated by electrophoresis on agarose gel.

Analysis is carried out using the technique of Southern blotting as described in Example 16.

This shows that the fragment inserted into plasmid pRG930 :: WI12 is formed, firstly, 4 fragments which together have a size of about 18.5 kbp and, secondly, an attached moiety the vector pRG930. This fragment has a size of about 8.5 kbp.

The fragment of 8.5 kbp, attached to the vector pRG930, gives a hybridization signal with the synthetic oligonucleotide (SEQ ID NO: 11), the other 4 fragments give no signal.

The fragment of 8.5 kbp attached to pRG930 vector is then ligated on itself according to the method described by Sambrook et al., 1989, pages 1.68-1.69. Obtained plasmid pRG930 :: WI13.

The ligation thereby obtained is used to transform cells of E. coli DH5a (GIBCO) as described in Sambrook et al., 1989, page 1.82-1.84.

There is obtained a colony of E. coli DH5a (pRG930 :: WI13) which is isolated and cultured on Petri dishes containing LB agar medium, 25 g / ml streptomycin and 50 mcg / ml spectinomycin, for about 24 hours at 37 ° C. It establishes a partial restriction map of plasmid pRG930 :: WI13 using the technique described in Molecular Cloning, a Laboratory Manual. - MANIAΗS et al, 1982, Cold Spring Harbor Laboratory, 374-379 pages, and by using enzymes Clal restriction, EcoRI, NcoI, SalI, HindIII, BglII, XhoI, BamHI, SmaI, SacI, SacII, KpnI, SphI, XbaI, EcoRV and Spel.

2. Identification of the lipase nucleotide sequence

plasmid by restriction analysis was carried out pPRG930 :: WI13, using the PstI restriction enzyme. The DNA fragments obtained were separated by electrophoresis on agarose gel. Analysis is carried out according to the technique of Southern blotting as described in Example 16.

This shows that the fragment inserted into plasmid pRG930 :: WT13 is formed, firstly, of 5 fragments and, secondly, a small fragment. This small fragment has a size of about 2.5 kbp. The fragment of 2.5 kbp gives a hybridization signal with the synthetic oligonucleotide (SEQ JD NO: 11), the other five fragments give no signal.

The fragment of 2.5 kbp was ligated with the vector pPRG930 by the method described by Sambrook et al., 1989, pages 1.68-1.69. Is obtained plasmid pRG930:: WI14.

From the plasmid pRG930 :: WI14, the fragment of 2.5 kbp was inserted into the plasmid pBLUESCRIPT.

The pBLUESCRIPT plasmid can be obtained from the company Stratagene. Obtained plasmid pBLUESCRIPT :: WI14.

The sequence fragment of 2.5 kbp inserted into plasmid 32

pBLUESCRIPT:: WI14 is achieved by implementing the SEQUΓΓHERM CYCLE SEQUENCING KIT kit (BIOZYM) and following the procedure recommended by the manufacturer.

To complete and confirm the nucleotide sequence obtained, repeats the above example with the following modification. analysis is performed by restriction of plasmid pPRG930 :: WI14, by performing successively SalI restriction enzymes, KpnI and SacII in place of the restriction enzyme PstI.

Identifying the nucleotide sequence of lipase from Pseudomonas wisconsinensis T 92 677/1. The amino acid sequence and the nucleotide sequence (SEQ ID NO: 2) coding for the mature lipase, as well as its amino acid translation (SEQ ID NO: 3), is given in Figure 1 (Figures la and lb ).

It is verified that the first amino acid of the lipase sequence thus identified, corresponding to the N-terminal sequence determined in Example 5.

Lipase is synthéti.sée form of a precursor. The precursor contains 308 amino acids (SEQ ID NO: 7). the nucleotide sequence was identified (SEQ ID NO: 5) coding for the precursor of the lipase, as well as its amino acid translation (SEQ ID NO: 6).

The precursor contains the 286 amino acid sequence (SEQ ID NO: 4) of the mature lipase and the sequence of 22 amino acids (SEQ ID NO: 10) of the presequence.

The mature lipase sequence is preceded by a presequence. It is an additional sequence of 22 amino acids (SEQ ID NO: 10).

the corresponding nucleotide sequence was identified (SEQ ID NO: 8) and its translation into amino acids (SEQ ID NO: 9). This presequence codes for the Pseudomonas lipase signal peptide wisconsinensis T 92 677/1. SEQUENCE LISTING (1) GENERAL INFORMATION:

(I) APPLICANT:

(A) NAME: SOLVAY (-Anonymous Company)

(B) STREET: Rue du Prince Albert, 33

(C) CITY: Brussels

(E) COUNTRY: Belgi-that

(F) POSTAL CODE: 1050

(Ii) TITLE OF INVENTION: Lipase, the producing microorganism, preparation method of this lipase and uses thereof

(Iii) NUMBER OF SEQUENCES: 11

(Iv) READABLE:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: PatentIn Release # 1.0, Version # 1.30 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS:

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: N-terminal

(Vi) ORIGINAL:

(A) ORGANISM: Pseudomonas

(B) STRAIN: Pseudomonas wisconsinensis

(C) INDIVIDUAL / ISOLATED: T 92 677/1

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

Asn Thr Tyr Lys Thr Lys Tyr Ile Pro Leu Val Val His Gly Val Thr 1 May 10 15

Phe Gly Asn Thr Ile Gly Leu Gly 20

(2) INFORMATION FOR SEQ ID NO: 2:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 861 base pairs

(B) TYPE: nucleotide (C) STRANDEDNESS: Simple

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: DNA (genomic) (v) FRAGMENT TYPE: internal

(Vi) ORIGINAL:

(A) ORGANISM: Pseudomonas

(B) STRAIN: Pseudomonas wisconsinensis

(C) INDIVIDUAL / ISOLATED: T 92 677/1

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

AACTACACCA AGACCAAGTA TCCGATCGTG CTGGTACACG GCGTGACCGG GTTCAûTACC 60

ATCGGCGGGC TGGTCAATTA CTTCCATACC ATTCCCTGGA ACCTAGAGCG CGATGGCGCC 120

CGGGTGCACG TCGCCAGTGT CGCTGCCTTC AATGACAGCG AGCAGCGCGG CGCCGAGCTG 180

GCCCGGCAGA TCGTGCCCTG GGCCGCAGGC GGAGGCGGCA AGGTCAACCT GATCGGCCAC 240

AGTCAGGGCT CGCCGACCTC GCGCGTGGCG GCTTCGTTGC GGCCGGATCT GGTGGCATCG 300

GTGACCTCGA TCAACGGCGT CAACAAGGGC TCCAAGGTCG CCGATGTGGT GCGCGGCGTG 360

CTGCCACCGG GTAGCGGTAT CGAAGGCGGC GCCAATGCCA TCGCCAACGC CCTCGGTGCG 420

GTGATCAATC TGCTGTCTGG CTCAAGCAAC CCGCAAAACG GTATCAACGC GCTAGGCACC 480

CTGACCACCG CGGGCACCAG TGCGCTGAAC AGTCGCCACC CGTGGGGCGT CAACACCAGC 540

AGCTACTGCG CCAAGTCCAC CGAAGTGCAC AATGTGCGCG GTCACAGCAT CCGCTACTAC 600

TCCTGGACCG GTAATGCCGC CTATACCAAC GTGCTCGATG CGGCCGATCC CTTCCTGGCC 660

TTCACCGGCC TGGTGTTCGG CAGCGAGAAG AACGACGGTC TGGTGGGCGT ATGTTCCACC 720

TATCTGGGGC AGGTGATCGA CGACAGCTAC AACATGAACC ACGTCGATGC GATCAACCAC 780

CTGTTCGGCA TTCGTGGCTG GACCGAACCG GTGTCGCTGT ATCGCCAGCA CGCCAACCGC 840

CTGAAGAACA AGGGCGTCTG A 861

(2) INFORMATION FOR SEQ ID NO: 3:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 861 base pairs

(B) TYPE: nucleotide

(C) STRANDEDNESS: Simple

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME / KEY: CDS

(B) LOCATION: 1..858

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

AAC TAC AAG ACC ACC AAG CGC TAT ATC GTG CTG GTA CAC ACC GTG GGC 48 Thr Asn Tyr Lys Thr Lys Tyr Ile Pro Leu Val Val His Gly Val Thr 1 May 10 15

GGG TTC AAT ACC ATC GGC GGG CTG GTC AAT TAC CAT TTC ACC ATT CCC 96 Gly Phe Ile Gly Thr Asn Gly Leu Val Asn His Tyr Phe Thr Ile Pro 20 25 30

TGG AAC CTA GAG CGC GTG GAT GGC CCG CGG CCG CAC GTC AGT GCT GTC 144 Trp Asn Leu Glu Arg Ala Asp Gly Arg Val Val His Ala Ser Val 35 40 45 Aia

GCC TTC AAT GAG GAC AGC CAG GGC CGC GCC GAG CTG CGG CCG CAG ATC 192 Phe Ala Asn Asp Ser Glu Glu Gin Arg Gly Ala Leu Ala Arg Gln Ile 50 55 60

GTG CCC CCG TGG GCA GGC GGA GGC GGC GTC AAG AAC CTG GGC ACC ATC 240 Val Pro Trp Ala Ala Gly Gly Gly Gly Lys Val Leu Asn Ile Gly His 65 70 75 80

AGT CAG GGC TCG CCG TCG ACC CGC GTG GCG GCT TTG TCG CGG CCG GAT 288 Ser Gln. Gly Ser Pro Ser Thr Arg Ala Val Ala Ser Leu Arg Pro Asp 85 90 95

CTG GTG GCA GTG TCG ACC TCG GGC ATC AAC GTC AAG AAC GGC TCC AAG 336 Leu Ala Ser Val Val Thr Ile Ser Asn Gly Val Lys Gly Asn Ser Lys 100 105 110

GTC GCC GAT GTG GTG CGC GGC GTG CTG CGC CCA AGC GGT GGT ATC GAA 384 Val Ala Asp Arg Val Val Gly Val Pro Pro Leu Gly Ser Gly Ile Glu 115 120 125

GGC GGC GCC AAT CCG ATC CCG GGT AAC GCC CTC ATC GCG GTG AAT CTG 432 Gly Gly Ala Asn Ala Ile Ala Asn Ala Leu Ala Gly Val Ile Leu Asn 130 135 140

CTG TCT GGC AGC ATT AAC CAA GCC ATC AAC GGT AC GCG CTA GGC ACC 480 Leu Ser Gly Ser Ser Asn Pro Asn Gly Ile Gin Leu Ala Asn Gly Thr 145 150 155 160

CTG GGC ACC ACC ACC GCG GCG CTG AAC AGT AGT CGC CAC CGC GGC TGG 528 Leu Thr Thr Ala Gly Ser Thr Ala Leu Asn Ser Arg His Pro Trp Gly 165 170 175

GTC AAC ACC AGC AGC TAC TGC TCC GCC AAG GAA ACC GTG CAC AAT GTG 576 Val Asn Thr Ser Tyr Ser Cys Ser Ala Lys Thr Glu Val His Asn Val 180 185 190 -36

CGC GGT CAC AGC ATC CGC TCC TAC TAC TGG ACC AAT GGT GCC GCC TAT 624 Arg Gly His Ser Ile Arg Tyr Tyr Ser Trp Thr Gly Asn Tyr Ala Ala 195 200 205

AAC ACC GTG CTC GAT GCG CCG TTC CCC GAT CTG GGC GCC ACC TTC CTG 672 Asn Thr Val Leu Asp Ala Phe Ala Asp Pro Leu Ala Phe Thr Gly Leu 210 215 220

GTG GGC AGC TTC GAG AAG AAC GAC GGT CTG GTG GTA TGT GGC TCC ACC 720 Val Phe Gly Ser Glu Lys Asn Gly Asp Leu Gly Val Val Cys Ser Thr 225 230 235 240

TAT CTG GGG GTG CAG ATC GAC AGC GAC TAC AAC ATG GAT GTC AAC CAC 768 Tyr Gin Gly Leu Val Asp Ile Asp Ser Tyr Met Asn Asn His Val Asp 245 250 255

GCG ATC AAC CAC TTC CTG GGC ATT CGT GGC TGG ACC GAA GCC GTG TCG 816 Ala Ile Leu Asn His Gly Phe Ile Arg Gly Trp Thr Val Ser Glu Pro 260,265,270

CTG TAT GCC AGC CAC AAC GCC GCC CTG AAC AAG AAG GGC GTC TGA 861

Leu Tyr Arg His Gin Ala Asn Arg Leu Lys Asn Lys Gly Val 275 280 285

(2) INFORMATION FOR SEQ ID NO: 4:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 286 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: protein

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Asn Thr Tyr Lys Thr Lys Tyr Ile Pro Leu Val Val His Gly Val Thr 1 May 10 15

Gly Phe Ile Gly Asn Thr Gly Val Leu Asn His Tyr Phe Thr Ile Pro 20 25 30

Trp Asn Glu Leu Arg Asp Gly Ala "rg Val His Ala Val S-. * - Val Ala 35 40 45

Ala Asn Phe Asp Ser Glu Gln Arg Gly Ala Leu Ala Glu Arg Gln Ile 50 55 60

Val Pro Trp Ala Ala Gly Gly Gly Gly Lys Val Ile Leu Asn Gly His 65 70 75 80

Ser Gln Gly Ser Pro Ser Thr Arg Ala Val Ala Ser Leu Arg Pro Asp 85 90 95-37

Val Leu Ala Ser Val Thr Ile Ser Asn Gly Val Lys Gly Asn Ser Lys 100 105 110

Val Ala Asp Arg Val Val Gly Val Pro Pro Leu Gly Ser Gly Ile Glu 115 120 125

Gly Gly Asn Ala Ala Ile Ala Asn Ala Leu Ala Gly Val Ile Leu Asn 130 135 140

Leu Ser Gly Ser Ser Asn Pro Asn Gly Ile Gin Leu Ala Asn Gly Thr 145 150 155 160

Leu Thr Thr Ala Gly Ser Thr Ala Leu Asn Ser Arg His Pro Trp Gly 165 170 175

Val Asn Thr Ser Tyr Ser Cys Ser Ala Lys Thr Glu Val His Asn Val 180 185 190

Arg Gly His Ser Ile Arg Tyr Tyr Ser Trp Thr Gly Asn Tyr Ala Ala 195 200 205

Thr Asn Val Leu Asp Ala Ala Asp Pro Phe Leu Ala Phe Thr Gly Leu 210 215 220

Val Phe Gly Ser Glu Lys Asn Gly Asp Leu Gly Val Val Cys Ser Thr 225 230 235 240

Tyr Gly Gin Leu Val Asp Ile Asp Ser Tyr Met Asn Asn His Val Asp 245 250 255

Ala Ile Leu Asn His Gly Phe Ile Arg Gly Trp Thr Val Ser Glu Pro 260,265,270

Leu Tyr Arg His Gin Ala Asn Arg Leu Lys Asn Lys Gly Val 275 280 285

(2) INFORMATION FOR SEQ ID NO: 5:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 927 base pairs

(B) TYPE: nucleotide

(C) STRANDEDNESS: Simple

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: ATGCGTCGCG TCTATACCGC TGCCCTGGCA ACACTCGCTC TGCTTGGCGC CGTCGAGGCC 60 CAGGCCAACT ACACCAAGAC CAAGTATCCG ATCGTGCTGG TACACGGCGT GACCGGGTTC 120 AATACCATCG GCGGGCTGGT CAATTACTTC CATACCATTC CCTGGAACCT AGAGCGCGAT 180 -38-

GGCGCCCGGG TGCACGTCGC CAGTGTCGCT GCCTTCAATG ACAGCGAGCA GCGCGGCGCC 240

GAGCTGGCCC GGCAGATCGT GCCCTGGGCC GCAGGCGGAG GCGGCAAGGT CAACCTGATC 300

GGCCACAGTC AGGGCTCGCC GACCTCGCGC GTGGCGGCTT CGTTGCGGCC GGATCTGGTG 360

GCATCGGTGA CCTCGATCAA CGGCGTCAAC AAGGGCTCCA AGGTCGCCGA TGTGGTGCGC 420

GGCGTGCTGC CACCGGGTAG CGGTATCGAA GGCGGCGCCA ATGCCATCGC CAACGCCCTC 480

GGTGCGGTGA TCAATCTGCT GTCTGGCTCA AGCAACCCGC AAAACGGTAT CAACGCGCTA 540

GGCACCCTGA CCACCGCGGG CACCAGTGCG CTGAACAGTC GCCACCCGTG GGGCGTCAAC 600

ACCAGCAGCT ACTGCGCCAA GTCCACCGAA GTGCACAATG TGCGCGGTCA CAGCATCCGC 660

TACTACTCCT GGACCGGTAA TGCCGCCTAT ACCAACGTGC TCGATGCGGC CGATCCCTTC 720

CTGGCCTTCA CCGGCCTGGT GTTCGGCAGC GAGAAGAACG ACGGTCTGGT GGGCGTATGT 780

TCCACCTATC TGGGGCAGGT GATCGACGAC AGCTACAACA TGAACCACGT CGATGCGATC 840

AACCACCTGT TCGGCATTCG TGGCTGGACC GAACCGGTGT CGCTGTATCG CCAGCACGCC 900

AACCGCCTGA AGAACAAGGG CGTCTGA 927

(2) INFORMATION FOR SEQ ID NO: 6:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 927 base pairs

(B) TYPE: nucleotide

(C) STRANDEDNESS: Single

(D) TOPOLOGY: linear

(N) MOLECULE TYPE: DNA (genomic)

(Ix) FEATURE:

(A) NAME / KEY: sigjpeptide

(B) LOCATION: 1..66

(Ix) FEATURE:

(A) NAME / KEY: mat_peptιde

(B) LOCATION: 67..924

(Ix) FEATURE:

(A) NAME / KEY. CDS

(B) convenient location: 1..924

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6

ATG CGT CGC GTC TAT GCT ACC CTG GCA GCC ACA GCT CTC CTT CTG GGC 48 Met Arg Arg Val Thr Ala Tyr Ala Leu Ala Thr Leu Ala Gly Leu Leu -22 -20 -15 -10 39 -

CCG GTC GAG GCC CAG GCC AAC TAC AAG ACC CGC TAT ACC AAG GTG ATC 96 Ala Val Glu Ala Gln Asn Ala Thr Tyr Lys Thr Lys Tyr Ile Pro Val -5 1 May 10

GTA CAC CTG GGC ACC GGG GTG TTC AAT ACC ATC GGC GGG CTG GTC AAT 144 Leu Thr Val His Gly Val Gly Phe Ile Gly Thr Asn Gly Leu Val Asn 15 20 25

TAC TTC CAT TGG AAC ACC ATT CCC CTA GAG GAT GGC CGC CCG CGG GTG 192 His Tyr Phe Thr Ile Pro Asn Trp Leu Glu Arg Ala Asp Gly Arg Val 30 35 40

CAC GTC GTC GCC AGT GCT GCC TTC AAT GAG GAC AGC CAG CGC GGC GCC 240 His Val Ala Ser Val Ala Ala Phe Ser Glu Asp Asn Gln Arg Gly Ala 45 50 55

GAG CTG CAG CCG CGG ATC TGG GTG CCC GCC GCA GGC GGA GGC GGC AAG 288 Glu Leu Ala Arg Gln Ile Val Pro Trp Ala Ala Gly Gly Gly Gly Lys 60 65 70

GTC AAC CTG CAC ATC GGC AGT CAG GGC TCG CCG TCG ACC CGC GTG GCG 336 Val Leu Asn Ile Gly His Ser Gln Gly Thr Ser Pro Ser Arg Ala Val 75 80 85 90

TCG GCT TTG CGG GAT CGC CTG GTG GTG GCA TCG TCG ATC ACC AAC GGC 384 Ala Ser Leu Pro Arg Leu Val Asp Ala Ser Val Thr Ile Ser Asn Gly 95,100,105

GTC AAC TCC AAG AAG GGC GTC GCC GAT GTG GTG CGC GGC GTG CTG CCA 432 Asn Val Lys Gly Ser Lys Val Ala Asp Arg Val Val Gly Val Leu Pro 110 115 120

AGC CGC GGT GGT ATC GAA GGC AAT GGC GCC GCC ATC AAC GCC GCC CTC 480 Pro Ser Gly Gly Ile Glu Gly Gly Ala Ala Asn Ile Ala Asn Ala Leu 125 130 135

GGT ATC GCG GTG AAT CTG CTG TCT GGC AGC ATT AAC CAA AAC GCC GGT 528 Gly Ala Val Ile Leu Leu Asn Ser Gly Ser Ser Asn Pro Asn Gly Gin 140 145 150

ATC GCG CTA GGC AAC ACC CTG ACC ACC GGC ACC GCG GCG CTG AAC AGT 576 Ile Leu Asn Ala Gly Thr Leu Thr Thr Ala Gly Ser Thr Ala Leu Asn 155 160 165 170

AGT CGC CAC CGC GGC TGG GTC AAC ACC AGC AGC TAC GCC TGC AAG TCC 624 Ser Arg His Pro Trp Gly Val Asn Thr Ser Tyr Ser Ala Lys Ser Cys 175 180 185

ACC GAA GTG GTG CAC AAT CGC GGT CAC AGC ATC CGC TCC TAC TAC TGG 672 Thr Glu Val His Asn Val Arg His Ser Gly Ile Arg Tyr Tyr Ser Trp 190 195 200 40 -

ACC GGT AAT GCC GCC TAT AAC ACC GTG CTC GAT GCG GCC CCC GAT TTC 720 Asn Thr Gly Ala Ala Tyr Thr Asn Val Leu Asp Ala Ala Asp Pro Phe 205 210 215

CTG GCC TTC ACC GGC CTG GTG TTC AGC GGC AAC GAG AAG CTG GAC GGT 768 Leu Ala Phe Thr Gly Leu Val Phe Gly Ser Glu Lys Asn Gly Asp Leu 220 225 230

GTG GGC TAT GTA TGT TCC ACC CTG GGG CAG GTG ATC GAC GAC AGC TAC 816 Val Gly Val Cys Leu Gly Tyr Ser Thr Val Gln Asp Ile Asp Ser Tyr 235 240 245 250

AAC AAC ATG CAC GTC GAT ATC GCG AAC CAC TTC CTG ATT GGC CGT GGC 864 Asn Met Asn His Val Asn Asp Ala Ile His Leu Gly Phe Ile Gly Arg 255 260 265

TGG ACC GAA GCC GTG TCG CTG TAT GCC AGC CAC AAC GCC GCC CTG AAG 912 Trp Thr Val Glu Pro Tyr Ser Leu Arg His Gln Arg Leu Lys Ala Asn 270 275 280

AAC AAG GGC GTC TGA 927

Lys Asn Gly Val 285

(2) INFORMATION FOR SEQ ID NO: 7:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 308 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: protein

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

Met Arg Arg Val Thr Ala Tyr Ala Leu Ala Thr Leu Ala Gly Leu Leu -22 -20 -15 -10

Ala Val Ala Glu Ala Gln Asn Thr Tyr Lys Thr Lys Tyr Ile Pro Val -5 1 May 10

Leu Val His Gly Val Gly Thr Phe Thr Ile Asn Gly Gly Leu Va]. Asn 15 20 25

Tyr Phe Thr His Ile Pro Trp Asn Leu Glu Arg Ala Asp Gly Arg Val 30 35 40

His Ser Val Ala Val Ala Ala Phe Ser Glu Asp Asn Gln Arg Gly Ala 45 50 55

Glu Leu Ala Arg Gln Ile Val Pro Trp Ala Ala Gly Gly Gly Gly Lys 60 65 70 41

Val Asn Leu Ile Gly His Ser Gln Gly Thr Ser Pro Ser Arg Ala Val 75 80 85 90

Ala Ser Leu Arg Leu Pro Asp Val Ala Ser Val Thr Ile Ser Asn Gly 95,100,105

Val Gly Ser Asn Lys Lys Val Ala Asp Arg Val Val Gly Val Leu Pro 110 115 120

Pro Gly Ser Gly Gly Gly Ala Ile Glu Asn Ala Ala Ile Asn Ala Leu 125 130 135

Ala Gly Val Ile Leu Asn Leu Ser Gly Ser Ser Asn Pro Asn Gly Gin 140 145 150

Ile Asn Leu Ala Gly Thr Leu Thr Thr Ala Gly Ser Thr Ala Leu Asn 155 160 165 170

Ser Arg His Pro Trp Gly Val Asn Thr Ser Tyr Ser Ala Lys Ser Cys 175 180 185

Thr Glu Val His Asn Val Arg His Ser Gly Ile Arg Tyr Tyr Ser Trp 190 195 200

Thr Gly Asn Tyr Ala Ala Thr Asn Val Leu Asp Ala Ala Asp Pro Phe 205 210 215

Leu Ala Phe Thr Gly Leu Val Phe Gly Ser Glu Lys Asn Gly Asp Leu 220 225 230

Val Gly Val Cys Tyr Ser Thr Leu Gln Gly Val Ile Asp Ser Tyr .asp 235 240 245 250

Met Asn Asn His Val Asn Asp Ala Ile His Leu Gly Phe Ile Gly Arg 255 260 265

Trp Thr Val Glu Pro Tyr Ser Leu Arg His Gln Arg Leu Lys Ala Asn 270 275 280

Lys Asn Gly Val 285

(2) INFORMATION FOR SEQ ID NO: 8:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 66 base pairs

(B) TYPE: nucleotide

(C) STRANDEDNESS: Simple

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: ATGCGTCGCG TCTATACCGC TGCCCTGGCA ACACTCGCTC TGCTTGGCGC CGTCGAGGCC 60 CAGGCC 66

(2) INFORMATION FOR SEQ ID NO: 9:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 66 base pairs

(B) TYPE: nucleotide

(C) STRANDEDNESS: Simple

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: DNA (genomic)

(Ix) FEATURE:

(A) NAME / KEY: CDS

(B) LOCATION: 1..66

(Ix) FEATURE:

(A) NAME / KEY: sig_peptide

(B) convenient location: 1..66

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

ATG CGT CGC GTC TAT GCT ACC CTG GCA GCC ACA GCT CTC CTT CTG GGC 48 Met Arg Arg Val Thr Ala Tyr Ala Leu Ala Thr Leu Ala Leu Leu Gly 1 May 10 15

GTC GCC GAG GCC CAG GCC 66

Glu Ala Val Ala Gln Ala 20

(2) INFORMATION FOR SEQ ID NO: 10:

(I) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: protein

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

Met Arg Arg Val Thr Ala Tyr Ala Leu Ala Thr Leu Ala Leu Leu Gly

January 5 10 15

Glu Ala Val Ala Gln Ala 20

(2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 72 base pairs

(B) TYPE: nucleotide

(C) STRANDEDNESS: Simple

(D) TOPOLOGY: linear

(Ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: / desc = "synthetic oligonucleotide"

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

AACTACACCA AGACCAAATA CCCCATCGTG CTGGTCCACG GCGTGACCGG CTTCAACACT 60

ATCGGCGGGC TC 72

Claims

/ 12012 -., -_ -.
PCT / BE95 / 00094
44
1 - Lipase, characterized in that it is from a strain of Pseudomonas wisconsinensis or a derivative or mutant thereof capable of producing said lipase.
2 - Lipase, characterized in that it is derived from the strain
Pseudomonas wisconsinensis T 92 677/1 (LMG P-15151) or a derivative or mutant thereof capable of producing said lipase.
3 - Lipase, characterized in that its N-terminal amino acid sequence (SEQ ID NO: l) is as follows: Asn Thr Tyr Lys Thr Lys Tyr Ile Pro Leu Val Val His 1 5 10
Val Thr Gly Gly Phe Asn Thr Ile Gly Leu Gly 15 20
4 - Lipase isolated and purified, characterized in that it comprises the amino acid sequence of 1-286 amino acids (SEQ ID NO: 4) or a modified sequence derived therefrom.
5 - Lipase isolated and purified, characterized in that the mature lipase sequence is preceded by a presequence of 22 amino acids (SEQ ID NO: 10) which encodes for the signal peptide of the lipase.
6 - Lipase isolated and purified, characterized in that it has a molecular weight of about 30 kDa.
7 - Lipase isolated and purified, characterized in that it has an estimated isoelectric point between about 9.8 and about 10.1.
8 - Lipase, characterized in that it is from an aerobic bacterium capable of producing the lipase in an appropriate nutrient medium containing sources of carbon and nitrogen and inorganic salts under aerobic condition.
9 - Lipase, characterized in that it develops optimum enzyme activity, measured at a pH of 9.5, in a temperature range above about 40 ° C. 10 - Lipase, characterized in that it develops optimum enzyme activity, measured at a pH of 9.5, in a temperature range lower than about 60 ° C.
11 - Lipase, characterized in that it develops optimum enzyme activity, measured at a pH of 9.5, in a temperature range between about 40 ° C to about 60 ° C.
12 - Lipase, characterized in that it develops optimum enzyme activity, measured at a pH of 9.5, at a temperature of about 55 ° C.
13 - Lipase, characterized in that it develops enzyme activity of more than 50% of maximal enzyme activity in a temperature range between about 40 ° C to about 60 ° C to a pH of about 9.5 , the maximum enzyme activity being measured at a temperature of 55 ° C and at a pH of 9.5.
14 - Lipase, characterized in that it develops optimum enzyme activity, measured at a temperature of about 30 ° C in a pH range greater than or equal to about 8.
15 - Lipase, characterized in that it develops optimum enzyme activity, measured at a temperature of about 30 ° C, within a pH range less than or equal to about 10.
16 - Lipase, characterized in that it develops optimum enzyme activity, measured at a temperature of about 30 ° C in a pH range between about 8 and about 10.
17 - Lipase, characterized in that it develops enzyme activity of more than 85% of maximal enzyme activity in a pH range between about 8 and about 10 for a temperature of about 30 ° C, the activity maximal enzyme being measured at a temperature of 30 ° C and at a pH of 9.5.
18 - Lipase, characterized in that it shows a relative enzymatic activity of at least 55% measured after incubation for 160 minutes at a temperature of 55 ° C and at a pH of 10 d <s buffered saline - 46 -
hardness 15.
19 - An isolated culture and purified Pseudomonas wisconsinensis and derived culture or mutant thereof.
20 - An isolated culture and purified Pseudomonas wisconsinensis T 92 677/1 (LMG P-15151) and culture derived or mutated therefrom.
21 - A DNA molecule comprising the nucleotide sequence (SEQ ID NO: 2) that codes for the mature lipase from Pseudomonas wisconsinensis T 92 677/1 (LMG P- 15151) or a modified sequence derived therefrom.
22 - DNA molecule according to claim 21, characterized in that it comprises the nucleotide sequence (SEQ ID NO: 5) which codes for the precursor of the lipase from Pseudomonas wisconsinensis T 92 677/1 or a modified sequence derived from it.
23 - A process for producing a lipase according to any one of claims 1 to 18, characterized in that it comprises culturing a bacterium capable of producing the lipase in an appropriate nutrient medium containing carbon sources and nitrogen and mineral salts and harvesting the lipase thus obtained.
24 - Process according to claim 23, characterized in that the aerobic bacterium is a strain of Pseudomonas.
25 - Process according to claim 24, characterized in that the aerobic bacterium is the strain Pseudomonas wisconsinensis T 92 677/1 (LMG P- 15151) and a derivative or mutant thereof capable of producing the lipase.
26 - An enzyme composition containing the lipase according to any one of claims 1 to 18 and at least one additive.
27 - The enzyme composition according to claim 26, characterized in that it is a composition of detergency.
28 - Use of lipase according to any one of claims 1 to 18 in detergency.
PCT/BE1995/000094 1994-10-14 1995-10-13 Lipase, microorganism producing same, method for preparing said lipase and uses thereof WO1996012012A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
BE9400930A BE1008783A3 (en) 1994-10-14 1994-10-14 Lipase, micro-organism producing same, method for preparing said lipase anduses thereof
BE9400930 1994-10-14
BE9500850 1995-10-12
BE9500850A BE1008998A3 (en) 1994-10-14 1995-10-12 Lipase, microorganism producing the preparation process for the lipase and uses thereof.

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
MX9702724A MX9702724A (en) 1994-10-14 1995-10-13 Lipase, microorganism producing same, method for preparing said lipase and uses thereof.
AU36929/95A AU3692995A (en) 1994-10-14 1995-10-13 Lipase, microorganism producing same, method for preparing said lipase and uses thereof
EP19950934004 EP0804557A1 (en) 1994-10-14 1995-10-13 Lipase, microorganism producing same, method for preparing said lipase and uses thereof
FI971530A FI971530A (en) 1994-10-14 1997-04-11 Lipase, the producing micro-organism, the method for producing the lipase and its use

Publications (1)

Publication Number Publication Date
WO1996012012A1 true WO1996012012A1 (en) 1996-04-25

Family

ID=25662930

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/BE1995/000094 WO1996012012A1 (en) 1994-10-14 1995-10-13 Lipase, microorganism producing same, method for preparing said lipase and uses thereof

Country Status (7)

Country Link
EP (1) EP0804557A1 (en)
AU (1) AU3692995A (en)
BE (1) BE1008998A3 (en)
CA (1) CA2202553A1 (en)
FI (1) FI971530A (en)
MX (1) MX9702724A (en)
WO (1) WO1996012012A1 (en)

Cited By (355)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997013847A1 (en) * 1995-10-12 1997-04-17 Genencor International, Inc. Expression system, vector and cell transformed thereby
WO2000060058A2 (en) 1999-03-31 2000-10-12 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
WO2000071685A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 132 and 133
WO2000071687A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 129 and 130
WO2000071691A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 125 and 126
WO2000071689A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 127 and 128
WO2000071688A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 126 and 127
WO2000071690A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 128 and 129
US6156552A (en) * 1998-02-18 2000-12-05 Novo Nordisk A/S Lipase variants
WO2002016547A2 (en) 2000-08-21 2002-02-28 Novozymes A/S Subtilase enzymes
WO2002092797A2 (en) 2001-05-15 2002-11-21 Novozymes A/S Alpha-amylase variant with altered properties
WO2003000941A2 (en) 2001-06-26 2003-01-03 Novozymes A/S Polypeptides having cellobiohydrolase i activity and polynucleotides encoding same
WO2003006602A2 (en) 2001-07-12 2003-01-23 Novozymes A/S Subtilase variants
WO2003080827A2 (en) 2002-03-27 2003-10-02 Novozymes A/S Granules with filamentous coatings
WO2004003187A2 (en) 2002-07-01 2004-01-08 Novozymes A/S Mpg added to fermentation
WO2004067739A2 (en) 2003-01-27 2004-08-12 Novozymes A/S Stabilization of granules
WO2004111221A1 (en) 2003-06-19 2004-12-23 Novozymes A/S Proteases
WO2005001064A2 (en) 2003-06-25 2005-01-06 Novozymes A/S Polypeptides having alpha-amylase activity and polypeptides encoding same
WO2005040372A1 (en) 2003-10-23 2005-05-06 Novozymes A/S Protease with improved stability in detergents
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005123911A2 (en) 2004-06-21 2005-12-29 Novozymes A/S Proteases
WO2006002643A2 (en) 2004-07-05 2006-01-12 Novozymes A/S Alpha-amylase variants with altered properties
WO2006032279A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032278A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032277A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2007006305A1 (en) 2005-07-08 2007-01-18 Novozymes A/S Subtilase variants
WO2007019858A2 (en) 2005-08-16 2007-02-22 Novozymes A/S Subtilases
WO2007036235A1 (en) 2005-09-30 2007-04-05 Novozymes A/S Immobilization of enzymes
EP1803817A1 (en) 1998-12-18 2007-07-04 Novozymes A/S Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region
WO2007098756A1 (en) 2006-03-02 2007-09-07 Novozymes A/S High capacity encapsulation process
WO2007107573A1 (en) 2006-03-22 2007-09-27 Novozymes A/S Use of polypeptides having antimicrobial activity
WO2007113241A1 (en) 2006-03-31 2007-10-11 Novozymes A/S A stabilized liquid enzyme composition
WO2007136469A2 (en) 2006-04-14 2007-11-29 Genencor International, Inc. One-step treatment of textiles
WO2008040818A1 (en) 2006-10-06 2008-04-10 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
WO2008057637A2 (en) 2006-07-21 2008-05-15 Novozymes, Inc. Methods of increasing secretion of polypeptides having biological activity
EP1923455A2 (en) 2003-02-18 2008-05-21 Novozymes A/S Detergent compositions
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
EP1975229A2 (en) 2000-10-13 2008-10-01 Novozymes A/S Alpha-amylase variant with altered properties
WO2008118749A2 (en) 2007-03-23 2008-10-02 Novozymes Biologicals, Inc. Preventing and reducing biofilm formation and planktonic proliferation
EP2011864A1 (en) 1999-03-31 2009-01-07 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
EP2045317A1 (en) 2007-10-04 2009-04-08 Lanxess Deutschland GmbH Liquid washing and cleaning agent
EP2128247A1 (en) 2002-12-20 2009-12-02 Novozymes A/S Polypeptides having cellobiohydrolase II activity and polynucleotides encoding same
EP2138574A2 (en) 2002-11-06 2009-12-30 Novozymes A/S Subtilase variants
EP2149786A1 (en) 2008-08-01 2010-02-03 Unilever PLC Improvements relating to detergent analysis
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2202290A1 (en) 2008-12-23 2010-06-30 Unilever PLC A flowable laundry composition and packaging therefor
EP2213723A1 (en) 2009-01-30 2010-08-04 Novozymes A/S Isomaltose for fungus fermentation
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
WO2010104675A1 (en) 2009-03-10 2010-09-16 Danisco Us Inc. Bacillus megaterium strain dsm90-related alpha-amylases, and methods of use, thereof
WO2010108000A1 (en) 2009-03-18 2010-09-23 The Procter & Gamble Company Structured fluid detergent compositions comprising dibenzylidene polyol acetal derivatives and detersive enzymes
WO2010108002A1 (en) 2009-03-18 2010-09-23 The Procter & Gamble Company Structured fluid detergent compositions comprising dibenzylidene sorbitol acetal derivatives
WO2010115028A2 (en) 2009-04-01 2010-10-07 Danisco Us Inc. Cleaning system comprising an alpha-amylase and a protease
WO2010117511A1 (en) 2009-04-08 2010-10-14 Danisco Us Inc. Halomonas strain wdg195-related alpha-amylases, and methods of use, thereof
WO2010127919A1 (en) 2009-05-05 2010-11-11 Unilever Plc Shading composition
EP2267001A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
WO2011005911A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company Method of laundering fabric using a compacted liquid laundry detergent composition
WO2011005917A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company Method of laundering fabric using a liquid laundry detergent composition
WO2011005905A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company A mildly alkaline, low-built, solid fabric treatment detergent composition comprising phthalimido peroxy caproic acid
WO2011005804A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company Method of laundering fabric using a liquid laundry detergent composition
EP2284259A2 (en) 2003-10-10 2011-02-16 Novozymes A/S Protease variants
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
EP2305821A2 (en) 2004-02-13 2011-04-06 Novozymes A/S Protease variants
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011042372A1 (en) 2009-10-08 2011-04-14 Unilever Plc Shading composition
WO2011045195A1 (en) 2009-10-13 2011-04-21 Unilever Plc Dye polymers
WO2011048083A1 (en) 2009-10-21 2011-04-28 Novozymes A/S Method for treatment of oil
WO2011049945A2 (en) 2009-10-23 2011-04-28 Danisco Us Inc. Methods for reducing blue saccharide
WO2011047987A1 (en) 2009-10-23 2011-04-28 Unilever Plc Dye polymers
EP2333055A1 (en) 2000-10-13 2011-06-15 Novozymes A/S Subtilase variants
EP2336331A1 (en) 1999-08-31 2011-06-22 Novozymes A/S Novel proteases and variants thereof
WO2011082889A1 (en) 2010-01-07 2011-07-14 Unilever Plc Natural shading agents
WO2011089561A1 (en) 2010-01-22 2011-07-28 Danisco A/S Methods for producing amino-substituted glycolipid compounds
EP2357220A1 (en) 2010-02-10 2011-08-17 The Procter and Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
WO2011098356A1 (en) 2010-02-12 2011-08-18 Unilever Plc Laundry treatment composition comprising bis-azo shading dyes
WO2011098531A1 (en) 2010-02-10 2011-08-18 Novozymes A/S Variants and compositions comprising variants with high stability in presence of a chelating agent
WO2011100667A1 (en) 2010-02-14 2011-08-18 Ls9, Inc. Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols
WO2011098355A1 (en) 2010-02-09 2011-08-18 Unilever Plc Dye polymers
WO2011102933A1 (en) 2010-02-18 2011-08-25 Danisco Us Inc. Amylase from nesterenkonia and methods of use, thereof
EP2363456A1 (en) 2010-03-01 2011-09-07 The Procter and Gamble Company Solid laundry detergent composition comprising brightener in micronized particulate form
WO2011109320A1 (en) 2010-03-01 2011-09-09 The Procter & Gamble Company Solid laundry detergent composition comprising secondary alcohol - based detersive surfactant
WO2011109318A1 (en) 2010-03-01 2011-09-09 1/3The Procter & Gamble Company Solid laundry detergent composition comprising c.i. fluorescent brightener 260 in alpha-crystalline form
WO2011109316A1 (en) 2010-03-01 2011-09-09 The Procter & Gamble Company Solid laundry detergent composition having an excellent anti-encrustation profile
EP2377914A1 (en) 2010-04-19 2011-10-19 The Procter and Gamble Company Mildly alkaline, low-built, solid fabric treatment detergent composition comprising perhydrolase
EP2380957A1 (en) 2010-04-19 2011-10-26 The Procter and Gamble Company Solid laundry detergent composition having a dynamic in-wash ph profile
WO2011133371A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Method of laundering fabric using a compacted liquid laundry detergent composition
WO2011133380A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company A laundry detergent composition comprising bleach particles that are suspended within a continuous liquid phase
WO2011133372A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Detergent composition
WO2011133456A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company A liquid laundry detergent composition comprising a source of peracid and having a ph profile that is controlled with respect to the pka of the source of peracid
WO2011134685A1 (en) 2010-04-29 2011-11-03 Unilever Plc Bis-heterocyclic azo dyes
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
EP2395070A1 (en) 2010-06-10 2011-12-14 The Procter and Gamble Company Liquid laundry detergent composition comprising lipase of bacterial origin
EP2395071A1 (en) 2010-06-10 2011-12-14 The Procter and Gamble Company Solid detergent composition comprising lipase of bacterial origin
US8084240B2 (en) 2008-06-06 2011-12-27 Danisco Us Inc. Geobacillus stearothermophilus α-amylase (AmyS) variants with improved properties
WO2011163457A1 (en) 2010-06-23 2011-12-29 The Procter & Gamble Company Product for pre-treatment and laundering of stained fabric
DE212009000119U1 (en) 2008-09-12 2011-12-30 Unilever N.V. Donors and pretreatment agents for viscous liquids
US8097444B2 (en) 2006-12-21 2012-01-17 Danisco Us Inc. Compositions and uses for an alpha-amylase polypeptide of bacillus species 195
WO2012010407A1 (en) 2010-07-22 2012-01-26 Unilever Plc Detergent compositions comprising biosurfactant and lipase
WO2012010406A1 (en) 2010-07-22 2012-01-26 Unilever Plc Combinations of rhamnolipids and enzymes for improved cleaning
EP2428572A2 (en) 2007-03-09 2012-03-14 Danisco US, Inc., Genencor Division Alkaliphilic Bacillus species alpha-amylase variants, compositions comprising alpha-amylase variants, and methods of use
WO2012038144A1 (en) 2010-09-20 2012-03-29 Hindustan Unilever Limited Fabric treatment compositions comprising target benefit agents
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US8153412B2 (en) 2007-11-05 2012-04-10 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
EP2441825A1 (en) 2010-10-14 2012-04-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Process for preparing laundry detergent particles
EP2441820A1 (en) 2010-10-14 2012-04-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Laundry detergent particles
EP2441822A1 (en) 2010-10-14 2012-04-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Laundry detergent particles
WO2012049055A1 (en) 2010-10-14 2012-04-19 Unilever Plc Transparent packaging of detergent compositions
WO2012049178A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012048947A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012049053A1 (en) 2010-10-14 2012-04-19 Hindustan Unilever Limited Package comprising a laundry composition, dispenser for said package and method for washing using said dispenser and said package
WO2012048955A1 (en) 2010-10-14 2012-04-19 Unilever Plc Packaging and dispensing of detergent compositions
WO2012048909A1 (en) 2010-10-14 2012-04-19 Unilever Plc Packaged particulate detergent composition
WO2012048948A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012049033A1 (en) 2010-10-14 2012-04-19 Unilever Plc Top-loading laundry vessel method
WO2012049034A1 (en) 2010-10-14 2012-04-19 Hindustan Unilever Limited Packaging and dispensing of detergent compositions
WO2012048949A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particle
WO2012048951A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012048956A1 (en) 2010-10-14 2012-04-19 Hindustan Unilever Limited Packaged concentrated particulate detergent composition
WO2012048950A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012048945A1 (en) 2010-10-14 2012-04-19 Unilever Plc Particulate detergent compositions comprising fluorescer
WO2012049032A1 (en) 2010-10-14 2012-04-19 Unilever Plc Refill and refillable packages of concentrated particulate detergent compositions
WO2012048910A1 (en) 2010-10-14 2012-04-19 Unilever Plc Packaged particulate detergent composition
WO2012052306A1 (en) 2010-10-22 2012-04-26 Unilever Plc Externally structured aqueous detergent liquid
WO2012059363A1 (en) 2010-11-01 2012-05-10 Hindustan Unilever Limited A detergent composition having shading dyes and lipase
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US8206966B2 (en) 2007-11-05 2012-06-26 Danisco Us Inc. Alpha-amylase variants with altered properties
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
EP2476743A1 (en) 2011-04-04 2012-07-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Method of laundering fabric
WO2012098114A1 (en) 2011-01-21 2012-07-26 Novozymes A/S Production of fatty acid alkyl esters
WO2012098046A1 (en) 2011-01-17 2012-07-26 Unilever Plc Dye polymer for laundry treatment
US8236545B2 (en) 2008-02-04 2012-08-07 Danisco Us Inc., Genencor Division TS23 alpha-amylase variants with altered properties
WO2012106701A1 (en) 2011-02-04 2012-08-09 Novozymes A/S Fatty acid esterification process
WO2012104176A1 (en) 2011-01-31 2012-08-09 Novozymes A/S Use of browned glucose as a feed substrate
WO2012104159A1 (en) 2011-01-31 2012-08-09 Unilever Plc Alkaline liquid detergent compositions
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012112718A1 (en) 2011-02-15 2012-08-23 Novozymes Biologicals, Inc. Mitigation of odor in cleaning machines and cleaning processes
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012119859A1 (en) 2011-03-10 2012-09-13 Unilever Plc Dye polymer
WO2012130961A1 (en) 2011-03-30 2012-10-04 Novozymes A/S Esterification process
WO2012130492A1 (en) 2011-03-25 2012-10-04 Unilever Plc Dye polymer
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
EP2522714A1 (en) 2011-05-13 2012-11-14 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Aqueous concentrated laundry detergent compositions
EP2522715A1 (en) 2011-05-13 2012-11-14 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Aqueous concentrated laundry detergent compositions
WO2012159778A1 (en) 2011-05-26 2012-11-29 Unilever Plc Liquid laundry composition
EP2537918A1 (en) 2011-06-20 2012-12-26 The Procter and Gamble Company Consumer products with lipase comprising coated particles
WO2012175401A2 (en) 2011-06-20 2012-12-27 Novozymes A/S Particulate composition
WO2012177709A1 (en) 2011-06-23 2012-12-27 The Procter & Gamble Company Product for pre-treatment and laundering of stained fabric
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP2540824A1 (en) 2011-06-30 2013-01-02 The Procter and Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
WO2013004636A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Stabilized subtilisin composition
WO2013004635A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Liquid detergent composition
WO2013007594A1 (en) 2011-07-12 2013-01-17 Novozymes A/S Storage-stable enzyme granules
WO2013011071A1 (en) 2011-07-21 2013-01-24 Unilever Plc Liquid laundry composition
EP2551335A1 (en) 2011-07-25 2013-01-30 The Procter and Gamble Company Enzyme stabilized liquid detergent composition
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013063460A2 (en) 2011-10-28 2013-05-02 Danisco Us Inc. Variant maltohexaose-forming alpha-amylase variants
WO2013076253A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013092052A1 (en) 2011-12-20 2013-06-27 Unilever Plc Isotropic liquid detergents comprising soil release polymer
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013092051A1 (en) 2011-12-20 2013-06-27 Unilever Plc Liquid detergents comprising lipase and bleach catalyst
WO2013096305A1 (en) 2011-12-22 2013-06-27 Danisco Us Inc. Variant alpha-amylases and methods of use, thereof
WO2013096653A1 (en) 2011-12-22 2013-06-27 Danisco Us Inc. Compositions and methods comprising a lipolytic enzyme variant
WO2013098205A2 (en) 2011-12-29 2013-07-04 Novozymes A/S Detergent compositions
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
US8507243B2 (en) 2008-09-25 2013-08-13 Danisco Us Inc. Alpha-amylase blends and methods for using said blends
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013131964A1 (en) 2012-03-07 2013-09-12 Novozymes A/S Detergent composition and substitution of optical brighteners in detergent compositions
EP2639291A1 (en) 2012-03-13 2013-09-18 Unilever PLC Packaged particulate detergent composition
WO2013138288A1 (en) 2012-03-16 2013-09-19 Monosol, Llc. Water soluble compositions incorporating enzymes, and method of making same
WO2013139702A1 (en) 2012-03-21 2013-09-26 Unilever Plc Laundry detergent particles
WO2013148492A1 (en) 2012-03-29 2013-10-03 Novozymes A/S Use of enzymes for preparing water soluble films
WO2013149754A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particle
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013149752A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particles
WO2013149755A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particles
WO2013149753A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particles
WO2013158364A1 (en) 2012-04-16 2013-10-24 Monosol, Llc Powdered pouch and method of making same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013160025A1 (en) 2012-04-23 2013-10-31 Unilever Plc Structured aqueous liquid detergent
WO2013169645A1 (en) 2012-05-11 2013-11-14 Danisco Us Inc. Use of alpha-amylase from aspergillus clavatus for saccharification
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013171241A1 (en) 2012-05-16 2013-11-21 Novozymes A/S Compositions comprising lipase and methods of use thereof
WO2013184577A1 (en) 2012-06-08 2013-12-12 Danisco Us Inc. Alpha-amylase variants derived from the alpha amylase of cytophaga sp.amylase|(cspamy2).
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2014012506A1 (en) 2012-07-18 2014-01-23 Novozymes A/S Method of treating polyester textile
WO2014028434A2 (en) 2012-08-16 2014-02-20 Danisco Us Inc. Method of using alpha-amylase from aspergillus clavatus and pullulanase for saccharification
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014048857A1 (en) 2012-09-25 2014-04-03 Unilever Plc Laundry detergent particles
WO2014068083A1 (en) 2012-11-01 2014-05-08 Novozymes A/S Method for removal of dna
WO2014081622A1 (en) 2012-11-20 2014-05-30 Danisco Us Inc. Amylase with maltogenic properties
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014093125A1 (en) 2012-12-14 2014-06-19 Danisco Us Inc. Method of using alpha-amylase from aspergillus fumigatus and isoamylase for saccharification
WO2014092960A1 (en) 2012-12-11 2014-06-19 Danisco Us Inc. Trichoderma reesei host cells expressing a glucoamylase from aspergillus fumigatus and methods of use thereof
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014099525A1 (en) 2012-12-21 2014-06-26 Danisco Us Inc. Paenibacillus curdlanolyticus amylase, and methods of use, thereof
WO2014099523A1 (en) 2012-12-21 2014-06-26 Danisco Us Inc. Alpha-amylase variants
WO2014099415A1 (en) 2012-12-20 2014-06-26 Danisco Us Inc. Method of using alpha-amylase from aspergillus terreus and pullulanase for saccharification
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
EP2767581A1 (en) 2013-02-19 2014-08-20 The Procter & Gamble Company Method of laundering a fabric
EP2767579A1 (en) 2013-02-19 2014-08-20 The Procter and Gamble Company Method of laundering a fabric
WO2014152674A1 (en) 2013-03-14 2014-09-25 Novozymes A/S Enzyme and inhibitor containing water-soluble films
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014164800A1 (en) 2013-03-11 2014-10-09 Danisco Us Inc. Alpha-amylase combinatorial variants
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014200658A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from promicromonospora vindobonensis
WO2014200657A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from streptomyces xiamenensis
WO2014198840A1 (en) 2013-06-12 2014-12-18 Earth Alive Clean Technologies Inc. Dust suppressant
WO2014200656A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from streptomyces umbrinus
WO2014204596A1 (en) 2013-06-17 2014-12-24 Danisco Us Inc. Alpha-amylase from bacillaceae family member
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
EP2857515A2 (en) 2008-11-20 2015-04-08 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2015050723A1 (en) 2013-10-03 2015-04-09 Danisco Us Inc. Alpha-amylases from exiguobacterium, and methods of use, thereof
WO2015050724A1 (en) 2013-10-03 2015-04-09 Danisco Us Inc. Alpha-amylases from a subset of exiguobacterium, and methods of use, thereof
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
US9040279B2 (en) 2008-06-06 2015-05-26 Danisco Us Inc. Saccharification enzyme composition and method of saccharification thereof
US9040278B2 (en) 2008-06-06 2015-05-26 Danisco Us Inc. Production of glucose from starch using alpha-amylases from Bacillus subtilis
WO2015077126A1 (en) 2013-11-20 2015-05-28 Danisco Us Inc. Variant alpha-amylases having reduced susceptibility to protease cleavage, and methods of use, thereof
WO2015095358A1 (en) 2013-12-18 2015-06-25 E. I. Du Pont De Nemours And Company Cationic poly alpha-1,3-glucan ethers
WO2015094809A1 (en) 2013-12-19 2015-06-25 Danisco Us Inc. Chimeric fungal alpha-amylases comprising carbohydrate binding module and the use thereof
WO2015123323A1 (en) 2014-02-14 2015-08-20 E. I. Du Pont De Nemours And Company Poly-alpha-1,3-1,6-glucans for viscosity modification
WO2015134729A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of non-cellulosic textile materials with xyloglucan endotransglycosylase
WO2015134737A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase
WO2015138283A1 (en) 2014-03-11 2015-09-17 E. I. Du Pont De Nemours And Company Oxidized poly alpha-1,3-glucan as detergent builder
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015195960A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2015195777A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP2987849A1 (en) 2014-08-19 2016-02-24 The Procter and Gamble Company Method of Laundering a Fabric
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
EP2987848A1 (en) 2014-08-19 2016-02-24 The Procter & Gamble Company Method of laundering a fabric
WO2016041676A1 (en) 2014-09-18 2016-03-24 Unilever Plc Whitening composition
WO2016079110A2 (en) 2014-11-19 2016-05-26 Novozymes A/S Use of enzyme for cleaning
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016106011A1 (en) 2014-12-23 2016-06-30 E. I. Du Pont De Nemours And Company Enzymatically produced cellulose
WO2016110378A1 (en) 2015-01-09 2016-07-14 Unilever Plc Laundry treatment composition comprising a dye
WO2016111884A2 (en) 2015-01-08 2016-07-14 Stepan Company Cold-water laundry detergents
WO2016128466A1 (en) 2015-02-13 2016-08-18 Unilever Plc Laundry liquid composition
WO2016133734A1 (en) 2015-02-18 2016-08-25 E. I. Du Pont De Nemours And Company Soy polysaccharide ethers
WO2016135351A1 (en) 2015-06-30 2016-09-01 Novozymes A/S Laundry detergent composition, method for washing and use of composition
US9434932B2 (en) 2011-06-30 2016-09-06 Novozymes A/S Alpha-amylase variants
WO2016160407A1 (en) 2015-03-31 2016-10-06 Stepan Company Detergents based on alpha-sulfonated fatty ester surfactants
WO2016155993A1 (en) 2015-04-02 2016-10-06 Unilever Plc Composition
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016164596A2 (en) 2015-04-07 2016-10-13 Novozymes A/S Methods for selecting enzymes having lipase activity
WO2016184944A1 (en) 2015-05-19 2016-11-24 Novozymes A/S Odor reduction
EP3101109A1 (en) 2015-06-04 2016-12-07 The Procter and Gamble Company Hand dishwashing liquid detergent composition
WO2016198262A1 (en) 2015-06-11 2016-12-15 Unilever Plc Laundry detergent composition
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016202785A1 (en) 2015-06-17 2016-12-22 Novozymes A/S Container
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2016206837A1 (en) 2015-06-26 2016-12-29 Unilever Plc Laundry detergent composition
WO2016206838A1 (en) 2015-06-26 2016-12-29 Unilever Plc Laundry detergent composition
WO2017046232A1 (en) 2015-09-17 2017-03-23 Henkel Ag & Co. Kgaa Detergent compositions comprising polypeptides having xanthan degrading activity
WO2017046260A1 (en) 2015-09-17 2017-03-23 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2017060471A1 (en) 2015-10-09 2017-04-13 Novozymes A/S Enzymatic or non-enzymatic biodiesel polishing process
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017083226A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017083228A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017083229A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017100720A1 (en) 2015-12-09 2017-06-15 Danisco Us Inc. Alpha-amylase combinatorial variants
WO2017117089A1 (en) 2015-12-28 2017-07-06 Novozymes Bioag A/S Heat priming of bacterial spores
EP3190167A1 (en) 2016-01-07 2017-07-12 Unilever PLC Bitter pill
WO2017121714A1 (en) 2016-01-15 2017-07-20 Unilever Plc Dye
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017133879A1 (en) 2016-02-04 2017-08-10 Unilever Plc Detergent liquid
WO2017140391A1 (en) 2016-02-17 2017-08-24 Unilever Plc Whitening composition
WO2017140392A1 (en) 2016-02-17 2017-08-24 Unilever Plc Whitening composition
WO2017147219A1 (en) 2016-02-26 2017-08-31 The Procter & Gamble Company Thickened or structured liquid detergent compositions
WO2017162378A1 (en) 2016-03-21 2017-09-28 Unilever Plc Laundry detergent composition
WO2017173324A2 (en) 2016-04-01 2017-10-05 Danisco Us Inc. Alpha-amylases, compositions & methods
WO2017173190A2 (en) 2016-04-01 2017-10-05 Danisco Us Inc. Alpha-amylases, compositions & methods
WO2017174251A1 (en) 2016-04-08 2017-10-12 Unilever Plc Laundry detergent composition
WO2017174769A2 (en) 2016-04-08 2017-10-12 Novozymes A/S Detergent compositions and uses of the same
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
WO2017191160A1 (en) 2016-05-03 2017-11-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
WO2017194487A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
WO2017207762A1 (en) 2016-06-03 2017-12-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2017210188A1 (en) 2016-05-31 2017-12-07 Novozymes A/S Stabilized liquid peroxide compositions
WO2017211697A1 (en) 2016-06-09 2017-12-14 Unilever Plc Laundry products
WO2017220422A1 (en) 2016-06-23 2017-12-28 Novozymes A/S Use of enzymes, composition and method for removing soil
WO2018001959A1 (en) 2016-06-30 2018-01-04 Novozymes A/S Lipase variants and compositions comprising surfactant and lipase variant
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
WO2018007435A1 (en) 2016-07-05 2018-01-11 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
WO2018011242A1 (en) 2016-07-14 2018-01-18 Basf Se Fermentation medium comprising chelating agent
WO2018011276A1 (en) 2016-07-13 2018-01-18 The Procter & Gamble Company Bacillus cibi dnase variants and uses thereof
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
EP3284805A1 (en) 2016-08-17 2018-02-21 The Procter & Gamble Company Cleaning composition comprising enzymes
WO2018037062A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2018037064A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants i
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018060475A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Spore containing granule
WO2018060216A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Use of enzyme for washing, method for washing and warewashing composition
EP3309249A1 (en) 2013-07-29 2018-04-18 Novozymes A/S Protease variants and polynucleotides encoding same
WO2018072979A1 (en) 2016-10-18 2018-04-26 Unilever Plc Whitening composition
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
WO2018083093A1 (en) 2016-11-01 2018-05-11 Novozymes A/S Multi-core granules
EP3321360A2 (en) 2013-01-03 2018-05-16 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2018099762A1 (en) 2016-12-01 2018-06-07 Basf Se Stabilization of enzymes in compositions
WO2018108382A1 (en) 2016-12-15 2018-06-21 Unilever Plc Laundry detergent composition
WO2018108865A1 (en) 2016-12-12 2018-06-21 Novozymes A/S Use of polypeptides
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018177938A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
EP3385362A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising fungal mannanases
EP3385361A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising bacterial mannanases
WO2018184873A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Detergent compositions and uses thereof
EP3401385A1 (en) 2017-05-08 2018-11-14 Henkel AG & Co. KGaA Detergent composition comprising polypeptide comprising carbohydrate-binding domain
WO2018234056A1 (en) 2017-06-20 2018-12-27 Unilever N.V. Particulate detergent composition comprising perfume
WO2018234003A1 (en) 2017-06-21 2018-12-27 Unilever Plc Packaging and dispensing of detergent compositions
WO2019008035A1 (en) 2017-07-07 2019-01-10 Unilever Plc Laundry cleaning composition
WO2019008036A1 (en) 2017-07-07 2019-01-10 Unilever Plc Whitening composition
WO2019030186A1 (en) 2017-08-07 2019-02-14 Novozymes A/S Use of fca control based on ph
EP3461881A1 (en) 2013-05-03 2019-04-03 Novozymes A/S Microencapsulation of detergent enzymes

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110097778A1 (en) 2008-04-30 2011-04-28 Power Scott D Chimeric alpha-amylase variants
US9090887B2 (en) 2008-06-06 2015-07-28 Danisco Us Inc. Variant alpha-amylases from Bacillus subtilis and methods of use, thereof
CN103849496B (en) * 2014-03-19 2016-08-17 广州麦饭石化工技术有限公司 One kind of self-adhesive glue stains remaining detergent and its manufacturing process

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0204284A2 (en) * 1985-06-05 1986-12-10 Sapporo Breweries Limited A novel lipase
EP0218272A1 (en) * 1985-08-09 1987-04-15 Gist-Brocades N.V. Novel lipolytic enzymes and their use in detergent compositions
EP0271154A2 (en) * 1986-12-10 1988-06-15 Unilever N.V. Enzymatic detergent composition
EP0334462A1 (en) * 1988-03-25 1989-09-27 Genencor International, Inc. Molecular cloning and expression of genes encoding lipolytic enzymes
EP0385401A1 (en) * 1989-02-27 1990-09-05 Occidental Chemical Corporation Unique Microbial lipases with activity at temperatures and pHs suitable for use in detergents
EP0571982A1 (en) * 1992-05-27 1993-12-01 Showa Denko Kabushiki Kaisha Alkaline lipase, method for producing the same, microorganism producing the same and detergent composition containing alkaline lipase
WO1994002617A2 (en) * 1992-07-23 1994-02-03 Gist-Brocades N.V. Cloning and expression of a lipase modulator gene from pseudomonas pseudoalcaligenes

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0204284A2 (en) * 1985-06-05 1986-12-10 Sapporo Breweries Limited A novel lipase
EP0218272A1 (en) * 1985-08-09 1987-04-15 Gist-Brocades N.V. Novel lipolytic enzymes and their use in detergent compositions
EP0271154A2 (en) * 1986-12-10 1988-06-15 Unilever N.V. Enzymatic detergent composition
EP0334462A1 (en) * 1988-03-25 1989-09-27 Genencor International, Inc. Molecular cloning and expression of genes encoding lipolytic enzymes
EP0385401A1 (en) * 1989-02-27 1990-09-05 Occidental Chemical Corporation Unique Microbial lipases with activity at temperatures and pHs suitable for use in detergents
EP0571982A1 (en) * 1992-05-27 1993-12-01 Showa Denko Kabushiki Kaisha Alkaline lipase, method for producing the same, microorganism producing the same and detergent composition containing alkaline lipase
WO1994002617A2 (en) * 1992-07-23 1994-02-03 Gist-Brocades N.V. Cloning and expression of a lipase modulator gene from pseudomonas pseudoalcaligenes

Cited By (445)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997013847A1 (en) * 1995-10-12 1997-04-17 Genencor International, Inc. Expression system, vector and cell transformed thereby
US6156552A (en) * 1998-02-18 2000-12-05 Novo Nordisk A/S Lipase variants
EP1803817A1 (en) 1998-12-18 2007-07-04 Novozymes A/S Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region
WO2000060058A2 (en) 1999-03-31 2000-10-12 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
EP2011864A1 (en) 1999-03-31 2009-01-07 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
EP2889375A1 (en) 1999-03-31 2015-07-01 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
WO2000071688A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 126 and 127
WO2000071690A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 128 and 129
WO2000071689A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 127 and 128
WO2000071691A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 125 and 126
WO2000071687A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 129 and 130
WO2000071685A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 132 and 133
EP2336331A1 (en) 1999-08-31 2011-06-22 Novozymes A/S Novel proteases and variants thereof
WO2002016547A2 (en) 2000-08-21 2002-02-28 Novozymes A/S Subtilase enzymes
EP2333055A1 (en) 2000-10-13 2011-06-15 Novozymes A/S Subtilase variants
EP2360247A1 (en) 2000-10-13 2011-08-24 Novozymes A/S Subtilase variants
EP1975229A2 (en) 2000-10-13 2008-10-01 Novozymes A/S Alpha-amylase variant with altered properties
US8486681B2 (en) 2001-05-15 2013-07-16 Novozymes A/S Alpha-amylase variant with altered properties
US9080137B2 (en) 2001-05-15 2015-07-14 Novozymes A/S Alpha-amylase variant with altered properties
US9670471B2 (en) 2001-05-15 2017-06-06 Novozymes A/S Alpha-amylase variant with altered properties
US9796968B2 (en) 2001-05-15 2017-10-24 Novozymes A/S Alpha-amylase variant with altered properties
EP2159279A2 (en) 2001-05-15 2010-03-03 Novozymes A/S Alpha-amylase variant with altered properties
US8617837B2 (en) 2001-05-15 2013-12-31 Novozymes A/S Method of hydrolyzing soluble starch with an alpha-amylase variant
US8252573B2 (en) 2001-05-15 2012-08-28 Novozymes A/S Alpha-amylase variant with altered properties
EP2264160A2 (en) 2001-05-15 2010-12-22 Novozymes A/S Alpha-amylase variant with altered properties
WO2002092797A2 (en) 2001-05-15 2002-11-21 Novozymes A/S Alpha-amylase variant with altered properties
EP3000881A2 (en) 2001-05-15 2016-03-30 Novozymes A/S Alpha-amylase variant with altered properties
EP2298868A2 (en) 2001-06-26 2011-03-23 Novozymes A/S Polypeptides having cellobiohydrolase I activity and polynucleotides encoding same
WO2003000941A2 (en) 2001-06-26 2003-01-03 Novozymes A/S Polypeptides having cellobiohydrolase i activity and polynucleotides encoding same
EP2295544A2 (en) 2001-06-26 2011-03-16 Novozymes A/S Polypeptides having cellobiohydrolase I activity and polynucleotides encoding same
EP2277997A2 (en) 2001-06-26 2011-01-26 Novozymes A/S Polypeptides having cellobiohydrolase I activity and polynucleotides encoding same
WO2003006602A2 (en) 2001-07-12 2003-01-23 Novozymes A/S Subtilase variants
WO2003080827A2 (en) 2002-03-27 2003-10-02 Novozymes A/S Granules with filamentous coatings
WO2004003187A2 (en) 2002-07-01 2004-01-08 Novozymes A/S Mpg added to fermentation
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
EP2138574A2 (en) 2002-11-06 2009-12-30 Novozymes A/S Subtilase variants
EP2399992A2 (en) 2002-11-06 2011-12-28 Novozymes A/S Subtilase Variants
EP2284258A2 (en) 2002-11-06 2011-02-16 Novozymes A/S Subtilase variants
EP2128247A1 (en) 2002-12-20 2009-12-02 Novozymes A/S Polypeptides having cellobiohydrolase II activity and polynucleotides encoding same
WO2004067739A2 (en) 2003-01-27 2004-08-12 Novozymes A/S Stabilization of granules
EP1923455A2 (en) 2003-02-18 2008-05-21 Novozymes A/S Detergent compositions
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
WO2004111221A1 (en) 2003-06-19 2004-12-23 Novozymes A/S Proteases
WO2005001064A2 (en) 2003-06-25 2005-01-06 Novozymes A/S Polypeptides having alpha-amylase activity and polypeptides encoding same
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
EP2284259A2 (en) 2003-10-10 2011-02-16 Novozymes A/S Protease variants
EP2308966A1 (en) 2003-10-10 2011-04-13 Novozymes A/S Protease variants
WO2005040372A1 (en) 2003-10-23 2005-05-06 Novozymes A/S Protease with improved stability in detergents
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
EP2305702A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305703A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2308890A1 (en) 2004-01-30 2011-04-13 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2314605A1 (en) 2004-01-30 2011-04-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2301958A1 (en) 2004-01-30 2011-03-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2325318A1 (en) 2004-02-13 2011-05-25 Novozymes A/S Protease variants
EP2305821A2 (en) 2004-02-13 2011-04-06 Novozymes A/S Protease variants
EP2267002A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
EP2267000A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
EP2267001A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
EP2258839A1 (en) 2004-06-21 2010-12-08 Novozymes A/S Nocardiopsis proteases
EP2258838A1 (en) 2004-06-21 2010-12-08 Novozymes A/S Nocardiopsis proteases
WO2005123911A2 (en) 2004-06-21 2005-12-29 Novozymes A/S Proteases
WO2006002643A2 (en) 2004-07-05 2006-01-12 Novozymes A/S Alpha-amylase variants with altered properties
EP2261329A2 (en) 2004-09-21 2010-12-15 Novozymes A/S Subtilases
WO2006032278A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032277A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032279A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
EP2302042A2 (en) 2004-09-30 2011-03-30 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2298872A2 (en) 2004-09-30 2011-03-23 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP2295555A2 (en) 2004-09-30 2011-03-16 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encodig same
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2007006305A1 (en) 2005-07-08 2007-01-18 Novozymes A/S Subtilase variants
EP2385111A2 (en) 2005-07-08 2011-11-09 Novozymes A/S Subtilase variants
EP2290061A2 (en) 2005-07-08 2011-03-02 Novozymes A/S Subtilase variants
EP2385112A2 (en) 2005-07-08 2011-11-09 Novozymes A/S Subtilase variants
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2007019858A2 (en) 2005-08-16 2007-02-22 Novozymes A/S Subtilases
EP2360246A1 (en) 2005-08-16 2011-08-24 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2007036235A1 (en) 2005-09-30 2007-04-05 Novozymes A/S Immobilization of enzymes
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2007098756A1 (en) 2006-03-02 2007-09-07 Novozymes A/S High capacity encapsulation process
WO2007107573A1 (en) 2006-03-22 2007-09-27 Novozymes A/S Use of polypeptides having antimicrobial activity
EP2383330A1 (en) 2006-03-31 2011-11-02 Novozymes A/S A stabilized liquid enzyme composition
WO2007113241A1 (en) 2006-03-31 2007-10-11 Novozymes A/S A stabilized liquid enzyme composition
WO2007136469A2 (en) 2006-04-14 2007-11-29 Genencor International, Inc. One-step treatment of textiles
WO2008057637A2 (en) 2006-07-21 2008-05-15 Novozymes, Inc. Methods of increasing secretion of polypeptides having biological activity
EP2272943A1 (en) 2006-10-06 2011-01-12 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
WO2008040818A1 (en) 2006-10-06 2008-04-10 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
US8470758B2 (en) 2006-12-21 2013-06-25 Danisco Us Inc. Detergent compositions and methods of use for an alpha-amylase polypeptide of bacillus species 195
US8097444B2 (en) 2006-12-21 2012-01-17 Danisco Us Inc. Compositions and uses for an alpha-amylase polypeptide of bacillus species 195
EP2428572A2 (en) 2007-03-09 2012-03-14 Danisco US, Inc., Genencor Division Alkaliphilic Bacillus species alpha-amylase variants, compositions comprising alpha-amylase variants, and methods of use
EP2500325A1 (en) 2007-03-23 2012-09-19 Novozymes Biologicals, Inc. Preventing and Reducing Biofilm Formation and Planktonic Proliferation
WO2008118749A2 (en) 2007-03-23 2008-10-02 Novozymes Biologicals, Inc. Preventing and reducing biofilm formation and planktonic proliferation
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
EP2471911A2 (en) 2007-03-30 2012-07-04 Novozymes A/S Fungal peroxygenases and methods of application
EP2045317A1 (en) 2007-10-04 2009-04-08 Lanxess Deutschland GmbH Liquid washing and cleaning agent
DE102007047433A1 (en) 2007-10-04 2009-04-09 Lanxess Deutschland Gmbh Flüssigwasch- and liquid detergent
US8153412B2 (en) 2007-11-05 2012-04-10 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
US8206966B2 (en) 2007-11-05 2012-06-26 Danisco Us Inc. Alpha-amylase variants with altered properties
US8236545B2 (en) 2008-02-04 2012-08-07 Danisco Us Inc., Genencor Division TS23 alpha-amylase variants with altered properties
US8507244B2 (en) 2008-02-04 2013-08-13 Danisco Us Inc. Variants of bacillus sp. TS-23 alpha-amylase with altered properties
US8460916B2 (en) 2008-02-04 2013-06-11 Danisco Us Inc. TS-23 alpha-amylase variants with altered properties
EP2447361A2 (en) 2008-06-06 2012-05-02 Danisco US Inc. Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties
US8084240B2 (en) 2008-06-06 2011-12-27 Danisco Us Inc. Geobacillus stearothermophilus α-amylase (AmyS) variants with improved properties
US9040279B2 (en) 2008-06-06 2015-05-26 Danisco Us Inc. Saccharification enzyme composition and method of saccharification thereof
US9040278B2 (en) 2008-06-06 2015-05-26 Danisco Us Inc. Production of glucose from starch using alpha-amylases from Bacillus subtilis
EP2623591A2 (en) 2008-06-06 2013-08-07 Danisco US Inc. Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties
EP2149786A1 (en) 2008-08-01 2010-02-03 Unilever PLC Improvements relating to detergent analysis
DE212009000119U1 (en) 2008-09-12 2011-12-30 Unilever N.V. Donors and pretreatment agents for viscous liquids
US8507243B2 (en) 2008-09-25 2013-08-13 Danisco Us Inc. Alpha-amylase blends and methods for using said blends
EP2857515A2 (en) 2008-11-20 2015-04-08 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2202290A1 (en) 2008-12-23 2010-06-30 Unilever PLC A flowable laundry composition and packaging therefor
EP2213723A1 (en) 2009-01-30 2010-08-04 Novozymes A/S Isomaltose for fungus fermentation
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
WO2010104675A1 (en) 2009-03-10 2010-09-16 Danisco Us Inc. Bacillus megaterium strain dsm90-related alpha-amylases, and methods of use, thereof
WO2010108002A1 (en) 2009-03-18 2010-09-23 The Procter & Gamble Company Structured fluid detergent compositions comprising dibenzylidene sorbitol acetal derivatives
WO2010108000A1 (en) 2009-03-18 2010-09-23 The Procter & Gamble Company Structured fluid detergent compositions comprising dibenzylidene polyol acetal derivatives and detersive enzymes
WO2010115028A2 (en) 2009-04-01 2010-10-07 Danisco Us Inc. Cleaning system comprising an alpha-amylase and a protease
WO2010115021A2 (en) 2009-04-01 2010-10-07 Danisco Us Inc. Compositions and methods comprising alpha-amylase variants with altered properties
EP2902487A2 (en) 2009-04-01 2015-08-05 Danisco US Inc. Compositions and methods comprising alpha-amylase variants with altered properties
WO2010117511A1 (en) 2009-04-08 2010-10-14 Danisco Us Inc. Halomonas strain wdg195-related alpha-amylases, and methods of use, thereof
WO2010127919A1 (en) 2009-05-05 2010-11-11 Unilever Plc Shading composition
WO2011005804A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company Method of laundering fabric using a liquid laundry detergent composition
WO2011005905A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company A mildly alkaline, low-built, solid fabric treatment detergent composition comprising phthalimido peroxy caproic acid
WO2011005911A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company Method of laundering fabric using a compacted liquid laundry detergent composition
WO2011005917A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company Method of laundering fabric using a liquid laundry detergent composition
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3269804A1 (en) 2009-09-17 2018-01-17 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
EP2977382A2 (en) 2009-09-30 2016-01-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011042372A1 (en) 2009-10-08 2011-04-14 Unilever Plc Shading composition
WO2011045195A1 (en) 2009-10-13 2011-04-21 Unilever Plc Dye polymers
WO2011048083A1 (en) 2009-10-21 2011-04-28 Novozymes A/S Method for treatment of oil
WO2011047987A1 (en) 2009-10-23 2011-04-28 Unilever Plc Dye polymers
WO2011049945A2 (en) 2009-10-23 2011-04-28 Danisco Us Inc. Methods for reducing blue saccharide
WO2011082889A1 (en) 2010-01-07 2011-07-14 Unilever Plc Natural shading agents
WO2011089561A1 (en) 2010-01-22 2011-07-28 Danisco A/S Methods for producing amino-substituted glycolipid compounds
US9045514B2 (en) 2010-01-22 2015-06-02 Dupont Nutrition Biosciences Aps Methods for producing amino-substituted glycolipid compounds
WO2011098355A1 (en) 2010-02-09 2011-08-18 Unilever Plc Dye polymers
WO2011100410A2 (en) 2010-02-10 2011-08-18 The Procter & Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
EP2357220A1 (en) 2010-02-10 2011-08-17 The Procter and Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
WO2011098531A1 (en) 2010-02-10 2011-08-18 Novozymes A/S Variants and compositions comprising variants with high stability in presence of a chelating agent
WO2011098356A1 (en) 2010-02-12 2011-08-18 Unilever Plc Laundry treatment composition comprising bis-azo shading dyes
WO2011100667A1 (en) 2010-02-14 2011-08-18 Ls9, Inc. Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols
WO2011102933A1 (en) 2010-02-18 2011-08-25 Danisco Us Inc. Amylase from nesterenkonia and methods of use, thereof
US8815559B2 (en) 2010-02-18 2014-08-26 Danisco Us Inc. Amylase from nesterenkonia and methods of use, thereof
WO2011109320A1 (en) 2010-03-01 2011-09-09 The Procter & Gamble Company Solid laundry detergent composition comprising secondary alcohol - based detersive surfactant
WO2011109318A1 (en) 2010-03-01 2011-09-09 1/3The Procter & Gamble Company Solid laundry detergent composition comprising c.i. fluorescent brightener 260 in alpha-crystalline form
WO2011109316A1 (en) 2010-03-01 2011-09-09 The Procter & Gamble Company Solid laundry detergent composition having an excellent anti-encrustation profile
EP2365054A1 (en) 2010-03-01 2011-09-14 The Procter and Gamble Company Solid laundry detergent composition comprising secondary alcohol-based detersive surfactant
EP2363456A1 (en) 2010-03-01 2011-09-07 The Procter and Gamble Company Solid laundry detergent composition comprising brightener in micronized particulate form
EP2365059A1 (en) 2010-03-01 2011-09-14 The Procter and Gamble Company Solid laundry detergent composition comprising C.I. fluorescent brightener 260 in alpha-crystalline form
EP2365058A1 (en) 2010-03-01 2011-09-14 The Procter and Gamble Company Solid laundry detergent composition having an excellent anti-encrustation profile
WO2011109292A1 (en) 2010-03-01 2011-09-09 The Procter & Gamble Company Solid laundry detergent composition comprising brightener in micronized particulate form
EP2377914A1 (en) 2010-04-19 2011-10-19 The Procter and Gamble Company Mildly alkaline, low-built, solid fabric treatment detergent composition comprising perhydrolase
WO2011133371A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Method of laundering fabric using a compacted liquid laundry detergent composition
WO2011133381A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company A mildly alkaline, low-built, solid fabric treatment detergent composition comprising perhydrolase
WO2011133285A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Solid laundry detergent composition having a dynamic in-wash ph profile
WO2011133380A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company A laundry detergent composition comprising bleach particles that are suspended within a continuous liquid phase
WO2011133456A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company A liquid laundry detergent composition comprising a source of peracid and having a ph profile that is controlled with respect to the pka of the source of peracid
WO2011133372A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Detergent composition
EP2380957A1 (en) 2010-04-19 2011-10-26 The Procter and Gamble Company Solid laundry detergent composition having a dynamic in-wash ph profile
WO2011134685A1 (en) 2010-04-29 2011-11-03 Unilever Plc Bis-heterocyclic azo dyes
WO2011156297A2 (en) 2010-06-10 2011-12-15 The Procter & Gamble Company Compacted liquid laundry detergent composition comprising lipase of bacterial origin
EP2395070A1 (en) 2010-06-10 2011-12-14 The Procter and Gamble Company Liquid laundry detergent composition comprising lipase of bacterial origin
EP2395071A1 (en) 2010-06-10 2011-12-14 The Procter and Gamble Company Solid detergent composition comprising lipase of bacterial origin
WO2011156298A2 (en) 2010-06-10 2011-12-15 The Procter & Gamble Company Solid detergent composition comprising lipase of bacterial origin
WO2011163457A1 (en) 2010-06-23 2011-12-29 The Procter & Gamble Company Product for pre-treatment and laundering of stained fabric
WO2012010407A1 (en) 2010-07-22 2012-01-26 Unilever Plc Detergent compositions comprising biosurfactant and lipase
WO2012010406A1 (en) 2010-07-22 2012-01-26 Unilever Plc Combinations of rhamnolipids and enzymes for improved cleaning
WO2012038144A1 (en) 2010-09-20 2012-03-29 Hindustan Unilever Limited Fabric treatment compositions comprising target benefit agents
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2441825A1 (en) 2010-10-14 2012-04-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Process for preparing laundry detergent particles
WO2012048949A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particle
WO2012048947A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012049053A1 (en) 2010-10-14 2012-04-19 Hindustan Unilever Limited Package comprising a laundry composition, dispenser for said package and method for washing using said dispenser and said package
WO2012048955A1 (en) 2010-10-14 2012-04-19 Unilever Plc Packaging and dispensing of detergent compositions
WO2012049032A1 (en) 2010-10-14 2012-04-19 Unilever Plc Refill and refillable packages of concentrated particulate detergent compositions
WO2012048909A1 (en) 2010-10-14 2012-04-19 Unilever Plc Packaged particulate detergent composition
WO2012049178A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012048948A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012048951A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012048956A1 (en) 2010-10-14 2012-04-19 Hindustan Unilever Limited Packaged concentrated particulate detergent composition
WO2012048950A1 (en) 2010-10-14 2012-04-19 Unilever Plc Laundry detergent particles
WO2012049033A1 (en) 2010-10-14 2012-04-19 Unilever Plc Top-loading laundry vessel method
WO2012049055A1 (en) 2010-10-14 2012-04-19 Unilever Plc Transparent packaging of detergent compositions
WO2012048945A1 (en) 2010-10-14 2012-04-19 Unilever Plc Particulate detergent compositions comprising fluorescer
EP2441822A1 (en) 2010-10-14 2012-04-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Laundry detergent particles
WO2012048910A1 (en) 2010-10-14 2012-04-19 Unilever Plc Packaged particulate detergent composition
WO2012049034A1 (en) 2010-10-14 2012-04-19 Hindustan Unilever Limited Packaging and dispensing of detergent compositions
EP2441820A1 (en) 2010-10-14 2012-04-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Laundry detergent particles
WO2012052306A1 (en) 2010-10-22 2012-04-26 Unilever Plc Externally structured aqueous detergent liquid
WO2012059363A1 (en) 2010-11-01 2012-05-10 Hindustan Unilever Limited A detergent composition having shading dyes and lipase
EP2787066A1 (en) 2010-11-01 2014-10-08 Unilever N.V. A detergent composition having shading dyes and lipase
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012098046A1 (en) 2011-01-17 2012-07-26 Unilever Plc Dye polymer for laundry treatment
WO2012098114A1 (en) 2011-01-21 2012-07-26 Novozymes A/S Production of fatty acid alkyl esters
WO2012104176A1 (en) 2011-01-31 2012-08-09 Novozymes A/S Use of browned glucose as a feed substrate
WO2012104159A1 (en) 2011-01-31 2012-08-09 Unilever Plc Alkaline liquid detergent compositions
WO2012106701A1 (en) 2011-02-04 2012-08-09 Novozymes A/S Fatty acid esterification process
WO2012112718A1 (en) 2011-02-15 2012-08-23 Novozymes Biologicals, Inc. Mitigation of odor in cleaning machines and cleaning processes
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012119859A1 (en) 2011-03-10 2012-09-13 Unilever Plc Dye polymer
WO2012130492A1 (en) 2011-03-25 2012-10-04 Unilever Plc Dye polymer
WO2012130961A1 (en) 2011-03-30 2012-10-04 Novozymes A/S Esterification process
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012136427A1 (en) 2011-04-04 2012-10-11 Unilever Plc Method of laundering fabric
EP2476743A1 (en) 2011-04-04 2012-07-18 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Method of laundering fabric
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
EP2522714A1 (en) 2011-05-13 2012-11-14 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Aqueous concentrated laundry detergent compositions
EP2522715A1 (en) 2011-05-13 2012-11-14 Unilever Plc, A Company Registered In England And Wales under company no. 41424 of Unilever House Aqueous concentrated laundry detergent compositions
WO2012159778A1 (en) 2011-05-26 2012-11-29 Unilever Plc Liquid laundry composition
WO2012175401A2 (en) 2011-06-20 2012-12-27 Novozymes A/S Particulate composition
WO2013003025A1 (en) 2011-06-20 2013-01-03 The Procter & Gamble Company Consumer products with lipase comprising coated particles
EP2537918A1 (en) 2011-06-20 2012-12-26 The Procter and Gamble Company Consumer products with lipase comprising coated particles
WO2012177709A1 (en) 2011-06-23 2012-12-27 The Procter & Gamble Company Product for pre-treatment and laundering of stained fabric
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP2540824A1 (en) 2011-06-30 2013-01-02 The Procter and Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
EP2540825A2 (en) 2011-06-30 2013-01-02 The Procter and Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
EP3121270A2 (en) 2011-06-30 2017-01-25 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
US9434932B2 (en) 2011-06-30 2016-09-06 Novozymes A/S Alpha-amylase variants
US10167458B2 (en) 2011-06-30 2019-01-01 Novozymes A/S Alpha-amylase variants
WO2013004635A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Liquid detergent composition
WO2013004636A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Stabilized subtilisin composition
WO2013007594A1 (en) 2011-07-12 2013-01-17 Novozymes A/S Storage-stable enzyme granules
WO2013011071A1 (en) 2011-07-21 2013-01-24 Unilever Plc Liquid laundry composition
WO2013016368A1 (en) 2011-07-25 2013-01-31 The Procter & Gamble Company Detergent compositions
EP2551336A1 (en) 2011-07-25 2013-01-30 The Procter and Gamble Company Detergent compositions
EP2551335A1 (en) 2011-07-25 2013-01-30 The Procter and Gamble Company Enzyme stabilized liquid detergent composition
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013063460A2 (en) 2011-10-28 2013-05-02 Danisco Us Inc. Variant maltohexaose-forming alpha-amylase variants
EP3246404A1 (en) 2011-10-28 2017-11-22 Danisco US Inc. Variant maltohexaose-forming alpha-amylase variants
EP3219794A1 (en) 2011-11-21 2017-09-20 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013076259A2 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013076253A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
EP3272862A1 (en) 2011-12-16 2018-01-24 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013092052A1 (en) 2011-12-20 2013-06-27 Unilever Plc Isotropic liquid detergents comprising soil release polymer
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
EP3323875A1 (en) 2011-12-20 2018-05-23 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013092051A1 (en) 2011-12-20 2013-06-27 Unilever Plc Liquid detergents comprising lipase and bleach catalyst
WO2013096653A1 (en) 2011-12-22 2013-06-27 Danisco Us Inc. Compositions and methods comprising a lipolytic enzyme variant
WO2013096305A1 (en) 2011-12-22 2013-06-27 Danisco Us Inc. Variant alpha-amylases and methods of use, thereof
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
WO2013098205A2 (en) 2011-12-29 2013-07-04 Novozymes A/S Detergent compositions
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013120952A2 (en) 2012-02-17 2013-08-22 Henkel Ag & Co. Kgaa Detergent compositions comprising subtilase variants
WO2013131964A1 (en) 2012-03-07 2013-09-12 Novozymes A/S Detergent composition and substitution of optical brighteners in detergent compositions
EP2639291A1 (en) 2012-03-13 2013-09-18 Unilever PLC Packaged particulate detergent composition
WO2013138288A1 (en) 2012-03-16 2013-09-19 Monosol, Llc. Water soluble compositions incorporating enzymes, and method of making same
US10087401B2 (en) 2012-03-16 2018-10-02 Monosol, Llc Water soluble compositions incorporating enzymes, and method of making same
WO2013139702A1 (en) 2012-03-21 2013-09-26 Unilever Plc Laundry detergent particles
WO2013148492A1 (en) 2012-03-29 2013-10-03 Novozymes A/S Use of enzymes for preparing water soluble films
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013149752A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particles
WO2013149755A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particles
WO2013149753A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particles
WO2013149754A1 (en) 2012-04-03 2013-10-10 Unilever Plc Laundry detergent particle
US9908675B2 (en) 2012-04-16 2018-03-06 Monosol, Llc Powdered pouch and method of making same
WO2013158364A1 (en) 2012-04-16 2013-10-24 Monosol, Llc Powdered pouch and method of making same
US9394092B2 (en) 2012-04-16 2016-07-19 Monosol, Llc Powdered pouch and method of making same
WO2013160025A1 (en) 2012-04-23 2013-10-31 Unilever Plc Structured aqueous liquid detergent
EP3279320A2 (en) 2012-04-27 2018-02-07 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013169645A1 (en) 2012-05-11 2013-11-14 Danisco Us Inc. Use of alpha-amylase from aspergillus clavatus for saccharification
US8945889B2 (en) 2012-05-11 2015-02-03 Danisco Us Inc. Method of using alpha-amylase from Aspergillus clavatus for saccharification
WO2013171241A1 (en) 2012-05-16 2013-11-21 Novozymes A/S Compositions comprising lipase and methods of use thereof
WO2013184577A1 (en) 2012-06-08 2013-12-12 Danisco Us Inc. Alpha-amylase variants derived from the alpha amylase of cytophaga sp.amylase|(cspamy2).
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2014012506A1 (en) 2012-07-18 2014-01-23 Novozymes A/S Method of treating polyester textile
WO2014028434A2 (en) 2012-08-16 2014-02-20 Danisco Us Inc. Method of using alpha-amylase from aspergillus clavatus and pullulanase for saccharification
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014048857A1 (en) 2012-09-25 2014-04-03 Unilever Plc Laundry detergent particles
WO2014068083A1 (en) 2012-11-01 2014-05-08 Novozymes A/S Method for removal of dna
WO2014081622A1 (en) 2012-11-20 2014-05-30 Danisco Us Inc. Amylase with maltogenic properties
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014092960A1 (en) 2012-12-11 2014-06-19 Danisco Us Inc. Trichoderma reesei host cells expressing a glucoamylase from aspergillus fumigatus and methods of use thereof
EP3321353A1 (en) 2012-12-11 2018-05-16 Danisco US Inc. Yeast host cells epxressing a glucoamylase from aspergillus fumigatus and methods of use thereof
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014093125A1 (en) 2012-12-14 2014-06-19 Danisco Us Inc. Method of using alpha-amylase from aspergillus fumigatus and isoamylase for saccharification
WO2014099415A1 (en) 2012-12-20 2014-06-26 Danisco Us Inc. Method of using alpha-amylase from aspergillus terreus and pullulanase for saccharification
WO2014099523A1 (en) 2012-12-21 2014-06-26 Danisco Us Inc. Alpha-amylase variants
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014099525A1 (en) 2012-12-21 2014-06-26 Danisco Us Inc. Paenibacillus curdlanolyticus amylase, and methods of use, thereof
EP3321360A2 (en) 2013-01-03 2018-05-16 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
CN104955930A (en) * 2013-02-19 2015-09-30 宝洁公司 Method of laundering a fabric
WO2014130512A1 (en) 2013-02-19 2014-08-28 The Procter & Gamble Company Method of laundering a fabric
WO2014130508A1 (en) 2013-02-19 2014-08-28 The Procter & Gamble Company Method of laundering a fabric
EP2767579A1 (en) 2013-02-19 2014-08-20 The Procter and Gamble Company Method of laundering a fabric
EP2767581A1 (en) 2013-02-19 2014-08-20 The Procter & Gamble Company Method of laundering a fabric
WO2014164800A1 (en) 2013-03-11 2014-10-09 Danisco Us Inc. Alpha-amylase combinatorial variants
WO2014164777A1 (en) 2013-03-11 2014-10-09 Danisco Us Inc. Alpha-amylase combinatorial variants
WO2014152674A1 (en) 2013-03-14 2014-09-25 Novozymes A/S Enzyme and inhibitor containing water-soluble films
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3461881A1 (en) 2013-05-03 2019-04-03 Novozymes A/S Microencapsulation of detergent enzymes
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
WO2014198840A1 (en) 2013-06-12 2014-12-18 Earth Alive Clean Technologies Inc. Dust suppressant
WO2014200656A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from streptomyces umbrinus
WO2014200658A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from promicromonospora vindobonensis
WO2014200657A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from streptomyces xiamenensis
WO2014204596A1 (en) 2013-06-17 2014-12-24 Danisco Us Inc. Alpha-amylase from bacillaceae family member
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3339436A1 (en) 2013-07-29 2018-06-27 Henkel AG & Co. KGaA Detergent composition comprising protease variants
EP3309249A1 (en) 2013-07-29 2018-04-18 Novozymes A/S Protease variants and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
WO2015050724A1 (en) 2013-10-03 2015-04-09 Danisco Us Inc. Alpha-amylases from a subset of exiguobacterium, and methods of use, thereof
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
WO2015050723A1 (en) 2013-10-03 2015-04-09 Danisco Us Inc. Alpha-amylases from exiguobacterium, and methods of use, thereof
WO2015077126A1 (en) 2013-11-20 2015-05-28 Danisco Us Inc. Variant alpha-amylases having reduced susceptibility to protease cleavage, and methods of use, thereof
WO2015095358A1 (en) 2013-12-18 2015-06-25 E. I. Du Pont De Nemours And Company Cationic poly alpha-1,3-glucan ethers
WO2015094809A1 (en) 2013-12-19 2015-06-25 Danisco Us Inc. Chimeric fungal alpha-amylases comprising carbohydrate binding module and the use thereof
WO2015123323A1 (en) 2014-02-14 2015-08-20 E. I. Du Pont De Nemours And Company Poly-alpha-1,3-1,6-glucans for viscosity modification
WO2015134737A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase
WO2015134729A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of non-cellulosic textile materials with xyloglucan endotransglycosylase
WO2015138283A1 (en) 2014-03-11 2015-09-17 E. I. Du Pont De Nemours And Company Oxidized poly alpha-1,3-glucan as detergent builder
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015195777A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2015195960A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP2987849A1 (en) 2014-08-19 2016-02-24 The Procter and Gamble Company Method of Laundering a Fabric
EP2987848A1 (en) 2014-08-19 2016-02-24 The Procter & Gamble Company Method of laundering a fabric
WO2016041676A1 (en) 2014-09-18 2016-03-24 Unilever Plc Whitening composition
WO2016079110A2 (en) 2014-11-19 2016-05-26 Novozymes A/S Use of enzyme for cleaning
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016106011A1 (en) 2014-12-23 2016-06-30 E. I. Du Pont De Nemours And Company Enzymatically produced cellulose
WO2016111884A2 (en) 2015-01-08 2016-07-14 Stepan Company Cold-water laundry detergents
WO2016110378A1 (en) 2015-01-09 2016-07-14 Unilever Plc Laundry treatment composition comprising a dye
WO2016128466A1 (en) 2015-02-13 2016-08-18 Unilever Plc Laundry liquid composition
WO2016133734A1 (en) 2015-02-18 2016-08-25 E. I. Du Pont De Nemours And Company Soy polysaccharide ethers
WO2016160407A1 (en) 2015-03-31 2016-10-06 Stepan Company Detergents based on alpha-sulfonated fatty ester surfactants
WO2016155993A1 (en) 2015-04-02 2016-10-06 Unilever Plc Composition
WO2016164596A2 (en) 2015-04-07 2016-10-13 Novozymes A/S Methods for selecting enzymes having lipase activity
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016184944A1 (en) 2015-05-19 2016-11-24 Novozymes A/S Odor reduction
EP3101109A1 (en) 2015-06-04 2016-12-07 The Procter and Gamble Company Hand dishwashing liquid detergent composition
WO2016196872A1 (en) 2015-06-04 2016-12-08 The Procter & Gamble Company Hand dishwashing liquid detergent composition
EP3284811A1 (en) 2015-06-04 2018-02-21 The Procter & Gamble Company Hand dishwashing liquid detergent composition
WO2016198262A1 (en) 2015-06-11 2016-12-15 Unilever Plc Laundry detergent composition
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2016202785A1 (en) 2015-06-17 2016-12-22 Novozymes A/S Container
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016206838A1 (en) 2015-06-26 2016-12-29 Unilever Plc Laundry detergent composition
WO2016206837A1 (en) 2015-06-26 2016-12-29 Unilever Plc Laundry detergent composition
WO2016135351A1 (en) 2015-06-30 2016-09-01 Novozymes A/S Laundry detergent composition, method for washing and use of composition
WO2017046232A1 (en) 2015-09-17 2017-03-23 Henkel Ag & Co. Kgaa Detergent compositions comprising polypeptides having xanthan degrading activity
WO2017046260A1 (en) 2015-09-17 2017-03-23 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017060471A1 (en) 2015-10-09 2017-04-13 Novozymes A/S Enzymatic or non-enzymatic biodiesel polishing process
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017083226A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017083228A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017083229A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017100720A1 (en) 2015-12-09 2017-06-15 Danisco Us Inc. Alpha-amylase combinatorial variants
WO2017117089A1 (en) 2015-12-28 2017-07-06 Novozymes Bioag A/S Heat priming of bacterial spores
EP3190167A1 (en) 2016-01-07 2017-07-12 Unilever PLC Bitter pill
WO2017121714A1 (en) 2016-01-15 2017-07-20 Unilever Plc Dye
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017133879A1 (en) 2016-02-04 2017-08-10 Unilever Plc Detergent liquid
WO2017140391A1 (en) 2016-02-17 2017-08-24 Unilever Plc Whitening composition
WO2017140392A1 (en) 2016-02-17 2017-08-24 Unilever Plc Whitening composition
WO2017147219A1 (en) 2016-02-26 2017-08-31 The Procter & Gamble Company Thickened or structured liquid detergent compositions
WO2017162378A1 (en) 2016-03-21 2017-09-28 Unilever Plc Laundry detergent composition
WO2017173190A2 (en) 2016-04-01 2017-10-05 Danisco Us Inc. Alpha-amylases, compositions & methods
WO2017173324A2 (en) 2016-04-01 2017-10-05 Danisco Us Inc. Alpha-amylases, compositions & methods
WO2017174769A2 (en) 2016-04-08 2017-10-12 Novozymes A/S Detergent compositions and uses of the same
WO2017174251A1 (en) 2016-04-08 2017-10-12 Unilever Plc Laundry detergent composition
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
WO2017191160A1 (en) 2016-05-03 2017-11-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
WO2017194487A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
WO2017210188A1 (en) 2016-05-31 2017-12-07 Novozymes A/S Stabilized liquid peroxide compositions
WO2017207762A1 (en) 2016-06-03 2017-12-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2017211697A1 (en) 2016-06-09 2017-12-14 Unilever Plc Laundry products
WO2017220422A1 (en) 2016-06-23 2017-12-28 Novozymes A/S Use of enzymes, composition and method for removing soil
WO2018001959A1 (en) 2016-06-30 2018-01-04 Novozymes A/S Lipase variants and compositions comprising surfactant and lipase variant
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
WO2018007435A1 (en) 2016-07-05 2018-01-11 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
WO2018011277A1 (en) 2016-07-13 2018-01-18 Novozymes A/S Bacillus cibi dnase variants
WO2018011276A1 (en) 2016-07-13 2018-01-18 The Procter & Gamble Company Bacillus cibi dnase variants and uses thereof
WO2018011242A1 (en) 2016-07-14 2018-01-18 Basf Se Fermentation medium comprising chelating agent
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
EP3284805A1 (en) 2016-08-17 2018-02-21 The Procter & Gamble Company Cleaning composition comprising enzymes
WO2018034842A1 (en) 2016-08-17 2018-02-22 The Procter & Gamble Company Cleaning composition comprising enzymes
WO2018037062A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018037064A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants i
WO2018060216A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Use of enzyme for washing, method for washing and warewashing composition
WO2018060475A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Spore containing granule
WO2018072979A1 (en) 2016-10-18 2018-04-26 Unilever Plc Whitening composition
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
WO2018083093A1 (en) 2016-11-01 2018-05-11 Novozymes A/S Multi-core granules
WO2018099762A1 (en) 2016-12-01 2018-06-07 Basf Se Stabilization of enzymes in compositions
WO2018108865A1 (en) 2016-12-12 2018-06-21 Novozymes A/S Use of polypeptides
WO2018108382A1 (en) 2016-12-15 2018-06-21 Unilever Plc Laundry detergent composition
WO2018177938A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
EP3385361A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising bacterial mannanases
WO2018184767A1 (en) 2017-04-05 2018-10-11 Henkel Ag & Co. Kgaa Detergent compositions comprising bacterial mannanases
EP3385362A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising fungal mannanases
WO2018184873A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Detergent compositions and uses thereof
EP3401385A1 (en) 2017-05-08 2018-11-14 Henkel AG & Co. KGaA Detergent composition comprising polypeptide comprising carbohydrate-binding domain
WO2018234056A1 (en) 2017-06-20 2018-12-27 Unilever N.V. Particulate detergent composition comprising perfume
WO2018234003A1 (en) 2017-06-21 2018-12-27 Unilever Plc Packaging and dispensing of detergent compositions
WO2019008035A1 (en) 2017-07-07 2019-01-10 Unilever Plc Laundry cleaning composition
WO2019008036A1 (en) 2017-07-07 2019-01-10 Unilever Plc Whitening composition
WO2019030186A1 (en) 2017-08-07 2019-02-14 Novozymes A/S Use of fca control based on ph

Also Published As

Publication number Publication date
BE1008998A3 (en) 1996-10-01
EP0804557A1 (en) 1997-11-05
CA2202553A1 (en) 1996-04-25
FI971530D0 (en)
FI971530A0 (en) 1997-04-11
MX9702724A (en) 1997-06-28
AU3692995A (en) 1996-05-06
FI971530A (en) 1997-06-10

Similar Documents

Publication Publication Date Title
Kim et al. Gene cloning and characterization of thermostable lipase from Bacillus stearothermophilus L1
Gilbert Pseudomonas lipases: biochemical properties and molecular cloning
Schmidt-Dannert et al. Screening, purification and properties of a thermophilic lipase from Bacillus thermocatenulatus
JP3553958B2 (en) Method for producing a variant of the lipid-degrading enzymes
EP1456368B1 (en) Novel alkaline protease from bacillus sp. (dsm 14392) and washing and cleaning products comprising said novel alkaline protease
EP0406314B1 (en) A cellulase preparation
AU686574B2 (en) Pullulanase, microorganisms which produce it, processes for the preparation of this pullulanase and the uses thereof
FI103052B (en) Subtilisin and enzymatic puhdistusainekoo containing this stumus
EP0130064B1 (en) Improvements in and relating to an enzymatic detergent additive, a detergent, and a washing method
EP0290568B1 (en) Enzymatic detergent additive
US5290694A (en) Recombinant DNA, bacterium of the genus Pseudomonas containing it, and process for preparing lipase by using it
DE69839076T2 (en) Protease variants and compositions
EP0396608B1 (en) Mutated subtilisin genes
US5817495A (en) H2 O2 -stable peroxidase variants
JP3618748B2 (en) New lipase variants to be used in detergents
US5892013A (en) Lipase variants
US20120309063A1 (en) Detergent compositions containing geobacillus stearothermophilus lipase and methods of use thereof
US5453372A (en) Stabilized enzymes and process for preparing them
US5281525A (en) Cephalosporin acetylhydrolase gene from Bacillus subtilis
DE69034187T2 (en) Mutated subtilisin protease
EP0548228B1 (en) Lipase variants
CN1218039C (en) Amylase
CA2222141C (en) Alkaline cellulase and method for producing the same
KR100236540B1 (en) Alkaline bacillus lipases, coding dna sequences thereof and bacilli which produce these lipases
US5965418A (en) Haloperoxidases from Curvularia verruculosa and nucleic acids encoding same

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AU BB BG BR BY CA CN CZ EE FI GE HU IS JP KG KP KR KZ LK LR LT LV MD MG MK MN MX NO NZ PL RO RU SG SI SK TJ TT UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 971530

Country of ref document: FI

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2202553

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2202553

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/1997/002724

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 293902

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1995934004

Country of ref document: EP

ENP Entry into the national phase in:

Ref country code: US

Ref document number: 1997 817451

Date of ref document: 19971014

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1995934004

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1995934004

Country of ref document: EP