WO2023190851A1 - Anticorps se liant au nouveau coronavirus (sars-cov-2) - Google Patents

Anticorps se liant au nouveau coronavirus (sars-cov-2) Download PDF

Info

Publication number
WO2023190851A1
WO2023190851A1 PCT/JP2023/013145 JP2023013145W WO2023190851A1 WO 2023190851 A1 WO2023190851 A1 WO 2023190851A1 JP 2023013145 W JP2023013145 W JP 2023013145W WO 2023190851 A1 WO2023190851 A1 WO 2023190851A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
amino acid
acid sequence
sequence
sars
Prior art date
Application number
PCT/JP2023/013145
Other languages
English (en)
Japanese (ja)
Inventor
慎哉 渡辺
順一 今井
葉月 志賀
慈子 佐藤
進 松倉
裕孝 星
Original Assignee
公立大学法人福島県立医科大学
株式会社メディクローム
福島セルファクトリー株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 公立大学法人福島県立医科大学, 株式会社メディクローム, 福島セルファクトリー株式会社 filed Critical 公立大学法人福島県立医科大学
Publication of WO2023190851A1 publication Critical patent/WO2023190851A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A—HUMAN NECESSITIES
    • A41—WEARING APPAREL
    • A41D—OUTERWEAR; PROTECTIVE GARMENTS; ACCESSORIES
    • A41D13/00—Professional, industrial or sporting protective garments, e.g. surgeons' gowns or garments protecting against blows or punches
    • A41D13/05—Professional, industrial or sporting protective garments, e.g. surgeons' gowns or garments protecting against blows or punches protecting only a particular body part
    • A41D13/11—Protective face masks, e.g. for surgical use, or for use in foul atmospheres
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A—HUMAN NECESSITIES
    • A62—LIFE-SAVING; FIRE-FIGHTING
    • A62B—DEVICES, APPARATUS OR METHODS FOR LIFE-SAVING
    • A62B18/00—Breathing masks or helmets, e.g. affording protection against chemical agents or for use at high altitudes or incorporating a pump or compressor for reducing the inhalation effort
    • A62B18/02—Masks
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Definitions

  • the present invention relates to antibodies against SARS-related coronaviruses.
  • the invention particularly relates to antibodies that bind to the S1 subunit of SARS-CoV-2.
  • Novel coronavirus infection is an emerging infectious disease caused by the new coronavirus (SARS-CoV-2), which was first reported in December 2019, and can lead to pneumonia caused by cold-like symptoms such as fever and cough. vinegar.
  • SARS-CoV-2 new coronavirus
  • the overall fatality rate in Japan is said to be 1-2%, but the rate increases as people get older, reaching over 12% for people in their 80s and older. Furthermore, it has become a global pandemic, making it the world's greatest epidemiological challenge.
  • the main method used to diagnose COVID-19 is to use PCR to detect SARS-CoV-2 present in body fluids, but this method takes time to measure, is expensive, and is too sensitive. There are problems such as the possibility that non-infectious virus fragments are being detected. Antigen test kits have also come out, but they are not necessarily highly specific, and there are problems with false positives and false negatives. In addition, although vaccinations have begun to be administered around the world and are expected to be effective, there are reports that the effectiveness of vaccines is limited and does not last for a long period of time. Furthermore, although there are reports that antibodies have been obtained that have the ability to bind and neutralize SARS-CoV-2 (Non-Patent Documents 1 to 5), there is currently no effective therapeutic drug. .
  • the present invention aims to provide a novel antibody that can prevent infection with the new coronavirus (SARS-CoV-2) and/or treat COVID-19.
  • SARS-CoV-2 new coronavirus
  • the present inventors isolated cells that produce antibodies against SARS-CoV-2 from the blood of people who had recovered from SARS-CoV-2 infection, and succeeded in obtaining the antibody gene for IgG antibodies.
  • the present inventors focused on the primary defense function of IgA antibodies, which bind to bacteria and viruses locally (eyes, nose, intestines, etc.) and prevent them from entering the body, and by modifying the IgG antibodies, the IgA antibodies can be improved. It was also successfully acquired.
  • the present invention has been completed based on this knowledge. That is, the present invention includes the following aspects:
  • Heavy chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 1
  • heavy chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 2
  • heavy chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 3
  • light chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 4
  • an antibody having a light chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 5
  • a light chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 6
  • An antibody or antibody fragment thereof that binds to the receptor binding domain (RBD) of the S1 subunit of SARS-CoV-2.
  • the antibody of the present invention or antibody fragment thereof is [2] The antibody or antibody fragment thereof according to [1] above, It is characterized in that the receptor binding domain (RBD) of the S1 subunit is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 7 or a polypeptide having a mutation in the polypeptide.
  • RBD receptor binding domain
  • the antibody of the present invention or antibody fragment thereof is [3] The antibody or antibody fragment thereof according to [1] or [2] above, (a) Amino acid sequence of SEQ ID NO: 8, (b) an amino acid sequence having at least 90% identity to the framework region sequences other than each CDR sequence in the sequence of (a), and (c) an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the framework region sequence other than each CDR sequence in the sequence (a), a heavy chain variable region consisting of an amino acid sequence selected from the group consisting of; and (d) the amino acid sequence of SEQ ID NO: 9, (e) an amino acid sequence having at least 90% identity to the framework region sequences other than each CDR sequence in the sequence (d) above, and (f) an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the framework region sequence other than each CDR sequence in the sequence (e) above; It is characterized by having a light chain variable region consisting of an amino acid sequence selected from the group consist
  • Another aspect of the present invention is [7] A composition comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above.
  • Another aspect of the present invention is [8] A spray for preventing SARS-CoV-2 infection, comprising the composition according to [7] above.
  • Another aspect of the present invention is [9] A filter comprising a base material supporting the composition according to [7] above.
  • Another aspect of the present invention is [10] A mask for preventing SARS-CoV-2 infection or spreading, which includes the filter according to [9] above.
  • Another aspect of the present invention is [11] A food composition comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above.
  • the food composition of the present invention has the following features: [12] The food composition according to [11] above, characterized in that it is a food composition for preventing infection with SARS-CoV-2.
  • Another aspect of the present invention is [13] A reagent for detecting SARS-CoV-2, comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above.
  • Another aspect of the present invention is [14] A COVID-19 diagnostic agent comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above.
  • Another aspect of the present invention is [15] A pharmaceutical composition containing the antibody or antibody fragment thereof according to any one of [1] to [6] above, which is used for preventing and/or treating the onset of COVID-19.
  • Another aspect of the present invention is [16] A polynucleotide encoding the antibody or antibody fragment thereof according to any one of [1] to [6] above.
  • Another aspect of the present invention is [17] An expression vector containing the polynucleotide according to [16] above.
  • Another aspect of the present invention is [18] It relates to a host cell transformed with the expression vector described in [17] above.
  • Another aspect of the present invention is [19] A method for producing an antibody, comprising the steps of culturing the host cell according to [18] above, and collecting the antibody of interest from the culture obtained in the step.
  • Another aspect of the present invention is [20] relates to an antibody obtained by the production method described in [119] above.
  • One embodiment of the composition according to the present invention is [21] A composition comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above and a carrier.
  • One embodiment of the SARS-CoV-2 detection reagent according to the present invention is [22] A reagent for detecting SARS-CoV-2, comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above, and a carrier.
  • One embodiment of the COVID-19 diagnostic agent according to the present invention is [23] A COVID-19 diagnostic agent comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above and a carrier.
  • One embodiment of the pharmaceutical composition according to the present invention is [24] A pharmaceutical composition comprising the antibody or antibody fragment thereof according to any one of [1] to [6] above and a pharmaceutically acceptable carrier.
  • Another aspect of the present invention is [25] A method for preventing and/or treating the onset of COVID-19, which comprises administering to a subject a therapeutically effective amount of the antibody or antibody fragment thereof according to any one of [1] to [6] above.
  • an embodiment of the antibody or antibody fragment thereof according to the present invention is [26] The antibody or antibody fragment thereof according to any one of [1] to [6] above, which is used for preventing and/or treating the onset of COVID-19.
  • Another aspect of the present invention is [27] It relates to the use of the antibody or antibody fragment thereof according to any one of [1] to [6] above in the manufacture of a pharmaceutical composition for preventing and/or treating the onset of COVID-19.
  • Another aspect of the invention is [28] A method of using the composition according to [7] above, comprising: The present invention relates to a method of using the composition, which includes the step of slowly releasing, spraying, or dispersing the composition into the air.
  • one embodiment of the method of using the composition of the present invention is as follows: [29] A method of using the composition according to [28] above, comprising: The method is characterized in that the step is a step of spraying the composition into the air using a humidifier.
  • the antibody according to the present invention is an antibody that strongly binds to the S1 region of SARS-CoV-2, and can be used for protection against (prevention of) SARS-CoV-2 infection. Furthermore, in addition to pharmaceuticals, the antibodies of the present invention can also be applied to antibody-containing sprays, antibody-containing masks, antibody-containing hand creams, antibody-containing cosmetics, and the like.
  • FIG. 1 shows the heavy chain amino acid sequence of the IgG antibody obtained in Example 1 below and the base sequence encoding it.
  • the underline indicates the heavy chain CDR1 region
  • the double line indicates the heavy chain CDR2 region
  • the wavy line indicates the heavy chain CDR3 region.
  • FIG. 2 shows the amino acid sequence of the heavy chain variable region of the IgG antibody obtained in Example 1 below and the base sequence encoding it.
  • the underline indicates the heavy chain CDR1 region
  • the double line indicates the heavy chain CDR2 region
  • the wavy line indicates the heavy chain CDR3 region.
  • FIG. 3 shows the light chain amino acid sequence of the IgG antibody obtained in Example 1 below and the base sequence encoding it.
  • FIG. 4 shows the amino acid sequence of the light chain variable region of the IgG antibody obtained in Example 1 below and the nucleotide sequence encoding it.
  • the underline indicates the light chain CDR1 region, the double line indicates the light chain CDR2 region, and the wavy line indicates the light chain CDR3 region.
  • FIG. 5 shows the heavy chain amino acid sequence of the IgA antibody obtained in Example 2 below and the base sequence encoding it.
  • the underline indicates the heavy chain CDR1 region, the double line indicates the heavy chain CDR2 region, and the wavy line indicates the heavy chain CDR3 region.
  • FIG. 4 shows the amino acid sequence of the light chain variable region of the IgG antibody obtained in Example 1 below and the nucleotide sequence encoding it.
  • the underline indicates the light chain CDR1 region, the double line indicates the light chain CDR2 region, and the wavy line indicates the light chain CDR3 region.
  • FIG. 5 shows the heavy chain amino acid sequence of the IgA antibody obtained in Example
  • FIG. 6 shows the amino acid sequence of the heavy chain variable region of the IgA antibody obtained in Example 2 below and the nucleotide sequence encoding the same.
  • the underline indicates the heavy chain CDR1 region
  • the double line indicates the heavy chain CDR2 region
  • the wavy line indicates the heavy chain CDR3 region.
  • FIG. 7 shows the light chain amino acid sequence of the IgA antibody obtained in Example 2 below and the nucleotide sequence encoding it.
  • the underline indicates the light chain CDR1 region
  • the double line indicates the light chain CDR2 region
  • the wavy line indicates the light chain CDR3 region.
  • FIG. 8 shows the amino acid sequence of the light chain variable region of the IgA antibody obtained in Example 2 below and the nucleotide sequence encoding the same.
  • FIG. 9 shows the results of the protein microarray performed in Example 3 below in the form of a heat map.
  • the binding ability to each coronavirus-derived protein was evaluated using the antibody according to the present invention, an antibody known as an antibody drug, and a commercially available antibody.
  • “New” refers to SARS-CoV-2
  • “SARS” refers to SARS-CoV
  • “MERS” refers to Middle East Respiratory Syndrome
  • OC43 refers to human coronavirus OC43 (HCoV- OC43)
  • HKU1 indicates human coronavirus HKU1 (HCoV-HKU1)
  • second29E indicates human coronavirus 229E (HCoV-229E)
  • NL63 indicates human coronavirus NL63 (HCoV-NL63). shows.
  • “HIG001677” and “HIG001677A1” indicate antibodies according to the present invention.
  • Figure 10A shows the human ACE2 protein, SARS-CoV2 spike protein (RBD region of S1 domain or trimer containing S1 domain and S2 domain), and each antibody used in Example 5 below. This is a table showing IC50 calculated from the results of antibody binding inhibition evaluation by competitive ELISA method.
  • Figure 10B shows the human ACE2 protein, SARS-CoV2 spike protein (RBD region of S1 domain or trimer containing S1 domain and S2 domain), and each antibody used in Example 5 below. This is a table showing IC50 calculated from the results of antibody binding inhibition evaluation by competitive ELISA method.
  • FIG. 11 is a graph showing the infection inhibition rate of the ABT#03985 antibody against the pseudovirus among the results of neutralization activity evaluation 1 using pseudovirus performed in Example 6-1 below.
  • FIG. 12 is a graph showing the infection inhibition rate of the ABT#04348 antibody against pseudoviruses among the results of neutralization activity evaluation 1 using pseudoviruses performed in Example 6-1 below.
  • FIG. 13 is a graph showing the infection inhibition rate of the HIG001677A1 antibody against the pseudovirus among the results of neutralization activity evaluation 1 using pseudovirus performed in Example 6-1 below.
  • FIG. 14 is a graph showing the infection inhibition rate of the HIG001677 antibody against pseudoviruses among the results of neutralization activity evaluation 1 using pseudoviruses performed in Example 6-1 below.
  • One aspect of the present invention is a heavy chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 1, a heavy chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 2, a heavy chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 3, and a heavy chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 4.
  • Antibodies or antibody fragments thereof are provided that bind to a domain (RBD).
  • SARS-CoV severe acute respiratory syndrome coronavirus
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • coronaviruses belonging to the SARS-related coronavirus Severe acute respiratory syndrome-related coronavirus
  • It is an enveloped, single-stranded, positive-stranded RNA virus.
  • ⁇ SARS-CoV'' is a virus that causes acute respiratory syndrome (SARS).
  • SARS-CoV-2''' is the pathogenic virus that causes COVID-19, a new coronavirus infection.
  • SARS-CoV and SARS-CoV-2 have four major structural proteins: spike (S) protein, nucleocapsid (N) protein, membrane (M) protein, and envelope (E) protein.
  • the spike protein is a type I transmembrane protein consisting of two subunits, the S1 subunit and the S2 subunit, with the S1 subunit containing a receptor binding domain (RBD) that recognizes cell surface receptors.
  • the antibody or antibody fragment thereof according to the invention binds to the receptor binding domain (RBD) of the S1 subunit, the extracellular domain of the spike protein of SARS-CoV-2.
  • the antibody of the present invention or its antibody fragment has the receptor binding domain (RBD) of the S1 subunit to which it binds, it can be ) or a mutant strain that may be generated in the future from the mutant strain, the antibody or antibody fragment thereof according to the present invention can specifically bind.
  • mutant strains include, but are not limited to, the B.1.1.7 strain (Alpha strain), the B.1.351 strain (Beta strain), and the P.1 strain (Gamma strain).
  • gamma strain B.1.617.2 strain (Delta strain), B.1.427/B.1.429 strain (Epsilon strain), P.3 strain (Theta strain), B.1.617.
  • the antibody or antibody fragment thereof according to the present invention is selected from the group consisting of Wuhan strain, Alpha strain, Beta strain, Gamma strain, Delta strain, Epsilon strain, Theta strain, Kappa strain, and Omicron strain.
  • the antibody or antibody fragment thereof according to the invention is directed against extracellular spike proteins derived from Wuhan, Alpha, Beta, Gamma, Delta, Epsilon, Theta, Kappa, and Omicron strains. It specifically binds to all of the receptor binding domains (RBD) of the S1 subunit.
  • the antibody or antibody fragment thereof according to the present invention can be used to target SARS-CoV-2 Wuhan strain, Alpha strain, Beta strain, Gamma strain, Delta strain, Epsilon strain, Theta strain, Kappa strain, and Omicron strain. specifically binds to at least one strain selected from the group consisting of strains.
  • the antibody or antibody fragment thereof according to the present invention is specific for all of the Wuhan strain, Alpha strain, Beta strain, Gamma strain, Delta strain, Epsilon strain, Theta strain, Kappa strain, and Omicron strain. Join.
  • the receptor binding domain (RBD) of the S1 subunit to which the antibody of the present invention or its antibody fragment binds is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 7 (wild type), or the Mention may be made of polypeptides that have mutations in the wild-type polypeptide.
  • the polypeptide consisting of the amino acid sequence of SEQ ID NO: 7 is a polypeptide containing the 319th arginine residue to the 541st phenylalanine residue of the amino acid sequence specified by the accession number YP_009724390.
  • the polypeptide having a mutation in the wild-type RBD polypeptide includes, for example, a polypeptide containing from the 319th arginine residue to the 541st phenylalanine residue of the amino acid sequence specified by the accession number YP_009724390.
  • a conservative amino acid substitution is a substitution that occurs within an amino acid group that is related to the amino acid side chain.
  • Such amino acid substitutions include, for example, if the amino acid before substitution is a nonpolar amino acid (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), substitution with another nonpolar amino acid; If the amino acid is an uncharged amino acid (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine), it can be replaced with another uncharged amino acid; if the amino acid before substitution is an acidic amino acid (aspartic acid, glutamic acid) Examples include substitution with other acidic amino acids, and substitution with other basic amino acids if the amino acid before substitution is a basic amino acid (lysine, arginine, histidine).
  • amino acid groups are: aliphatic hydroxy groups (serine and threonine), amide-containing groups (asparagia and glutamine), aliphatic groups (alanine, valine, leucine and isoleucine), and , aromatic groups (phenylalanine, tryptophan and tyrosine).
  • Such acid substitutions are preferably carried out within a range that does not reduce the properties of the substance having the original amino acid sequence.
  • polypeptide having a mutation in the wild-type RBD polypeptide listed above for example, the amino acid sequence from the 319th arginine residue to the 541st phenylalanine residue is specified by the accession number YP_009724390.
  • Examples include polypeptides having mutations corresponding to the mutations in .
  • P337S indicates that proline at position 337 in a specific amino acid sequence is replaced with cysteine.
  • the polypeptide having a mutation in the wild-type polypeptide of RBD to which the antibody or antibody fragment thereof according to the present invention can bind is not limited to the polypeptides listed above.
  • Antibody binding can be measured and evaluated using known techniques such as protein microarray, ELISA, and Biacore (registered trademark) assay. More specifically, as shown in Example 2 below, the binding ability of antibodies can be evaluated using a protein microarray. In addition, the neutralizing activity of antibodies can be evaluated, for example, as shown in Examples 6 to 8 below, by using pseudoviruses (lentiviruses with coronavirus S glycoprotein in their envelope protein) or SARS-CoV-2 against ACE2-expressing cells. This can be evaluated by measuring the infection-inhibiting effect of antibodies against infection.
  • pseudoviruses lentiviruses with coronavirus S glycoprotein in their envelope protein
  • SARS-CoV-2 against ACE2-expressing cells
  • antibody mainly refers to human antibodies, mouse antibodies, humanized antibodies, chimeric antibodies of human antibodies and antibodies of other mammals, and chimeric antibodies of mouse antibodies and antibodies of other mammals.
  • the antibody is not limited to these as long as it has the property of specifically binding to the extracellular domain of the spike protein of SARS-CoV-2, and there is no particular restriction on the animal species of the antibody.
  • the antibodies of the invention or antibody fragments thereof are human antibodies or antibody fragments thereof.
  • naturally human antibodies refer to antibodies constructed and produced using genetic engineering technology based on the nucleotide sequence information encoding antibodies obtained from human individuals who have recovered from infection with the new coronavirus. say.
  • the term "antibody” as used herein includes the following known structures: Also includes antibodies with: (1) Antibodies consisting of two polypeptide chains, one immunoglobulin light chain and one immunoglobulin heavy chain, (2) a single chain antibody having a linker sequence on the C-terminal side of an immunoglobulin light chain and binding an immunoglobulin heavy chain to the C-terminal side of the linker sequence; (3) a single chain antibody having a linker sequence on the C-terminal side of an immunoglobulin heavy chain and binding an immunoglobulin light chain to the C-terminal side of the linker sequence; (4) Fab antibodies consisting of Fab regions, F(ab') antibodies consisting of Fab regions and all or part of the hinge region, and F(ab') 2 antibodies (5) Fab, F(ab') or scFab, scF(ab'),
  • the linker sequence for producing the antibody is not limited as long as the single chain antibody produced has specific affinity for the extracellular domain of the spike protein of SARS-CoV-2.
  • Examples of such a linker sequence include, but are not limited to, a peptide chain composed of 2 to 50 amino acid residues (preferably a peptide chain composed of only glycine or glycine and serine). can.
  • Antibody fragment refers to an antigen-binding fragment that retains at least a portion of its specific affinity for the extracellular domain of the spike protein of SARS-CoV-2. Examples of binding fragments include those shown in (4) and (5) above.
  • single chain antibodies Fab, Fab', F(ab') 2 , variable region (Fv), heavy chain variable region (V H ) and light chain variable region (V L ) linked with an appropriate linker ( scFv), a diabody which is a dimer of a polypeptide containing a heavy chain variable region (V H ) and a light chain variable region (V L ), and a part of the constant region (C H
  • Fab single chain antibodies
  • Fab', F(ab') 2 variable region
  • V H heavy chain variable region
  • V L light chain variable region linked with an appropriate linker
  • scFv a diabody which is a dimer of a polypeptide containing a heavy chain variable region (V H ) and a
  • antibody fragments are not limited to these molecules as long as they have specific affinity for the spike protein extracellular domain of SARS-CoV-2.
  • the antibody or antibody fragment thereof according to the present invention has any of the CDRs represented by SEQ ID NOs: 1 to 6 (any combination or all) and is directed against the extracellular domain of the spike protein of SARS-CoV-2.
  • the class and subclass of the antibody is not limited as long as it has specific affinity.
  • a preferred embodiment of the antibody or antibody fragment thereof according to the present invention is an IgG antibody or an IgA antibody, or an antibody fragment thereof. It is preferable to use an IgG antibody because the stability of the antibody is enhanced.
  • an IgA antibody it can be suitably used for applications focusing on the primary defense function of living organisms.
  • Applications focused on primary defense functions include, but are not limited to, the prevention of SARS-CoV-2 infection by local administration (eyes or nose) of living bodies, and/or the prevention and/or onset of COVID-19.
  • the antibody or antibody fragment thereof according to the present invention is an IgA antibody, it may be a monomer or a multimer such as a dimer, trimer, or tetramer.
  • the term IgA antibody includes these multimers.
  • the IgA antibody is dimeric.
  • CDR complementarity determining region. It is known that the heavy chain and light chain of an antibody molecule each have three CDRs. CDRs, also called hypervariable domains, are located within the variable regions of the heavy and light chains of antibodies, and are regions with particularly high variability in primary structure, and are located in the polypeptide chains of heavy and light chains. Each is separated into three locations on its primary structure.
  • heavy chain CDRs are expressed as heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3 from the amino terminal side of the heavy chain amino acid sequence, and light chain CDRs are expressed as the light chain amino acid sequence. From the amino terminal side, they are written as light chain CDR1, light chain CDR2, and light chain CDR3.
  • the "heavy chain” has the structure of Ig ⁇ , Ig ⁇ , Ig ⁇ , Ig ⁇ , Ig ⁇ corresponding to the classes of IgG, IgM, IgA, IgD, and IgE, and , and can take the structures of Ig ⁇ 1, Ig ⁇ 2, Ig ⁇ 3, Ig ⁇ 4, Ig ⁇ 1, and Ig ⁇ 2 corresponding to the subclasses.
  • the antibody of the invention is an IgG antibody or an IgA antibody
  • the heavy chain is Ig ⁇ 1 and/or Ig ⁇ 2.
  • the heavy chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgG antibody, and has a heavy chain consisting of any amino acid sequence selected from the group consisting of (a) to (c) below.
  • the heavy chain variable region consisting of the specified amino acid sequence has the above (a) affinity for the receptor binding domain (RBD) of the S1 subunit of SARS-CoV-2, which the heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 8 has. It is to maintain the
  • the heavy chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgG antibody and contains any amino acid selected from the group consisting of (a') to (c') below.
  • Consists of an array (a') Amino acid sequence of SEQ ID NO: 10, (b') an amino acid sequence having at least 90% identity to the framework region and constant region sequences other than each CDR sequence in the sequence (a'), and (c') Amino acid sequence in which one or several amino acids are deleted, substituted or added in the framework region and constant region sequences other than each CDR sequence in the sequence (a') above.
  • the heavy chain variable region consisting of the amino acid sequence specified in (c') above is a receptor for the S1 subunit of SARS-CoV-2 possessed by the heavy chain variable region consisting of the amino acid sequence of (a') SEQ ID NO: 10 above. It maintains affinity for the binding domain (RBD).
  • the heavy chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgA antibody, and has any amino acid selected from the group consisting of (a'') to (c'') below.
  • the heavy chain variable region consisting of the amino acid sequence specified in (c'') above is the S1 subunit of SARS-CoV-2 possessed by the heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 29 (a'') above. It maintains affinity for the receptor binding domain (RBD).
  • the heavy chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgA antibody and is selected from the group consisting of (a''') to (c''') below. Consists of either amino acid sequence: (a''') Amino acid sequence of SEQ ID NO: 30, (b''') an amino acid sequence having at least 90% identity to the framework region and constant region sequences other than each CDR sequence in the sequence (a'''), and (c''') An amino acid sequence in which one or several amino acids have been deleted, substituted, or added in the framework region and constant region sequences other than each CDR sequence in the sequence (a''') above.
  • the heavy chain variable region consisting of the amino acid sequence specified in (b'') or (c''') above is the SARS- It maintains the affinity for the receptor binding domain (RBD) of the S1 subunit of CoV-2.
  • the "light chain” can have an Ig ⁇ or Ig ⁇ structure.
  • the antibody of the invention is an IgG antibody or an IgA antibody, and the light chain is Ig ⁇ .
  • the light chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgG antibody, and the heavy chain consists of any amino acid sequence selected from the group consisting of (d) to (f) below.
  • variable regions (d) the amino acid sequence of SEQ ID NO: 9, (e) an amino acid sequence having at least 90% identity to the framework region sequences other than each CDR sequence in the sequence (d) above, and (f) an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the framework region sequence other than each CDR sequence in the sequence (e) above;
  • a light chain variable region consisting of an amino acid sequence specified in (e) or (f) above is a light chain variable region consisting of an amino acid sequence selected from the group consisting of (d) SEQ ID NO: 9. This maintains the affinity of the light chain variable region for the receptor binding domain (RBD) of the S1 subunit of SARS-CoV-2.
  • the light chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgG antibody and contains any amino acid selected from the group consisting of (d') to (f') below.
  • Consists of an array (d') Amino acid sequence of SEQ ID NO: 11, (e') an amino acid sequence having at least 90% identity to the framework region and constant region sequences other than each CDR sequence in the sequence (d'), and (f') An amino acid sequence in which one or several amino acids are deleted, substituted, or added in the framework region and constant region sequences other than each CDR sequence in the sequence (d') above.
  • the light chain variable region consisting of the amino acid sequence specified in (f') above is a receptor for the S1 subunit of SARS-CoV-2 possessed by the light chain variable region consisting of the amino acid sequence of (d') SEQ ID NO: 11 above. It maintains affinity for the binding domain (RBD).
  • the light chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgA antibody and has any amino acid sequence selected from the group consisting of (d'') to (f'') below.
  • the light chain of the antibody or antibody fragment thereof according to the present invention has the structure of an IgA antibody and is selected from the group consisting of (d''') to (f''') below. Consists of either amino acid sequence: (d''') amino acid sequence of SEQ ID NO: 32, (e''') an amino acid sequence having at least 90% identity to the framework region and constant region sequences other than each CDR sequence in the sequence (d'''), and (f''') An amino acid sequence in which one or several amino acids have been deleted, substituted, or added in the framework region and constant region sequences other than each CDR sequence in the sequence (d''') above.
  • the light chain variable region consisting of the amino acid sequence specified in (e'') or (f''') above is the SARS- It maintains the affinity for the receptor binding domain (RBD) of the S1 subunit of CoV-2.
  • an amino acid sequence that has at least 90% or more identity to a framework region sequence other than each CDR sequence in a specific amino acid sequence is an amino acid sequence that has the same CDR as the specific amino acid sequence, and It means an amino acid sequence that has a mutation only in the framework region of the amino acid sequence.
  • Amino acid mutations in the framework region are 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence in the framework region before mutation introduction. % or more.
  • any numerical value of "identity” shown in this specification may be a numerical value calculated using a homology search program known to those skilled in the art, for example, a default (initial setting) parameter in FASTA, BLAST, etc. It can be easily calculated by using .
  • the Blast algorithm can also be used by visiting www.ncbi.nlm.nih.gov/blast on the Internet. Note that the homology between the nucleotide sequence of the antibody of the present invention and the nucleotide sequences of other antibodies can also be determined by Blast algorithm.
  • severe amino acids When “several amino acids are deleted, substituted, or added,”"several refers to 1 to 50, 1 to 48, 1 to 40, 1 to 30, 1 to 23, 1 to 20 pieces, 1 to 10 pieces, 1 to 9 pieces, 1 to 8 pieces, 1 to 7 pieces, 1 to 6 pieces, 1 to 5 pieces, 1 to 4 pieces, 1 to 3 pieces, or 1 or 2 pieces do. Any amino acid substitutions introduced are preferably conservative substitutions.
  • the antibody or antibody fragment thereof according to the present invention has high affinity for the receptor binding domain (RBD) of the S1 subunit, the extracellular domain of the spike protein of SARS-CoV-2.
  • the antibody or antibody fragment thereof according to the invention has a dissociation constant (K D ) for the receptor binding domain (RBD) of the S1 subunit of SARS-CoV-2 of less than 20 nM, more preferably less than 5 nM. , less than 2 nM, less than 1 nM, more preferably less than 0.1 nM, less than 0.05 nM.
  • K D dissociation constant
  • the dissociation constant of an antibody or an antibody fragment thereof can be evaluated by Biacore according to the method described in Example 4 below.
  • compositions comprising the above-described antibody or antibody fragment thereof according to the present invention. That is, one embodiment of the composition includes heavy chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 1, heavy chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 2, heavy chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 3, and heavy chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 3.
  • a composition comprising an antibody or antibody fragment thereof that binds to the S1 subunit in the extracellular domain.
  • the antibody or antibody fragment thereof included in the composition competes for binding between the extracellular domain of the human ACE receptor and the extracellular domain of the spike protein of SARS-CoV-2.
  • the composition according to the present invention can be used as an element (component) constituting a filter, spray, mask, etc. used to prevent infection with SARS-CoV-2, or as a component of cosmetics.
  • the filter is not limited to the following, examples include filters for air purifiers and air conditioners.
  • One aspect of the present invention also includes a method of slowly releasing, spraying, or dispersing a composition containing the above-described antibody or antibody fragment of the present invention into the air. That is, the composition according to the present invention (preferably a liquid composition) can be used by slow release, spraying, or scattering into the air (in a closed space such as indoors or in an open space such as outdoors). can.
  • the means is not limited as long as the composition according to the present invention can be released slowly, sprayed, or dispersed, and any known means (microcapsules, etc.), devices (humidifiers, etc.), and methods can be employed.
  • any known means microcapsules, etc.
  • devices humidityidifiers, etc.
  • the composition according to the present invention can be sprayed into the air while humidifying the air. Therefore, the composition according to the present invention can be provided in a form suitable for sustained release, spraying, or dispersion into the air (for example, an aqueous solution for a humidifier) depending on the means, apparatus, and method employed.
  • composition according to the present invention can be used as a composition for food or drink, a reagent for detecting SARS-CoV-2, a COVID-19 diagnostic agent, or a pharmaceutical composition used for preventing and/or treating the onset of COVID-19. It can also be provided as
  • the composition according to the present invention can adopt a form suitable for its use and contain preferred components. Therefore, the form of the composition is not limited, and may be in liquid form such as an aqueous solution, suspension, or emulsion, or in solid form (powder form) together with a carrier so that it can be dissolved, suspended, or emulsified. , lyophilized powder, etc.).
  • Solvents for dissolving antibodies or antibody fragments thereof include, but are not limited to, physiological saline, glucose solutions, and isotonic solutions (e.g., sodium chloride, potassium chloride, glycerin, mannitol, sorbitol, boric acid, borax). , propylene glycol, etc.), distilled water for injection, methanol, ethanol, propanol, isopropanol, and other organic solvents.
  • Carriers that can be used in the composition include, but are not limited to, stabilizers, solubilizers, suspending agents, emulsifiers, soothing agents, buffers, preservatives, preservatives, pH adjusters, and Examples include antioxidants.
  • stabilizers include various amino acids, albumin, globulin, gelatin, mannitol, glucose, dextran, ethylene glycol, propylene glycol, polyethylene glycol, ascorbic acid, sodium bisulfite, sodium thiosulfate, sodium edetate, sodium citrate, Dibutylhydroxytoluene and the like can be used.
  • solubilizing agents examples include alcohols (e.g., ethanol, etc.), polyalcohols (e.g., propylene glycol, polyethylene glycol, etc.), nonionic surfactants (e.g., polysorbate 20 (registered trademark), polysorbate 80 (registered trademark) ), HCO-50, etc.) can be used.
  • alcohols e.g., ethanol, etc.
  • polyalcohols e.g., propylene glycol, polyethylene glycol, etc.
  • nonionic surfactants e.g., polysorbate 20 (registered trademark), polysorbate 80 (registered trademark)
  • HCO-50 etc.
  • the suspending agent for example, glyceryl monostearate, aluminum monostearate, methylcellulose, carboxymethylcellulose, hydroxymethylcellulose, sodium lauryl sulfate, etc.
  • emulsifier for example, gum arabic, sodium alginate, tragacanth, etc. can be used
  • the soothing agent for example, benzyl alcohol, chlorobutanol, sorbitol, etc.
  • the buffer for example, phosphate buffer, acetate buffer, borate buffer, carbonate buffer, citrate buffer, Tris buffer, glutamate buffer, epsilon aminocaproate buffer, etc.
  • preservatives include methyl paraoxybenzoate, ethyl paraoxybenzoate, propyl paraoxybenzoate, butyl paraoxybenzoate, chlorobutanol, benzyl alcohol, benzalkonium chloride, sodium dehydroacetate, sodium edetate, boric acid, and boric acid. Sand etc. can be used.
  • preservative for example, benzalkonium chloride, paraoxybenzoic acid, chlorobutanol, etc.
  • pH adjuster for example, hydrochloric acid, sodium hydroxide, phosphoric acid, acetic acid, etc. can be used.
  • antioxidants for example, (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc., (2) ascorbyl palmitate, butylated hydroxyanisole, (3) using oil-soluble antioxidants such as butylated hydroxytoluene, lecithin, propyl gallate, ⁇ -tocopherol, etc.; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid, sorbitol, tartaric acid, phosphoric acid, etc. Can be done.
  • water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.
  • ascorbyl palmitate butylated hydroxyanisole
  • oil-soluble antioxidants such as butylated hydroxytoluene, lecithin, propyl gallate, ⁇ -tocophe
  • the carrier is a pharmaceutically acceptable carrier.
  • a carrier that can be used.
  • examples of pharmaceutically acceptable carriers include the carriers listed above.
  • the content of the antibody or antibody fragment thereof in the composition of the present invention may be within a range that provides the desired effect depending on the intended use. For example, but not limited to, it can be 1 ⁇ g/kg to 1,000 mg/kg.
  • the present invention provides a spray for preventing SARS-CoV-2 infection, comprising the above composition.
  • the spray for preventing SARS-CoV-2 infection of the present invention contains the above-mentioned antibodies or antibody fragments thereof and their solvents. Therefore, it can be used by spraying in areas where SARS-CoV-2 infection is suspected (including, but not limited to, closed spaces, open spaces, masks, doorknobs, desks, straps, etc.), and it can also be used on hands. It can be used for disinfection.
  • the spray for preventing SARS-CoV-2 infection of the present invention can further contain other buffers, salts, sugars, additives (preservatives, surfactants, etc.), and the like.
  • known solvents, buffers, salts, sugars, additives, etc. that can be used in the spray can be used as long as they do not inhibit the affinity of the antibody for SARS-CoV-2.
  • it can be prepared using ethanol as a solvent and adding a preservative such as methylparaben and a surfactant such as polysorbate 80.
  • a spray can be manufactured according to a known spray manufacturing method.
  • the present invention provides a filter that includes a substrate carrying the composition described above.
  • the filter of the present invention can be used in applications such as air purifiers and mask materials to capture SARS-CoV-2 in the air.
  • the substrate is not limited as long as it can support the above antibody or antibody fragment and does not inhibit the affinity for SARS-CoV-2.
  • base materials include polyvinyl alcohol fibers (e.g., vinylon), polyester fibers (e.g., polyethylene terephthalate fibers), polyamide fibers (e.g., nylons such as nylon 6 and nylon 66, polyacrylamide fibers, etc.), polyolefin fibers (e.g., polyethylene fibers), synthetic fibers such as acrylic fibers, polyurethane fibers, cellulose fibers, and cellulose ester fibers; natural fibers such as cotton, silk, wool, and rayon; and recycled fibers and mixtures thereof.
  • polyvinyl alcohol fibers e.g., vinylon
  • polyester fibers e.g., polyethylene terephthalate fibers
  • polyamide fibers e.g., nylons such as nylon 6 and nylon 66, polyacrylamide fibers, etc.
  • polyolefin fibers e.g., polyethylene fibers
  • synthetic fibers such as acrylic fibers, polyurethane fibers, cellulose fibers, and cellulose ester fiber
  • the form of the base material may be nonwoven fabrics such as films, spunbond nonwoven fabrics, spunlace nonwoven fabrics, needle punched nonwoven fabrics, melt blown nonwoven fabrics, flash spun nonwoven fabrics, thermal bonded nonwoven fabrics, chemical bonded nonwoven fabrics, stitch bonded nonwoven fabrics, and wet paper-made nonwoven fabrics, or woven fabrics.
  • nonwoven fabrics such as films, spunbond nonwoven fabrics, spunlace nonwoven fabrics, needle punched nonwoven fabrics, melt blown nonwoven fabrics, flash spun nonwoven fabrics, thermal bonded nonwoven fabrics, chemical bonded nonwoven fabrics, stitch bonded nonwoven fabrics, and wet paper-made nonwoven fabrics, or woven fabrics.
  • sheets such as paper.
  • its basis weight is not particularly limited, but can be, for example, 1 ⁇ g/m 2 to 200 mg/m 2 .
  • the method of supporting a composition containing an antibody or an antibody fragment thereof on a substrate is not limited as long as the antibody can be supported on the substrate, but for example, a method of spraying an antibody-containing solution (liquid composition) onto a substrate, A method can be mentioned in which the material is impregnated with an antibody-containing solution (liquid composition) at an appropriate concentration and dried at an appropriate temperature and time.
  • a method of impregnating the substrate with an antibody-containing solution to support the antibody can be performed with reference to, for example, JP-A-2010-131537.
  • a method of introducing a functional group such as an aldehyde group onto the surface of the substrate and covalently bonding the antibody and the functional group and a method of using a carrier with molecules (Fc receptor, protein A/G, etc.) that selectively binds to the Fc portion of the antibody.
  • the antibody may be supported on the substrate via a linker or a method in which the antibody is introduced onto the surface and bound to the surface.
  • One aspect of the present invention provides a mask for preventing SARS-CoV-2 infection or spread, which includes the above filter.
  • the mask for preventing SARS-CoV-2 infection or spreading of the present invention is equipped with the above-mentioned filter to capture SARS-CoV-2 in the air and infiltrate into the body, or for subjects infected with SARS-related coronavirus. It captures SARS-CoV-2 contained in exhaled air and prevents it from being released outside the body (or into the air).
  • the form of the mask is not limited, and it can preferably be an oral cavity mask or a nasal cavity mask.
  • the mask for preventing SARS-CoV-2 infection of the present invention only needs to include the above-mentioned filter in the mask so that SARS-CoV-2 contained in exhaled or inhaled air can be captured.
  • Such a mask can be manufactured by a known method.
  • One aspect of the present invention provides a composition for food or drink containing the above-described antibody or antibody fragment thereof. Since the food and drink composition of the present invention contains antibodies or antibody fragments thereof that have affinity for SARS-CoV-2, SARS-CoV-2 taken into the body can enter cells in the esophagus, stomach, intestines, etc. restrain from doing. Therefore, in one embodiment, the food and drink composition of the present invention can be provided as a food composition for preventing infection with SARS-CoV-2.
  • the food and drink compositions may be in any form such as liquid, paste, gel-like solid, powder, etc., such as nutritional supplements, tablets, liquid foods (nutritive foods for tube ingestion); Flour products such as bread, macaroni, spaghetti, noodles, cake mixes, fried chicken powder, and bread crumbs; instant noodles, cup noodles, retort/cooked foods, cooked canned foods, microwave foods, instant soups/stews, instant miso soup/suimono, and canned soups.
  • liquid, paste, gel-like solid, powder, etc. such as nutritional supplements, tablets, liquid foods (nutritive foods for tube ingestion); Flour products such as bread, macaroni, spaghetti, noodles, cake mixes, fried chicken powder, and bread crumbs; instant noodles, cup noodles, retort/cooked foods, cooked canned foods, microwave foods, instant soups/stews, instant miso soup/suimono, and canned soups.
  • processed agricultural products such as canned agricultural products, canned fruits, jams and marmalades, pickles, boiled beans, dried agricultural products, and cereals (processed grain products); canned marine products; , processed seafood products such as fish hams and sausages, seafood paste products, seafood delicacies, and boiled fish; processed livestock products such as canned livestock products and pastes, meat hams and sausages; processed milk, milk drinks, yogurts, lactic acid bacteria drinks, Milk and dairy products such as cheese, ice cream, powdered milk, cream, and other dairy products; Oils and fats such as butter, margarine, and vegetable oil; Soy sauce, miso, sauces, processed tomato seasonings, mirin, and vinegar Basic seasonings such as cooking mixes, curry ingredients, sauces, dressings, noodle soups, spices, and other complex seasonings and foods; Frozen raw foods, semi-cooked frozen foods, Frozen foods such as cooked frozen foods; Confectionery such as caramels, candies, chew
  • the content of the antibody or its antibody fragment contained in the food/beverage composition of the present invention may be within a range in which a desired effect can be obtained depending on the form thereof. For example, but not limited to, it can be 1 ⁇ g/kg to 1,000 mg/kg.
  • Such food and drink compositions can be produced according to known methods.
  • the present invention provides a cosmetic product comprising the above-described antibody or antibody fragment thereof.
  • the cosmetics of the present invention prevent SARS-CoV-2 attached to the skin from entering the body (into cells) through mucous membranes, etc. suppress.
  • the form of cosmetics is not limited, and examples include lotion, serum, milky lotion, cream, facial cleanser, pack, body cleanser, shampoo, conditioner, treatment, conditioner, hair lotion, hair tonic, hair oil, hair cream, and hair. It can be in the form of wax, hair foam, gel, grease, pomade, tick, hair spray, hair water, hair mist, hair dye, coloring agent, bleaching agent, mascara, eyebrow mascara, eyebrow eyebrow, etc.
  • the content of the antibody or its antibody fragment contained in the cosmetics of the present invention may be within a range that allows desired effects to be obtained depending on the form thereof. For example, but not limited to, it can be 0.1 ng/ml to 100 mg/ml.
  • Such cosmetics can be manufactured according to known methods.
  • the present invention provides a reagent for detecting SARS-CoV-2 and a diagnostic agent for COVID-19, which contain the above-described antibody or antibody fragment thereof.
  • Methods for immunologically measuring SARS-CoV-2 using the antibodies of the present invention or antibody fragments thereof include, but are not limited to, enzyme immunoassays (hereinafter referred to as EIA or ELISA), chemiluminescent enzyme immunoassays, etc.
  • CLIA chemiluminescence immunoassay
  • FET fluorescent antibody assay
  • FION fluorescent enzyme immunoassay
  • ELIA electrochemiluminescence immunoassay
  • RIA radioimmunoassay
  • Known methods such as , agglutination method, competition method, etc. can be adopted.
  • the antibody or antibody fragment used in the SARS-CoV-2 detection reagent of the present invention may be labeled according to the measurement method. good.
  • the specimen to be detected for SARS-CoV-2 is not particularly limited, and may be a biologically derived sample or an environmentally derived sample.
  • Aqueous specimens are preferred, such as blood (whole blood, plasma, serum, etc.), urine, tissue fluid, lymph fluid, joint fluid, milk, cerebrospinal fluid, pus, saliva, tears, mucus, nasal discharge, sputum, ascites, and water.
  • body fluids such as semen, washing fluids after washing nasal cavities, bronchi, lungs, skin, abdominal cavity, various organs, joints, bones, etc., cell culture supernatants, column eluates, sewage samples, etc. .
  • samples can be used for measurement as they are, or after being diluted with various buffers or the like, or concentrated after extraction. Furthermore, by collecting any of the above specimens from a subject, it is possible to assist in determining whether or not the subject is suffering from COVID-19.
  • a pharmaceutical composition containing the antibody of the present invention or its antibody fragment may contain only the antibody or its antibody fragment as an active ingredient, but it usually contains a pharmaceutically acceptable compound as listed above. It can be produced by a known method by mixing together with one or more carriers. It is desirable to use the most effective administration route for the pharmaceutical composition of the present invention for treatment; oral administration; transmucosal administration such as intranasal, oral, respiratory tract, and intrarectal administration; subcutaneous, intramuscular, and intravenous administration. Parenteral administration such as intravenous administration can be mentioned. Examples of dosage forms include, but are not limited to, sprays, capsules, tablets, granules, syrups, emulsions, suppositories, injections, ointments, tapes, and the like.
  • Preparations suitable for oral administration include emulsions, syrups, capsules, tablets, powders, and granules.
  • Preparations suitable for parenteral administration include injections, suppositories, and sprays. Sprays are prepared using the antibody or its antibody fragment itself or a carrier that does not irritate the subject's oral and respiratory mucous membranes and disperses the antibody or its antibody fragment as fine particles to facilitate absorption.
  • Specific examples of carriers include lactose and glycerin. Depending on the nature of the antibody or its antibody fragment and the carrier used, formulations such as aerosols and dry powders are possible.
  • the dose or frequency of administration varies depending on the desired therapeutic effect, administration method, treatment period, age, body weight, etc., but can be, for example, usually 1 ⁇ g/kg to 100 mg/kg per day for adults.
  • the pharmaceutical composition according to the invention is administered as a spray into the respiratory airways of the nasal cavity or throat.
  • Sprays suitable for administration are not particularly limited, but inhalation aerosol types that are sprayed as an aerosol are preferred.
  • Another aspect of the present invention provides a method for preventing and/or treating the onset of COVID-19, which includes the step of administering to a subject a therapeutically effective amount of the above antibody or antibody fragment thereof.
  • Subject refers to humans or non-human mammals (e.g., mice, guinea pigs, hamsters, rats, rats, rabbits, pigs, sheep, goats, cows, horses, cats, dogs, marmosets, monkeys, or chimpanzees). (one or more types).
  • the target may also be a patient who has developed COVID-19, has developed COVID-19, or has been diagnosed as being at risk of developing COVID-19.
  • Another aspect of the invention provides a polynucleotide encoding an antibody or antibody fragment thereof according to the invention.
  • Another aspect of the present invention provides an expression vector containing the above-described polynucleotide according to the present invention.
  • a polynucleotide of the invention encodes an antibody or antibody fragment thereof comprising a heavy chain CDR identified as SEQ ID NO: 1-3 or a light chain CDR identified as SEQ ID NO: 4-6.
  • the polynucleotide of the present invention is a polynucleotide encoding the heavy chain or light chain of an IgG antibody, which is a polynucleotide consisting of SEQ ID NO: 12 encoding the heavy chain, or a polynucleotide consisting of SEQ ID NO: 12 encoding the light chain. It is a polynucleotide consisting of 13.
  • the polynucleotide of the present invention is a polynucleotide encoding the heavy chain or light chain of an IgA antibody, which is a polynucleotide consisting of SEQ ID NO: 33 encoding the heavy chain, or a polynucleotide encoding the light chain.
  • This is a polynucleotide consisting of SEQ ID NO: 34.
  • the polynucleotide of the present invention is a polynucleotide encoding the variable region of the heavy chain or light chain of an IgG antibody, and comprising SEQ ID NO: 35 encoding the heavy chain, or a polynucleotide encoding the variable region of the heavy chain or light chain of an IgG antibody.
  • This is a polynucleotide consisting of SEQ ID NO: 36 encoding.
  • the polynucleotide of the present invention is a polynucleotide encoding the variable region of the heavy chain or light chain of an IgA antibody, and consisting of SEQ ID NO: 37 encoding the heavy chain, or a polynucleotide encoding the variable region of the heavy chain or light chain of an IgA antibody, or This is a polynucleotide consisting of SEQ ID NO: 38 encoding.
  • a transformant can be produced by introducing a vector containing this polynucleotide or the polypeptide into cells.
  • the polynucleotide or vector may be constructed to be capable of expressing anti-SARS-CoV-2 antibodies.
  • the polynucleotide or vector can contain components necessary for protein expression, such as a promoter, enhancer, and origin of replication, and/or genes for screening such as antibiotic resistance genes. Further, the polynucleotide or vector may have a base sequence derived from a different species.
  • a base sequence derived from a foreign species is, for example, a base sequence derived from two or more species selected from the group consisting of humans and non-human organisms (e.g., bacteria, archaea, yeast, insects, birds, viruses, or mammals other than humans). It may contain the original base sequence.
  • the above vectors are not limited as long as they can carry out protein expression in host cells, such as Escherichia coli-derived plasmids (e.g. pET-Blue), Bacillus subtilis-derived plasmids (e.g. pUB110), yeast-derived plasmids (e.g. pSH19). , animal cell expression plasmids (e.g. pA1-11, pcDNA3.1-V5/His-TOPO, pcDNA 3.1(-) Mammalian Expression Vector, pcDNA 3.1/Hygro(-) Mammalian Expression Vector), bacteriophages such as ⁇ phage, viruses Vectors derived from the above can be used.
  • the vector may be an expression vector and may be circular.
  • the "host cell” may be a cell of a human or a mammal other than a human (eg, rat, mouse, guinea pig, rabbit, cow, monkey, etc.).
  • mammalian cells include Chinese hamster ovary cells (CHO cells), monkey cells COS-7, human fetal kidney cells (eg, HEK293 cells), and mammalian cells Expi293.
  • the host cell may be Escherichia bacteria, yeast, or the like.
  • Methods for introducing the above-mentioned polynucleotides or vectors into cells are known, such as the calcium phosphate method, lipofection method, electroporation method, adenovirus method, retrovirus method, or microinjection.
  • a method for producing antibodies using cells is also known, and antibodies are produced by culturing cells under culture conditions suitable for host cells, and then recovered.
  • Another aspect of the present invention provides a method for producing an antibody, which includes the steps of culturing the host cell according to the present invention described above, and collecting the antibody of interest from the culture obtained in the step.
  • the method for producing an antibody may include a step of preparing a cell culture medium, and may also include a step of purifying an anti-SARS-CoV-2 antibody.
  • Antibody purification methods are known, such as ammonium sulfate, ethanol precipitation, protein A, protein G, protein L, gel filtration chromatography, anion, cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography. , affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or the like can be used.
  • Example 1 Recovery of IgG antibody and identification of CDR sequence
  • PBMCs Human peripheral blood mononuclear cells
  • PBMCs Human peripheral blood mononuclear cells
  • PBMCs Human peripheral blood mononuclear cells
  • a blastoid cell line (LCL) was generated.
  • B cells which normally do not have the ability to proliferate, were infected with human Epstein-Barr virus (EB virus) and transformed into a lymphoblastoid cell line (LCL) that has the ability to proliferate.
  • EB virus Epstein-Barr virus
  • An EB virus solution for infecting with EB virus was prepared as follows. B95-8 cells were cultured in RPMI medium (10% FBS), and after passage once, they were seeded at a concentration of 4 to 6 ⁇ 10 4 cells/ml. After that, the culture was continued for 10 to 14 days without replacing the medium. After the culture was completed, the B95-8 cell culture solution was centrifuged at 400 ⁇ g for 10 minutes at room temperature to collect the culture supernatant. The culture supernatant was filtered through a 0.45 ⁇ m filter and centrifuged at 10,000 rpm for 3 hours at 4°C to collect the virus fraction. It was dissolved again in RPMI1640 (10% FBS) to prepare an EB virus solution.
  • the EB virus solution was aliquoted and stored at -80°C until use. After thawing the PBMC, the number of cells was measured, and 100 ⁇ L of EB virus solution was added per 1 ⁇ 10 6 to 10 7 cells, followed by culturing at 37° C. for 30 minutes. After the infection, the cells were centrifuged at 400 xg for 10 minutes at room temperature, the supernatant was removed, and after washing once, they were suspended in RPMI1640 medium (20% FBS) to start culturing. After culturing for 7 to 14 days, a lymphoblastoid cell line (LCL) with proliferation ability was obtained.
  • RPMI1640 medium (20% FBS
  • Alexa Fluor 488 labeling of anti-His-tag antibody was labeled according to the procedure of Alexa Fluor 488 Antibody Labeling Kit (ThermoFisher Scientific, A20181).
  • coronavirus antigen - Alexa Fluor 488 was prepared by reacting with an anti-His-tag antibody labeled with Alexa Fluor 488. did. Specifically, coronavirus antigen was prepared at 100 ⁇ g/mL with a sorting solution, 15 ⁇ g of Alexa Fluor 488-labeled anti-His-tag antibody was added, and the mixture was incubated on ice for 30 minutes.
  • Single cell sorting of LCL LCL of interest was single cell sorted using a fluorescently labeled antigen. Specifically, LCLs in culture were washed with PBS and then adjusted to 2 ⁇ 10 7 cells/mL with a sorting solution. In the combination shown in Table 1, 5 ⁇ g of antigen and 1 ⁇ g of anti-IgA antibody (Bethyl, Cat. A80-202D5) were added per 1 ⁇ 10 6 cells, and incubated on ice for 30 minutes. After incubation, the cells were washed twice with PBS and suspended in a sorting solution.
  • an Alexa647-labeled anti-human IgA antibody fluorescently labeled with Alexa Fluor 647 as an antibody for detecting human immunoglobulin, and a Cy3-labeled anti-goat IgG antibody fluorescently labeled with Cy3 for detecting a reference antibody were added to 2 ml of secondary It was added to the diluted antibody solution and added to the cassette after stirring.
  • solution B 10X
  • solution B 10X
  • the protein microarray used for LCL antibody profiling is based on microorganisms (Actinomycetes, Aerococcaceae, Aeromonadaceae, Alcaligenes, Alcaligenes, Bacillus, Bacteroidetes, Bifidobacteriaceae, Campylobacteriaceae, Chlamydiaceae).
  • oligo(dT) primer (5'-GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3': SEQ ID NO: 14) with an arbitrary sequence added to the 5' end, perform a reverse transcription reaction using SMARTScribe Reverse Transcriptase (TaKaRa, Cat.Z9538N).
  • cDNA synthesis was performed by adding an adapter oligo capable of binding to the 5' end.
  • the adapter oligo capable of binding to the 5' end was synthesized as an LNA-RNA-DNA chimera oligo with the sequence 5'-AAGCAGTGGTATCAACGCAGAGTACCGGG-3' (SEQ ID NO: 15).
  • 1stPCR_FW primer (5'- AAGCAGTGGTATCAACGCAGAGTAC -3' : SEQ ID NO: 16) and 1stPCR_RV primer (5'- GCGGCTGAAGACGGCCTATGT). -3': SEQ ID NO: 17) and PrimeSTAR GXL DNA Polymerase (TaKaRa, Cat. R050B), 1st PCR was performed to amplify all the RNAs expressed in the antibody-producing cells.
  • 2ndPCR_FW primer (5'- ACGGGCCCTCTAGACAAGCAGTGGTATCAACGC -3': SEQ ID NO: 24
  • 2ndPCR_IgG_RV primer (5'- TTACCCGGAGACAGGGAGAGG -3': SEQ ID NO: 25)
  • 2ndPCR_Ig-K_RV primer (5' - CCTGTTGAAGCTCTTTGTGACG -3': SEQ ID NO: 26)
  • 2nd PCR_Ig-L_RV primer (5'- GGGGCCACTGTCTTCTCCA -3': SEQ ID NO: 27)
  • PrimeSTAR GXL DNA Polymerase (TaKaRa, Cat.
  • R050B was applied to each of the H chain and L chain.
  • 2nd PCR was performed using the PCR method to amplify the full-length antibody gene. Size was confirmed by agarose gel electrophoresis, and only cells in which full-length antibody genes of the expected size for both H and L chains were amplified were selected. Since the 2nd PCR product contains residual oligos and non-specific side reaction products, the 2nd PCR product was purified by performing treatments such as extraction using PCR product purification beads and agarose gel. The H chain antibody gene fragments and L chain antibody gene fragments obtained for each were aligned to create an antibody gene set.
  • Expression clones for producing antibodies in mammalian cells were created. Expression clones were created from the H chain and L chain, and finally antibodies were produced by simultaneously transfecting cells with both. The antibody gene fragments for the H chain and L chain were cloned into a cell expression cassette vector that can be used for expression analysis using a recombination reaction between homologous sequences called seamless cloning.
  • pcDNA 3.1 (-) Mammalian Expression Vector (Invitrogen (ThermoFisher SCIENTIFIC, V79520) was used for the H chain gene
  • pcDNA 3.1/Hygro(-) Mammalian Expression Vector (Invitrogen (ThermoFisher SCIENTIFIC, V79520) was used for the L chain gene.
  • the vector into which the antibody gene fragment had been introduced was transformed into Escherichia coli. The transformants were selected and cultured on a drug-containing agar medium.Four subclones were selected for each antibody gene and cultured.
  • Plasmid DNA was prepared from the E. coli culture using an automatic plasmid separation device. The size of the prepared plasmid DNA was confirmed by agarose gel electrophoresis.
  • antibody gene expression clones whose antibody gene sequences could be determined were aligned as an antibody gene expression clone set.
  • the heavy chain amino acid sequence of the obtained antibody and the base sequence encoding it are shown in FIG.
  • the amino acid sequence of the heavy chain variable region of the obtained antibody and the nucleotide sequence encoding it are shown in FIG. 2.
  • the light chain amino acid sequence of the obtained antibody and the base sequence encoding it are shown in FIG.
  • the amino acid sequence of the light chain variable region of the obtained antibody and the nucleotide sequence encoding it are shown in FIG.
  • the obtained antibody was an IgG antibody, and the heavy chain of the antibody was Ig ⁇ 1 and the light chain was Ig ⁇ .
  • IgA human IgG antibody was produced based on the information on the amino acid sequences of the heavy chain variable region and light chain variable region of the antibody obtained in "1-9. Antibody gene sequence determination" above. Based on the C-terminal portion of the amino acid sequence, the most suitable isotype and subtype were predicted from the antibody gene database constructed at Fukushima Medical University, and a constant region sequence was added. Furthermore, based on the information on the N-terminal portion of the amino acid sequence of the variable region, an optimal signal sequence predicted from the antibody gene database constructed at Fukushima Medical University was added. In addition, an optimal 5'-UTR sequence was added for stable protein expression.
  • the base sequence encoding the predicted amino acid sequence was cloned into a cell expression cassette vector. More specifically, for the base sequence of the H chain, we used pcDNA 3.1 (-) Mammalian Expression Vector (Invitrogen (ThermoFisher SCIENTIFIC, V79520), and for the base sequence of the L chain, we used pcDNA 3.1/Hygro(-) Mammalian Expression Vector (Invitrogen (ThermoFisher SCIENTIFIC, V87520).
  • the gene (SEQ ID NO: 28) encoding JCHAIN (Joining Chain Of Multimeric IgA And IgM) for co-expression with IgA type antibody gene was subcloned into vector pcDNA3.2/V5-DEST (Invitrogen (ThermoFisher SCIENTIFIC)). did.
  • the heavy chain amino acid sequence of the constructed IgA human IgG antibody and the base sequence encoding it are shown in FIG.
  • the amino acid sequence of the heavy chain variable region of the constructed IgA human IgG antibody and the nucleotide sequence encoding it are shown in FIG.
  • the light chain amino acid sequence of the constructed IgA human IgG and the nucleotide sequence encoding it are shown in FIG.
  • the amino acid sequence of the light chain variable region of the constructed IgA human IgG and the nucleotide sequence encoding it are shown in FIG.
  • Example 3 Antibody evaluation 1 using protein microarray
  • 3-1 Antibody production The antibody gene obtained in "1-9. Determination of antibody gene sequence" or the antibody gene of the IgA-ized human IgG antibody produced in Example 2 above and the gene encoding JCHAIN were introduced into mammalian cells Expi293F. using ExpiFectamine 293 Transfection Kit (Gibco (ThermoFisher SCIENTIFIC), A14524) and transiently expressed to produce antibodies. Specifically, shaking culture of cryopreserved human floating cells was started in a 125 ml flask. A minimum of two passages were performed to allow cells to recover from freeze-thaw injury.
  • the obtained antibody was named natural human IgG antibody (HIG001677) or IgA-ized human IgG antibody (HIG001677A1).
  • the antigen was identified using a protein microarray.
  • Sequence information (amino acid sequence information of the variable region) of each of the publicly available preceding antibodies was obtained.
  • the nucleic acid sequence was predicted from the amino acid sequence information.
  • the isotype and subtype were predicted from the antibody gene database constructed at Fukushima Medical University, and a constant region sequence considered to be optimal was added.
  • an optimal signal sequence predicted from the antibody gene database constructed at Fukushima Medical University was added.
  • an optimal 5'-UTR sequence was added for stable protein expression.
  • the relationship between the base sequence encoding the predicted amino acid sequence and the sequence number is shown in the table below.
  • the nucleotide sequences encoding the predicted amino acid sequences for the heavy chain and light chain of each preceding antibody were cloned into a cell expression cassette vector. More specifically, for the base sequence of the H chain, we used pcDNA 3.1 (-) Mammalian Expression Vector (Invitrogen (ThermoFisher SCIENTIFIC, V79520), and for the base sequence of the L chain, we used pcDNA 3.1/Hygro(-) Mammalian Expression Vector (Invitrogen (ThermoFisher SCIENTIFIC, V87520). Then, the cell expression cassette vector was introduced into mammalian cell Expi293F using ExpiFectamine 293 Transfection Kit (Gibco (ThermoFisher SCIENTIFIC), A14524), and transiently expressed.
  • Antibodies were produced.Specifically, shaking culture of cryopreserved human suspension cells was started in a 125 ml flask.The cells were passaged at least twice to recover from freeze-thaw damage. Cells were passaged into 125 ml flasks, cultured overnight, and then seeded onto 96 plates, and cell expression cassette vectors (plasmid DNA) were introduced into the cells by lipofection. 3rd day after introduction of plasmid DNA. A culture supernatant was obtained. Using the obtained culture supernatant, it was developed by polyacrylamide electrophoresis under denaturing conditions, and the expression of each preceding antibody was confirmed by Coomassie Brilliant Blue (CBB) staining and Western blot analysis.
  • CBB Coomassie Brilliant Blue
  • a primary antibody dilution solution was prepared as a negative control (hereinafter referred to as negative control).
  • negative control 1000 ⁇ l of a primary antibody dilution solution was prepared as a negative control (hereinafter referred to as negative control).
  • reference antibody 10 ml of goat reference antibody mixture (10 reactions) (Fukushima Protein Factory, PA5010) with primary antibody dilution solution (hereinafter referred to as reference antibody), and shake all the prepared antibodies at 37°C for 1 hour. I let it happen.
  • results The results of evaluating natural human IgG antibody (HIG001677) and IgA human IgG antibody (HIG001677A1) using a protein microarray are shown.
  • the data obtained using the protein microarray was converted into the value of the signal of the Alexa647-labeled anti-human IgA antibody relative to the signal of the Cy3-labeled anti-goat IgG antibody, and further converted into a logarithmic ratio with a base of 2.
  • the data was converted into a relative ratio to a negative control (ie, data from a protein microarray that was not reacted with the primary antibody) (FIG. 9).
  • natural human IgG antibody HIG001677
  • IgA-ized human IgG antibody HIG001677A1
  • SARS-CoV-2 AZD1061, AZD8895, LY_CoV16, LY_CoV555, REGN10933, REGN10987, S309
  • ABT#03984 Active Motif, 91349
  • ABT#03985 Active Motif, 91361
  • ABT#04347 Active Motif, 91377)
  • IgA human IgG antibody (HIG001677A1) bound more strongly to the S1 protein of SARS-CoV-2 compared to known and commercially available antibodies.
  • Tables 3A to 3E show the protein microarray-mounted samples used for the analysis in FIG. 9. Additionally, Tables 4A-H provide relative ratio data to the negative control.
  • the binding affinity between an antigen and an antibody can be expressed by a dissociation constant (KD), which is calculated as the ratio of the dissociation rate to the binding rate (Ka/Kd) when the binding between the antigen and antibody reaches equilibrium.
  • KD dissociation constant
  • the dissociation constant was measured using surface plasmon resonance (SPR) technology by Biacore (Cytiva). All analyzes were performed by single cycle kinetics using a Biacore T200 instrument.
  • Natural human antibody (HIG001677), IgA human IgG antibody (HIG001677A1), commercially available antibodies (ABT#03984, ABT#03985, ABT#04347), and five preceding antibodies (LY) known as antibody drugs against SARS-CoV-2.
  • -CoV16, LY-CoV555, REGN10933, REGN10987, and S309) were used as test antibodies.
  • various recombinant coronavirus proteins (RBD region of the spike protein) as analytes were flowed onto the sensor chip to evaluate binding affinity.
  • the method followed the instructions of the supplier (Cytiva), and after activation with EDC and NHC reagents, the antibody (ligand) was coupled to the flow cell in a range of 20 RU to 100 RU. Subsequently, unreacted groups were blocked with 1M ethanolamine.
  • IgG antibodies Natural human IgG antibodies, commercially available antibodies, and preceding antibodies
  • Natural human IgG antibodies were obtained using Protein G Sepharose 4 Fast Flow from the culture supernatant obtained in "3-1. Antibody production” above. (cytiva, 17061801) purified antibody was used.
  • the preceding antibodies (LY-CoV16, LY-CoV555, REGN10933, REGN10987, and S309), which are IgG antibodies, are the purified antibodies obtained in "3-2.
  • Antibody evaluation (1) Preparation of the preceding antibodies above. Using.
  • ABT#03984, ABT#03985, ABT#04347 and preceding antibodies were prepared using EDC and NHC reagents on a series S sensor chip CM5 (carboxymethyl dextran coated tip) according to the instructions of the Human Antibody Capture Kit (Cytiva). After activation, anti-IgG antibodies were coupled in a range of approximately 8000 RU to 10,000 RU. Subsequently, unreacted groups were blocked with 1M ethanolamine. The IgG antibody (ligand) was then supplemented with approximately 500 to 700 RU of anti-IgG antibody.
  • reaction rate measurement Prepare 3-fold serial dilutions (27-0.33 nM) of each antigen protein (analyte) in running buffer (0.01 M HEPES, 0.15 M NaCl, 0.003 M EDTA and 0.05% v/v Surfactant P20). Injected into the flow cell for 120 seconds at a flow rate of 10 ⁇ L/min. After addition of the analyte, running buffer was injected for 900 seconds to dissociate the analyte. After subtracting the reference flow cell value from the measured value, the association rate (Ka) and dissociation rate (Kd) were calculated using analysis software for BIAcore T200 (version 2.0).
  • the dissociation constant (K D ) was calculated using a one-to-one binding model.
  • the detection range for Biacore T200 is an association rate (Ka) of 10 3 -10 7 (1/Ms) and a dissociation rate (Kd) of 10 -5 -0.5 (1/s).
  • Example 5 Antibody binding inhibition evaluation by competitive ELISA method
  • the binding inhibition effect of a natural human IgG antibody (HIG001677) and an IgA human IgG antibody (HIG001677A1) was evaluated using a competitive ELISA method.
  • the SARS-CoV2 spike protein (RBD region of the S1 domain) competed with a natural human IgG antibody or an IgA-modified human IgG antibody against the human ACE2 protein, and the binding inhibition rate was evaluated.
  • IgA human IgG antibody HIG001677A1
  • CaptureSelect IgA Affinity Matrix Thermo Scientific, 19428801L (1L)
  • the natural human IgG antibody HIG0016707
  • the preceding antibody were purified from the culture supernatant using Protein G Sepharose 4 Fast Flow in the same manner as in Example 4 above.
  • the ELISA method was performed using the SARS-CoV-2 Anti-RBD Antibody Profiling Kit (MBL, Code No. 5370) based on the attached protocol.
  • MBL SARS-CoV-2 Anti-RBD Antibody Profiling Kit
  • each antibody was prepared at 2 ⁇ g/ml, 1 ⁇ g/ml, 0.5 ⁇ g/ml, 0.25 ⁇ g/ml, 0.125 ⁇ g/ml, 0.0625 ⁇ g/ml, 0.03125 ⁇ g/ml, respectively, in the Reaction buffer provided with the kit. 100 ⁇ l each was prepared at 0.015625 ⁇ g/ml. Thereafter, 100 ⁇ l of the positive control was prepared so as to be diluted 4 times with Reaction buffer, and 100 ⁇ l of Reaction buffer was prepared as a blank.
  • RBD protein As the RBD protein, the spike proteins (RBD region or Trimer region of S1 domain) derived from the natural type (Wuhan type) and mutant SARS-CoV2 shown in the table below were used. Each RBD protein was prepared using Reaction buffer to a final concentration of 0.3 pmol.
  • HIG001677 and HIG001677A1 exhibited high inhibition rates against both the native (Wuhan type) and mutant SARS-CoV2-derived spike proteins (RBD region of S1 domain). .
  • HIG001677 and HIG001677A1 also showed an inhibition rate of 45% or more against Omicron strains (BA.2 and BA.3 strains) (2 ⁇ g/ml group).
  • Omicron strain B.1.1.529 strain
  • HIG001677A1 was the only antibody that showed an inhibition rate of 30% or more among the antibodies tested (2 ⁇ g/ml group).
  • IC50 (ng/ml) of each antibody was calculated from the obtained inhibition rate results.
  • IC50 was calculated using the following formula.
  • FIG. 10A corresponds to the results in Tables 8A-8D
  • FIG. 10B corresponds to the results in Tables 8H-8J.
  • IC50 10 ⁇ (LOG(A/B)*(50-C)/(DC)+LOG(B))
  • B Low concentration between 50% binding inhibition rate
  • C Inhibition rate at B
  • D Inhibition rate at A
  • the antibody of the present invention HIG001677 and HIG001677A1 showed inhibitory activity against all strains used in the test, and IC50 could be calculated against strains other than Omicron strain.
  • HIG001677A1 showed the highest inhibition rate (31.48%) against Omicron strain at 2 ⁇ g/ml.
  • the known antibodies used as controls either had no inhibitory activity against any of the strains, or had higher IC50 values than HIG001677 and HIG001677A1 depending on the mutant strain.
  • Example 6 Neutralization activity evaluation 1 using pseudovirus
  • Coronavirus entry into host cells is mediated by the trimeric transmembrane spike (S) glycoprotein.
  • S-glycoprotein is surface-exposed and binds to the SARS-CoV-2 receptor human angiotensin-converting enzyme 2 (ACE2) to mediate entry into host cells.
  • ACE2 forced expression cells were used to evaluate the inhibition of pseudovirus (lentivirus having S glycoprotein of coronavirus in the envelope protein) infection by natural human IgG antibody or IgA-modified human IgG antibody.
  • the Human ACE2 expression plasmid vector is a pcDNA3.2 V5-DEST-Hyg vector that contains the ORF (SEQ ID NO: 40) of the Human ACE2 (angiotensin I converting enzyme 2) protein (NP_068576.1; SEQ ID NO: 39) using a recombination reaction.
  • This is a plasmid vector constructed by inserting a nucleotide sequence encoding ) (SEQ ID NO: 41).
  • a mixed solution of 150 ⁇ l of ExpiFectamine 293 Transfection enhancer 1 and 1.5 ml of ExpiFectamine 293 Transfection enhancer 2 included in the ExpiFectamine 293 Transfection kit was added to the cells. Since the expression plasmid vectors used have a Hygromycin resistance gene, they were cultured in a medium containing 50 ⁇ g/ml hygromycin B (Thermo Fisher Scientific, cat#10687010), and cells into which each protein expression plasmid vector had been introduced were selected. . The obtained cells were designated as SSC#000364 (human ACE2 stably expressing cells).
  • the human ACE2 stably expressing cell group (SSC#000364) prepared above was immunostained with anti-ACE2 antibody (R&D systems, cat#MAB9332) and analyzed using Cell Sorter (SONY, cat#SH800S). After setting a gate in the range that included 6.8% of the cells with high ACE2 expression among the human ACE2 stably expressing cells (SSC#000364) group, the cell group with high ACE2 expression was obtained by cell sort and designated as SSC#000442.
  • SSC#000442 Furthermore, a similar analysis was performed on SSC#000442, and after setting a gate in a range that included 42.42% of cells with high ACE2 expression in SSC#000442, cells were cloned by Single cell sort. The expression of ACE2 was confirmed for the obtained 11 clones (SSC#000465-475) by flow cytometry analysis and Western blot analysis. Among them, SSC#000465 had a high expression level of ACE2 and had a sharp waveform when analyzed by flow cytometry, so it was decided to use it for the following test.
  • the final treatment concentration of natural human IgG antibody or IgA-ized human IgG antibody was 1 ⁇ g/mL, 0.5 ⁇ g/mL, 0.25 ⁇ g/mL, 0.1 ⁇ g/mL, or 0.01 ⁇ g/mL.
  • the final treatment concentration of commercially available antibodies was 1 ⁇ g/mL, 0.1 ⁇ g/mL, or 0.01 ⁇ g/mL.
  • Example 6-2 Neutralization activity evaluation 2 using pseudovirus
  • pseudoviruses using natural human IgG antibodies or IgA-ized human IgG antibodies were used in the same manner and under the same conditions as in Example 6-1, except that different pseudoviruses having the RBD region of the wild strain or each mutant strain were used. Inhibition of virus infection (a lentivirus with coronavirus S glycoprotein in its envelope protein) was evaluated. Information on the pseudovirus solution (manufactured by Vector Builder Japan Co., Ltd.) used in this example is shown in Table 10B below.
  • Table 10C shows the IC 50 of the natural human IgG antibody (HIG001697) or the IgA-conjugated human IgG antibody (HIG001697A1) against the pseudovirus.
  • Tables 10D and 10E show the infection inhibition rate of each antibody against the pseudovirus at each treatment concentration.
  • natural human IgG antibodies showed neutralizing activity against Wuhan type, delta type, and omicron type
  • IgA human IgG antibodies showed neutralizing activity against Wuhan type, delta type, alpha type, It showed neutralizing activity against Omicron type.
  • Example 7 Neutralization activity evaluation 2 using pseudovirus
  • the inhibition of infection by a pseudovirus a lentivirus having coronavirus S glycoprotein in its envelope protein
  • an IgA human IgG antibody HIG001677A1
  • HEK293 cells overexpressing ACE2 and TMPRSS2 were infected with a pseudolentivirus expressing GFP and SARS-CoV-2 spike (S) protein (Vector Builder LVL-S2DG (VB200088-2229upx)). It was carried out using The intermediate activity evaluation using this test was outsourced to Charles River Discovery Research Services UK Ltd. All tests were performed in triplicate for each condition.
  • Anti-SARS-CoV-2 S1 antibody (Amsbio; Cat # AMS.SAD-S35, Lot # S35-206RF1-TL) was used as a positive control, and IgA isotype control antibody (Invitrogen; Cat # 31148, Lot # WF3292542).
  • Example 8 Neutralization activity evaluation 1 using SARS-CoV-2
  • IgA human IgG antibody HOG001677A1
  • the intermediate activity evaluation using this test was outsourced to Charles River Discovery Research Services UK Ltd. All tests were performed in triplicate for each condition.
  • IgA isotype control antibody Invitrogen; Cat # 31148, Lot # WF3292542
  • WHO standard pooled convalescent plasma from SARS-CoV-2 patients were used as a control.
  • Table 12A The results of the neutralization activity test using each antibody are shown as infection inhibition rates in Table 12A.
  • Table 12B the concentration of WHO standard pooled convalescent plasma indicates the dilution factor (for example, 50.000 means 1/50 dilution).
  • HIG001677A1 inhibited SARS-CoV-2 infection at all concentrations tested, with an estimated EC50 value of ⁇ 0.031 ⁇ g/mL.
  • Table 12B also shows the cell survival rate of the group treated with HIG001677A1 or IgA isotype control antibody without being infected with SARS-CoV-2. HIG001677A1 did not affect cell viability even when added to cells at 32 ⁇ g/ml.
  • Example 9 Neutralization activity evaluation 2 using SARS-CoV-2
  • the same method as in Example 8 was used to evaluate the inhibition of SARS-CoV-2 infection by IgA human IgG antibody (HIG001677A1).
  • the Wuhan strain wild type
  • Delta strain and Omicron strain were used as SARS-CoV-2.
  • preceding antibodies REGN10987, AZD1061, LY_CoV16, AZD8895, REGN10933, S309
  • IgA isotype control antibody Invitrogen; Cat # 31148, Lot # WF3292542
  • Nanobody antibody Absolute Antibody; Cat # Ab02013-1.159.
  • Example 10 Antibody-RBD binding evaluation by ELISA method
  • a natural human IgG antibody HAG001677
  • Omicron strain BA.2 strain
  • Omicron strain BA.3 strain
  • the binding ability of IgA human IgG antibody HOG001677A1 was evaluated.
  • eight prior antibodies AZD1061, AZD8895, LY-CoV16, LY-CoV555, REGN10933, REGN10987, S309, ADG2 known as antibody drugs against SARS-CoV-2 were used.
  • the preceding antibodies prepared and purified in Examples 3 and 5 were used.
  • RBD proteins Various RBD proteins (RBD derived from Omicron strain (BA.1 strain): Acro Biosystems (SPD-C522e, 5716-21C8F1-Z1) SARS-CoV-2 Spike RBD, His Tag (B.1.1. 529/Omicron) (MALS verified) (Stock con. 0.6 mg/ml), RBD derived from Omicron strain (BA.2 strain): Acro Biosystems (SPD-C522g, 5911-222DF1-11F) SARS-CoV-2 Spike RBD, His Tag (BA.2/Omicron) (Stock con.
  • RBD derived from Omicron strain BA.3 strain: Acro Biosystems (SPD-C522i, 6063-2238F1-11W) SARS-CoV-2 Spike RBD, His Tag (BA.3/Omicron) (Stock con. 0.2 mg/ml), RBD derived from Omicron strain (BA.4/BA.5 strains): AcroBio (SPD-C522r, 6363-225HF1-133) SARS- CoV-2 Spike RBD, His Tag (BA.4&BA.5/Omicron) (MALS verified) (Stock con.
  • RBD solution 0.1 mol/L carbonate-bicarbonate buffer (pH 9.6)
  • 50 ⁇ l of the prepared RBD solution was added to a Corning (registered trademark) 96-well Half Area Clear Flat Bottom Polystyrene High Bind Microplate (Corning 3690) and left at 4° C. for 17 hours. After 17 hours, the RBD solution was removed and 180 ⁇ l of solution B (10X) (Fukushima Protein Factory, PA1110) diluted 10 times with ultrapure water with 0.02% Tween-20 added (hereinafter referred to as washing solution) was added for washing.
  • solution B 10X
  • washing solution 10X
  • Washing was performed by exchanging solutions, a total of two times. After the washing step, the washing solution was removed, and 180 ⁇ l of Blocking One (Nacalai Tesque, 03953-95) diluted 5 times with the washing solution was added, and the mixture was allowed to stand at room temperature (20-25°C) for 1 hour. After standing still for 1 hour, Blocking One was removed and 180 ⁇ l of washing solution was added for washing. Washing was performed by exchanging solutions, a total of two times. The plate subjected to the above treatment was used as an RBD coated microplate, and 180 ⁇ l of a washing solution was added thereto and stored at 4°C until use.
  • Blocking One Nacalai Tesque, 03953-95
  • Blocking ONE (hereinafter referred to as "antigen/antibody dilution solution"), which is a 20-fold dilution of purified natural human antibodies and preceding antibodies with washing solution, was used at 2 ⁇ g/ml, 1 ⁇ g/ml, 0.5 ⁇ g/ml, and 0.25 ⁇ g/ml, respectively. , 0.125 ⁇ g/ml, 0.0625 ⁇ g/ml, 0.03125 ⁇ g/ml, and 0.015625 ⁇ g/ml in 50 ⁇ l portions. 50 ⁇ l of antigen/antibody dilution solution was prepared as a blank solution.
  • reaction between antibody and RBD 50 ⁇ l of each prepared antibody/blank solution was transferred to an RBD coated microplate that had been warmed to room temperature, and reacted at room temperature (20-25°C) for 30 minutes. After 30 minutes of reaction, the reaction solution was removed from the RBD coated microplate, and 180 ⁇ l of washing solution was added to wash it. Washing was performed by changing the solution a total of 4 times.
  • Table 14A shows the binding ability of each antibody to RBD derived from Omicron strain (BA.1 strain)
  • Table 14B shows the binding ability of each antibody to RBD derived from Omicron strain (BA.2 strain)
  • Table 14C shows the binding ability of each antibody to RBD derived from Omicron strain (BA.2 strain).
  • Table 14D shows the binding ability of each antibody to the RBD derived from the Omicron strain (BA.4&5 strain).

Abstract

La présente invention pour but de procurer un nouvel anticorps pouvant prévenir et/ou traiter l'infection par le COVID-19. Un aspect de la présente invention concerne : un anticorps présentant un CDR1 à chaîne lourde comprenant la séquence d'acides aminés de SEQ. ID NO : 1, un CDR2 à chaîne lourde comprenant la séquence d'acides aminés de SEQ ID NO : 2, un CDR3 à chaîne lourde comprenant la séquence d'acides aminés de SEQ ID NO : 3, un CDR1 de la chaîne légère comprenant la séquence d'acides aminés de SEQ ID NO : 4, un CDR2 de la chaîne légère comprenant la séquence d'acides aminés de SEQ ID NO : 5, et un CDR3 de la chaîne légère comprenant la séquence d'acides aminés de SEQ ID NO : 6, et se liant à une sous-unité S1 du SARS-CoV-2 ; ou un fragment de cet anticorps.
PCT/JP2023/013145 2022-03-31 2023-03-30 Anticorps se liant au nouveau coronavirus (sars-cov-2) WO2023190851A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2022-059383 2022-03-31
JP2022059383 2022-03-31

Publications (1)

Publication Number Publication Date
WO2023190851A1 true WO2023190851A1 (fr) 2023-10-05

Family

ID=88202848

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2023/013145 WO2023190851A1 (fr) 2022-03-31 2023-03-30 Anticorps se liant au nouveau coronavirus (sars-cov-2)

Country Status (1)

Country Link
WO (1) WO2023190851A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111592594A (zh) * 2020-03-13 2020-08-28 北京大学 一种抗新型冠状病毒的单克隆抗体及其应用
KR102205028B1 (ko) * 2020-03-22 2021-01-20 (주)셀트리온 사스-코로나바이러스-2에 중화 활성을 갖는 결합 분자
WO2021045836A1 (fr) * 2020-04-02 2021-03-11 Regeneron Pharmaceuticals, Inc. Anticorps anti-glycoprotéine spike du sars-cov 2 et fragments de liaison à l'antigène de ceux-ci
KR102229225B1 (ko) * 2020-09-04 2021-03-19 (주)셀트리온 사스-코로나바이러스-2 표면의 스파이크 단백질에 결합하는 사스-코로나바이러스 감염증의 진단용 결합 분자

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111592594A (zh) * 2020-03-13 2020-08-28 北京大学 一种抗新型冠状病毒的单克隆抗体及其应用
KR102205028B1 (ko) * 2020-03-22 2021-01-20 (주)셀트리온 사스-코로나바이러스-2에 중화 활성을 갖는 결합 분자
WO2021045836A1 (fr) * 2020-04-02 2021-03-11 Regeneron Pharmaceuticals, Inc. Anticorps anti-glycoprotéine spike du sars-cov 2 et fragments de liaison à l'antigène de ceux-ci
KR102229225B1 (ko) * 2020-09-04 2021-03-19 (주)셀트리온 사스-코로나바이러스-2 표면의 스파이크 단백질에 결합하는 사스-코로나바이러스 감염증의 진단용 결합 분자

Similar Documents

Publication Publication Date Title
TWI628190B (zh) 可結合及中和ｂ型流感病毒之人類結合分子及其用途
CN105418757B (zh) 能中和流感病毒h3n2的人结合分子及其应用
CN108350070A (zh) 胸腺基质淋巴细胞生成素(tslp)-结合分子及该分子的使用方法
CN101072795A (zh) 针对流感病毒m2蛋白的人单克隆抗体及其制备和使用方法
KR102323960B1 (ko) 항-pd-l1 항체 및 이의 용도
KR102122618B1 (ko) 인플루엔자 중화를 위한 작용제
PT2423229E (pt) Membro de ligação para o recetor de gm-csf
CN107660150A (zh) Il‑18结合蛋白(il‑18bp)和抗体在炎性疾病中
KR20220158053A (ko) 중증 급성 호흡기 증후군 코로나바이러스 2(SARS-CoV-2)에 대한 인간 단클론 항체
CN115066435A (zh) 针对lilrb2的单域抗体
CN109535263A (zh) SIRPα突变体及其融合蛋白
CN108350053A (zh) 淀粉样蛋白β表位及其抗体
CN108368160A (zh) 淀粉样蛋白β中的C-末端表位及其构象选择性抗体
CN106795223A (zh) 针对Fcγ受体IIB及Fcε受体的新型抗体
WO2023190851A1 (fr) Anticorps se liant au nouveau coronavirus (sars-cov-2)
WO2023190852A1 (fr) Anticorps pouvant se lier au nouveau coronavirus (sars-cov-2)
KR20140012131A (ko) 인플루엔자의 치료 및 진단을 위한 조성물 및 방법
WO2023002944A1 (fr) Anticorps se liant au nouveau coronavirus (ｓａｒｓ－ｃｏｖ－２) et au coronavirus du syndrome respiratoire aigu sévère (ｓａｒｓ－ｃｏｖ)
JP2023152613A (ja) 新型コロナウイルス（ＳＡＲＳ－ＣｏＶ－２）に結合する抗体
JP2023061248A (ja) 新型コロナウイルス（ＳＡＲＳ－ＣｏＶ－２）に結合する抗体
JP2023061249A (ja) 新型コロナウイルス（ＳＡＲＳ－ＣｏＶ－２）に結合する抗体
CN105814077B (zh) 能够中和狂犬病毒的结合分子
EP4130035A1 (fr) Anticorps et protéine de fusion pour traiter des coronavirus et leur utilisation
US10888615B2 (en) Neutralizing human monoclonal antibody 8D6 against HCV infection
WO2023083377A1 (fr) Anticorps monoclonal humanisé pour restaurer des lymphocytes t et b humains dysfonctionnels pour lutter contre le cancer et une infection virale

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23780859

Country of ref document: EP

Kind code of ref document: A1