WO2023059112A1 - 최적의 재조합 발현 구축물의 개발 - Google Patents

최적의 재조합 발현 구축물의 개발 Download PDF

Info

Publication number
WO2023059112A1
WO2023059112A1 PCT/KR2022/015063 KR2022015063W WO2023059112A1 WO 2023059112 A1 WO2023059112 A1 WO 2023059112A1 KR 2022015063 W KR2022015063 W KR 2022015063W WO 2023059112 A1 WO2023059112 A1 WO 2023059112A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
recombinant expression
expression construct
sequence
seq
Prior art date
Application number
PCT/KR2022/015063
Other languages
English (en)
French (fr)
Inventor
호성현
박수진
Original Assignee
주식회사 지앤피바이오사이언스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US17/495,233 external-priority patent/US20230212603A1/en
Application filed by 주식회사 지앤피바이오사이언스 filed Critical 주식회사 지앤피바이오사이언스
Publication of WO2023059112A1 publication Critical patent/WO2023059112A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Definitions

  • the present invention relates to the development of expression constructs having high expression efficiency in gene therapy and/or DNA vaccines, and more particularly, to the development of expression constructs prepared by inserting the full-length HCMV IE control and transcription sites of the optimal HCMV strain based on the pVAX1 vector. It relates to a recombinant expression construct for the expression of a foreign gene.
  • Double plasmid DNA-based gene therapy is basically low in expression efficiency, so research to increase the expression efficiency of the therapeutic gene is being actively conducted in various fields.
  • the HCMV promoter is one of the strongest promoters, and there are various HCMV strains, of which Towne and AD169 are representative strains.
  • the nucleotide sequence of the major promoter of the HCMV immediate-early (IE) gene is similar with little sequence difference depending on the strain, but the sequence of the full-length HCMV IE regulatory and transcriptional region including intron A of the IE gene differs among HCMV strains. See. Previously, Chapman et al. reported that expression efficiency increased in gp120 and gp160 genes when intron A of HCMV Towne strain was included in the promoter (full-length HCMV regulatory and transcriptional region). Not known.
  • the pVAX1 vector used in the approval stage, phase 3 clinical trials, and numerous clinical trials uses the major promoter of the HCMV IE gene of the AD169 strain. Based on this vector, research is underway to increase the expression efficiency.
  • the present inventors have made intensive efforts to develop vectors with high expression efficiency in eukaryotic cells suitable for use in gene therapy and/or DNA vaccines.
  • the full-length HCMV IE regulatory and transcriptional regions of the HCMV 3157 strain compared to the case of using the full-length HCMV IE regulatory and transcriptional regions derived from other strains, it was confirmed that the gene expression efficiency was significantly increased, thereby completing the present invention.
  • an object of the present invention is to provide a recombinant expression construct.
  • Another object of the present invention is to provide a recombinant expression construct comprising a sequence having 90% or more homology with the full-length HCMV IE control and transcription region sequences of the HCMV 3157 strain.
  • Another object of the present invention is to provide a recombinant expression construct for expression of a transgene.
  • Another object of the present invention is to provide a host cell transduced with the recombinant expression construct or the recombinant expression construct for exogen expression.
  • Another object of the present invention is to provide a method for preparing the recombinant expression construct or the recombinant expression construct for expression of a foreign gene.
  • Another object of the present invention is to provide a therapeutic use of the recombinant expression construct for expressing the exogenous gene (for use in therapy).
  • Another object of the present invention is to provide a method for expressing a foreign gene, comprising administering a therapeutically effective amount of the recombinant expression construct for expressing the foreign gene to a subject in need thereof.
  • Another object of the present invention is to provide a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically effective amount of the recombinant expression construct for expressing the foreign gene and a pharmaceutically acceptable carrier.
  • the present invention provides a recombinant expression construct.
  • vector refers to a construct into which a nucleic acid or gene can be inserted, and is preferably a delivery system into which a nucleic acid sequence can be inserted for introduction into a cell capable of replicating the nucleic acid sequence.
  • a nucleic acid sequence may be exogenous or heterologous.
  • a nucleic acid sequence may be a transgene.
  • Constructs include, but are not limited to, plasmids, cosmids, and viruses (eg, AAV).
  • expression vector refers to a vector or construct comprising a nucleotide sequence encoding at least a portion of a gene product to be transcribed. In some cases, the RNA molecule is then translated into a protein, polypeptide, or peptide.
  • Expression constructs may contain various regulatory regions. Along with regulatory regions that control transcription and translation, vectors and expression vectors may also contain nucleotide sequences that serve other functions as well. The regulatory elements may include enhancers, promoters, exons, introns, splicing donor and acceptor sequences, and the like.
  • the regulatory elements include sequences for transcription termination (eg, poly A, etc.), sequences for stably expressing a transgene (eg, WPRE sequence, etc.), transgene-specific immunity Sequences to reduce occurrence (eg, miRNA target sequences, etc.) may be included.
  • operably linked means that the DNA sequences to be linked are positioned contiguous to perform a desired function, e.g., a specific promoter is linked to a coding sequence (e.g., a foreign When helping to initiate transcription of a gene), such a promoter can be operably linked with a coding region. As long as this functional relationship is maintained, the promoter and coding region need not necessarily be contiguous.
  • full-length HCMV IE regulatory and transcriptional region or “full HCMV IE regulatory and transcribed regions” refers to a structure containing an enhancer, promoter, intron A, etc. as regulatory and transcriptional regions.
  • "Main HCMV IE promoter” or “major HCMV IE promoter” refers to a structure in which intron A, which is not an essential site, is missing from the above “full-length HCMV IE regulatory and transcriptional region”.
  • the full-length HCMV IE control and transcription region sequence of the HCMV 3157 strain includes the sequence of SEQ ID NO: 24.
  • the recombinant expression construct includes a multi-cloning site (MCS) for inserting a foreign gene (transgene).
  • MCS multi-cloning site
  • the exogenous gene is BamHI and XbaI sites for human hepatocyte growth factor (HGF), NheI and XbaI sites for human transforming growth factor- ⁇ (TGF- ⁇ ), and human insulin.
  • HGF human hepatocyte growth factor
  • TGF- ⁇ human transforming growth factor- ⁇
  • human insulin NheI and NotI sites for Insulin-like Growth Factor-1 (IGF-1), NheI and XbaI sites for human interferon- ⁇ (IFN- ⁇ ), SARS-CoV-2 spike or
  • IGF-1 Insulin-like Growth Factor-1
  • IFN- ⁇ human interferon- ⁇
  • RBD receptor binding domain
  • KpnI and ApaI sites may be used, but are not limited thereto.
  • exogen refers to one or more polynucleotides or polynucleotide regions encoded within a recombinant expression construct or expression products of such polynucleotides or polynucleotide regions, polypeptides or poly-polypeptides encoding multi-polypeptides.
  • the exogenous gene may be a polynucleotide encoding a therapeutic peptide for the purpose of sustained expression or a DNA or RNA vaccine for the purpose of preventing or treating a disease.
  • the recombinant expression construct further comprises a polyadenylation sequence (pA).
  • pA polyadenylation sequence
  • the polyadenylation sequence preferably includes a human growth hormone (hGH) pA sequence, a bovine growth hormone (bGH) pA sequence, a simian vacuolating virus 40 (SV40) early pA sequence, a SV40 late pA sequence, etc., but is limited thereto It is not.
  • hGH human growth hormone
  • bGH bovine growth hormone
  • SV40 simian vacuolating virus 40
  • the polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23 to 33.
  • the recombinant expression construct additionally contains an antibiotic resistance gene.
  • antibiotic resistance gene or "antibiotic resistance gene” is a gene inserted into a plasmid for the purpose of imparting drug resistance so that microorganisms can survive exposure to antibiotics. In most cases, cloning is used to select individuals with the desired plasmid.
  • the antibiotic resistance gene is preferably ampicillin, kanamycin, neomycin, chloramphenicol, gentamycin, streptomycin, tetracycline, erythromycin (Erythromycin), Vancomycin, Penicillin, Spectinomycin, Chloramphenicol, Sulfaciazine, Trimethoprim resistance genes, etc., but are not limited thereto no.
  • the antibiotic resistance gene comprises a gene sequence selected from the group consisting of neomycin resistance gene (SEQ ID NO: 28), kanamycin resistance gene (SEQ ID NO: 29), and combinations thereof.
  • the recombinant expression construct has the cleavage map of FIG. 4 .
  • the present invention is a recombinant expression construct for expressing a transgene comprising the following components, wherein the transgene can be transcribed and translated in a host cell
  • a recombinant expression construct for the expression of a foreign gene wherein:
  • regulatory and transcribed regions operably linked to the exogen, wherein the regulatory and transcribed regions comprise the sequence of SEQ ID NO: 24.
  • sequence of SEQ ID NO: 24 refers to a sequence having homology to a sequence derived from the full-length HCMV IE regulatory and transcribed regions sequence of the HCMV 3157 strain.
  • the recombinant expression construct for expressing the exogenous gene is the full-length HCMV IE regulatory and transcriptional region sequence of HCMV Towne strain of SEQ ID NO: 20 and the full-length HCMV IE regulatory and transcriptional region of HCMV AD169 strain of SEQ ID NO: 22 Sequence and SEQ ID NO: 26 HCMV CINCY and Towne strain's full-length HCMV IE regulatory and transcriptional sequences (CINCY + Towne fusion) Compared to the case where the regulatory and transcriptional regions are inserted, the expression of the transgene this is increased
  • the recombinant expression construct of the present invention when loaded with a transgene, is the full-length HCMV IE regulatory and transcriptional sequence of HCMV Towne strain, the full-length HCMV IE regulatory and transcriptional sequence of HCMV AD169 strain, or the full-length HCMV IE of HCMV CINCY and Towne strains.
  • the expression of the exogenous gene can be increased by 10% or more, preferably statistically significant.
  • the recombinant expression construct is at least 80% or more, at least 85% or more, at least 90% or more than the full-length HCMV IE regulatory and transcribed regions sequence of HCMV 3157 strain. % or higher homology.
  • the expression level of the foreign gene is maintained at an equal or similar level.
  • “maintaining at a similar level” means that the expression level is preferably 30% or less, more preferably 20% or less, and most preferably 10% or less, when the expression level of the foreign gene to be compared is 100%. It is used in the sense of including a decrease or increase in expression level.
  • the recombinant expression construct of the present invention When the recombinant expression construct of the present invention is loaded with a transgene, it can greatly increase (eg, statistically significant increase) the expression efficiency of the transgene, and the full-length HCMV IE regulatory and transcriptional region of the HCMV 3157 strain Sequences having expression efficiency equal to or higher than 90% when the sequence is inserted may be included in the homologous sequences.
  • the exogenous gene is a nucleotide sequence encoding a peptide for the treatment of a specific disease (eg, HGF, TGF- ⁇ , IGF -1, IFN- ⁇ gene or a variant gene thereof, etc.).
  • a specific disease eg, HGF, TGF- ⁇ , IGF -1, IFN- ⁇ gene or a variant gene thereof, etc.
  • the foreign gene is a DNA or RNA vaccine sequence (eg, for the purpose of continuous expression in the body of a subject or patient) for the prevention of a specific disease (eg, coronavirus) , SARS-CoV-2 spike gene or SARS-CoV-2 spike RBD gene, etc.).
  • a specific disease eg, coronavirus
  • HGF variant refers to an HGF polypeptide having an amino acid sequence that is at least 80% identical to a naturally occurring HGF amino acid sequence in an animal, including all allelic variants.
  • HGF variant has a meaning encompassing both the normal form or wild type of HGF, and various variants (eg, splicing variants and defective variants) and isoforms of HGF.
  • HGF variant may be a hybrid HGF gene capable of expressing both isoforms (HGF and dHGF) of HGF (see Korean Patent Registration No. 10-0562824).
  • the "hybrid HGF gene” has high gene expression efficiency, in which intron 4 of the human HGF gene or a fragment thereof is inserted between exon 4 and exon 5 of the HGF cDNA, and is a combination of HGF and deleted variant of HGF (dHGF). It may be a hybrid HGF gene (eg, SEQ ID NOs: 16 to 18) that simultaneously expresses branched isoforms.
  • nucleotide sequences encoding two or more isoforms of HGF.
  • Two or more types of HGF isoform-encoding nucleotide sequences may be provided as one polynucleotide or as separate polynucleotides.
  • HGF variant gene may be HGF-X7 gene (SEQ ID NO: 17) (refer to Korean Patent Registration No. 10-0562824).
  • HGF variant gene may be a deleted variant of HGF (dHGF) gene (SEQ ID NO: 19) (refer to Korean Patent Registration No. 10-0562824).
  • dHGF refers to an animal, preferably a mutant mutant of HGF protein produced by alternative splicing of the HGF gene in a mammal, more preferably alpha from a full-length HGF sequence (728 amino acids). It refers to human HGF consisting of 723 amino acids in which 5 amino acids (F, L, P, S and S) are deleted from the first Kringle domain of the chain.
  • SARS-CoV-2 spike gene may be the gene sequence of SEQ ID NO: 4.
  • SARS-CoV-2 spike RBD gene may be the gene sequence of SEQ ID NO: 9.
  • the present invention provides a host cell transduced, transfected or transformed with the recombinant expression construct or the recombinant expression construct for expressing a foreign gene.
  • the term "host cell” includes eukaryotes and prokaryotes, and any transducer capable of replicating the expression construct (eg, vector) or expressing the gene encoded by the expression construct. means living things.
  • the term “transduction” or “transduction” is used as a meaning including transfection (transfection) or transformation (transformation).
  • a host cell may be transduced, transfected or transformed by the expression construct, which means a process in which an exogenous nucleic acid molecule is delivered or introduced into the host cell.
  • the host cell of the present invention is not limited, but eukaryotic cells, preferably insect cells or mammalian cells, more preferably Sf9 in the case of insect cells, HEK293 cells in the case of mammalian cells, HeLa cells, C2C12 cells, ARPE-19 cells, RPE-1 cells, HepG2 cells, Hep3B cells, Huh-7 cells, C8D1a cells, Neuro2A cells, CHO cells, MES13 cells, BHK-21 cells, COS7 cells, COP5 cells, A549 cells, MCF-7 cells, HC70 cells, HCC1428 cells, BT-549 cells, PC3 cells, LNCaP cells, Capan-1 cells, Panc-1 cells, MIA PaCa-2 cells, SW480 cells, HCT166 cells, LoVo cells, A172 cells, MKN-45 cells, MKN -74 cells, Kato-III cells, NCI-N87 cells, HT-144 cells, SK-MEL-2 cells, SH-SY5Y cells
  • the recombinant expression construct for expressing a foreign gene of the present invention may be used for direct delivery of a gene to a mammalian host cell in vivo for therapeutic or preventive purposes.
  • the present invention provides a method for preparing the recombinant expression construct.
  • the present invention provides a method for preparing a recombinant expression construct for expressing the exogenous gene.
  • the method for producing a recombinant expression construct of the present invention includes inserting the sequence of SEQ ID NO: 24 into a pVAX1 vector.
  • a pVAX1 vector For example, it can be prepared by removing the promoter from the pVAX1 vector and inserting the full-length HCMV IE regulatory and transcriptional regions of the HCMV 3157 strain of SEQ ID NO: 24.
  • the manufacturing method further comprises the step of inserting a foreign gene (transgene) into the recombinant expression construct.
  • a foreign gene transgene
  • the present invention provides a therapeutic use (for use in therapy) of the recombinant expression construct for the expression of the foreign gene.
  • the present invention provides a method for expressing a foreign gene, comprising administering a therapeutically effective amount of the recombinant expression construct for expressing the foreign gene to a subject in need thereof.
  • the expression is in vivo expression.
  • the present invention provides a pharmaceutical composition comprising the pharmaceutically effective amount of the recombinant expression construct for expressing a foreign gene and a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, including, but not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil; it is not going to be
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • the pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenteral administration, such as intravenous injection, transdermal administration, subcutaneous injection, intramuscular injection, intravitreal injection, subretinal injection.
  • parenteral administration such as intravenous injection, transdermal administration, subcutaneous injection, intramuscular injection, intravitreal injection, subretinal injection.
  • the suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, morbid condition, food, administration time, administration route, excretion rate and reaction sensitivity, A ordinarily skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis.
  • the daily dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg/kg.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. or it may be prepared by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally contain a dispersing agent or stabilizer.
  • the present invention provides a method for treating a disease, comprising administering an effective amount of the recombinant expression construct or the recombinant virus to a subject.
  • the term "subject” or “subject” refers to a subject in need of administering the composition of the present invention or the recombinant expression construct, and is not limited to mammals, birds, reptiles, amphibians, fish, etc. administration subjects.
  • the present invention relates to a method for preventing a disease, such as a gene therapy or a method for treating a disease, or a method for preventing a disease, capable of achieving sustained expression of an exogenous gene.
  • the disease to be prevented, improved, or treated by the present invention is not limited, but preferably includes all diseases that require reducing the frequency of drug administration or delaying infection or progression of the disease.
  • the composition may be a pharmaceutical composition for preventing or treating ischemic disease, neurological disease or liver disease.
  • HGF human hepatocyte growth factor
  • the neurological disease includes pain disease and diabetic peripheral neuropathy (DPN).
  • DPN diabetic peripheral neuropathy
  • the composition may be a pharmaceutical composition for preventing or treating symptoms or diseases mediated by IGF-1 receptor binding.
  • IGF-1 insulin-like growth factor-1
  • the condition or disease is short stature, obesity, weight loss, cachexia, anorexia, neurological disease (eg, diabetic neuropathy), fibrosis-related symptoms, cartilage disorders, bone disease, from the group consisting of inflammatory disorders, intestinal disorders, insulin resistance, diabetes, diabetic ketoacidosis, Rabson-Mendenhall syndrome, retinopathy, acromegaly, fibromuscular hyperplasia and heart disorders It can be one selected species.
  • the subject requiring treatment for short stature is a human pediatric subject having insulin-like growth factor-1 deficiency (IGFD), and the composition is effective for the treatment of IGFD in a human pediatric subject.
  • IGFD insulin-like growth factor-1 deficiency
  • the TGF- ⁇ gene is located on chromosome 19q13, and TGF- ⁇ is secreted by activated T cells, macrophages, and various other cells to exhibit various biological functions. It can suppress differentiation by acting on T cells, block production of cytokines or expression of activation markers, and exhibit immunosuppressive function by inducing apoptosis of T cells.
  • TGF- ⁇ has functions of angiogenesis, inhibition of tumor cell growth, and tissue repair through the synthesis of extracellular matrix proteins.
  • the composition may be a pharmaceutical composition for preventing or treating cardiovascular disease, cancer, diabetes, Alzheimer's disease, lung disease, allergic disease, and/or autoimmune disease.
  • Interferon is classified as a helical physiologically active substance, and is classified into two types, type 1 and type 2, according to physicochemical and functional characteristics.
  • Type 1 interferons include alpha-, beta-, tau-, and epsilon-interferons
  • type 2 interferons include gamma interferons.
  • interferon beta belonging to type 1 interferon is a protein with species-specific characteristics, and is also called fibroblast interferon depending on where it is mainly produced, and pH2-stable interferon depending on its biological characteristics.
  • interferon beta binds to the same receptor on the cell surface as interferon alpha, which is classified in the same type 1 group, and induces transcription of antiviral factors by a series of signal transduction systems within the cell.
  • Interferon beta has intrinsic antiviral activity, cell growth inhibition or antigrowth ability, antiproliferation, lymphocyte cytotoxicity increase, immunomodulatory activity, target cell differentiation induction or inhibition, macrophage activation, cytokine production increase, It can be used to treat cancer, autoimmune disorders, and viral infections by increasing the effectiveness of cytotoxic T cells, increasing the effectiveness of macrophages, and increasing natural killing cells. In addition, research results proving the effect of IFN ⁇ on HIV-related diseases, hepatitis C, etc.
  • the composition may be a pharmaceutical composition for preventing or treating cancer, autoimmune disease, and/or viral infection disease.
  • the diseases for which the frequency of drug administration needs to be reduced are not limited, but preferably cardiovascular diseases, diabetes, Alzheimer's disease, lung diseases, cancer diseases, autoimmune diseases, infectious diseases, ischemic diseases, neurological diseases, kidney diseases and/or or liver disease.
  • Diseases requiring delay in infection or progression of the above diseases include, but are not limited to, preferably viral diseases, more preferably coronavirus diseases.
  • the present invention provides a novel recombinant expression construct pHP3.
  • pHP3 of the present invention significantly increases the expression efficiency of various exogenous genes compared to recombinant expression constructs derived from various strains of HCMV, and thus can be usefully used in gene therapy and/or DNA vaccines.
  • Figure 1 is a schematic diagram of the structure for constructing eukaryotic cell expression vectors having control and transcription sites of various HCMV strains.
  • 5 shows a vector map of pHP4.
  • pHP1, pHP2, pHP3, and pHP4 are data comparing expression efficiencies between pHP1, pHP2, pHP3, and pHP4 derived from various HCMV strains using a recombinant expression construct for exogenous gene expression containing an HGF gene as an exogenous gene.
  • pHP7 is data comparing expression efficiencies between pHP1, pHP2, pHP3, and pHP4 derived from various HCMV strains using a recombinant expression construct for exogen expression including a SARS-CoV-2 spike gene as an exogen.
  • Figure 8 compares the expression efficiency between pHP1, pHP2, pHP3 and pHP4 derived from various HCMV strains using a recombinant expression construct for exogenous gene expression containing a SARS-CoV-2 spike receptor binding domain (RBD) gene as an exogenous gene. It is data.
  • RBD SARS-CoV-2 spike receptor binding domain
  • pHP9 is data comparing expression efficiencies between pHP1, pHP2, pHP3, and pHP4 derived from various HCMV strains using a recombinant expression construct for exogenous gene expression containing a TGF- ⁇ gene as an exogenous gene.
  • FIG. 11 confirms a statistically significant increase in IFN- ⁇ protein expression in pHP3-IFN ⁇ compared to pHP1-IFN ⁇ as a control group.
  • FIG. 12 confirms a statistically significant increase in HGF protein expression in pHP3-HGF compared to pHP1-HGF as a control group.
  • Figure 17 confirms that, as a result of performing the Rotarod latency test, exercise performance is improved statistically significantly compared to the control group in the Examples.
  • HGF Human Hepatocyte Growth Factor
  • the human hepatocyte growth factor (HGF) gene represented by SEQ ID NO: 1 was produced by requesting Genscript (USA).
  • the prepared gene was amplified by PCR with SEQ ID Nos. 2 and 3 in Table 1 to prepare a gene inserted into a vector.
  • SARS-CoV-2 spike gene represented by SEQ ID NO: 4 was subjected to primary PCR using SEQ ID NOS: 5 and 6 in Table 1 using the Spike ORF mammalian expression plasmid (Codon Optimized) sold by SinoBiological as a template.
  • Signal peptide In order to add sequences, SEQ ID Nos. 7 and 8 in Table 1 were amplified by secondary PCR and constructed.
  • SARS-CoV-2 2019-nCoV spike receptor binding domain (RBD)
  • the SARS-CoV-2 (2019-nCoV) RBD gene represented by SEQ ID NO: 9, uses the Spike ORF mammalian expression plasmid (Codon Optimized) sold by SinoBiological as a template and performs primary PCR with SEQ ID NOs: 10 and 11 in Table 1. In order to add the signal peptide sequence, secondary PCR was performed with SEQ ID Nos. 12 and 13 in Table 1 to amplify and prepare.
  • TGF- ⁇ Human Transforming Growth Factor- ⁇
  • Human transforming growth factor beta (TGF- ⁇ ) represented by SEQ ID NO: 34 is a vector obtained by PCR amplification with SEQ ID NOs: 35 and 36 in Table 1 using the gene sold by Sino Biological (see NCBI nucleotide sequence NM_000660.4) as a template. The gene inserted into was prepared.
  • IGF-1 Human Insulin-like Growth Factor-1
  • the human insulin-like growth factor 1 (IGF-1) gene represented by SEQ ID NO: 37 (refer to NCBI nucleotide sequence NM_001111283.3) was produced by requesting Bionics.
  • the prepared gene was PCR amplified with SEQ ID NOs: 38 and 39 in Table 1 to prepare a gene inserted into a vector.
  • Human interferon beta (IFN- ⁇ ) represented by SEQ ID NO: 40 is PCR amplified with SEQ ID NOs: 41 and 42 in Table 1 using the gene sold by Sino Biological (see NCBI nucleotide sequence NM_002176.2) as a template and inserted into the vector gene was created.
  • IFN- ⁇ Human interferon beta
  • the plasmid used in the present invention has a structure as shown in Figure 1, and the detailed production method of each plasmid is as follows.
  • pVAX1-BMP2 (Plasmid#137909) was purchased from Addgene and used.
  • pHP1 of SEQ ID NO: 21 was prepared by inserting the prepared promoter into the same restriction enzyme site.
  • the vector map of pHP1 is shown in FIG. 2 .
  • the full HCMV promoter of the AD169 strain was produced by requesting Bionics Inc. with reference to NCBI nucleotide sequence X17403.
  • pHP2 of SEQ ID NO: 23 was prepared by inserting the prepared promoter into the same restriction enzyme site.
  • the vector map of pHP2 is shown in FIG. 3 .
  • the full HCMV promoter of the 3157 strain was produced by requesting Bionics, referring to the NCBI nucleotide sequence GQ221974. After cutting the pVAX1 promoter with MluI and NheI, pHP3 of SEQ ID NO: 25 was prepared by inserting the prepared promoter into the same restriction enzyme site. The vector map of pHP3 is shown in FIG. 4 .
  • the full HCMV promoter of the CINCY+Towne fusion strain was produced by requesting Bionics by referring to the NCBI nucleotide sequence GU980198.1.
  • pHP4 of SEQ ID NO: 27 was prepared by inserting the prepared promoter into the same restriction enzyme site.
  • the vector map of pHP4 is shown in FIG. 5 .
  • HGF Human Hepatocyte Growth Factor
  • HGF-X6 16 HGF-X7 17 HGF-X8 18 dHGF (deleted variant of HGF) 19 SARS-CoV-2 (2019-nCoV) spike 4 SARS-CoV-2 (2019-nCoV) spike receptor binding domain (RBD) 9 Full HCMV IE sequence (1563bp) of Towne strain, AY315197 20 pHP1 21 AD169 strain, full HCMV IE sequence of X17403 (1564bp) 22 pHP2 23 3157 strain, full HCMV IE sequence of GQ221974 (1552bp) 24 pHP3 25 CINCY+Towne fusion, full HCMV IE sequence of GU980198.1 (1563bp) 26 pHP4 27 Neomycin/Kanamycin resistance gene 28 hGH pA 29 bGH pA 30 SV40 early pA 31 SV40 late pA 32 Human Transforming Growth Factor- ⁇ (TGF)
  • TGF Human Transforming Growth
  • HGF and pHP plasmids were digested with BamHI and XbaI enzymes for 1 hour, respectively, and the fragments were separated by electrophoresis on an agarose gel. The separated sections were ligated for 30 minutes using T4 ligase and cultured overnight in E. coli. The next day, after culturing the colony, mini-prep was performed to isolate DNA and confirm it with BamHI and XbaI.
  • the SARS-CoV2 spike RBD and pHP plasmids were digested with KpnI and ApaI enzymes for 1 hour, respectively, and the fragments were separated by electrophoresis on an agarose gel. The separated sections were ligated for 30 minutes using T4 ligase and cultured overnight in E. coli. The next day, after culturing the colony, mini-prep was performed to isolate DNA and confirm it with KpnI and ApaI. E. Coli supernatant containing the cloned DNA was added to two 200 mL flasks together with kanamycin, cultured overnight, and maxi prep. Plasmid DNA was produced using Kit (Qiagen, USA) and used for cell experiments.
  • TGF- ⁇ and pHP plasmids were digested with NheI and XbaI enzymes for 1 hour, respectively, and the fragments were separated by electrophoresis on an agarose gel. The separated sections were ligated for 30 minutes using T4 ligase and cultured overnight in E. coli. The next day, after culturing the colony, mini-prep was performed to isolate the DNA and confirm it with ScaI and KpnI.
  • IGF-1 and pHP plasmids were digested with NheI and NotI enzymes for 1 hour, respectively, and the fragments were separated by electrophoresis on an agarose gel. The separated sections were ligated for 30 minutes using T4 ligase and cultured overnight in E. coli. The next day, after culturing the colony, mini-prep was performed to isolate DNA and confirm with NheI and NotI.
  • IFN- ⁇ and pHP plasmids were digested for 1 hour with NheI and XbaI enzymes, respectively, and the fragments were separated by electrophoresis on an agarose gel. The separated sections were ligated for 30 minutes using T4 ligase and cultured overnight in E. coli. The next day, after culturing the colony, mini-prep was performed to isolate DNA and confirm with NheI and ApaI.
  • DMEM Dulbecco's modified Eagle's medium
  • DMEM Dulbecco's modified Eagle's medium
  • SIGMA-ALDRICH 10% of fetal bovine serum
  • HEK293 cells (Korea Cell Line Bank) cultured with medium (SIGMA-ALDRICH, USA) were spread 1 ⁇ 10 6 per well in a 6-well plate (SPL, USA), and the next day, 60 to 80% cell level After mixing 3 ⁇ g of each plasmid DNA with 200 ⁇ l of transfection reagent (jetPEI ® , polyplus transfection, USA) and reacting at room temperature for 30 minutes, it was applied evenly to all areas of the well. The next day, the cells were collected after 48 hours after replacement with DMEM medium containing 10% FBS, and mRNA expression of the spike gene was measured by quantitative PCR. The value was corrected by measuring GAPDH as an internal control.
  • DMEM Dulbecco's modified Eagle's medium
  • SIGMA-ALDRICH 10% fetal bovine serum
  • HEK293 cells (Korea Cell Line Bank) cultured with medium (SIGMA-ALDRICH, USA) were spread 1 ⁇ 10 6 per well in a 6-well plate (SPL, USA), and the next day, 60 to 80% cell level After mixing 3 ⁇ g of each plasmid DNA with 200 ⁇ l of transfection reagent (jetPEI ® , polyplus transfection, USA) and reacting at room temperature for 30 minutes, it was applied evenly to all areas of the well. The next day, after replacing the medium with DMEM containing 10% FBS, the cells were collected 48 hours later and the mRNA expression of the RBD gene was measured by quantitative PCR. The value was corrected by measuring GAPDH as an internal control.
  • DMEM Dulbecco's modified Eagle's medium
  • SIGMA-ALDRICH 10% fetal bovine serum
  • TGF- ⁇ protein expression was measured using an ELISA kit (R&D Systems, USA). As shown in FIG. 9, it was confirmed that the TGF- ⁇ protein expression was statistically significantly increased in pHP3-TGF ⁇ of Example 2 compared to pHP1-TGF ⁇ of the control group. On the other hand, in Examples 1 and 3, there was no statistically significant difference in TGF- ⁇ protein expression compared to the control group.
  • DMEM Dulbecco's modified Eagle's medium
  • SIGMA-ALDRICH 10% fetal bovine serum
  • DMEM Dulbecco's modified Eagle's medium
  • SIGMA-ALDRICH 10% fetal bovine serum
  • pHP1-HGF control group
  • pHP3-HGF Example plasmid DNA into which the HGF gene was inserted in vivo
  • 25 ⁇ g/25 ⁇ g/25 ⁇ g were administered to the calf muscles of Balb/c mice (Sam Taco Bio Korea). Injected by ⁇ l/leg.
  • the mice were sacrificed and the muscle at the injection site was cut. And, after pulverizing each of the cut muscles using liquid nitrogen and a protein extraction kit (Cellbiolabs, USA), total protein was separated. The total amount of separated protein was measured using a DC protein assay kit (Bio-Rad Laboratories, USA).
  • HGF protein expression was measured using an ELISA kit (R&D Systems, USA) using the same amount of protein.
  • Diabetic peripheral neuropathy is a type of ischemic disease and neurological disease that clinically causes symptoms such as pain and abnormalities as peripheral nerves are damaged due to increased blood sugar due to diabetes and consequent damage to microvessels. It is a complex disease. Streptozotocin (STZ) induced diabetic peripheral neuropathy used in this study is a representative animal model of diabetic peripheral neuropathy.
  • Type 1 diabetes was induced by intravenous injection of 50 mg/kg of STZ into 7-week-old male Wistar rats purchased from Orient Bio Co., Ltd.
  • the von Frey test was conducted 4 weeks after STZ injection, and according to the ranking results, the average filament strength of each group was distributed randomly so that the strength of each group was distributed as uniformly as possible, and then 7 animals per group were separated into 2 groups. Thereafter, as a control group, a total of 2 mL of 250 ⁇ l of physiological saline was administered to each of the 4 places on each side of the calf muscle, and the mixture was administered with 2 mg of pHP3-HGF as an example and microparticles. After administration of the examples, 3 MHz ultrasound was applied for 5 minutes.
  • the pain was improved statistically significantly compared to the control group in the Example from the 3rd week after administration, which is This was maintained until the 6th week when this was completed.
  • PWT paw withdrawal threshold
  • EMG was statistically significantly improved from the 3rd week after administration and was maintained until the 6th week when the test was completed, and nerve conduction was statistically significantly improved at the 6th week.
  • Diabetic peripheral neuropathy is a type of ischemic disease and neurological disease that clinically causes symptoms such as pain and abnormalities as peripheral nerves are damaged due to increased blood sugar due to diabetes and consequent damage to microvessels. It is a complex disease. Streptozotocin (STZ) induced diabetic peripheral neuropathy used in this study is a representative animal model of diabetic peripheral neuropathy.
  • Type 1 diabetes was induced by intravenous injection of 50 mg/kg of STZ into 7-week-old male Wistar rats purchased from Orient Bio Co., Ltd.
  • the von Frey test was conducted 4 weeks after STZ injection, and according to the ranking results, the average filament strength of each group was distributed randomly so that the strength of each group was distributed as uniformly as possible, and then 7 animals per group were separated into 2 groups. Thereafter, as a control group, a total of 2 mL of physiological saline was administered to each of the calf muscles on each side, 250 ⁇ l each in 4 places, and in the example, 2 mg of pHP3-IGF1 and microparticles were mixed and then administered. In the example, 3 MHz ultrasound was applied for 5 minutes after administration.
  • PWT paw withdrawal threshold
  • Severe lower extremity ischemia is an ischemic disease in which blood circulation in the lower extremities is impaired due to occlusion of blood vessels due to various causes, and blood supply to the muscles is not smooth, resulting in pain and ulcers in the extremities of the lower extremities.
  • the surgical femoral artery amputation used in this study is a representative animal model for severe limb ischemia in rabbits.
  • the left femoral skin was incised from the patella to the inguinal ligament in the direction of movement of the femoral artery to expose the femoral artery, and the proximal femoral artery was resected from the saphenous artery to the bifurcation of the popliteal artery. After confirming the presence of bleeding, when hemostasis was completed, the incised muscle fascia and skin were sutured.
  • the number of arterioles was measured using a C-arm on day 42, and microvessels were measured through histological analysis of the muscle tissue in the corresponding area. As a result, as shown in FIG. 19, the number of arterioles and microvessels was statistically significantly increased in the examples compared to the control group.

Abstract

본 발명은 유전자 치료 및 DNA 백신에 있어서 최적의 조건을 가지는 진핵세포 발현 벡터의 개발에 관한 것이다. 본 발명의 진핵세포 발현 벡터는 이전 보고된 HCMV Towne strain의 immediate-early(IE) 유전자 intron A를 포함하는 전장 HCMV 조절 및 전사부위와 다양한 HCMV strain의 동일 부위를 pVAX1 프로모터 부위에 치환하여 HCMV 종별에 따른 유전자 발현 효율 차이를 진핵세포에서 비교한 결과 HCMV Towne strain에 비해 여러 가지 유전자의 발현을 유의하게 증가시킬 수 있다. 이를 통해 진핵세포에서 발현이 높은 벡터인 pHP3을 개발하였고 이를 유전자 치료 및/또는 DNA 백신에 유용하게 사용할 수 있다.

Description

최적의 재조합 발현 구축물의 개발
본 발명은 유전자 치료 및/또는 DNA 백신에 있어서 높은 발현 효율을 가지는 발현 구축물 개발에 관한 것으로, 보다 상세하게는 pVAX1 벡터를 기반으로 최적의 HCMV 균주의 전장 HCMV IE 조절 및 전사부위를 삽입하여 제조된 외래유전자 발현용 재조합 발현 구축물에 관한 것이다.
모든 유전자 치료제는 치료유전자를 전달하는 전달체(벡터)의 종류에 따라 바이러스성과 비바이러스성으로 나뉘며 그 중 안전성이 높은 플라스미드 DNA와 발현 효율이 우수한 아데노바이러스 및 아데노부속바이러스가 가장 많이 사용되고 있다. 이중 플라스미드 DNA 근간 유전자 치료제는 기본적으로 발현효율이 낮으므로 치료유전자의 발현 효율을 높이기 위한 연구가 다방면으로 활발하게 진행되고 있다.
치료유전자의 발현 효율을 높이기 위한 방법은 세가지 방향의 연구가 가장 일반적인데 먼저 프로모터의 조합 등을 통한 발현 벡터 개선 연구와, 둘째로 질환에 최적인 유전자를 개선하는 연구, 그리고 생체 내 전달효율을 높이기 위한 연구 등이 진행되고 있다. 본 연구는 이 중 유전자 발현 프로모터를 비교 및 선별하여 진핵세포에서 최적의 발현효율을 보이는 벡터를 개발하기 위한 연구이다.
HCMV 프로모터는 가장 강력한 프로모터 중의 하나이며 다양한 HCMV strain이 있는데 이 중 Towne과 AD169 등이 대표적인 strain이다. HCMV immediate-early(IE) 유전자의 major 프로모터의 염기서열은 strain에 따른 서열 차이가 거의 없이 유사하나 IE 유전자의 intron A를 포함하는 전장 HCMV IE 조절 및 전사부위 서열은 HCMV strain마다 염기서열의 차이를 보인다. 이전 Chapman 등은 HCMV Towne strain의 intron A를 프로모터에 포함(전장 HCMV 조절 및 전사부위)하는 경우 gp120과 gp160 유전자에서는 발현효율이 증가하는 것을 보고한 적이 있으나 HCMV strain별 프로모터에 따른 유전자 발현의 차이는 알려져 있지 않다.
현재 허가단계 및 임상 3상 시험 그리고 다수의 임상 시험에 사용되는 pVAX1 벡터는 AD169 strain의 HCMV IE유전자의 major 프로모터를 사용하고 있는데 임상시험에서 안전성은 뛰어나지만 발현 효율이 높지 않은 것으로 알려져 있어 여러 연구자들이 본 벡터를 기반으로 발현 효율을 높이기 위한 연구를 진행 중에 있다.
상기한 배경기술로서 설명된 사항들은 본 발명의 배경에 대한 이해 증진을 위한 것일 뿐, 이 기술분야에서 통상의 지식을 가진 자에게 이미 알려진 종래기술에 해당함을 인정하는 것으로 받아들여져서는 안 될 것이다.
[선행기술문헌]
[특허문헌]
대한민국등록특허 제10-0562824호
본 발명자들은 유전자 치료 및/또는 DNA 백신에 이용하기에 적합한, 진핵세포 내에서 발현 효율이 높은 벡터를 개발하고자 예의 노력하였다. 그 결과 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위를 이용하는 경우 다른 균주 유래의 전장 HCMV IE 조절 및 전사부위를 이용하는 경우와 비교하여 유전자의 발현 효율이 월등히 증가됨을 확인함으로써, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 재조합 발현 구축물(recombinant expression construct)을 제공하는데 있다.
본 발명의 다른 목적은 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 서열과 90% 이상의 상동성을 갖는 서열을 포함하는 재조합 발현 구축물을 제공하는데 있다.
본 발명의 또 다른 목적은 외래유전자(transgene) 발현용 재조합 발현 구축물(recombinant expression construct)을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 재조합 발현 구축물 또는 외래유전자 발현용 재조합 발현 구축물로 형질도입(transduction)된 숙주세포를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 재조합 발현 구축물 또는 외래유전자 발현용 재조합 발현 구축물을 제조하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 외래유전자 발현용 재조합 발현 구축물의 치료 용도(for use in therapy)을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 외래유전자 발현용 재조합 발현 구축물을 이를 필요로 하는 대상(subject)에게 치료학적 유효량을 투여하는 단계를 포함하는, 외래유전자의 발현 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 약제학적 유효량의 상기 외래유전자 발현용 재조합 발현 구축물 및 약제학적으로 허용가능한 담체를 포함하는 약제학적 조성물을 제공하는데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 재조합 발현 구축물(recombinant expression construct)을 제공한다.
본 명세서에서 용어 "벡터" 또는 "구축물"은 핵산 또는 유전자를 삽입할 수 있는 구축물을 의미하며, 바람직하게는 핵산 서열을 복제할 수 있는 세포로의 도입을 위해서 핵산 서열을 삽입할 수 있는 전달체를 포함한다. 핵산 서열은 외생 (exogenous) 또는 이종 (heterologous)일 수 있다. 핵산 서열은 외래유전자(transgene) 일 수 있다. 구축물로서는 플라스미드, 코스미드 및 바이러스(예를 들면, AAV)를 들 수 있으나, 이에 제한되지 않는다. 당업자는 표준적인 재조합 기술에 의해 상기 벡터 또는 구축물을 구축할 수 있다(Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988; 및 Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994 등).
본 명세서에서 용어 "발현 벡터" 또는 "발현 구축물"은 전사되는 유전자 산물 중 적어도 일부분을 코딩하는 뉴클레오타이드 서열을 포함한 벡터 또는 구축물을 의미한다. 일부의 경우에는 그 후 RNA 분자가 단백질, 폴리펩타이드, 또는 펩타이드로 번역된다. 발현 구축물에는 다양한 조절부위(regulatory regions)를 포함할 수 있다. 전사 및 번역을 조절하는 조절부위과 함께 벡터 및 발현 벡터에는 또 다른 기능도 제공하는 뉴클레오타이드 서열도 포함될 수 있다. 상기 조절요소에는 인핸서, 프로모터, 엑손, 인트론, 스플라이싱 공여체 및 수여체 서열 등을 포함될 수 있다. 또한, 상기 조절요소에는 전사 종결을 위한 서열(예를 들어, poly A 등), 외래유전자(transgene)를 안정적으로 발현시키기 위한 서열(예를 들어, WPRE 서열 등), 외래유전자-특이적 면역의 발생을 감소시키기 위한 서열(예를 들어, miRNA 타겟 서열 등)이 포함될 수 있다.
본 명세서에서 용어 "작동적으로 연결된" 또는 "작동 가능하게 연결된"은 연결될 DNA 서열들이 원하는 기능을 수행하도록 인접하여 위치함을 의미하며, 예를 들어, 특정 프로모터가 코딩 서열(예를 들어, 외래유전자)의 전사를 개시하는 데 도움을 주는 경우, 이러한 프로모터는 코딩 영역과 작동적으로 연결될 수 있다. 이러한 기능적 관계가 유지되는 한은 프로모터와 코딩 영역이 반드시 인접하여 위치할 필요는 없다.
본 명세서에서 용어 "전장 HCMV IE 조절 및 전사부위" 또는 "full HCMV IE regulatory and transcribed regions"는 조절 및 전사부위로서 enhancer, promoter, intron A 등이 포함되어 있는 구조를 의미한다. "주요 HCMV IE 프로모터" 또는 "major HCMV IE promoter"는 상기 " 전장 HCMV IE 조절 및 전사부위"에서 필수 부위가 아닌 intron A 등이 빠진 구조를 의미한다.
본 발명의 바람직한 구현예에 따르면, 상기 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 서열은 서열번호 24의 서열을 포함한다.
본 발명의 바람직한 구현예에 따르면, 상기 재조합 발현 구축물은 외래유전자(transgene) 삽입용 멀티 클로닝 사이트(MCS)를 포함한다.
예를 들어, 외래유전자가 인간 간세포 성장인자(Hepatocyte Growth Factor: HGF)의 경우 BamHI과 XbaI 사이트, 인간 전환 성장인자 베타(Transforming Growth Factor-β: TGF-β)의 경우 NheI과 XbaI 사이트, 인간 인슐린 유사 성장인자 1(Insulin-like Growth Factor-1: IGF-1)의 경우 NheI과 NotI 사이트, 인간 인터페론 베타(Interferon-β: IFN-β)의 경우 NheI과 XbaI 사이트, SARS-CoV-2 스파이크나 RBD(receptor binding domain)인 경우는 KpnI과 ApaI 사이트를 이용할 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 용어 "외래유전자" 또는 "transgene"은 재조합 발현 구축물 내에 인코딩된 하나 이상의 폴리뉴클레오타이드 또는 폴리뉴클레오타이드 영역 또는 이러한 폴리뉴클레오타이드 또는 폴리뉴클레오타이드 영역의 발현 산물, 폴리펩타이드 또는 다중-폴리펩타이드를 인코딩하는 폴리뉴클레오타이드 또는 조절 핵산(modulatory or regulatory nucleic acid)을 나타낸다.
본 발명의 바람직한 구현예에 따르면, 상기 외래유전자는 지속적인 발현을 목적으로 하는 치료 목적의 펩타이드를 코딩하는 폴리뉴클레오타이드 또는 질병의 예방 또는 치료를 목적으로 하는 DNA 또는 RNA 백신일 수 있다.
본 발명의 바람직한 구현예에 따르면, 상기 재조합 발현 구축물은 폴리 아데닐화 서열(polyadenylation sequence, pA)을 추가적으로 포함한다.
상기 폴리 아데닐화 서열은 바람직하게는 hGH(human growth hormone) pA 서열, bGH(bovine growth hormone) pA 서열, SV40(simian vacuolating virus 40) early pA 서열, SV40 late pA 서열 등을 포함하나, 이에 제한되는 것은 아니다.
본 발명의 바람직한 구현예에 따르면, 상기 폴리 아데닐화 서열은 서열번호 23 내지 33으로 구성된 군으로부터 선택되는 뉴클레오타이드 서열을 포함한다.
본 발명의 바람직한 구현예에 따르면, 상기 재조합 발현 구축물은 항생제 저항성 유전자 (antibiotic resistance gene)을 추가적으로 포함한다.
본 명세서에서 용어 "항생제 저항성 유전자" 또는 "antibiotic resistance gene"은 미생물이 항생제에 노출되어도 생존할 수 있도록 약물 저항성을 부여해 줄 목적으로 플라스미드에 삽입되는 유전자이다. 대부분 클로닝을 진행함에 있어 원하는 플라스미드를 가진 개체를 선별해 내기 위하여 사용한다.
상기 항생제 저항성 유전자는 바람직하게는 엠피실린 (Ampicillin), 카나마이신 (Kanamycin), 네오마이신 (Neomycin), 클로람페니콜(Chloramphenicol), 젠타마이신(Gentamycin), 스트렙토마이신 (Streptomycin), 테트라사이클린 (Tetracycline), 에리스로마이신 (Erythromycin), 반코마이신 (Vancomycin), 페니실린 (Penicillin), 스펙티노마이신 (Spectinomycin), 클로람페니콜 (Chloramphenicol), 설파디아자인 (Sulfaciazine), 트리메소프림 (Trimethoprim) 저항성 유전자 등을 포함하나, 이에 제한되는 것은 아니다.
본 발명의 바람직한 구현예에 따르면, 상기 항생제 저항성 유전자는 네오마이신 저항성 유전자(서열번호 28), 카나마이신 저항성 유전자(서열번호 29) 및 이의 조합으로 구성된 군으로부터 선택되는 유전자 서열을 포함한다.
본 발명의 바람직한 구현예에 따르면, 상기 재조합 발현 구축물은 도 4의 개열지도를 갖는다.
본 발명의 다른 양태에 따르면, 본 발명은 하기의 구성을 포함하는 외래유전자(transgene) 발현용 재조합 발현 구축물(recombinant expression construct)로서, 상기 외래유전자는 숙주세포에서 전사 및 번역될 수 있는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물을 제공한다:
(a) 외래유전자(transgene); 및
(b) 상기 외래유전자에 작동적으로 연결된(operably linked) 조절 및 전사부위 (regulatory and transcribed regions)로서, 상기 조절 및 전사부위는 서열번호 24의 서열을 포함함.
상기 서열번호 24의 서열은 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 (full HCMV IE regulatory and transcribed regions) 서열로부터 유래된 서열과 상동성을 갖는 서열을 의미한다.
본 발명의 바람직한 구현예에 따르면, 상기 외래유전자 발현용 재조합 발현 구축물은 서열번호 20의 HCMV Towne 균주의 전장 HCMV IE 조절 및 전사부위 서열, 서열번호 22의 HCMV AD169 균주의 전장 HCMV IE 조절 및 전사부위 서열 및 서열번호 26의 HCMV CINCY 및 Towne 균주의 전장 HCMV IE 조절 및 전사부위 서열(CINCY+Towne fusion)로 구성된 군으로부터 선택되는 조절 및 전사부위가 삽입된 경우와 비교하여 외래유전자(transgene)의 발현이 증가된 것이다.
본 발명의 재조합 발현 구축물은 외래유전자(transgene) 탑재시, HCMV Towne 균주의 전장 HCMV IE 조절 및 전사부위 서열, HCMV AD169 균주의 전장 HCMV IE 조절 및 전사부위 서열 또는 HCMV CINCY 및 Towne 균주의 전장 HCMV IE 조절 및 전사부위 서열을 탑재한 경우와 비교하여, 외래유전자의 발현을 10% 이상, 바람직하게는 통계적으로 유의하게 증가시킬 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명은 재조합 발현 구축물은 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 (full HCMV IE regulatory and transcribed regions) 서열과 적어도 80% 이상, 적어도 85% 이상, 적어도 90% 이상의 상동성을 갖는다.
상기 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 서열과 상동성을 갖는 서열은 본 발명의 재조합 발현 구축물 내에 존재시, 외래유전자의 발현량을 동등하거나 유사한 수준으로 유지한다.
본 발명에서 "유사한 수준으로 유지"한다는 것은 비교 대상의 외래유전자 발현량을 100%로 보았을 때, 발현량이 바람직하게는 30% 이하, 보다 바람직하게는 20% 이하, 가장 바람직하게는 10% 이하의 발현량의 감소 또는 증가를 포함하는 의미로 사용된다.
본 발명의 재조합 발현 구축물은 외래유전자(transgene) 탑재시, 상기 외래유전자의 발현 효율을 크게 증가(예를 들어, 통계적으로 유의하게 증가)시킬 수 있으며, HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 서열을 삽입한 경우와 발현 효율이 동등하거나 90% 이상의 발현 효율을 나타내는 서열은 상기 상동성을 갖는 서열에 포함될 수 있다.
본 발명의 일 실시예에 따르면, 상기 외래유전자는 대상 또는 환자의 신체 내에서 지속적인 발현을 목적으로 하는, 특정 질환의 치료용 펩타이드를 인코딩하는 뉴클레오타이드 서열(예를 들어, HGF, TGF-β, IGF-1, IFN-β 유전자 또는 이의 변이체 유전자 등)일 수 있다.
본 발명의 일 실시예에 따르면, 상기 외래유전자는 대상 또는 환자의 신체 내에서 지속적인 발현을 목적으로 하는, 특정 질환(예를 들어, 코로나바이러스)의 예방을 위한 DNA 또는 RNA 백신 서열(예를 들어, SARS-CoV-2 스파이크 유전자 또는 SARS-CoV-2 스파이크 RBD 유전자 등)일 수 있다.
본 명세서에서 용어 "HGF 변이체"는 모든 대립 유전자 변이체들(variants)을 포함하는，동물에서 자연적으로 생성되는(naturally occurring) HGF 아미노산 서열과 적어도 80% 동일한 아미노산 서열을 갖는 HGF 폴리펩타이드를 의미한다. 예를 들어， HGF 변이체는 HGF의 정상형(normal form) 또는 야생형(wild type), 그리고 HGF의 다양한 변이체(예컨대, 스플라이싱 변이체 및 결손 변이체) 및 이형체를 모두 포괄하는 의미를 갖는다.
본 명세서에서, "HGF 변이체"는 HGF의 두 가지 이형체(HGF 및 dHGF)를 모두 발현할 수 있는 하이브리드 HGF 유전자일 수 있다(한국등록특허 제10-0562824호 참조). 구체적으로, 상기 "하이브리드 HGF 유전자"는 HGF cDNA의 엑손 4와 엑손 5 사이에 인간 HGF 유전자의 인트론 4 또는 그의 단편 서열이 삽입된, 유전자 발현효율이 높으며 HGF 및 dHGF(deleted varient of HGF)의 두 가지 이형체를 동시에 발현하는 하이브리드 HGF 유전자(예를 들어, 서열번호 16 내지 18)일 수 있다.
본 발명의 유전자 치료제 전략에 따르면，HGF의 두 종류 이상의 이형체를 암호화하는 하나 이상의 뉴클레오타이드 서열을 이용하는 것이 치료 효과면에서 바람직하다. 두 종류 이상의 HGF 이형체-암호화 뉴클레오타이드 서열은 하나의 폴리뉴클레오타이드로 제공되거나 별도의 폴리뉴클레오타이드로 제공될 수 있다.
또한, 본 명세서에서, “HGF 변이체 유전자”는 HGF-X7 유전자(서열번호 17)(한국등록특허 제10-0562824호 참조)일 수 있다.
또한, 본 명세서에서, “HGF 변이체 유전자”는 결손된 변이형 HGF(deleted varient of HGF; dHGF) 유전자(서열번호 19)(한국 등록특허 제10-0562824호 참조)일 수 있다. 본 명세서에서 사용되는 용어 "dHGF"는 동물, 바람직하게는 포유동물에서 HGF 유전자의 선택적 스플라이싱에 의해 생성되는 HGF 단백질의 결손된 변이체，보다 바람직하게는 전장 HGF 서열(728 개의 아미노산)로부터 알파 사슬의 첫 번째 크링글 도메인에서 5 개의 아미노산(F, L, P, S 및 S)이 결손된 723 개의 아미노산으로 이루어지는 인간 HGF를 지칭한다.
본 명세서에서 "SARS-CoV-2 스파이크 유전자"는 서열번호 4의 유전자 서열일 수 있다.
본 명세서에서 "SARS-CoV-2 스파이크 RBD 유전자"는 서열번호 9의 유전자 서열일 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 재조합 발현 구축물 또는 외래유전자 발현용 재조합 발현 구축물로 형질도입(transduced), 형질감염(transfected) 또는 형질전환(transformed)된 숙주세포를 제공한다.
본 발명에서 용어 "숙주세포"는 진핵생물 및 원핵생물을 포함하며, 상기 발현 구축물(예를 들어, 벡터)을 복제할 수 있거나 발현 구축물에 의해 코딩되는 유전자를 발현할 수 있는 임의의 형질 도입 가능한 생물을 의미한다. 본 발명에서 용어 "형질도입" 또는 "transduction"은 형질감염(transfection)이나 형질전환(transformation)을 포함하는 의미로 사용된다. 숙주세포는 상기 발현 구축물에 의해 형질도입(transduced), 형질감염(transfected) 또는 형질전환(transformed) 될 수 있으며, 이는 외생의 핵산분자가 숙주세포 내에 전달되거나 도입되는 과정을 의미한다.
본 발명의 숙주세포는 제한되지 않으나, 진핵세포, 바람직하게는 곤충세포 또는 포유동물 세포, 보다 바람직하게는 곤충세포의 경우 Sf9, 포유동물 세포의 경우 HEK293 세포, HeLa 세포, C2C12 세포, ARPE-19 세포, RPE-1 세포, HepG2 세포, Hep3B 세포, Huh-7 세포, C8D1a 세포, Neuro2A 세포, CHO 세포, MES13 세포, BHK-21 세포, COS7 세포, COP5 세포, A549 세포, MCF-7 세포, HC70 세포, HCC1428 세포, BT-549 세포, PC3 세포, LNCaP 세포, Capan-1 세포, Panc-1 세포, MIA PaCa-2 세포, SW480 세포, HCT166 세포, LoVo 세포, A172 세포, MKN-45 세포, MKN-74 세포, Kato-III 세포, NCI-N87 세포, HT-144 세포, SK-MEL-2 세포, SH-SY5Y 세포, C6 세포, HT-22 세포, PC-12 세포, NIH3T3 세포 등을 이용할 수 있다.
또한, 본 발명의 외래유전자 발현용 재조합 발현 구축물은 치료 또는 예방 목적의 유전자 전달을 위해 포유동물의 생체 내 숙주세포에 직접 전달하는데 이용될 수도 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 재조합 발현 구축물의 제조방법을 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 외래유전자 발현용 재조합 발현 구축물의 제조방법을 제공한다.
본 발명의 일 실시예에 따르면, 본 발명의 재조합 발현 구축물의 제조방법은 pVAX1 벡터에 서열번호 24의 서열을 삽입하는 단계를 포함한다. 예를 들어, pVAX1 벡터에서 프로모터를 제거한 후, 서열번호 24의 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위를 삽입하여 제조할 수 있다.
본 발명의 바람직한 구현예에 따르면, 상기 제조방법은 상기 재조합 발현 구축물에 외래유전자(transgene)를 삽입하는 단계를 추가적으로 포함한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 외래유전자 발현용 재조합 발현 구축물의 치료 용도(for use in therapy)를 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 외래유전자 발현용 재조합 발현 구축물을 이를 필요로 하는 대상(subject)에게 치료학적 유효량을 투여하는 단계를 포함하는, 외래유전자의 발현 방법을 제공한다.
본 발명의 바람직한 구현예에 따르면, 상기 발현은 생체 내 발현인 것이다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 약제학적 유효량의 외래유전자 발현용 재조합 발현 구축물 및 약제학적으로 허용가능한 담체를 포함하는 약제학적 조성물을 제공한다.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 바람직하게는 비경구 투여이며, 예컨대, 정맥 내 주입, 경피 투여, 피하 주입, 근육 내 주입, 유리체 내 주입(intravitreal injection), 망막 하 주입(subretinal injection), 맥락막위공간 주입(suprachoroidal injection), 점안 투여(eye drop administration), 뇌실 내 주입(intracerebroventricular injection), 척추강 내 주입(intrathecal injection), 양막 내 주입 (intraamniotic injection), 동맥 내 주입 (intraarterial injection), 관절강 내 주입 (intraarticular injection), 심장 내 주입 (intracardiac injection), 음경해면체 내 주입 (intracavernous injection), 뇌 내 주입 (intracerebral injection), 뇌수조 주입 (intracisternal injection), 관상 내 주입 (intracoronary injection), 두개 내 주입 (intracranial injection), 경막 내 주입 (intradural injection), 경막 외 주입 (epidural injection), 해마 내 주입 (intrahippocampal injection), 비강 내 주입 (intranasal injection), 골강 내 주입 (intraosseous injection), 복강 내 주입 (intraperitoneal injection), 흉강 내 주입 (intrapleural injection), 척수 내 주입 (intraspinal injection), 흉곽 내 주입 (intrathoracic injection), 흉선 내 주입 (intrathymic injection), 자궁 내 주입 (intrauterine injection), 질 내 주입 (intravaginal injection), 심실 내 주입 (intraventricular injection), 방광 내 주입 (intravesical injection), 결막 하 주입 (subconjunctival injection) , 종양 내 주입 (intratumoral injection), 국소 주입 및 복강 주입(intraperitoneal injection) 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성별, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.0001-100 ㎎/㎏이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 재조합 발현 구축물 또는 상기 재조합 바이러스의 유효량을 대상(subject)에게 투여하는 단계를 포함하는, 질환의 치료방법을 제공한다.
본 명세서에서 용어 "대상" 또는 "subject"는 본 발명의 조성물 또는 상기 재조합 발현 구축물을 투여할 필요가 있는 개체를 의미하며, 포유류, 조류, 파충류, 양서류, 어류 등 투여 대상에 제한되지 않는다.
본 발명의 바람직한 구현예에 따르면, 본 발명은 외래유전자의 지속적인 발현을 달성할 수 있는 유전자 치료제 또는 질환의 치료방법, 또는 백신과 같은 질환의 예방방법에 관한 것이다.
본 발명이 예방, 개선 또는 치료하고자 하는 질환은 제한되지 않으나, 바람직하게는 약물 투여의 횟수를 감소시키거나, 질병의 감염 또는 진행을 지연시킬 필요가 있는 모든 질환을 포함한다.
외래유전자가 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자일 경우 상기 조성물은 허혈성 질환, 신경질환 또는 간 질환의 예방 또는 치료용 약제학적 조성물일 수 있다.
상기 신경 질환은 통증 질환 및 당뇨병성 말초 신경병증(diabetic peripheral neuropathy, DPN)을 포함한다.
또한, 외래유전자가 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF-1) 유전자일 경우, 상기 조성물은 IGF-1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약제학적 조성물일 수 있다.
본 발명의 일 실시예에 있어서, 상기 증상 또는 질환은, 저신장, 비만, 체중 감소, 악액질, 식욕 부진, 신경질환 (에를 들어, 당뇨병성 신경병증), 섬유증-관련 증상, 연골 장애, 골 질환, 염증 장애, 장 장애, 인슐린 내성, 당뇨병, 당뇨병성 케톤산증, 랍슨-멘덴할 증후군(Rabson-Mendenhall syndrome), 망막증, 말단 비대증(acromegaly), 섬유근성 이형성증(fibromuscular hyperplasia) 및 심장 장애로 이루어진 군으로부터 선택된 1종일 수 있다.
본 발명의 일 실시예에 있어서, 상기 저신장증에 대한 치료가 요구되는 개체는 인슐린 유사 성장 인자-1 결핍증(IGFD)을 가지고 있는 인간 소아 개체이고, 상기 조성물은 인간 소아 개체에서 IGFD의 치료에 유효한 것일 수 있다.
또한, TGF-β유전자는 염색체 19q13에 위치하고 있으며 TGF-β은 활성화된 T 세포, 대식세포 및 여러 가지 다른 세포들에 의해 분비되어 다양한 생물학적 작용을 나타낸다. T 세포에 작용하여 분화를 억제할 수 있으며 사이토카인의 생산이나 활성화 표지자의 발현을 차단할 수 있을 뿐 아니라 T 세포의 apoptosis를 유도함으로써 면역억제기능을 나타낸다. 그 외에도 TGF-β는 혈관신생, 종양세포 성장 억제 및 세포외 기질 단백의 합성을 통한 조직복구 기능을 갖고 있다. 이러한 활성을 통해 외래유전자가 TGF-β유전자일 경우 상기 조성물은 심혈관 질환, 암, 당뇨, 알츠하이머, 폐 질환, 알레르기 질환 및/또는 자가 면역 질환의 예방 또는 치료용 약제학적 조성물일 수 있다.
인터페론은 나선형의 생리활성물질로 분류되며, 물리화학적, 기능적 특징에 따라 1형과 2형의 두 가지로 분류된다. 1형 인터페론은 알파-, 베타-, 타우-, 입실론-인터페론이 있고, 2형 인터페론에는 감마 인터페론이 존재한다. 이들 중 1형 인터페론에 속하는 인터페론 베타는 종 특이적인 특성을 나타내는 단백질로서 주로 생산되는 위치에 따라 섬유모세포 인터페론(fibroblast interferon)으로도 불리며 생물학적 특성에 따라 pH2-안정성 인터페론(pH2-stable interferon)으로도 불린다. 또한 인터페론 베타는 같은 1형 그룹으로 분류되는 인터페론 알파와 세포 표면의 동일한 수용체에 결합하여 세포 내에서 일련의 신호전달 체계에 의해 항 바이러스성 인자들의 전사를 유도한다. 인터페론 베타는 고유 활성인 항바이러스 능력, 세포 성장 억제 또는 항 성장 능력, 항 증식, 림프구세 포독성 증대, 면역조절 활성, 표적 세포의 분화 유도 또는 억제, 대식세포의 활성화, 사이토카인 생성의 증가, 세포독성 T 세포의 효과 증가, 대식세포의 효과 증가 및 natural killing 세포의 증가로 암, 자가면역 장애 및 바이러스 감염 등을 치료하는데 이용될 수 있다. 또한, HIV와 관련된 질병, C형 간염 등에 대한 IFNβ의 효과가 입증되는 연구결과가 최근 많이 보고되고 있는 실정이며, 자가면역질환의 일종인 류마티스성 관절염의 경우에도 치료의 효과가 있다. 이러한 활성을 통해 외래유전자가 IFN-β 유전자일 경우 상기 조성물은 암, 자가면역 질환 및/또는 바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물일 수 있다.
상기 약물 투여의 횟수를 감소시킬 필요가 있는 질환은 제한되지 않으나, 바람직하게는 심혈관 질환, 당뇨, 알츠하이머, 폐 질환, 암 질환, 자가면역 질환, 감염 질환, 허혈성 질환, 신경 질환, 신장 질환 및/또는 간 질환을 포함한다.
상기 질병의 감염 또는 진행을 지연시킬 필요가 있는 질환은 제한되지 않으나, 바람직하게는 바이러스 질환, 보다 바람직하게는 코로나바이러스 질환을 포함한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(i) 본 발명은 신규한 재조합 발현 구축물 pHP3을 제공한다.
(ii) 본 발명의 pHP3은 다양한 HCMV 균주 유래의 재조합 발현 구축물과 비교하여 다양한 외래유전자의 발현 효율을 유의하게 증가시킴으로써, 유전자 치료제 및/또는 DNA 백신에 유용하게 사용될 수 있다.
도 1은 다양한 HCMV strain의 조절 및 전사부위를 갖는 진핵세포 발현 벡터를 제작하기 위한 구조를 도식화한 것이다.
도 2는 pHP1의 벡터맵을 나타낸다.
도 3은 pHP2의 벡터맵을 나타낸다.
도 4는 pHP3의 벡터맵을 나타낸다.
도 5는 pHP4의 벡터맵을 나타낸다.
도 6은 외래유전자로서 HGF 유전자를 포함하는 외래유전자 발현용 재조합 발현 구축물을 이용하여 다양한 HCMV 균주 유래의 pHP1, pHP2, pHP3 및 pHP4 간 발현 효율을 비교한 데이터이다.
도 7은 외래유전자로서 SARS-CoV-2 스파이크 유전자를 포함하는 외래유전자 발현용 재조합 발현 구축물을 이용하여 다양한 HCMV 균주 유래의 pHP1, pHP2, pHP3 및 pHP4 간 발현 효율을 비교한 데이터이다.
도 8은 외래유전자로서 SARS-CoV-2 스파이크 RBD(receptor binding domain) 유전자를 포함하는 외래유전자 발현용 재조합 발현 구축물을 이용하여 다양한 HCMV 균주 유래의 pHP1, pHP2, pHP3 및 pHP4 간 발현 효율을 비교한 데이터이다.
도 9는 외래유전자로서 TGF-β 유전자를 포함하는 외래유전자 발현용 재조합 발현 구축물을 이용하여 다양한 HCMV 균주 유래의 pHP1, pHP2, pHP3 및 pHP4 간 발현 효율을 비교한 데이터이다.
도 10은 대조군인 pHP1-IGF1에 비해 pHP3-IGF1에서 IGF-1 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인한 것이다.
도 11은 대조군인 pHP1-IFNβ에 비해 pHP3-IFNβ에서 IFN-β 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인한 것이다.
도 12는 대조군인 pHP1-HGF에 비해 pHP3-HGF에서 HGF 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인한 것이다.
도 13은 PWT를 측정한 결과, 실시예에서 대조군에 비해 통계적으로 유의하게 통증이 개선됨을 확인한 것이다.
도 14는 Rotarod latency test를 수행한 결과, 실시예에서 대조군에 비해 통계적으로 유의하게 운동수행능력 개선이 확인한 것이다.
도 15는 근전도 및 신경전도를 측정한 결과, 실시예에서 대조군에 비해 통계적으로 유의하게 개선됨을 확인한 것이다.
도 16은 PWT를 측정한 결과, 실시예에서 대조군에 비해 통계적으로 유의하게 통증이 개선됨을 확인한 것이다.
도 17은 Rotarod latency test를 수행한 결과, 실시예에서 대조군에 비해 통계적으로 유의하게 운동수행능력이 개선됨을 확인한 것이다.
도 18은 근전도 및 신경전도를 측정한 결과, 실시예에서 대조군에 비해 통계적으로 유의하게 개선됨을 확인한 것이다.
도 19는 실시예에서 대조군에 비해 통계적으로 유의하게 세동맥과 미세혈관수가 증가됨을 확인한 것이다.
이하, 실시 예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
재료 및 방법
유전자
1. 인간 간세포 성장인자(Hepatocyte Growth Factor: HGF)
서열번호 1로 표시되는 인간 간세포 성장인자(HGF)의 유전자(NCBI염기서열 NM_000601.6참고)를 Genscript사(USA)에 의뢰하여 제작하였다. 제작된 유전자를 표 1의 서열번호 2와 3으로 PCR 증폭하여 벡터에 삽입된 유전자를 제작하였다.
2. SARS-CoV-2(2019-nCoV) 스파이크
서열번호 4로 표시되는 SARS-CoV-2 스파이크 유전자는 SinoBiological사에서 판매하는 Spike ORF mammalian expression plasmid (Codon Optimized)를 주형으로 하여 표 1의 서열번호 5와 6으로 1차 PCR을 진행하였고, Signal peptide서열을 추가하기 위해 표 1의 서열번호 7와 8로 2차 PCR로 증폭하여 제작하였다.
3. SARS-CoV-2(2019-nCoV) spike receptor binding domain(RBD)
서열번호 9로 표시되는 SARS-CoV-2 (2019-nCoV) RBD 유전자는 SinoBiological사에서 판매하는 Spike ORF mammalian expression plasmid (Codon Optimized)를 주형으로 하여 표 1의 서열번호 10과 11로 1차 PCR을 진행하였고, Signal peptide서열을 추가하기 위해 표 1의 서열번호 12와 13으로 2차 PCR을 진행하여 증폭하여 제작하였다.
4. 인간 전환 성장인자 베타(Transforming Growth Factor-β: TGF-β)
서열번호 34로 표시되는 인간 전환 성장인자 베타(TGF-β)는 Sino Biological사에서 판매하는 유전자(NCBI 염기서열 NM_000660.4 참고)를 주형으로 하여 표 1의 서열번호 35와 36으로 PCR 증폭하여 벡터에 삽입된 유전자를 제작하였다.
5. 인간 인슐린 유사 성장인자 1(Insulin-like Growth Factor-1: IGF-1)
서열번호 37로 표시되는 인간 인슐린 유사 성장인자 1(IGF-1)의 유전자(NCBI 염기서열 NM_001111283.3 참고)를 바이오닉스사에 의뢰하여 제작하였다. 제작된 유전자를 표 1의 서열번호 38과 39로 PCR 증폭하여 벡터에 삽입된 유전자를 제작하였다.
6. 인간 인터페론 베타(Interferon-β: IFN-β)
서열번호 40으로 표시되는 인간 인터페론 베타(IFN-β)는 Sino Biological사에서 판매하는 유전자(NCBI 염기서열 NM_002176.2 참고)를 주형으로 하여 표 1의 서열번호 41과 42로 PCR 증폭하여 벡터에 삽입된 유전자를 제작하였다.
플라스미드
본 발명에 사용되는 플라스미드는 도 1과 같은 구조를 가지며 각 플라스미드의 자세한 제작방법은 아래와 같다.
1. pVAX1
Addgene사에서 pVAX1-BMP2(Plasmid#137909)를 구매하여 사용하였다.
2. pHP1
Addgene사에서 pEQ276 (Plasmid #83945)를 구매한 후 주형으로 사용하였고 표 1의 서열번호 14와 15로 PCR을 진행하여 Towne strain의 full HCMV 프로모터를 제작하였다. pVAX1 프로모터를 MluI 및 NheI로 잘라낸 후 상기 제작한 프로모터를 동일 제한효소 사이트로 삽입하여 서열번호 21인 pHP1을 제작하였다. pHP1의 벡터맵은 도 2와 같다.
3. pHP2
AD169 strain의 full HCMV 프로모터는 NCBI염기서열 X17403을 참고하여 바이오닉스사에 의뢰하여 제작하였다. pVAX1 프로모터를 MluI 및 NheI로 잘라낸 후 상기 제작한 프로모터를 동일 제한효소 사이트로 삽입하여 서열번호 23인 pHP2를 제작하였다. pHP2의 벡터맵은 도 3과 같다.
4. pHP3
3157 strain의 full HCMV 프로모터는 NCBI염기서열 GQ221974를 참고하여 바이오닉스사에 의뢰하여 제작하였다. pVAX1 프로모터를 MluI 및 NheI로 잘라낸 후 상기 제작한 프로모터를 동일 제한효소 사이트로 삽입하여 서열번호 25인 pHP3를 제작하였다. pHP3의 벡터맵은 도 4와 같다.
5. pHP4
CINCY+Towne fusion strain의 full HCMV 프로모터는 NCBI염기서열 GU980198.1을 참고하여 바이오닉스사에 의뢰하여 제작하였다. pVAX1 프로모터를 MluI 및 NheI로 잘라낸 후 상기 제작한 프로모터를 동일 제한효소 사이트로 삽입하여 서열번호 27인 pHP4를 제작하였다. pHP4의 벡터맵은 도 5와 같다.
상기 제조된 각각의 플라스미드 DNA와 유전자를 표 2에 정리하여 나타내었다.
프라이머명 서열번호 염기서열
HGF(F) 2 GGATCCATGTGGGTGACCAAACTCCTGCCA
HGF(R) 3 GCGGCTCTAGACTATGACTGTGGTACCTTATATGT
Spike-1(F) 5 CTGGTGGCCGCCGCCACACGGGTGCACAGCATGTTTGTGTTCCTGGTGCTGCTG
Spike-1(R) 6 TCTAGATCAGGTGTAGTGCAGTTTCACTCCTTTC
Spike-2(F) 7 CCGGGTACCATGGACTGGACCTGGATCCTGTTCCTGGTGGCCGCCGCCACA
Spike-2(R) 8 CTAGTCTAGATCAGGTGTAGTGCAGTTTCACTCCTTTC
RBD-1(F) 10 CTGGTGGCCGCCGCCACACGGGTGCACAGCCCAAACATCACCAACCTGTGTCCATTTGG
RBD-1(R) 11 CTAGTCTAGATCACTCCAAGGTCTGTGGGTCCCTC
RBD-2(F) 12 CCGGGTACCATGGACTGGACCTGGATCCTGTTCCTGGTGGCCGCCGCCACA
RBD-2(R) 13 CTAGTCTAGATCACTCCAAGGTCTGTGGGTCCCTC
Towne(F) 14 ACGCGTTGACATTGATTATTGACTAGTTATTAATAG
Towne(R) 15 GCTAGCCGTGTCAAGGACGGTGACTGCAGAAAAGAC
TGF-β(F) 35 GCTAGCATGCCGCCCTCCGGGCTGCGGCTGCT
TGF-β(R) 36 TCTAGATCAGCTGCACTTGCAGGAGCGCACGA
IGF-1(F) 38 GCTAGCATGGGAAAAATCAGCAGTCTTCCAAC
IGF-1(R) 39 GCGGCCGCCTACTTGCGTTCTTCAAATGTACTTC
IFN-β(F) 41 GCTAGCATGACCAACAAGTGTCTCCTCC
IFN-β(R) 42 TCTAGATCAGTTTCGGAGGTAACCTGTAAGTCTG
유전자 또는 플라스미드 DNA 서열번호
인간 간세포 성장인자(Hepatocyte Growth Factor: HGF) 1
HGF-X6 16
HGF-X7 17
HGF-X8 18
dHGF(deleted varient of HGF) 19
SARS-CoV-2(2019-nCoV) 스파이크 4
SARS-CoV-2(2019-nCoV) spike receptor binding domain(RBD) 9
Towne strain, AY315197의 full HCMV IE 서열 (1563bp) 20
pHP1 21
AD169 strain, X17403의 full HCMV IE 서열 (1564bp) 22
pHP2 23
3157 strain, GQ221974의 full HCMV IE 서열 (1552bp) 24
pHP3 25
CINCY+Towne fusion, GU980198.1의 full HCMV IE 서열 (1563bp) 26
pHP4 27
네오마이신 / 카나마이신 저항성 유전자 28
hGH pA 29
bGH pA 30
SV40 early pA 31
SV40 late pA 32
인간 전환 성장인자 베타(Transforming Growth Factor-β: TGF-β) 34
인간 인슐린 유사 성장인자 1(Insulin-like Growth Factor-1: IGF-1) 37
인간 인터페론 베타(Interferon-β: IFN-β) 40
유전자를 포함하는 플라스미드 DNA의 제조
상기에서 준비한 유전자 중 HGF와 pHP 플라스미드들을 각각 BamHI과 XbaI 효소로 1시간 동안 절단하고 아가로즈젤에 전기영동하여 절편을 분리하였다. 분리된 절편을 T4 ligase를 이용하여 30분간 ligation하고 E. Coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 BamHI과 XbaI으로 확인하였다.
상기에서 준비한 유전자 중 SARS-CoV2 스파이크 RBD와 pHP 플라스미드들은 각각 KpnI과 ApaI 효소로 1시간 동안 절단하고 아가로즈젤에 전기영동하여 절편을 분리하였다. 분리된 절편을 T4 ligase를 이용하여 30분간 ligation하고 E. Coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 KpnI과 ApaI으로 확인하였다. 클로닝이 완료된 DNA를 가지고 있는 E. Coli supernatant를 200 mL 플라스크 두 병에 kanamycin과 함께 넣고 overnight 배양한 후 maxi prep. Kit(Qiagen, USA)를 이용하여 플라스미드 DNA를 생산하고 세포실험에 사용하였다.
상기에서 준비한 유전자 중 TGF-β와 pHP 플라스미드들을 각각 NheI과 XbaI 효소로 1시간 동안 절단하고 아가로즈젤에 전기영동하여 절편을 분리하였다. 분리된 절편을 T4 ligase를 이용하여 30분간 ligation하고 E. Coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 ScaI과 KpnI으로 확인하였다.
상기에서 준비한 유전자 중 IGF-1과 pHP 플라스미드들을 각각 NheI과 NotI 효소로 1시간 동안 절단하고 아가로즈젤에 전기영동하여 절편을 분리하였다. 분리된 절편을 T4 ligase를 이용하여 30분간 ligation하고 E. Coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 NheI과 NotI으로 확인하였다.
상기에서 준비한 유전자 중 IFN-β와 pHP 플라스미드들을 각각 NheI과 XbaI 효소로 1시간 동안 절단하고 아가로즈젤에 전기영동하여 절편을 분리하였다. 분리된 절편을 T4 ligase를 이용하여 30분간 ligation하고 E. Coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 NheI과 ApaI으로 확인하였다.
실험결과
실험예 1: 세포에서 HGF 단백질 발현량 비교
HGF 유전자가 삽입된 2종의 pHP-HGF 플라스미드 DNA의 발현수준을 세포 내에서 비교하기 위해 fetal bovine serum (SIGMA-ALDRICH사, USA) 10%를 함유하고 있는 DMEM(Dulbecco's modified Eagle's medium) 배지 (SIGMA-ALDRICH사, USA)로 배양된 HEK293 세포(한국세포주은행)를 6 well plate(SPL사, USA)의 각 well당 1×106 개 스프레드한 후 다음날 60 내지 80% 세포수준일 때 각 플라스미드 DNA 3 ㎍를 transfection reagent 200 ㎕ (jetPEI®, polyplus transfection사, USA)를 혼합한 후 30분간 실온에 반응한 뒤 well 모든 면적에 균일하게 나누어 도포하였다. 다음날 FBS를 10% 함유하고 있는 DMEM 배지로 교체한 후 48시간 뒤에 상층액을 collection하여 ELISA kit(R&D systems, USA)를 통해 HGF의 단백질 발현을 측정하였다.
도 6에서 보는 바와 같이 대조군인 pHP1-HGF에 비해 실시예 2인 pHP3-HGF에서 통계적으로 유의하기 HGF 단백질 발현이 증가되는 것을 확인할 수 있었다. 반면, 실시예 1과 3는 대조군에 비해 HGF 단백질 발현이 감소되었다.
실험예 2: 세포에서 Covid-19 스파이크 mRNA 발현량 비교
Covid-19의 스파이크 유전자가 삽입된 4종의 pHP-spike 플라스미드 DNA의 발현수준을 세포 내에서 비교하기 위해 fetal bovine serum (SIGMA-ALDRICH사, USA) 10%를 함유하고 있는 DMEM(Dulbecco's modified Eagle's medium) 배지 (SIGMA-ALDRICH사, USA)로 배양된 HEK293 세포(한국세포주은행)를 6 well plate(SPL사, USA)의 각 well당 1×106 개 스프레드한 후 다음날 60 내지 80% 세포수준일 때 각 플라스미드 DNA 3 ㎍를 transfection reagent 200 ㎕ (jetPEI®, polyplus transfection사, USA)를 혼합한 후 30분간 실온에 반응한 뒤 well 모든 면적에 균일하게 나누어 도포하였다. 다음날 FBS를 10% 함유하고 있는 DMEM 배지로 교체한 후 48시간 뒤에 세포를 collection하여 정량적 PCR법을 통해 스파이크유전자의 mRNA 발현을 측정하였다. Internal control로 GAPDH를 측정하여 값을 보정하였다.
도 7에서 보는 바와 같이 대조군인 pHP1-spike에 비해 실시예 2인 pHP3-spike에서 mRNA 발현이 통계적으로 유의하게 증가되는 것을 확인할 수 있었다. 반면, 실시예 1과 3은 대조군에 비해 mRNA 발현이 감소되었다.
실험예 3: 세포에서 Covid-19 RBD mRNA 발현량 비교
Covid-19의 RBD 유전자가 삽입된 4종의 pHP-RBD 플라스미드 DNA의 발현수준을 세포 내에서 비교하기 위해 fetal bovine serum (SIGMA-ALDRICH사, USA) 10%를 함유하고 있는 DMEM(Dulbecco's modified Eagle's medium) 배지 (SIGMA-ALDRICH사, USA)로 배양된 HEK293 세포(한국세포주은행)를 6 well plate(SPL사, USA)의 각 well당 1×106 개 스프레드한 후 다음날 60 내지 80% 세포수준일 때 각 플라스미드 DNA 3 ㎍를 transfection reagent 200 ㎕ (jetPEI®, polyplus transfection사, USA)를 혼합한 후 30분간 실온에 반응한 뒤 well 모든 면적에 균일하게 나누어 도포하였다. 다음날 FBS를 10% 함유하고 있는 DMEM 배지로 교체한 후 48시간 뒤에 세포를 collection하여 정량적 PCR법을 통해 RBD 유전자의 mRNA 발현을 측정하였다. Internal control로 GAPDH를 측정하여 값을 보정하였다.
도 8에서 보는 바와 같이 대조군인 pHP1-RBD에 비해 실시예 2인 pHP3-RBD에서 mRNA 발현이 통계적으로 유의하게 증가되는 것을 확인할 수 있었다. 반면, 실시예 1과 3은 대조군에 비해 mRNA 발현이 감소되었다.
실험예 4: 세포에서 TGF-β 단백질 발현량 비교
TGF-β 유전자가 삽입된 4종의 pHP-TGFβ 플라스미드 DNA의 발현수준을 세포 내에서 비교하기 위해 fetal bovine serum (SIGMA-ALDRICH사, USA) 10%를 함유하고 있는 DMEM(Dulbecco's modified Eagle's medium) 배지 (SIGMA-ALDRICH사, USA)로 배양된 Raw264.7 세포(ATCC, USA)를 6 well plate(SPL사, USA)의 각 well당 5×105 개 스프레드한 후 다음날 60 내지 80% 세포수준일 때 각 플라스미드 DNA 3 ㎍을 transfection reagent 200 ㎕ (jetPEI®, Polyplus Transfection사, France)와 혼합한 후 30분간 실온에서 반응한 뒤 well의 모든 면적에 균일하게 나누어 도포하였다. 다음날 FBS를 10% 함유하고 있는 DMEM 배지로 교체한 후 48시간 뒤에 상층액을 collection하고 ELISA kit(R&D Systems사, USA)를 통해 TGF-β의 단백질 발현을 측정하였다. 도 9에서 보는 바와 같이 대조군인 pHP1-TGFβ에 비해 실시예 2인 pHP3-TGFβ에서 TGF-β 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인할 수 있었다. 반면, 실시예 1과 3는 대조군에 비해 TGF-β 단백질 발현이 통계적으로 유의한 차이가 없었다.
실험예 5: 세포에서 IGF-1 단백질 발현량 비교
IGF-1 유전자가 삽입된 2종의 pHP-IGF1 플라스미드 DNA의 발현수준을 세포 내에서 비교하기 위해 fetal bovine serum (SIGMA-ALDRICH사, USA) 10%를 함유하고 있는 DMEM(Dulbecco's modified Eagle's medium) 배지 (SIGMA-ALDRICH사, USA)로 배양된 SH-SY5Y 세포(한국세포주은행)를 6 well plate(SPL사, USA)의 각 well당 1×106 개 스프레드한 후 다음날 60 내지 80% 세포수준일 때 각 플라스미드 DNA 3 ㎍을 transfection reagent 200 ㎕ (jetPEI®, Polyplus Transfection사, France)와 혼합한 후 30분간 실온에서 반응한 뒤 well의 모든 면적에 균일하게 나누어 도포하였다. 다음날 FBS를 10% 함유하고 있는 DMEM 배지로 교체한 후 48시간 뒤에 상층액을 collection하고 ELISA kit(R&D Systems사, USA)를 통해 1GF-1의 단백질 발현을 측정하였다. 도 10에서 보는 바와 같이 대조군인 pHP1-IGF1에 비해 실시예인 pHP3-IGF1에서 IGF-1 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인할 수 있었다.
실험예 6: 세포에서 IFN-β 단백질 발현량 비교
IFN-β 유전자가 삽입된 4종의 pHP-IFNβ 플라스미드 DNA의 발현수준을 세포 내에서 비교하기 위해 fetal bovine serum (SIGMA-ALDRICH사, USA) 10%를 함유하고 있는 DMEM(Dulbecco's modified Eagle's medium) 배지 (SIGMA-ALDRICH사, USA)로 배양된 Raw264.7 세포(ATCC, USA)를 6 well plate(SPL사, USA)의 각 well당 1×105 개 스프레드한 후 다음날 60 내지 80% 세포수준일 때 각 플라스미드 DNA 3 ㎍을 transfection reagent 200 ㎕ (jetPEI®, Polyplus Transfection사, France)와 혼합한 후 30분간 실온에서 반응한 뒤 well의 모든 면적에 균일하게 나누어 도포하였다. 다음날 FBS를 10% 함유하고 있는 DMEM 배지로 교체한 후 48시간 뒤에 상층액을 collection하고 ELISA kit(R&D Ssystems사, USA)를 통해 IFN-β의 단백질 발현을 측정하였다. 도 11에서 보는 바와 같이 대조군인 pHP1-IFNβ에 비해 실시예인 pHP3-IFNβ에서 IFN-β 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인할 수 있었다.
실험예 7: 마우스에서 HGF 단백질 발현량 비교
HGF 유전자가 삽입된 pHP1-HGF(대조군)과 pHP3-HGF(실시예) 플라스미드 DNA의 발현수준을 생체 내에서 비교하기 위해 Balb/c 마우스(샘타코바이오코리아)의 하지 장딴지근에 25㎍/25㎕/leg씩 주사하였다. 투여 후 7일째에 마우스를 희생시키고 주사한 부위의 근육을 잘라내었다. 그리고, 상기 잘라낸 각각의 근육들을 액체 질소 및 단백질 추출킷트(Cellbiolabs사, USA)를 이용하여 분쇄한 후, 총단백질을 분리하였다. 분리된 총단백질량은 DC 단백질 분석키트(Bio-Rad Laboratories사, USA)를 이용하여 측정하였다. HGF 단백질 측정을 위해서 동일한 양의 단백질을 사용하여 ELISA kit(R&D Systems사, USA)를 통해 HGF의 단백질 발현을 측정하였다.
도 12에서 보는 바와 같이 대조군인 pHP1-HGF에 비해 실시예인 pHP3-HGF에서 HGF 단백질 발현이 통계적으로 유의하게 증가되는 것을 확인할 수 있었다.
실험예 8: 당뇨병으로 유발된 랫드 peripheral neuropathy 모델에서 pHP3-HGF의 효능 평가
당뇨병성 말초 신경병증(diabetic peripheral neuropathy, DPN)은 당뇨병으로 인해 혈당이 상승하고 이에 따른 미세혈관의 손상으로 인해 말초신경이 손상되면서 임상적으로 통증 이상 등의 증상이 발생하는 허혈성 질환 및 신경 질환의 복합 질환이다. 본 연구에서 사용한 streptozotocin(STZ) induced diabetic peripheral neuropathy가 당뇨병성 말초 신경병증의 대표적인 동물모델이다.
㈜오리엔트바이오에서 구입한 7주령 수컷 Wistar 랫드에 STZ 50mg/kg를 정맥으로 주입하여 1형 당뇨를 유발하였다. STZ 주입 후 4주째에 von Frey test를 실시하여 순위화한 결과에 따라 각군의 평균 필라멘트의 강도가 최대한 균일하게 분포하도록 무작위법으로 분배한 후 군당 7마리씩 2군으로 분리하였다. 이후 대조군으로 생리식염수를 양측 장딴지근마다 각각 4곳에 250㎕씩 총 2mL을 투여하였고, 실시예인 pHP3-HGF 2mg과 microparticles을 섞은 후 투여하였다. 실시예 투여 후 초음파 3MHz를 5분간 적용하였다. 통증에 대한 효능을 평가하기 위해 통증 척도인 paw withdrawal threshold(PWT)를 측정한 결과, 도 13에서 보는 바와 같이 투여 후 3주째부터 실시예에서 대조군에 비해 통계적으로 유의하게 통증이 개선되었고, 이는 시험이 완료되는 6주째까지 유지되었다.
운동수행능력 평가를 위해 Rotarod latency test를 수행한 결과, 도 14에서 보는 바와 같이 투여 후 2주째부터 실시예에서 대조군에 비해 통계적으로 유의하게 운동수행능력 개선이 확인되었고, 이는 시험이 완료되는 6주째까지 유지되었다.
근전도와 신경전도 평가를 위해 Ultium-ESP(NORAXON사, USA)기기를 이용하여 근전도를 MP160(BIOPAC Systems사, USA)기기를 이용하여 신경전도를 측정한 결과, 도 15에서 보는 바와 같이 실시예에서 대조군에 비해 근전도는 투여 후 3주째부터 통계적으로 유의하게 개선되어 시험이 완료되는 6주째까지 유지되었고, 신경전도는 6주째에 통계적으로 유의하게 개선되었다.
실험예 9: 당뇨병으로 유발된 랫드 peripheral neuropathy 모델에서 pHP3-IGF1의 효능 평가
당뇨병성 말초 신경병증(diabetic peripheral neuropathy, DPN)은 당뇨병으로 인해 혈당이 상승하고 이에 따른 미세혈관의 손상으로 인해 말초신경이 손상되면서 임상적으로 통증 이상 등의 증상이 발생하는 허혈성 질환 및 신경 질환의 복합 질환이다. 본 연구에서 사용한 streptozotocin(STZ) induced diabetic peripheral neuropathy가 당뇨병성 말초 신경병증의 대표적인 동물모델이다.
㈜오리엔트바이오에서 구입한 7주령 수컷 Wistar 랫드에 STZ 50mg/kg를 정맥으로 주입하여 1형 당뇨를 유발하였다. STZ 주입 후 4주째에 von Frey test를 실시하여 순위화한 결과에 따라 각군의 평균 필라멘트의 강도가 최대한 균일하게 분포하도록 무작위법으로 분배한 후 군당 7마리씩 2군으로 분리하였다. 이후 대조군으로 생리식염수를 양측 장딴지근마다 각각 4곳에 250㎕씩 총 2mL을 투여하였고, 실시예는 pHP3-IGF1 2mg과 microparticles을 섞은 후 투여하였다. 실시예는 투여 후 초음파 3MHz를 5분간 적용하였다. 통증 척도인 paw withdrawal threshold(PWT)를 측정한 결과, 도 16에서 보는 바와 같이 실시예에서 대조군에 비해 투여 후 2주째부터 통계적으로 유의하게 통증이 개선되었고, 이는 시험이 완료되는 6주째까지 유지되었다.
운동수행능력 평가를 위해 Rotarod latency test를 수행한 결과, 도 17에서 보는 바와 같이 실시예에서 대조군에 비해 투여 후 2주째부터 통계적으로 유의하게 운동수행능력이 개선되었고, 이는 시험이 완료되는 6주째까지 유지되었다.
근전도와 신경전도 평가를 위해 Ultium-ESP(NORAXON사, USA)기기를 이용하여 근전도를 MP160(BIOPAC Systems사, USA)기기를 이용하여 신경전도를 측정한 결과, 도 18에서 보는 바와 같이 실시예에서 대조군에 비해 근전도는 투여 후 5주째부터 통계적으로 유의하게 개선되어 시험이 완료되는 6주째까지 유지되었고, 신경전도는 6주째에 통계적으로 유의하게 개선되었다.
실험예 10: 토끼 중증하지허혈(critical limb ischemia, CLI) 모델에서 pHP3-HGF의 효능 평가
중증하지허혈은 여러 가지 원인으로 인해 혈관의 폐색이 발생함으로써 하지의 혈행장애가 일어나고 이로 인해 근육에 혈액공급이 원활하지 않게 되어 하지말단에 통증 및 궤양이 발생하게 되는 허혈성 질환이다. 본 연구에서 사용한 수술적 대퇴동맥 절단술이 토끼 중증하지허혈의 대표적인 동물모델이다. 동물모델 제작을 위해 한림실험동물에서 구입한 약 3kg의 수컷 New Zealand white rabbit을 마취한 후 좌측 대퇴 피부를 대퇴동맥의 주행방향으로 슬개골로부터 샅굴인대까지 절개하여 대퇴동맥을 노출시킨 후 대퇴동맥의 근위로부터 복재동맥과 슬와동맥의 분기점까지 절제하였다. 출혈여부를 확인한 후 지혈이 완료되면 절개한 근육 근막 및 피부를 봉합하였다. 모델 제작 후 10일째에 C-arm(SIEMENS사, Germany)기기를 이용하여 조영촬영을 실시한 다음, 12일째에 대퇴골과 수직으로 가상선 3개를 그어 그 선을 통과하는 혈관의 수를 세번 측정 후 결과의 평균값으로 순위화하여 5마리씩 2군으로 분리하였다. 이후 대조군으로 생리식염수를 좌측 대퇴부위 4곳에 250㎕씩 총 1mL를 투여하였고, 실시예는 pHP3-HGF 1mg과 microparticles을 섞은 후 투여하였다. 실시예는 투여 후 초음파 3MHz를 5분간 적용하였다. 혈관생성 효능 평가를 위해 42일째에 C-arm을 이용하여 세동맥의 수를 측정하였고, 해당부위의 근육조직에 대한 조직학적분석을 통해 미세혈관을 측정하였다. 그 결과, 도 19에서 보는 바와 같이 실시예에서 대조군에 비해 통계적으로 유의하게 세동맥과 미세혈관수가 증가되었다.
이상의 결과들을 통해 HCMV strain별 프로모터에 따라 발현 효율의 차이가 있으며 pHP3의 기반이 되는 HCMV 3157 strain 프로모터가 세포내와 생체내에서 가장 우수한 발현 효율을 나타내는 것을 확인할 수 있었고, 또한 신경 및 허혈성 질환모델에서 HCMV 3157 strain 프로모터를 포함하는 pHP3의 임상적 효능을 여러 유전자에서 확인할 수 있었다.
이상, 본 발명의 실시예들에 대하여 설명하였으나, 해당 기술 분야에서 통상의 지식을 가진 자라면 특허청구범위에 기재된 본 발명의 사상으로부터 벗어나지 않는 범위 내에서, 구성 요소의 부가, 변경, 삭제 또는 추가 등에 의해 본 발명을 다양하게 수정 및 변경시킬 수 있을 것이며, 이 또한 본 발명의 권리범위 내에 포함된다고 할 것이다.

Claims (29)

  1. 서열번호 24의 서열을 포함하는 재조합 발현 구축물(recombinant expression construct).
  2. 제 1 항에 있어서, 상기 서열번호 24의 서열은 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 (full HCMV IE regulatory and transcribed regions) 서열인 것을 특징으로 하는, 재조합 발현 구축물.
  3. 제 1 항에 있어서, 상기 재조합 발현 구축물은 외래유전자(transgene) 삽입용 멀티 클로닝 사이트(MCS)를 포함하는 것을 특징으로 하는, 재조합 발현 구축물.
  4. 제 1 항에 있어서, 상기 재조합 발현 구축물은 폴리 아데닐화 서열(polyadenylation sequence, pA)을 추가적으로 포함하는 것을 특징으로 하는, 재조합 발현 구축물.
  5. 제 4 항에 있어서, 상기 폴리 아데닐화 서열은 hGH(human growth hormone) pA 서열, bGH(bovine growth hormone) pA 서열, SV40(simian vacuolating virus 40) early pA 서열 및 SV40 late pA 서열로 구성된 군으로부터 선택되는 것을 특징으로 하는, 재조합 발현 구축물.
  6. 제 5 항에 있어서, 상기 폴리 아데닐화 서열은 서열번호 30 내지 33으로 구성된 군으로부터 선택되는 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는, 재조합 발현 구축물.
  7. 제 1 항에 있어서, 상기 재조합 발현 구축물은 항생제 저항성 유전자 (antibiotic resistance gene)을 추가적으로 포함하는 것을 특징으로 하는, 재조합 발현 구축물.
  8. 제 7 항에 있어서, 상기 항생제 저항성 유전자는 엠피실린 (Ampicillin), 카나마이신 (Kanamycin), 네오마이신 (Neomycin), 클로람페니콜 (Chloramphenicol), 젠타마이신 (Gentamycin), 스트렙토마이신 (Streptomycin), 테트라사이클린 (Tetracycline), 에리스로마이신 (Erythromycin), 반코마이신 (Vancomycin), 페니실린 (Penicillin), 스펙티노마이신 (Spectinomycin), 클로람페니콜 (Chloramphenicol), 설파디아자인 (Sulfaciazine) 및 트리메소프림 (Trimethoprim) 저항성 유전자로 구성된 군으로부터 선택되는 것을 특징으로 하는, 재조합 발현 구축물.
  9. 제 8 항에 있어서, 상기 항생제 저항성 유전자는 서열번호 28 또는 29의 서열을 포함하는 것을 특징으로 하는, 재조합 발현 구축물.
  10. 제 1 항에 있어서, 상기 재조합 발현 구축물은 도 4의 개열지도를 갖는 것을 특징으로 하는, 재조합 발현 구축물.
  11. 하기의 구성을 포함하는 외래유전자(transgene) 발현용 재조합 발현 구축물(recombinant expression construct)로서, 상기 외래유전자는 숙주세포에서 전사 및 번역될 수 있는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물:
    (a) 외래유전자(transgene); 및
    (b) 상기 외래유전자에 작동적으로 연결된(operably linked) 조절 및 전사부위 (regulatory and transcribed regions)로서, 상기 조절 및 전사부위는 서열번호 24의 서열을 포함함.
  12. 제 11 항에 있어서, 상기 서열번호 24의 서열은 HCMV 3157 균주의 전장 HCMV IE 조절 및 전사부위 (full HCMV IE regulatory and transcribed regions) 서열인 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  13. 제 12 항에 있어서, 상기 외래유전자 발현용 재조합 발현 구축물은 서열번호 20의 HCMV Towne 균주의 전장 HCMV IE 조절 및 전사부위 서열, 서열번호 22의 HCMV AD169 균주의 전장 HCMV IE 조절 및 전사부위 서열 및 서열번호 26의 HCMV CINCY 및 Towne 균주의 전장 HCMV IE 조절 및 전사부위 서열로 구성된 군으로부터 선택되는 조절 및 전사부위가 삽입된 경우와 비교하여 외래유전자(transgene)의 발현이 증가된 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  14. 제 11 항에 있어서, 상기 외래유전자는 HGF 또는 이의 변이체 유전자, SARS-CoV-2 스파이크 유전자, SARS-CoV-2 스파이크 RBD(receptor binding domain) 유전자, TGF-β 유전자, IGF-1 유전자 또는 IFN-β 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  15. 제 14 항에 있어서, 상기 HGF 또는 이의 변이체 유전자는 서열번호 1, 서열번호 16 내지 19로 구성된 군으로부터 선택되는 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  16. 제 14 항에 있어서, 상기 SARS-CoV-2 스파이크 유전자는 서열번호 4의 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  17. 제 14 항에 있어서, 상기 SARS-CoV-2 스파이크 RBD 유전자는 서열번호 9의 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  18. 제 14 항에 있어서, 상기 TGF-β 유전자는 서열번호 34의 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  19. 제 14 항에 있어서, 상기 IGF-1 유전자는 서열번호 37의 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  20. 제 14 항에 있어서, 상기 IFN-β 유전자는 서열번호 40의 유전자를 포함하는 것을 특징으로 하는, 외래유전자 발현용 재조합 발현 구축물.
  21. 제 1 항의 재조합 발현 구축물 또는 제 11 항의 외래유전자 발현용 재조합 발현 구축물로 형질도입(transduction)된 숙주세포.
  22. pVAX1 벡터에 서열번호 24의 서열을 삽입하는 단계를 포함하는, 재조합 발현 구축물의 제조방법.
  23. 제 22 항에 있어서, 상기 제조방법은 상기 재조합 발현 구축물에 외래유전자(transgene)를 삽입하는 단계를 추가적으로 포함하는, 재조합 발현 구축물의 제조방법.
  24. 제 1 항의 재조합 발현 구축물에 외래유전자(transgene)를 삽입하는 단계를 포함하는, 외래유전자 발현용 재조합 발현 구축물의 제조방법.
  25. 제 11 항의 외래유전자 발현용 재조합 발현 구축물의 치료 용도(for use in therapy).
  26. 제 11 항의 외래유전자 발현용 재조합 발현 구축물을 이를 필요로 하는 대상(subject)에게 치료학적 유효량을 투여하는 단계를 포함하는, 외래유전자의 발현 방법.
  27. 약제학적 유효량의 제 11 항의 외래유전자 발현용 재조합 발현 구축물 및 약제학적으로 허용가능한 담체를 포함하는 약제학적 조성물.
  28. 제 27 항에 있어서, 상기 약제학적 조성물은 심혈관 질환, 당뇨, 알츠하이머, 폐 질환, 암 질환, 자가면역 질환, 감염 질환, 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약제학적 조성물인 것을 특징으로 하는, 약제학적 조성물.
  29. 제 27 항에 있어서, 상기 약제학적 조성물은 코로나바이러스 질환의 예방 또는 치료용 약제학적 조성물인 것을 특징으로 하는, 약제학적 조성물.
PCT/KR2022/015063 2021-10-06 2022-10-06 최적의 재조합 발현 구축물의 개발 WO2023059112A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US17/495,233 US20230212603A1 (en) 2021-10-06 2021-10-06 Development of optimized recombinant expression construct
US17/495,233 2021-10-06
KR1020210143683A KR20230049515A (ko) 2021-10-06 2021-10-26 최적의 재조합 발현 구축물의 개발
KR10-2021-0143683 2021-10-26

Publications (1)

Publication Number Publication Date
WO2023059112A1 true WO2023059112A1 (ko) 2023-04-13

Family

ID=85804524

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/015063 WO2023059112A1 (ko) 2021-10-06 2022-10-06 최적의 재조합 발현 구축물의 개발

Country Status (1)

Country Link
WO (1) WO2023059112A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5591639A (en) * 1987-07-23 1997-01-07 Celltech Ltd Recombinant DNA expression vectors
KR101302904B1 (ko) * 2005-04-22 2013-09-06 론자 바이올로직스 피엘씨 ｈＣＭＶ 주요 즉각 조기 유전자의 제 1 인트론 및ｍＣＭＶ 프로모터를 포함한 포유동물 발현 벡터
US20160114027A1 (en) * 2010-05-14 2016-04-28 Oregon Health & Science University Recombinant hcmv and rhcmv vectors and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5591639A (en) * 1987-07-23 1997-01-07 Celltech Ltd Recombinant DNA expression vectors
KR101302904B1 (ko) * 2005-04-22 2013-09-06 론자 바이올로직스 피엘씨 ｈＣＭＶ 주요 즉각 조기 유전자의 제 1 인트론 및ｍＣＭＶ 프로모터를 포함한 포유동물 발현 벡터
US20160114027A1 (en) * 2010-05-14 2016-04-28 Oregon Health & Science University Recombinant hcmv and rhcmv vectors and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHAPMAN B. S., ET AL.: "EFFECT OF INTRON A FROM HUMAN CYTOMEGALOVIRUS (TOWNE) IMMEDIATE- EARLY GENE ON HETEROLOGOUS EXPRESSION IN MAMMALIAN CELLS.", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 19., no. 14., 25 July 1991 (1991-07-25), GB , pages 3979 - 3986., XP000569788, ISSN: 0305-1048 *
DATABASE Nucleotide 9 May 2013 (2013-05-09), "Human herpesvirus 5 strain 3157, complete genome", XP093055672, retrieved from ncbi Database accession no. GQ221974.1 *

Similar Documents

Publication Publication Date Title
WO2016200219A1 (en) Modified interleukin-7 protein and uses thereof
WO2010041913A9 (ko) Grs 단백질 또는 이의 단편의 신규한 용도
WO2013169077A1 (ko) 악액질 예방 또는 치료용 조성물
WO2016108654A1 (ko) Glp 및 면역글로불린 하이브리드 fc 융합 폴리펩타이드 및 이의 용도
WO2019066586A1 (ko) 글루카곤 유사 펩타이드-2(glp-2) 유도체의 지속형 결합체
WO2018088838A1 (en) Pharmaceutical composition for preventing or treating hepatitis, hepatic fibrosis, and hepatic cirrhosis comprising fusion proteins
WO2021096275A1 (ko) 변형된 인터루킨-7 및 tgf 베타 수용체 ii를 포함하는 융합단백질 및 이의 용도
AU2015372767B2 (en) Glucagon derivatives
WO2018174668A2 (ko) 인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도
WO2018088813A2 (ko) Nkx3.2 단편 및 이를 유효성분으로 포함하는 약학 조성물
WO2023059112A1 (ko) 최적의 재조합 발현 구축물의 개발
WO2019147036A1 (ko) 뇌유래-신경영양인자를 발현하는 중간엽줄기세포 및 이의 용도
WO2019143201A1 (ko) 재조합 백시니아 바이러스 및 이를 포함하는 약학 조성물
WO2019156540A1 (ko) 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물
WO2018080277A1 (ko) 통증 완화 또는 치료용 조성물
WO2022010319A1 (ko) 글루카곤-유사 펩타이드-1 및 인터루킨-1 수용체 길항제를 포함하는 융합단백질 및 이의 용도
WO2018004294A9 (ko) 인간 성장호르몬 변이 단백질 또는 이의 트랜스페린 융합 단백질을 유효성분으로 포함하는 약학적 조성물
WO2022211454A1 (ko) 샤르코-마리-투스병 예방 또는 치료용 약제학적 조성물
WO2023204693A1 (ko) 타겟 조직의 크기 또는 부피 축소용 조성물 또는 이를 포함하는 키트
WO2023085882A1 (ko) 코로나바이러스 감염성 질환의 치료 또는 예방을 위한 인터루킨-7 융합단백질의 투여 요법
WO2016099091A1 (ko) 페길화된 vegf 트랩 및 이의 제조방법
WO2022235140A1 (ko) 단일사슬항체조각 및 페리틴의 융합단백질을 포함하는 나노입자 및 이의 용도
WO2022114810A1 (ko) 프로그래뉼린 단백질 또는 이의 활성 단편을 유효성분으로 포함하는 섬유화 질환 예방 또는 치료용 약학 조성물
WO2021080400A1 (ko) 미나리 유래 폴리펩티드 및 상기 폴리펩티드를 포함하는 약학적 조성물
WO2023249439A1 (ko) TGF-β 신호전달을 억제할 수 있는 신규한 펩타이드 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22878933

Country of ref document: EP

Kind code of ref document: A1