WO2018174668A2 - 인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도 - Google Patents

인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도 Download PDF

Info

Publication number
WO2018174668A2
WO2018174668A2 PCT/KR2018/003489 KR2018003489W WO2018174668A2 WO 2018174668 A2 WO2018174668 A2 WO 2018174668A2 KR 2018003489 W KR2018003489 W KR 2018003489W WO 2018174668 A2 WO2018174668 A2 WO 2018174668A2
Authority
WO
WIPO (PCT)
Prior art keywords
tyrosine
formula
xaa16
insulin
serine
Prior art date
Application number
PCT/KR2018/003489
Other languages
English (en)
French (fr)
Other versions
WO2018174668A3 (ko
Inventor
박영진
최인영
정성엽
권세창
Original Assignee
한미약품 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2019011297A priority Critical patent/MX2019011297A/es
Priority to CA3054899A priority patent/CA3054899A1/en
Priority to AU2018239037A priority patent/AU2018239037B2/en
Priority to EP18772695.5A priority patent/EP3604328A4/en
Priority to JP2019552181A priority patent/JP2020511513A/ja
Priority to CN201880026742.8A priority patent/CN110536899B/zh
Application filed by 한미약품 주식회사 filed Critical 한미약품 주식회사
Priority to RU2019131593A priority patent/RU2779462C2/ru
Priority to BR112019019823A priority patent/BR112019019823A2/pt
Priority to US16/495,884 priority patent/US11752216B2/en
Publication of WO2018174668A2 publication Critical patent/WO2018174668A2/ko
Publication of WO2018174668A3 publication Critical patent/WO2018174668A3/ko
Priority to JP2022205798A priority patent/JP2023024674A/ja

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6883—Polymer-drug antibody conjugates, e.g. mitomycin-dextran-Ab; DNA-polylysine-antibody complex or conjugate used for therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/62—Insulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to insulin analogue conjugates and their use.
  • Proteins in vivo are known to be removed through several pathways, such as being degraded by proteolytic enzymes in the blood, excreted through the kidneys or removed by receptors. Thus, many attempts have been made to avoid such protein removal mechanisms and increase the half-life of physiologically active proteins to increase the therapeutic efficacy.
  • insulin is a blood glucose control hormone secreted by the human pancreas, and transfers excess glucose in the blood to cells to supply energy sources to the cells and to maintain blood sugar at normal levels.
  • insulin may not function normally due to the lack of insulin or insulin resistance and the loss of beta cell function.
  • diabetics cannot use glucose in the blood as an energy source and have high glucose levels in the blood, resulting in the discharge of glucose into the urine, which causes various complications. Therefore, diabetic patients with abnormal insulin production (Type I) or insulin resistance (Type II) need insulin treatment, and insulin administration can control blood glucose to normal levels.
  • RMC receptor mediated clearance
  • J Pharmacol Exp Ther (1998) 286: 959, Diabetes Care (1990) 13: 923, and Diabetes (1990) 39: 1033, etc., reported that blood levels are increased by attenuating in-vitro activity to avoid RMC of insulin.
  • the suggested insulin analogues substituted two or more amino acids or did not give specific results.
  • the insulin analogues are reported to have no change in receptor binding capacity or to decrease activity by substituting amino acids directly involved in the insulin receptor.
  • One object of the present invention is to provide a conjugate of insulin analogues.
  • Another object of the present invention is to provide a polynucleotide encoding the conjugate, a vector comprising the polynucleotide, and a transformant comprising the polynucleotide or a vector comprising the same.
  • Another object of the present invention is to provide a method for preparing the conjugate.
  • Still another object of the present invention is to provide a long-acting formulation containing an analogue of the insulin analogue, which has increased in vivo persistence and / or stability compared to a conjugate of natural insulin.
  • Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating insulin-related diseases such as diabetes, including a conjugate of the insulin analogues.
  • Another object of the present invention is to provide a use of the conjugate of the insulin analog in the manufacture of a medicament.
  • Another object of the present invention is to provide the use of a conjugate of said insulin analogues in the treatment of insulin-related diseases, in particular diabetes.
  • One aspect of the present invention for solving the above problems is a conjugate of the insulin analogue.
  • one embodiment of the present invention is a conjugate represented by the following general formula (1):
  • X is a variation of one or more amino acids selected from the group consisting of 16 amino acids of the native insulin B-chain, 25 amino acids of the B-chain, 14 amino acids of the A-chain and 19 amino acids of the A-chain Is an insulin analogue;
  • L is a linker
  • a is 0 or a natural number, provided that L is independent of each other when a is 2 or more;
  • F is a substance that can increase the half-life of X.
  • X is a mutation of tyrosine, amino acid 16 of the native insulin B-chain, into glutamic acid, serine, threonine, or aspartic acid; Mutation of phenylalanine, amino acid amino acid 25 of the native insulin B-chain, into aspartic acid or glutamic acid; Mutation of tyrosine, amino acid 14 of the native insulin A-chain, into histidine, lysine, alanine, or aspartic acid; And one or more mutations selected from the group consisting of mutations in glutamic acid, serine, or threonine of amino acid amino acid 19 of the natural insulin A-chain.
  • X is an insulin analog including all combinations of the A-chain of SEQ ID NO: 55 represented by the following Formula 2 and the B-chain of SEQ ID NO: 56 represented by the following Formula 3, Except for the type insulin, i.e., the A-chain is identical to SEQ ID NO: 53 and at the same time B-chain SEQ ID NO: 54 is characterized by excluding the peptide.
  • Xaa1 is alanine, glycine, glutamine, histidine, glutamic acid or asparagine,
  • Xaa5 is alanine, glutamic acid, glutamine, histidine or asparagine,
  • Xaa12 is alanine, serine, glutamine, glutamic acid, histidine or asparagine,
  • Xaa14 is tyrosine, histidine, lysine, alanine or aspartic acid,
  • Xaa16 is alanine, leucine, tyrosine, histidine, glutamic acid or asparagine,
  • Xaa19 is tyrosine, glutamic acid, serine, or threonine
  • Xaa21 is asparagine, glycine, histidine, or alanine.
  • Xaa16 is tyrosine, glutamic acid, serine, threonine, or aspartic acid,
  • Xaa25 is phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 is threonine or absent
  • Xaa28 is proline, glutamic acid, or aspartic acid, or absent.
  • X is an insulin analogue comprising an A-chain of SEQ ID NO: 55 and a B-chain of SEQ ID NO: 54 represented by Formula 2 above.
  • X is an insulin analogue including the A-chain of SEQ ID NO: 53 and the B-chain of SEQ ID NO: 56 represented by Formula 3.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • histidine lysine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • glutamic acid serine
  • threonine and Xaa21 is asparagine
  • Xaa16 is tyrosine, glutamic acid, serine, threonine, or aspartic acid
  • Xaa25 is phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • glutamic acid or serine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine, glutamic acid, serine, or aspartic acid
  • Xaa25 is phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is histidine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is lysine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is glutamic acid
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is serine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is threonine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is glutamic acid
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is serine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is threonine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is alanine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is aspartic acid
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is aspartic acid
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is aspartic acid
  • Xaa27 is threonine
  • Xaa28 is proline
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is glutamic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • X is an insulin analogue comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, and 52 It is characterized by.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is glutamic acid
  • Xaa21 is asparagine
  • Formula 3 above Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is serine
  • Xaa21 is asparagine
  • Formula 3 above Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is threonine
  • Xaa21 is asparagine
  • Formula 3 above Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is aspartic acid
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is Tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is aspartic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Formula 3 above Xaa16 is tyrosine
  • Xaa25 is glutamic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • the F is a polymer, fatty acid, cholesterol, albumin and fragments thereof, albumin binding material, polymer of repeating unit of a specific amino acid sequence, antibody, antibody fragment, FcRn binding material, in vivo connective tissue, nucleotide, five Ronectin, transferrin (Transferrin), saccharides (saccharides), heparin, and characterized in that it is selected from the group consisting of elastin.
  • the polymer is polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylated polyol, polyvinyl alcohol, polysaccharide, dextran, polyvinyl ethyl ether, biodegradable polymer, Lipid polymer, chitin, hyaluronic acid, oligonucleotide, and combinations thereof.
  • the F is an immunoglobulin Fc region.
  • the F is an IgG Fc region.
  • the L is selected from the group consisting of peptides, fatty acids, saccharides (saccharides), high molecular polymers, low molecular weight compounds, nucleotides, and combinations thereof.
  • the polymer is polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylated polyol, polyvinyl alcohol, polysaccharide, dextran, polyvinyl ethyl ether, biodegradable polymer, Lipid polymer, chitin, hyaluronic acid, oligonucleotide, and combinations thereof.
  • L is polyethylene glycol
  • the high molecular polymer is characterized by having a molecular weight of 1 to 100 kDa.
  • the linker is linked to the N-terminus of the B-chain or the lysine residue in the insulin analogue of the insulin analogue.
  • the F is an immunoglobulin Fc region, and a linker is linked to the N-terminus of the immunoglobulin Fc region.
  • the F is an immunoglobulin Fc region
  • the conjugate is characterized in that both ends of the linker are connected to the N-terminus of the B-chain of the insulin analogue and the N-terminus of the immunoglobulin Fc, respectively.
  • the insulin analogue is characterized in that the binding force to the natural insulin receptor compared to the natural insulin.
  • the binding force of the insulin analogue to the native insulin receptor is about 10% to about 90% of the native insulin.
  • the conjugate is characterized in that F is an immunoglobulin Fc region, L is polyethyleneglycol, and the binding force to a native insulin receptor is 0.1% to 50% of native insulin.
  • the conjugate is an insulin analogue identical in sequence to native insulin except that F is an immunoglobulin Fc region, L is polyethylene glycol and X is A-chain 14 amino acid aspartic acid.
  • Another embodiment embodying the present invention is a polynucleotide encoding the conjugate, a vector comprising the polynucleotide, and a transformant comprising the polynucleotide or a vector comprising the same.
  • Another embodiment embodying the present invention is a method of preparing the conjugate.
  • composition comprising said combination.
  • the composition is characterized in that the pharmaceutical composition.
  • composition is characterized in that the pharmaceutical composition for the prevention or treatment of insulin-related diseases.
  • composition is characterized in that the pharmaceutical composition for the prevention or treatment of diabetes.
  • Another aspect for embodying the present invention is a sustained preparation which has enhanced in vivo persistence and / or stability compared to a conjugate of native insulin, comprising a conjugate of said insulin analogues.
  • Another aspect for practicing the present invention is a method of treating an insulin related disease comprising administering to a subject in need thereof a conjugate of the insulin analogue or a composition thereof.
  • the insulin related disease is diabetes.
  • Another aspect for implementing the present invention is the use of a conjugate of said insulin analog in the manufacture of a medicament.
  • the medicament is characterized in that for the prevention or treatment of insulin-related diseases.
  • the medicament is characterized in that it is for the prevention or treatment of diabetes.
  • Another aspect for implementing the present invention is the use of a conjugate of said insulin analogues in the treatment of insulin related diseases, in particular diabetes.
  • the conjugate of the non-natural insulin analogue according to the present invention can increase the convenience of patients in need of insulin administration.
  • FIG. 1 is a diagram showing the results of analyzing the purity of the insulin analogue protein electrophoresis. Representative results of analogues 9, 10, 11, and 12 analogue.
  • Lane 1 section size marker
  • lane 2 native insulin
  • lane 3 insulin analogue 9
  • lane 4 insulin analogue 10
  • lane 5 insulin analogue 11
  • lane 6 Insulin analogue no.12
  • FIGS. 2A to 2D show the results of high pressure chromatography analyzing the purity of the insulin analogue. Representative results for the analog analog 9, 10, 11, 12 analogues are shown in sequence (Figs. 2a to 2d). In each figure, RP-HPLC (C18), RP-HPLC (C4) and SE-HPLC results are shown in turn from above.
  • Figures 3a to 3c shows the normal pharmacokinetic properties between the "insulin analog 10-PEG-immunoglobulin Fc", a representative insulin analogue conjugate according to the present invention, and the "natural insulin-PEG-immunoglobulin Fc" conjugate, a native insulin conjugate (FIG. 3A), SD rats (FIG. 3B), and beagle dogs (FIG. 3C) show the results of comparison.
  • FIG. 4 shows DIO / STZ rat ability to lower blood sugar levels between insulin analog 10-PEG-immunoglobulin Fc, a typical insulin analogue conjugate, and natural insulin-PEG-immunoglobulin Fc, a native insulin conjugate. It shows the result confirmed in.
  • One aspect for implementing the present invention provides a combination of insulin analogs.
  • the conjugate of the insulin analogue may be in the form of a conjugate in which the insulin analogue is combined with a biocompatible material for increasing its in vivo half-life.
  • the biocompatible material may be mixed with a carrier.
  • the conjugate of the insulin analog may exhibit increased persistence of the potency compared to the insulin analog to which the carrier is not bound, and in the present invention, such a conjugate is referred to as a "persistent conjugate".
  • the present invention provides a binder represented by the following formula (1):
  • X is a variation of one or more amino acids selected from the group consisting of 16 amino acids of the native insulin B-chain, 25 amino acids of the B-chain, 14 amino acids of the A-chain and 19 amino acids of the A-chain Is an insulin analogue;
  • L is a linker
  • a is 0 or a natural number, provided that L is independent of each other when a is 2 or more;
  • F is a substance that can increase the half-life of X.
  • insulin analog refers to non-natural insulin that is different from native insulin.
  • the insulin analogue includes non-natural human insulin that is different from native human insulin.
  • the insulin analogue is a moiety moeity constituting the conjugate of the present invention, and corresponds to X in the formula (1).
  • Such insulin analogues include analogs in which some amino acids of native insulin are modified in the form of additions, deletions or substitutions.
  • the insulin analogue of the present invention is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, when comparing sequence identity with a native insulin sequence, At least 91%, at least 92%, at least 93%, at least 94%, or at least 95%.
  • the insulin analogue of the present invention may have a lower binding force to the native insulin receptor as compared with the native insulin sequence, while having the sequence identity with the native insulin sequence.
  • the insulin analogue may be capable of retaining glucose like natural insulin and / or retain the ability to lower blood glucose in vivo.
  • the binding force of any insulin analogue to the native insulin receptor means that the binding of any detector ligand to the native insulin receptor is inhibited in the presence of native insulin or the corresponding insulin analogue.
  • the inhibition of binding means the percentage of binding inhibition that is expressed by native insulin and the inhibition of binding of the insulin analogue.
  • the degree of binding inhibition may be indirectly defined as a value measured whether the signal expressed by the ligand binding of the insulin receptor effectively changes according to an appropriate standard. For example, when insulin labeled with a label, such as a radioisotope, binds to the insulin receptor, the signal generated from the label decreases or increases after the addition of the unlabeled native insulin or insulin analog, respectively.
  • the binding force can be defined by the percentage of the measured value obtained by measuring the IC 50 value for reducing the signal of the native insulin or insulin analogue (for example, the percentage of the IC 50 of the native insulin to the IC 50 of the corresponding insulin analogue). have.
  • Receptor binding capacity measurement through such competitive inhibition is well known in the art.
  • the native insulin receptor required for such a measurement includes a cell membrane expressing a human native insulin receptor (A isoform or B isoform or both), for example, human native form through genetic engineering methods. Cell membranes of cells engineered to overexpress the insulin receptor can be used, and as the detector ligand, natural type insulin labeled with iodine-125 can be used.
  • scintillation proximity assay SPA
  • the binding force to the insulin receptor can be measured by the method of Experimental Example 1.
  • the insulin analog of the present invention is about 99% or less, about 95% or less, about 90% or less, about 85% or more compared to the insulin receptor binding capacity (100%) of native insulin About 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less , About 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, About 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4% or less, about Binding to an insulin receptor of 3% or less, about 2% or less, about 1% or less, or about 0.1% or less.
  • the binding force of the insulin analogue to the natural insulin receptor is suitably about 10% to about 90% of the native insulin, but the value thereof is not limited. Belongs to the category. If the binding force is weaker than the natural insulin, the insulin analogues by the insulin receptors are weakened, thereby improving blood half-life and expecting a sustained effect.
  • the insulin analogue conjugate has a linker of polyethyleneglycol, an agent capable of increasing half-life is an immunoglobulin Fc region, and an avidity of about 99% or less of native insulin, About 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25 % Or less, about 20% or less, about 15% or less, about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% Or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, about 1% or less, or about 0.1% or less of the binding force to the insulin receptor (but the insulin analogue conjugate of the present invention does not correspond to 0% binding force to the insulin receptor).
  • the binding force of the insulin analogue conjugate to the natural insulin receptor is suitably 0.1 to 50% of the natural insulin, but its value is not limited. Belong. If the binding force is weaker than the natural insulin, the removal of the insulin analogue conjugate by the insulin receptor is weakened, thereby improving the blood half-life and expecting the lasting effect.
  • the term "about” includes all of the values of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, and the like, and includes all values in the range equivalent to or similar to those following the term about, It is not limited.
  • the insulin analogue of the present invention may retain glucose absorption ability as natural insulin.
  • the insulin analogue according to the present invention is about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 55% or more relative to the glucose absorption capacity (100%) of natural insulin , About 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 100% or more, about 110% or more At least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% It may be.
  • Determination of glucose uptake can be accomplished using various methods of measuring glucose uptake.
  • the insulin analogue is a single chain in which two sequence sites respectively corresponding to the native A chain and B chain are linked in one polypeptide chain, or two polypeptides each consisting of independent polypeptide chains. It may be in the form of a chain.
  • the insulin analogue refers not only to its constituent A-chain or B-chain when the two polypeptide chain forms, but also when the analog is in the short-chain form. It is to be interpreted as appropriate in the sense that the sequence portion corresponding to the native type A-chain or the sequence portion corresponding to the native type B-chain in the single-chain polypeptide, respectively.
  • the insulin analogue of the present invention is a single or two polypeptide chain which is a combination of one selected from the A-chain of a native insulin or a polypeptide corresponding thereto and one chain selected from the B-chain of a native insulin or a polypeptide corresponding thereto. It may be in the form.
  • the present invention is not limited thereto, and may be easily understood by those skilled in the art by comparing the sequences constituting the polypeptide with the sequences of the A-chain or B-chain of the native insulin.
  • Natural insulin is a hormone secreted by the pancreas and generally regulates blood glucose in the body by promoting glucose uptake in cells and inhibiting breakdown of fat.
  • Insulin is processed in the form of a proinsulin precursor that has no glycemic control function and becomes insulin having glycemic control function.
  • Insulin consists of two polypeptide chains, A-chain and B-chain, each comprising 21 and 30 amino acid residues, which are interconnected by two disulfide bridges.
  • the A- and B-chains of native insulin comprise the amino acid sequences represented by SEQ ID NOs: 53 and 54, respectively.
  • the insulin analogue described herein may be one that has reduced receptor binding capacity while retaining blood glucose control functions in vivo like native insulin. More specifically, the insulin analogue may retain the ability to lower blood glucose in vivo.
  • the insulin analogue may be not particularly limited in kind and size as long as it can exhibit low receptor-mediated internalization or receptor-mediated clearance. Accordingly, the insulin analog of the present invention may exhibit increased blood half-life compared to native insulin.
  • Insulin analogs of the present invention include reverse insulin, derivatives of native insulin, fragments of native insulin, and the like. Such insulin analogues may be prepared not only by genetic recombination but also by solid phase method, but are not limited thereto.
  • derived derivative of natural insulin refers to a peptide having one or more differences in amino acid sequence compared to a native insulin, a peptide in which a native insulin sequence is modified through modification, and a living body such as natural insulin. And mimics of native insulin that modulate blood glucose control functions within. Derivatives of such natural insulin may be one having a blood glucose control function in vivo.
  • derivatives of native insulin may modify some amino acids in native insulin through any one of substitution, addition, removal and modification, or a combination of these methods. have.
  • the A- and B-chains of native insulin may each be homologous in at least 80% or more amino acid sequence and / or some groups of amino acid residues of insulin may be chemically substituted (eg, alpha-methylation). , alpha-hydroxylation), removed (eg, deamination), or modified (eg, N-methylation) forms, but is not limited thereto.
  • Combinations of the various methods for the preparation of derivatives can be used to prepare derivatives of native insulin to which the present invention is applied.
  • modifications for the preparation of derivatives of native insulin include modifications with L- or D-type amino acids, and / or non-natural amino acids; And / or modifying by native or post-translational modification (eg, methylation, acylation, ubiquitination, intramolecular covalent bonds, etc.).
  • derivatives of native insulin include both those in which one or more amino acids are added at the amino and / or carboxy terminus of the native insulin.
  • the substituted or added amino acids may use at least 20 amino acids commonly found in human proteins, as well as atypical or non-naturally occurring amino acids.
  • Commercial sources of atypical amino acids include Sigma-Aldrich, ChemPep and Genzyme pharmaceuticals. Peptides and formal peptide sequences containing these amino acids can be synthesized and purchased through commercial peptide synthesis companies, for example, American peptide company or Bachem of the United States, or Anygen of Korea, but is not particularly limited thereto.
  • fragment of natural insulin or derivative of natural insulin refers to a form in which one or more amino acids are removed at the amino terminus or carboxy terminus of a native insulin or derivative of natural insulin. Such insulin fragments may retain glycemic control in the body.
  • insulin analogue of the present invention may be prepared by using each of the production methods used in the preparation of the derivatives and fragments of the native insulin independently or in combination.
  • the insulin analogue according to the present invention includes a modification of specific amino acid residues in the A-chain and B-chain of the native insulin as described above. Specifically, specific amino acid residues of the A-chain of the native insulin And / or may be modified specific amino acid residues of the B-chain.
  • the insulin analogue is one or more selected from the group consisting of 16 amino acids of the natural insulin B-chain, 25 amino acids of the B-chain, 14 amino acids of the A-chain, and 19 amino acids of the A-chain
  • the amino acid may be substituted with another amino acid, for example, but may be substituted with glutamic acid, serine, threonine, aspartic acid, histidine, lysine, or alanine, but is not limited thereto.
  • At least one, at least two, at least three, or four of the amino acids described above may be substituted with an amino acid other than the original amino acid.
  • the mutation is a mutation of tyrosine, amino acid 16 of the insulin B-chain, into glutamic acid, serine, threonine, or aspartic acid; Mutation of the phenylalanine amino acid 25 of the insulin B-chain to aspartic acid or glutamic acid; Mutation of tyrosine, amino acid 14 of the insulin A-chain, into histidine, lysine, alanine, or aspartic acid; Or a mutation of tyrosine, amino acid 19 of the insulin A-chain, into glutamic acid, serine, or threonine.
  • the insulin analogue may include a mutation of tyrosine, amino acid 16 of the native insulin B-chain, into glutamic acid, serine, threonine, or aspartic acid; And / or mutation of phenylalanine, amino acid amino acid 25 of the native insulin B-chain, into aspartic acid or glutamic acid; And / or mutation of tyrosine, amino acid 14 of the native insulin A-chain, to histidine, lysine, alanine, or aspartic acid; And / or a mutation of tyrosine, amino acid 19 of the native insulin A-chain, into glutamic acid, serine, or threonine.
  • the insulin analogue may be an insulin analogue including the A-chain of SEQ ID NO: 55 represented by the following Formula 2 and the B-chain of SEQ ID NO: 56 represented by the following Formula 3.
  • Such insulin analogues may be in the form of A-chain and B-chain sequences interconnected by disulfide bonds, or in the form of proinsulin, but are not limited thereto.
  • Xaa1 is alanine, glycine, glutamine, histidine, glutamic acid or asparagine,
  • Xaa5 is alanine, glutamic acid, glutamine, histidine or asparagine,
  • Xaa12 is alanine, serine, glutamine, glutamic acid, histidine or asparagine,
  • Xaa14 is tyrosine, histidine, lysine, alanine or aspartic acid,
  • Xaa16 is alanine, leucine, tyrosine, histidine, glutamic acid or asparagine,
  • Xaa19 is tyrosine, glutamic acid, serine, or threonine
  • Xaa21 is asparagine, glycine, histidine, or alanine.
  • Xaa16 is tyrosine, glutamic acid, serine, threonine, or aspartic acid,
  • Xaa25 is phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 is threonine or absent
  • Xaa28 is proline, glutamic acid, or aspartic acid, or absent.
  • peptides in which the A-chain matches SEQ ID NO: 53 while the B-chain matches the B-chain in SEQ ID NO: 54 can also be excluded.
  • the characteristic amino acid residues described above, in particular A-chain may be excluded.
  • Comprising a characteristic variation on amino acid 14 and / or amino acid 19 and / or amino acid 16 of the B-chain, and / or amino acid 25 ie, amino acid residues not present in native insulin
  • peptides with reduced receptor binding capacity as compared to native insulin are also included in the scope of the present invention.
  • the term "homology" is intended to indicate a degree of similarity with the amino acid sequence of a wild type protein or a polynucleotide sequence encoding the same, and the amino acid sequence or polynucleotide sequence of the present invention. It includes sequences having the same sequence of at least such percentages. Such homology may be determined by visually comparing two sequences, but may be determined using a bioinformatic algorithm that analyzes the degree of homology by arranging the sequences to be compared side by side. Homology between the two amino acid sequences can be expressed as a percentage.
  • Useful automated algorithms are available in the GAP, BESTFIT, FASTA and TFASTA computer software modules of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA). Automated alignment algorithms in this module include Needleman & Wunsch and Pearson & Lipman and Smith & Waterman sequence alignment algorithms. Algorithms and homology determinations for other useful arrays are automated in software including FASTP, BLAST, BLAST2, PSIBLAST and CLUSTAL W.
  • the insulin analogue may include an A-chain of SEQ ID NO: 55 and a B-chain of SEQ ID NO: 54 represented by Formula 2, wherein A- of SEQ ID NO: 53 It may be an insulin analogue, including a chain and a B-chain of SEQ ID NO: 56 represented by Formula 3, but is not particularly limited thereto.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • histidine lysine, alanine or aspartic acid
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • glutamic acid Is serine, or threonine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine, glutamic acid, serine, threonine, or aspartic acid
  • Xaa25 is phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 is threonine
  • Xaa28 is Proline, which may be an insulin analogue, is not limited thereto.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 may be tyrosine, glutamic acid, serine, or aspartic acid
  • Xaa25 may be phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 may be threonine
  • Xaa28 may be proline, but is not limited thereto.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine or aspartic acid
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine, aspartic acid, or glutamic acid
  • Xaa27 is threonine
  • Xaa28 may be proline, but is not limited thereto.
  • the insulin analogue according to the invention may correspond to:
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is histidine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is lysine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is glutamic acid
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is serine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is threonine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is glutamic acid
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is serine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is threonine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is alanine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is aspartic acid
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is aspartic acid
  • Xaa25 is phenylalanine
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is aspartic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • Xaa1 is glycine
  • Xaa5 is glutamine
  • Xaa12 is serine
  • Xaa14 is tyrosine
  • Xaa16 is leucine
  • Xaa19 is tyrosine
  • Xaa21 is asparagine
  • Xaa16 is tyrosine
  • Xaa25 is glutamic acid
  • Xaa27 is threonine
  • Xaa28 is proline.
  • the insulin analogue is an amino acid sequence selected from the group consisting of SEQ ID NOs: 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, and 52 It may be an insulin analogue including, but is not limited thereto.
  • Insulin analogues according to the present invention may include, but are not limited to, those comprising the specific sequences described above (required).
  • the insulin analogue includes all forms of the peptide itself, a salt thereof (eg, a pharmaceutically acceptable salt of the peptide), or a solvate thereof.
  • the peptide may be in any pharmaceutically acceptable form.
  • the kind of the salt is not particularly limited. However, it is preferable that the form is safe and effective for an individual such as a mammal, but is not particularly limited thereto.
  • pharmaceutically acceptable means a substance that can be effectively used for a desired use without causing excessive toxicity, irritation, or allergic reactions within the scope of medical judgment.
  • salts includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • suitable acids include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , Benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid and the like.
  • Salts derived from suitable bases may include alkali metals such as sodium, potassium, alkaline earth metals such as magnesium, and ammonium and the like.
  • solvate refers to a complex of a peptide or a salt thereof according to the present invention with a solvent molecule.
  • the insulin analogues can be readily produced by those skilled in the art using methods known in the art for peptide preparation. For example, it can be produced by a method comprising the following steps.
  • the medium used for culturing the transformant in the present invention should satisfy the requirements of the host cell culture in an appropriate manner.
  • the carbon source that can be included in the medium for the growth of the host cell may be appropriately selected according to the judgment of those skilled in the art according to the type of transformant produced, and appropriate culture conditions may be adopted to control the timing and amount of culture. .
  • Sugar sources that can be used include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, Fatty acids such as linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid. These materials can be used individually or as a mixture.
  • Nitrogen sources that can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture.
  • Personnel that may be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth.
  • essential growth materials such as amino acids and vitamins may be used in addition to the above materials.
  • suitable precursors to the culture medium may be used.
  • the above-mentioned raw materials may be added batchwise or continuously in a manner appropriate to the culture during the culture.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters can be used to inhibit bubble generation. Inject oxygen or oxygen-containing gas (such as air) into the culture to maintain aerobic conditions.
  • Cultivation of the transformant according to the present invention is usually carried out at a temperature of 20 °C to 45 °C, specifically 25 °C to 40 °C.
  • the culturing also lasts until the desired amount of insulin analog production is achieved, for which purpose the cultivation can usually last for 10 to 160 hours.
  • the transformant according to the present invention will produce an insulin analogue, and the insulin analogue produced according to the composition of the vector and the characteristics of the host cell will be in the cytoplasm of the host cell, It may be secreted into the plasma membrane or extracellular.
  • Proteins expressed in or outside the host cell can be purified in a conventional manner.
  • purification methods include salting out (eg, ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (eg, protein fraction precipitation with acetone, ethanol, etc.), dialysis, gel filtration, ion exchange, reverse phase column chromatography, and the like. Techniques such as chromatography and ultrafiltration may be applied alone or in combination.
  • the following steps may be further included to separate and purify the insulin analog expressed in inclusion body form from the transformant:
  • the nucleic acid encoding the insulin analogue specifically includes the nucleotide sequences set forth in SEQ ID NOs: 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, and 51. do.
  • the present invention in one embodiment, comprises at least 70% of the nucleotide sequence set forth in SEQ ID NOs: 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, and 51 as well as said sequence.
  • homologous specifically at least 80% homology, more specifically at least 90% homology, even more specifically at least 95% homology, most specifically at least 98% homology, wherein the nucleic acid is substantially While the encoded peptide retains glycemic control function in vivo, it includes all of those whose receptor binding ability is lower than that of natural insulin.
  • Recombinant vectors according to the invention are typically constructed as vectors for cloning or vectors for expression and can be constructed with prokaryotic or eukaryotic cells as host cells.
  • the term "vector” refers to a nucleic acid construct that is a recombinant vector capable of expressing a protein of interest in a suitable host cell, and that includes an essential regulatory element operably linked to express a nucleic acid insert.
  • the present invention can produce a recombinant vector comprising a nucleic acid encoding an insulin analogue, by transforming or transfecting the recombinant vector into a host cell, the insulin analogue of the present invention can be obtained. .
  • the nucleic acid encoding the insulin analogue may be operably linked to a promoter.
  • the method for transforming a recombinant vector comprising a nucleic acid encoding an insulin analogue according to the present invention is not limited to the above examples, and transformation or transfection methods commonly used in the art may be used without limitation.
  • the transformant of the present invention can be obtained by introducing a recombinant vector containing a nucleic acid encoding an insulin analog that is a target nucleic acid into a host cell.
  • Suitable hosts for the present invention are not particularly limited as long as they allow expression of the nucleic acid of the present invention.
  • Specific examples of hosts that can be used in the present invention include bacteria of the genus Escherichia , such as E. coli ; Bacillus subtilis (Bacillus subtilis) and Bacillus (Bacillus), such as bacteria belonging to the genus; Bacteria of the genus Pseudomonas , such as Pseudomonas putida ; Pichia pastoris , Saccharomyces cerevisiae ), Schizosaccharomyces yeast such as pombe ); Insect cells such as Spodoptera luciferda (SF9); And animal cells such as CHO, COS, BSC and the like.
  • Escherichia coli may be used as the host cell, but is not limited thereto.
  • F in the conjugate is a material that can increase the half-life of X, corresponds to one configuration of the moiety constituting the conjugate of the present invention.
  • the F may be bonded to each other by X and a covalent chemical bond or a non-covalent chemical bond, F and X may be bonded to each other through L through a covalent chemical bond, a non-covalent chemical bond, or a combination thereof.
  • X and L, and L and F may be connected to each other by a covalent bond, wherein the binder is a binder in which X, L, and F are each connected via a covalent bond in the order of Formula (1).
  • the substance capable of increasing the half-life of X may be a biocompatible substance, for example, a polymer, a fatty acid, cholesterol, albumin and fragments thereof, an albumin binding material, a polymer of a repeating unit of a specific amino acid sequence, an antibody, an antibody. It may be selected from the group consisting of fragments, FcRn binding material, in vivo connective tissue, nucleotides, fibronectin, transferrin, saccharide, heparin, and elastin, but is not particularly limited thereto.
  • the elastin may be human tropoelastin, which is a water-soluble precursor, and may be a polymer of some sequences or some repeating units, including, but not limited to, an elastin-like polypeptide. .
  • high polymer examples include polyethylene glycol (PEG), polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylated polyol, polyvinyl alcohol, polysaccharide, dextran, polyvinyl ethyl ether, biodegradable polymer, High molecular polymers selected from the group consisting of lipid polymers, chitin, hyaluronic acid, oligonucleotides, and combinations thereof, but are not particularly limited thereto.
  • the polyethylene glycol is a term that encompasses all forms of ethylene glycol homopolymer, PEG copolymer, or monomethyl-substituted PEG polymer (mPEG), but is not particularly limited thereto.
  • biocompatible materials include, but are not limited to, poly-amino acids such as poly-lysine, poly-aspartic acid, and poly-glutamic acid.
  • the fatty acid may be one having a binding force with albumin in vivo, but is not particularly limited thereto.
  • the FcRn binding agent may be an immunoglobulin Fc region, and more specifically, an IgG Fc region, but is not particularly limited thereto.
  • the biocompatible may be conjugated to one or more amino acid side chains in the insulin analog of the present invention to increase the solubility and / or half-life and / or increase the bioavailability of the insulin analog in vivo. Such modifications can also reduce clearance of therapeutic proteins and peptides.
  • biocompatible materials described above may be water soluble (amphiphilic or hydrophilic) and / or nontoxic and / or pharmaceutically acceptable.
  • F may be directly connected to X (that is, a is 0 in Formula 1), or connected through a linker (L).
  • L may be a peptidic linker or a nonpeptidic linker.
  • L When L is a peptidic linker, it may include one or more amino acids, for example, may include 1 to 1000 amino acids, but is not particularly limited thereto.
  • Various known peptide linkers may be used in the present invention to link F and X in the present invention, and examples thereof include [GS] x linkers, [GGGS] x linkers, [GGGGS] x linkers, and the like, where x is It may be one or more natural numbers. However, it is not limited to the above example.
  • a "non-peptidyl linker” includes a biocompatible polymer having two or more repeating units bonded thereto. The repeating units are linked to each other through any covalent bond, not a peptide bond.
  • the non-peptidyl linker may be one component forming a moiety of the conjugate of the present invention, and corresponds to L in Chemical Formula 1.
  • the terminal portion of the non-peptidyl linker may further include a linking element for covalently linking the linker L with the insulin analog X and / or F.
  • This linking element is not particularly limited as long as it is suitable for covalently linking the biocompatible polymer and X and / or F as an atom or atomic group which is not a repeating unit of the biocompatible polymer.
  • a may be 1 or more, and when L is 2 or more, each L may be independent.
  • the non-peptidyl linker may be used in combination with the non-peptidyl polymer.
  • the conjugate is that F and X are covalently linked to each other via a non-peptidyl linker comprising a reactor capable of binding to F, specifically an immunoglobulin Fc region and X at both ends.
  • a non-peptidyl linker comprising a reactor capable of binding to F, specifically an immunoglobulin Fc region and X at both ends.
  • non-peptidyl linker may be selected from the group consisting of fatty acids, saccharides (saccharides), high molecular polymers, low molecular weight compounds, nucleotides, and combinations thereof.
  • the polymer in the present invention may range from greater than 0 to about 100 kDa, specifically from about 1 to about 100 kDa, even more specifically from about 1 to about 20 kDa, but is not limited thereto. .
  • the non-peptidyl linker is polyethylene glycol, polypropylene glycol, copolymer of ethylene glycol and propylene glycol, polyoxy ethylated polyol, polyvinyl alcohol, polysaccharide, dextran, polyvinyl ethyl ether, Biodegradable polymers such as polylactic acid (PLA) and polylactic-glycolic acid (PLGA), lipid polymers, chitins, hyaluronic acid, oligonucleotides, and combinations thereof.
  • PLA polylactic acid
  • PLGA polylactic-glycolic acid
  • lipid polymers chitins, hyaluronic acid, oligonucleotides, and combinations thereof.
  • the non-peptidyl polymer may be polyethylene glycol, but is not limited thereto.
  • derivatives thereof known in the art and derivatives which can be easily prepared at the technical level in the art are included in the scope of the present invention.
  • Non-peptidyl linkers that can be used in the present invention can be used without limitation as long as they are polymers resistant to proteolytic enzymes in vivo.
  • the molecular weight of the non-peptidyl polymer ranges from greater than 0 to about 100 kDa, specifically from about 1 to about 100 kDa, even more specifically from about 1 to about 20 kDa, but is not limited thereto.
  • the term "about” includes all of the values of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, and the like, and includes all values in the range equivalent to or similar to those following the term about, It is not limited.
  • non-peptidyl linker of the present invention bound to the polypeptide corresponding to F may be a combination of polymers of different kinds as well as one kind of polymer.
  • both ends of the non-peptidyl linker may be linked to F and X, respectively, via connecting elements.
  • a reactor capable of chemically reacting to form a covalent bond (i.e., converted to a linking element of the conjugate) at its end is capable of chemically reacting with an amine group or thiol group of the immunoglobulin Fc region and an amine group or thiol group of X
  • the insulin analogue conjugate of the present invention is prepared by reacting (linking reaction) a retained non-peptidyl polymer (reactor retained non-peptidyl polymer) with an immunoglobulin Fc region and / or an insulin analogue.
  • the reactor-bearing non-peptidyl polymer here becomes a non-peptidyl linker that forms part of the conjugate through a linking reaction, in which the non-peptide linker is linked to the repeating units of the reactor-containing non-peptidyl polymer and the linking element. Is done.
  • reactor-retaining non-peptidyl polymers that can be used for the preparation of the conjugates include F (eg, immunoglobulin Fc regions) and X, F (eg, X or F, respectively) at both ends.
  • F eg, immunoglobulin Fc regions
  • X e.g, X or F, respectively
  • Non-peptidyl polymers having an amine group located at the N-terminus or lysine of an immunoglobulin Fc region) or a thiol group of cysteine can be used, but are not limited thereto.
  • the reactor of the non-peptidyl polymer which may form covalent bonds with F, such as an immunoglobulin Fc region and X, may be selected from the group consisting of aldehyde groups, maleimide groups and succinimide derivatives, but is not limited thereto. Do not.
  • an aldehyde group may be exemplified as a propion aldehyde group or a butyl aldehyde group, but is not limited thereto.
  • succinimidyl valerate succinimidyl methylbutanoate
  • succinimidyl methylpropionate succinimidyl butanoate
  • succinimidyl propionate N-hydroxysuccini Mead
  • hydroxy succinimidyl succinimidyl carboxymethyl or succinimidyl carbonate
  • Non-peptidyl linkers may be linked via X and F via a linking element through the conversion of this reactor, but are not particularly limited thereto.
  • the final product produced by reductive amination with aldehyde bonds is much more stable than linked with amide bonds.
  • the aldehyde reactor selectively reacts at the N-terminus at low pH and can form covalent bonds with lysine residues at high pH, for example pH 9.0 conditions.
  • the reactors at both ends of the reactor-retaining non-peptidyl polymer may be the same or different from each other, for example, one end has a maleimide group, the other end has an aldehyde group, a propion aldehyde group, or a butyl aldehyde group.
  • F specifically an immunoglobulin Fc region and X can be bonded to each end of the reactor-retaining non-peptidyl polymer, it is not particularly limited thereto.
  • one end of the reactor-containing non-peptidyl polymer may include a maleimide group as a reactor, and the other end may include an aldehyde group, a propion aldehyde group or a butyl aldehyde group.
  • the hydroxy group may be activated into the various reactors by a known chemical reaction, or a polyethylene glycol having a commercially available modified reactor may be used.
  • the long-acting protein conjugates of the invention can be prepared.
  • the non-peptidyl polymer may be linked to X, ie the N-terminal region or lysine residue of the insulin analogue, but is not particularly limited thereto.
  • the non-peptidyl polymer, specifically PEG may be linked to the N-terminal region of the insulin analogue, specifically, the amine group of the terminal amino acid, or the amine group of lysine present in the insulin analogue, but is particularly limited thereto. It doesn't work.
  • the non-peptidyl polymer may be linked to the N-terminal region of F, such as an immunoglobulin Fc, but is not particularly limited thereto.
  • F such as an immunoglobulin Fc
  • the non-peptidyl polymer may be linked to the N-terminal region of the immunoglobulin Fc, specifically, the amine group of the last amino acid, but is not particularly limited thereto.
  • N-terminal region refers to the amino terminal region of the insulin analogue or immunoglobulin Fc, and refers to a position capable of binding to a linker for the purposes of the present invention. Examples include, but are not limited to, the amino acid residues around the N-terminal amino acid residues as well as the terminal amino acid residues of the N-terminal region, and specifically, the first to 20th amino acid residues from the last. It may include. However, it is not particularly limited thereto.
  • the conjugate is a case in which the reactor-containing non-peptidyl polymer used in the preparation is PEG having an aldehyde group reactor at both ends, and is connected to an amino group of X and F through reductive amination to form a conjugate.
  • the conjugate has the following structure.
  • -CH 2 W- is a connecting element connecting X with non-peptidyl polymer and -Z-CH 2 -with non-peptidyl polymer with F and W and Z are absent or a divalent functional group such as alkylene.
  • the PEG moiety in the structure may include not only a-(CH 2 CH 2 O) n- structure but also an oxygen atom interposed between the linking element and the-(CH 2 CH 2 O) n-.
  • immunoglobulin Fc region means a site including heavy chain constant region 2 (CH2) and / or heavy chain constant region 3 (CH3) moieties except for the heavy and light chain variable regions of an immunoglobulin.
  • the immunoglobulin Fc region may be one component forming a moiety of the conjugate of the present invention.
  • the immunoglobulin Fc region may include a hinge portion in the heavy chain constant region, but is not limited thereto.
  • some or all heavy chain constant region 1 (CH1) and / or light chain constant region It may be an extended Fc region including 1 (CL1). It may also be a region from which some fairly long amino acid sequences corresponding to CH2 and / or CH3 have been removed.
  • the immunoglobulin Fc regions of the present invention may comprise 1) CH1 domain, CH2 domain, CH3 domain and CH4 domain, 2) CH1 domain and CH2 domain, 3) CH1 domain and CH3 domain, 4) CH2 domain and CH3 domain, 5) Combination of one or two or more of the CH1 domain, CH2 domain, CH3 domain and CH4 domain with an immunoglobulin hinge region (or a portion of the hinge region), 6) heavy chain constant region may be a dimer of each domain and light chain constant region .
  • an immunoglobulin hinge region or a portion of the hinge region
  • the immunoglobulin Fc region may be in a dimeric form, and one molecule may be covalently linked to one Fc region in the dimeric form, wherein the immunoglobulin Fc is X may be linked to each other by a non-peptidyl polymer.
  • the immunoglobulin Fc and X may be linked to each other by a non-peptidyl linker.
  • immunoglobulin Fc regions of the present invention include naturally occurring amino acid sequences as well as sequence derivatives thereof.
  • Amino acid sequence derivatives mean that one or more amino acid residues in a natural amino acid sequence have different sequences by deletion, insertion, non-conservative or conservative substitution, or a combination thereof.
  • IgG Fc amino acid residues 214 to 238, 297 to 299, 318 to 322 or 327 to 331 which are known to be important for binding can be used as suitable sites for modification.
  • various kinds of derivatives are possible, such as a site capable of forming disulfide bonds, a few amino acids at the N-terminus in the native Fc, or a methionine residue may be added at the N-terminus of the native Fc.
  • the complement binding site such as C1q binding site may be removed, ADCC (antibody dependent cell mediated cytotoxicity) site may be removed in order to eliminate the effector function.
  • ADCC antibody dependent cell mediated cytotoxicity
  • Amino acid exchange in proteins and peptides that do not alter the activity of the molecule as a whole is known in the art (H. Neurode, R. L. Hill, The Proteins, Academic Press, New York, 1979).
  • the most commonly occurring exchanges are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Exchange between Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly.
  • it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, acetylation and amidation. may be modified.
  • Fc derivatives may exhibit biological activities equivalent to those of the Fc region of the present invention and may increase structural stability to heat, pH, etc. of the Fc region.
  • the Fc region may be obtained from a natural type separated in vivo from animals such as humans, cows, goats, pigs, mice, rabbits, hamsters, rats or guinea pigs, or obtained from transformed animal cells or microorganisms. It may be recombinant or a derivative thereof.
  • the method of obtaining from the natural form may be a method of separating the whole immunoglobulin from a human or animal living body, and then processing the protease. Papain is cleaved into Fab and Fc and pepsin is cleaved into pF'c and F (ab) 2 . This may be separated by Fc or pF'c using size-exclusion chromatography and the like.
  • the human-derived Fc region is a recombinant immunoglobulin Fc region obtained from a microorganism.
  • the immunoglobulin Fc region may be in a natural sugar chain, an increased sugar chain compared to the natural form, a reduced sugar chain or a sugar chain removed from the natural form.
  • Conventional methods such as chemical methods, enzymatic methods, and genetic engineering methods using microorganisms can be used to increase or decrease such immunoglobulin Fc sugar chains.
  • the immunoglobulin Fc region in which the sugar chain is removed from the Fc is significantly reduced in binding strength with the complement (c1q), and antibody-dependent cytotoxicity or complement-dependent cytotoxicity is reduced or eliminated, thereby not causing an unnecessary immune response in vivo. Do not.
  • a form more consistent with the original purpose as a carrier of the drug would be the immunoglobulin Fc region from which the sugar chains have been removed or unglycosylated.
  • “Deglycosylation” refers to an Fc region in which sugar is removed by an enzyme
  • Aglycosylation refers to an Fc region which is not produced and glycosylated in prokaryotes, and more specifically, in Escherichia coli. .
  • the immunoglobulin Fc region may be of human origin or animal origin such as cattle, goats, pigs, mice, rabbits, hamsters, rats, guinea pigs, etc., and in more specific embodiments is human origin.
  • the immunoglobulin Fc region may be an Fc region by IgG, IgA, IgD, IgE, IgM derived or combinations thereof or hybrids thereof. In more specific embodiments it is derived from IgG or IgM, which is most abundant in human blood, and in more specific embodiments it is of IgG known to enhance the half-life of ligand binding proteins. In even more specific embodiments the immunoglobulin Fc region is an IgG4 Fc region, and in the most specific embodiment the immunoglobulin Fc region is a non-glycosylated Fc region derived from human IgG4, but is not limited thereto.
  • “combination” in the present invention means that, when forming a dimer or multimer, a polypeptide encoding a single-chain immunoglobulin Fc region of the same origin forms a bond with a single-chain polypeptide of different origin. That is, it is possible to prepare dimers or multimers from two or more fragments selected from the group consisting of Fc fragments of IgG Fc, IgA Fc, IgM Fc, IgD Fc and IgE.
  • Another embodiment embodying the present invention provides a polynucleotide encoding the conjugate, a vector comprising the polynucleotide, and a transformant comprising the polynucleotide or a vector comprising the same.
  • the polynucleotide may be encoding a conjugate in the form of a fusion protein.
  • the isolated polynucleotide encoding the conjugate is a polynucleotide sequence having at least 75%, specifically at least 85%, more specifically at least 90%, more specifically at least 95% sequence identity with the sequence. It is included in the scope of the invention.
  • Another aspect for implementing the present invention provides a method for preparing the conjugate.
  • a non-peptidyl polymer prepared in step (a) is attached to one end of the analogue and a carrier, and the terminal end of the other end, the non-peptidyl polymer and the carrier or the insulin analogue by reacting the other one of the insulin analogue and the carrier May comprise preparing a conjugate, which is linked via a non-peptidyl polymer.
  • composition comprising the combination.
  • the composition may be a pharmaceutical composition. More specifically, the composition may be a pharmaceutical composition for preventing or treating insulin-related diseases. More specifically, the composition may be a pharmaceutical composition for preventing or treating diabetes.
  • insulin-related disease is a disease that develops or progresses due to low or no physiological activity of insulin, such as diabetes, but is not particularly limited thereto.
  • prevention refers to any action that inhibits or delays the onset of insulin-related diseases by administration of the conjugate or composition comprising the same
  • treatment refers to insulin-related administration of the conjugate or composition comprising the same. It means any action that improves or benefits the condition of the disease.
  • compositions comprising an insulin analogue conjugate according to the invention may comprise a pharmaceutically acceptable carrier.
  • a carrier may be one that is present unnaturally.
  • the term "pharmaceutically acceptable” means a sufficient amount and side effects that do not cause a therapeutic effect, the type of disease, the age, weight, health, sex, sensitivity of the patient to the drug It can be easily determined by those skilled in the art according to well-known factors in the medical field, such as the route of administration, the method of administration, the frequency of administration, the duration of treatment, the combination or the drug used concurrently.
  • Pharmaceutically acceptable carriers can be used as oral administration binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments and flavors, etc., in the case of injections, buffers, preservatives, analgesic Topical agents, solubilizers, isotonic agents, stabilizers and the like can be used in combination, and for topical administration, bases, excipients, lubricants and preservatives can be used.
  • the formulation of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with the pharmaceutically acceptable carrier as described above.
  • oral administration in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups and wafers, and in the case of injections, they may be prepared in unit dosage ampoules or multiple dosage forms.
  • it can be formulated into solutions, suspensions, tablets, pills, capsules and sustained release preparations.
  • suitable carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers and preservatives may be further included.
  • administration means introducing a predetermined substance into a patient by any suitable method, and the route of administration of the conjugate may be administered through any general route as long as the drug can reach the target tissue.
  • Intraperitoneal administration intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, pulmonary administration and rectal administration, and the like.
  • the oral composition is preferably formulated to coat the active agent or to protect it from degradation in the stomach. Specifically, it may be administered in the form of an injection.
  • the pharmaceutical composition may be administered by any device that allows the active ingredient to migrate to the target cell.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient, along with various related factors such as the disease to be treated, the route of administration, the age, sex and weight of the patient and the severity of the disease.
  • the total effective amount of the composition of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol that is administered in multiple doses for long periods of time.
  • the pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the extent of the disease.
  • the preferred total dose of the conjugates of the present invention may be from about 0.0001 mg to 500 mg per kg body weight of the patient per day.
  • the dose of the conjugate is determined by taking into consideration various factors such as the age, weight, health condition, sex, severity of the disease, diet and excretion rate, as well as the route and frequency of treatment of the pharmaceutical composition.
  • compositions of the present invention are not particularly limited to its formulation, route of administration and method of administration as long as the effect of the present invention is shown.
  • Another aspect for implementing the present invention provides a long-acting formulation comprising a conjugate of the insulin analogue, which has increased in vivo persistence and / or stability compared to a conjugate of native insulin.
  • the insulin analogue and the conjugate are as described above.
  • Another aspect for practicing the present invention provides a method of treating an insulin related disease comprising administering to a subject in need thereof a conjugate of the insulin analogue or a composition thereof.
  • the insulin analogue and the conjugate are as described above.
  • the insulin related disease is diabetes, but is not particularly limited thereto.
  • Another aspect for practicing the present invention provides the use of a conjugate of said insulin analog in the manufacture of a medicament.
  • the medicament is for the prophylaxis or treatment of insulin related diseases, but is not particularly limited thereto.
  • the prophylaxis or treatment of diabetes is not particularly limited thereto.
  • Another aspect for implementing the present invention provides the use of a conjugate of said insulin analogues in the treatment of insulin related diseases, in particular diabetes.
  • the insulin analogues, conjugates, and insulin-related diseases are as described above.
  • Table 1 shows the change sequences and analog names of the amino acids of each A or B chain. That is, in the case of analog 1, 14 tyrosine (Y) in the A chain is substituted with histidine (H), and in the case of analog 6, 16 tyrosine in the B chain is substituted with glutamic acid (E).
  • the PCR conditions for analog analog amplification were repeated 18 times at 95 ° C. for 30 seconds, 55 ° C. for 30 seconds, and 68 ° C. for 6 minutes.
  • the insulin analog fragments obtained under these conditions were inserted into the pET22b vector for expression in the form of inclusion bodies in the cells.
  • the expression vectors thus obtained were named pET22b-insulin analogs 1 to 13.
  • the expression vector comprises a nucleic acid encoding the amino acid sequence of insulin analogs 1 to 13 under the control of the T7 promoter. Insulin analog proteins were expressed in inclusion bodies in a host comprising the expression vector.
  • Table 3 below shows the DNA sequences and protein sequences of each insulin analog 1-13.
  • Recombinant insulin analog expression was performed under the control of the T7 promoter.
  • Each recombinant insulin analog expression vector was E. coli BL21-DE3 ( E. coli B F-dcm ompT hsdS (rB-mB-) gal ⁇ DE3); Novazen) was transformed. The transformation method followed the method recommended by Novagen.
  • Each single colony transformed with each recombinant expression vector was taken and inoculated in 2X Luria Broth (LB) medium containing ampicillin (50 ⁇ g / ml) and incubated at 37 ° C. for 15 hours.
  • LB 2X Luria Broth
  • Recombinant strain cultures and 2X LB medium containing 30% glycerol were mixed at a ratio of 1: 1 (v / v), and each 1 ml was dispensed into cryo-tubes and stored at -140 ° C. This was used as a cell stock for the production of recombinant fusion proteins.
  • recombinant insulin analogues For expression of recombinant insulin analogues, 1 vial of each cell stock was dissolved and inoculated in 500 ml of 2 ⁇ Luria broth and shaken at 37 ° C. for 14-16 hours. When the value of OD600 showed 5.0 or more, the culture was terminated, and this was used as the seed culture solution. Seed cultures were inoculated into 17 L fermentation medium using a 50 L fermenter (MSJ-U2, B.E. MARUBISHI, Japan) and initial bath fermentation was started. Culture conditions were maintained at pH 6.70 using a temperature of 37 °C, air volume 20 L / min (1 vvm), stirring speed 500 rpm and 30% ammonia water.
  • MSJ-U2 50 L fermenter
  • Fermentation proceeded when the nutrients in the culture was limited, supplemented with additional feeding (feeding solution) to proceed with the oil value culture.
  • the growth of the strains was monitored by OD values and introduced with IPTG of 500 ⁇ M final concentration at OD values of 100 or higher.
  • the culture was further proceeded to about 23-25 hours after introduction, and after completion of the culture, the recombinant strain was harvested using a centrifuge and stored at -80 ° C until use.
  • Example 3 recovery of the recombinant insulin analogue and Refold ( refolding )
  • Cells were disrupted and refolded to convert the recombinant insulin analogs expressed in Example 2 into soluble form.
  • 100 g (wet weight) of cell pellet was resuspended in 1 L lysis buffer (50 mM Tris-HCl, pH 9.0), 1 mM EDTA, pH 8.0, 0.2 M NaCl and 0.5% Triton X-100.
  • Cells were disrupted by performing at 15,000 psi pressure using a microfluidization processor Microfluidizer (Microfluidic Corp. Model M-110EH-30). The lysed cell lysate was centrifuged at 7,000 rpm at 4-8 ° C.
  • Example 5 trypsin Trypsin )and Carboxypeptides B ( Carboxypeptidase B) treatment
  • the eluted sample was removed with salt by ultrafiltration membrane and replaced with buffer (10 mM Tris-HCl, pH 8.0). Trypsin corresponding to about 30,000 molar ratios of the sample protein obtained and carboxypeptides B corresponding to about 3,000 molar ratios were added, followed by stirring at 4 to 8 ° C. for at least 16 hours.
  • the sample was rebound to an SP HP (GE healthcare) column equilibrated with 20 mM sodium citrate (pH 2.0) buffer containing 45% ethanol, and then 20 mM containing 0.5 M potassium chloride and 45% ethanol.
  • Insulin analog protein was eluted with a linear gradient of 10 column doses using sodium citrate (pH 2.0) buffer so that the concentration was from 0% to 100%.
  • Example 6 In order to purely separate the pure insulin analogue from the sample obtained in Example 6, it was bound to a reverse phase chromatography Source30RPC (GE healthcare, USA) equilibrated with a buffer containing sodium phosphate and isopropanol, and then a buffer containing sodium phosphate and isopropanol. Insulin analogue protein was eluted with a linear concentration gradient.
  • Source30RPC GE healthcare, USA
  • the purified insulin analogues were analyzed using protein electrophoresis (SDS-PAGE, FIG. 1) and high pressure chromatography (HPLC). Among them, the insulin analogues 9, 10, 11, and 12 were analyzed for purity. ( Figure 2).
  • the conjugate of the insulin analogue prepared in Examples 1 to 7 was prepared by the following method.
  • sustained conjugates of analog 10 were prepared as follows.
  • PEG 3.4kDa PEG each having one propionaldehyde group at each end, NOF, USA
  • the molar ratio of: PEG was 1: 4 and the concentration of insulin analog 10 was 5 mg / ml at 4 ° C. for about 2 hours.
  • the reaction was performed by adding a sodium cyanoborohydride (NaCNBH 3 ) reducing agent at a concentration of 3 mM in a mixed solvent of 50 mM sodium citrate buffer (pH 5.0) and 45% isopropanol.
  • the reaction solution was purified using a SP-HP (GE Healthcare) column using sodium citrate (pH 3.0), a buffer containing 45% EtOH and a KCl concentration gradient.
  • the molar ratio of the purified mono-pegylated insulin analogue to the immunoglobulin Fc fragment is 1: 1.2.
  • the reaction was carried out at 25 ° C. for 15 hours at a total protein concentration of 20 mg / ml.
  • the reaction solution was added to 100 mM Hepes (HEPES) buffer (pH 8.2) and sodium chloride 20 mM sodium cyanoborohydride as a reducing agent.
  • reaction solution was applied to a Q-HP (GE, USA) column using Tris-HCl (pH 7.5) buffer and NaCl concentration gradient, and the ammoniumsulfate and Tris-HCl (pH 7.5) Insulin analogue 10-3.4K PEG-immunoglobulin Fc conjugates were purified by applying to Source 15ISO (GE, USA) using a concentration gradient.
  • PEG 3.4 kDa PEG, each having a propionaldehyde group at each end of N-terminus of native insulin (India Biocon) B-chain, US NOF Corporation
  • a PEGylation reaction and a purification column were applied to purify mono-pegylated native insulin.
  • the purified mono-pegylated native insulin and immunoglobulin Fc fragments were linked to the N-terminus of the immunoglobulin Fc fragment to which the native insulin attached PEG was attached.
  • the same reaction conditions and purification columns were applied to prepare a native insulin-3.4K PEG-immunoglobulin Fc conjugate.
  • CHO cell lines overexpressing insulin receptor B aoform were prepared by transfecting CHO cell lines using lipofectamine (Life technology, USA) to obtain cell membranes expressing insulin receptor B isoform. After homogenization with a homogenizer (Wheaton, USA), the cell membrane was separated by sucrose cushion method. Cell membranes and PVT SPA beads obtained with the obtained human native insulin receptor B isoform were put together in 96-well pico plates (PerkinElmer, Model No. 6005162, USA), and the reaction solution at a concentration of 10 or more as competitors.
  • SPA Stintillation proximity assay
  • Substance Insulin receptor binding capacity ( vs . Human insulin) Insulin analogue Insulin analogue (number 1) 90% Insulin analogue (No. 2) 95% Insulin analogue (No. 3) 1.0% Insulin analogue (4 times) ⁇ 0.1% Insulin analogue (No. 6) 20% Insulin analogue (No. 7) 8.5% Insulin analogue (No. 9) 79% Insulin analogue (No. 10) 79% Insulin analogue (No. 11) 24% Insulin analogue (No. 12) ⁇ 0.1% Insulin analogue (No. 13) ⁇ 0.1%
  • the binding capacity to the insulin receptor was 2.4 ⁇ 0.4% for the native insulin-PEG-immunoglobulin Fc conjugate and 1.3 ⁇ 0.2% for the insulin analog 10-PEG-immunoglobulin Fc conjugate as compared to human native insulin.
  • the binding force to the IGF-1 receptor was found to be less than 1% of the human insulin-type IGF-1 in both the native insulin-PEG-immunoglobulin Fc conjugate and the insulin analogue 10-PEG-immunoglobulin Fc conjugate.
  • the insulin analogue 10-PEG-immunoglobulin Fc conjugate of the present invention has reduced insulin receptor binding ability compared to the native insulin-PEG-immunoglobulin Fc conjugate, and both substances have low IGF-1 through PEG-immunoglobulin Fc binding. It was confirmed that it has a receptor binding capacity.
  • Native insulin-PEG-immunoglobulin Fc conjugates and insulin analogue 10-PEG-immunoglobulin Fc conjugates were injected once subcutaneously at 43.05 nmol / kg in mice and 65.1 nmol / kg in rats, respectively, at 0, 1, 4, 8 Blood was collected at, 24, 48, 72, 96, 120, 144 and 168 hours.
  • Native insulin- PEG-immunoglobulin Fc conjugates and insulin analogue 10- PEG-immunoglobulin Fc conjugates were administered once each subcutaneously at 6.3 nmol / kg, followed by 0, 1, 4, 8, 24, 48, 72, Blood was collected at 96, 120, 144, 168, 192, 216 and 240 hours.
  • Residual concentrations in blood of the native insulin- PEG-immunoglobulin Fc conjugate and insulin analogue 10- PEG-immunoglobulin Fc conjugate at each time were measured using an enzyme linked immunosorbent assay (ELISA).
  • ELISA enzyme linked immunosorbent assay
  • the kit used was Insulin ELISA (ALPCO, USA). However, a mouse anti-human IgG4 HRP conjugate (Alpha Diagnostic Intl, Inc, USA) was used as a detection antibody.
  • the insulin analogue 10-PEG-immunoglobulin Fc conjugate increased 1.9-fold, 1.2-fold, 1.6-fold in mice, rats, and dogs, respectively, compared to the native insulin-PEG-immunoglobulin Fc conjugate. Fold, 1.9-fold, 2.0-fold increase.
  • the insulin analogue 10-PEG-immunoglobulin Fc conjugate of the present invention was confirmed to have a result of increased blood persistence compared to the native insulin-PEG-immunoglobulin Fc conjugate.
  • Type 2 diabetes model was prepared by administering a total of twice a week at a dose of 30 mg / kg (hereinafter, DIO / STZ rats). The model was continuously fed a high-fat diet to maintain diabetes.
  • Native insulin-PEG-immunoglobulin Fc conjugates and insulin analogue 10-PEG-immunoglobulin Fc conjugates were subcutaneously administered to DIO / STZ rats at 12.1 nmol / kg and 8.09 nmol / kg, respectively. Proceeded.
  • the insulin analogue 10-PEG-immunoglobulin Fc conjugate compared to the natural insulin-PEG-immunoglobulin Fc conjugate had equivalent blood glucose lowering efficacy even when 50% less dose was administered in DIO / STZ rats.
  • the improved blood persistence of the insulin analogue 10-PEG-immunoglobulin Fc conjugate of the present invention can maintain excellent blood glucose lowering effect even at a small dose compared to the native insulin-PEG-immunoglobulin Fc conjugate.

Abstract

본 발명은 인슐린 아날로그 결합체 및 이의 용도에 관한 것이다.

Description

인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도
본 발명은 인슐린 아날로그 결합체 및 이의 용도에 관한 것이다.
생체 내 단백질들은 혈중 단백질 분해효소에 의해 분해되거나 신장을 통해 배설 혹은 수용체에 의한 제거되는 등 여러 경로를 거쳐 제거되는 것이 알려져 있다. 이에, 상기와 같은 단백질 제거 기전을 회피하여 생리활성 단백질의 반감기를 증가시켜 치료학적 효능을 높이려는 여러 시도가 진행되고 있다.
한편, 인슐린은 인체의 췌장에서 분비되는 혈당 조절 호르몬으로서, 혈액 내의 잉여 포도당을 세포로 옮겨 세포에 에너지원을 공급하는 한편 혈당을 정상 수준으로 유지시켜 주는 역할을 한다. 그러나 당뇨 환자의 경우 이러한 인슐린이 부족하거나 인슐린 저항성 및 베타 세포의 기능소실로 인하여 인슐린이 정상적인 기능을 수행하지 못한다. 그로 인해 당뇨 환자는 혈액 내의 포도당을 에너지원으로 이용하지 못하고 혈중 포도당 수준이 높은 고혈당 증세를 나타내어 결국 소변으로 당을 배출하게 되며, 이는 다양한 합병증의 원인이 되고 있다. 따라서 인슐린 생성에 이상이 있거나(Type I), 인슐린 내성으로 인한(Type II) 당뇨 환자는 인슐린 치료가 필요하며, 인슐린 투여로써 혈당을 정상 수준으로 조절할 수 있다.
하지만, 인슐린의 경우 다른 단백질이나 펩티드 호르몬과 같이 생체 내 반감기가 극히 짧아 지속적인 치료 효과를 보이지 못하여, 효과를 발휘하기 위해서는 지속적으로 반복 투여를 해야 한다는 단점이 있다. 이러한 빈번한 투여는 환자에게 엄청난 고통과 불편함을 야기하게 되므로, 환자의 순응성, 안전성 및 편의성 측면에서 개선이 요구되고 있다.
이에 인슐린과 같은 단백질 약물의 생체 내 반감기를 증가시켜 투여 횟수를 줄임으로써 환자의 삶의 질과 치료적 효과를 높이기 위한 다양한 단백질 제형화 연구와 화학적 결합체 (예, 지방산 결합체) 등에 대한 연구가 진행되고 있다.
기존 보고에 따르면, 50% 이상의 인슐린은 신장에서 제거되며, 나머지 인슐린들은 근육, 지방, 간 등의 작용 부위(target site)에서 수용체 매개 제거(receptor mediated clearance, RMC) 공정을 통해 제거된다.
이와 관련하여 J Pharmacol Exp Ther (1998) 286: 959, Diabetes Care (1990) 13: 923, 및 Diabetes (1990) 39: 1033 등에서 인슐린의 RMC를 피하고자 in-vitro 활성을 약화시킴으로써 혈중 농도를 증가시킨다는 등의 여러 보고가 있으나, J Pharmacol Exp Ther (1998) 286: 959, Diabetes Care (1990) 13:923의 경우 제시된 인슐린 아날로그는 2개 이상의 아미노산을 치환하였거나, 구체적인 결과를 제시하지 않았으며, Diabetes (1990) 39: 1033의 경우 인슐린 아날로그들은 수용체 결합력에서 변화가 없거나 인슐린 수용체에 직접 관여하는 아미노산을 치환하여 활성이 감소한 것으로 보고되는 등 여전히 지속성이 증대된 인슐린 아날로그의 개발이 요구되고 있다.
본 발명의 하나의 목적은 인슐린 아날로그의 결합체를 제공하는 것이다.
본 발명의 다른 목적은 상기 결합체를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터, 및 상기 폴리뉴클레오티드 또는 이를 포함하는 벡터를 포함하는 형질전환체를 제공하는 것이다.
본 발명의 다른 목적은 상기 결합체의 제조방법을 제공하는 것이다.
본 발명의 다른 목적은 상기 인슐린 아날로그의 결합체를 포함하는 조성물, 예컨대 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 인슐린 아날로그의 결합체를 포함하는, 천연형 인슐린의 결합체 대비 생체 내 지속성 및/또는 안정성이 증대된, 지속성 제제를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 인슐린 아날로그의 결합체를 포함하는, 인슐린 관련 질환, 예컨대 당뇨병의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 인슐린 아날로그의 결합체 또는 이의 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 인슐린 관련 질환, 예컨대 당뇨병을 치료하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 약제의 제조에 있어 상기 인슐린 아날로그의 결합체의 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 인슐린 관련 질환, 구체적으로 당뇨병의 치료에 있어 상기 인슐린 아날로그의 결합체의 용도를 제공하는 것이다.
상기 과제를 해결하기 위한 본 발명의 하나의 양태는 인슐린 아날로그의 결합체이다.
보다 구체적으로, 본 발명의 하나의 양태는 하기 화학식 1로 표시되는, 결합체이다:
[화학식 1]
X - La - F
여기서, X는 천연형 인슐린 B-쇄의 16번 아미노산, B-쇄의 25번 아미노산, A-쇄의 14번 아미노산 및 A-쇄의 19번 아미노산으로 이루어진 군에서 선택된 하나 이상의 아미노산의 변이를 포함하는, 인슐린 아날로그이고;
L은 링커이며;
a는 0 또는 자연수이며, 다만 a가 2 이상일 때 각각의 L은 서로 독립적이고;
F는 X의 반감기를 증가시킬 수 있는 물질임.
하나의 구체예로서, 상기 X는 천연형 인슐린 B-쇄의 16번 아미노산인 티로신의 글루탐산, 세린, 트레오닌, 또는 아스파르트산으로의 변이; 천연형 인슐린 B-쇄의 25번 아미노산인 페닐알라닌의 아스파르트산 또는 글루탐산으로의 변이; 천연형 인슐린 A-쇄의 14번 아미노산인 티로신의 히스티딘, 라이신, 알라닌, 또는 아스파르트산으로의 변이; 및 천연형 인슐린 A-쇄의 19번 아미노산인 티로신의 글루탐산, 세린, 또는 트레오닌으로의 변이로 이루어진 군에서 선택된 하나 이상의 변이를 포함하는 것을 특징으로 한다.
다른 구체예로서, 상기 X는 하기 일반식 2로 표시되는 서열번호: 55의 A-쇄와 하기 일반식 3으로 표시되는 서열번호: 56의 B-쇄의 모든 조합을 포함하는 인슐린 아날로그로서, 천연형 인슐린을 제외한 것, 즉 A-쇄가 서열번호: 53과 일치하면서 동시에 B-쇄도 서열번호: 54와 일치하는 펩티드를 제외한 것을 특징으로 한다.
[일반식 2]
Xaa1-Ile-Val-Glu-Xaa5-Cys-Cys-Thr-Ser-Ile-Cys-Xaa12-Leu-Xaa14-Gln-Xaa16-Glu-Asn-Xaa19-Cys-Xaa21(서열번호: 55)
상기 일반식 2에서,
Xaa1는 알라닌, 글리신, 글루타민, 히스티딘, 글루탐산 또는 아스파라긴이고,
Xaa5는 알라닌, 글루탐산, 글루타민, 히스티딘 또는 아스파라긴이고,
Xaa12는 알라닌, 세린, 글루타민, 글루탐산, 히스티딘 또는 아스파라긴이고,
Xaa14는 티로신, 히스티딘, 라이신, 알라닌 또는 아스파르트산이고,
Xaa16는 알라닌, 류신, 티로신, 히스티딘, 글루탐산 또는 아스파라긴이고,
Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고,
Xaa21은 아스파라긴, 글리신, 히스티딘, 또는 알라닌임.
[일반식 3]
Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Xaa16-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Xaa25-Tyr-Xaa27-Xaa28-Lys-Thr(서열번호: 56)
상기 일반식 3에서,
Xaa16은 티로신, 글루탐산, 세린, 트레오닌, 또는 아스파르트산이고,
Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고,
Xaa27은 트레오닌이거나, 부존재하며,
Xaa28은 프롤린, 글루탐산, 또는 아스파르트산이거나, 부존재함.
다른 구체예로서, 상기 X는 상기 일반식 2로 표시되는 서열번호: 55의 A-쇄와, 서열번호: 54의 B-쇄를 포함하는, 인슐린 아날로그인 것을 특징으로 한다.
다른 구체예로서, 상기 X는 상기 서열번호: 53의 A-쇄와 일반식 3으로 표시되는 서열번호: 56의 B-쇄를 포함하는, 인슐린 아날로그인 것을 특징으로 한다.
다른 구체예로서, 상기 일반식 2에서,
Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신, 히스티딘, 라이신, 알라닌 또는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고, Xaa21은 아스파라긴이며,
상기 일반식 3에서,
Xaa16은 티로신, 글루탐산, 세린, 트레오닌, 또는 아스파르트산이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서,
상기 일반식 2에서,
Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 또는 세린이고, Xaa21은 아스파라긴이며,
상기 일반식 3에서,
Xaa16은 티로신, 글루탐산, 세린, 또는 아스파르트산이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서,
상기 X는
(1) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 히스티딘이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(2) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 라이신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(3) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 글루탐산이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(4) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 세린이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(5) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(6) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 글루탐산이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(7) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 세린이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(8) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 트레오닌이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(9) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 알라닌이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(10) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(11) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 아스파르트산이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(12) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 아스파르트산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
(13) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서, 상기 X는 서열번호: 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 및 52로 이루어진 군에서 선택된 아미노산 서열을 포함하는 인슐린 아날로그인 것을 특징으로 한다.
다른 구체예로서, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 글루탐산이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 세린이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서,
상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서,
상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 아스파르트산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 것을 특징으로 한다.
다른 구체예로서, 상기 F는 고분자 중합체, 지방산, 콜레스테롤, 알부민 및 이의 단편, 알부민 결합물질, 특정 아미노산 서열의 반복단위의 중합체, 항체, 항체 단편, FcRn 결합물질, 생체 내 결합조직, 뉴클레오타이드, 파이브로넥틴, 트랜스페린(Transferrin), 사카라이드(saccharide), 헤파린, 및 엘라스틴으로 이루어진 군에서 선택되는 것을 특징으로 한다.
다른 구체예로서, 상기 고분자 중합체는 폴리에틸렌 글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 폴리비닐알콜, 폴리사카라이드, 덱스트란, 폴리비닐에틸에테르, 생분해성 고분자, 지질 중합체, 키틴, 히아루론산, 올리고뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
다른 구체예로서, 상기 F는 면역글로불린 Fc 영역인 것을 특징으로 한다.
다른 구체예로서, 상기 F는 IgG Fc 영역인 것을 특징으로 한다.
다른 구체예로서, 상기 L은 펩타이드, 지방산, 사카라이드 (saccharide), 고분자 중합체, 저분자 화합물, 뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
다른 구체예로서, 상기 고분자 중합체는 폴리에틸렌 글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 폴리비닐알콜, 폴리사카라이드, 덱스트란, 폴리비닐에틸에테르, 생분해성 고분자, 지질 중합체, 키틴, 히아루론산, 올리고뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
다른 구체예로서, 상기 L은 폴리에틸렌 글리콜인 것을 특징으로 한다.
다른 구체예로서, 상기 고분자 중합체는 1 내지 100kDa의 분자량을 가지는 것을 특징으로 한다.
다른 구체예로서, 상기 인슐린 아날로그의 B-쇄의 N-말단 또는 인슐린 아날로그 내의 라이신 잔기에 링커가 연결된 것을 특징으로 한다.
다른 구체예로서, 상기 F는 면역글로불린 Fc 영역이고, 면역글로불린 Fc 영역의 N-말단에 링커가 연결된 것을 특징으로 한다.
다른 구체예로서, 상기 F는 면역글로불린 Fc 영역이고, 상기 결합체는 링커의 양 말단이 각각 인슐린 아날로그의 B-쇄의 N-말단과 면역글로불린 Fc의 N-말단에 연결된 구조인 것을 특징으로 한다.
다른 구체예로서, 상기 인슐린 아날로그는 천연형 인슐린 대비 천연형 인슐린 수용체에 대한 결합력이 저하된 것을 특징으로 한다.
다른 구체예로서, 상기 인슐린 아날로그의 천연형 인슐린 수용체에 대한 결합력은 천연형 인슐린의 약 10% 내지 약 90%인 것을 특징으로 한다.
다른 구체예로서, 상기 결합체는 F가 면역글로불린 Fc 영역이고, L이 폴리에틸렌글리콜이며 천연형 인슐린 수용체에 대한 결합력은 천연형 인슐린의 0.1% 내지 50%인 것을 특징으로 한다.
다른 구체예로서, 상기 결합체는 F가 면역글로불린 Fc 영역이고, L이 폴리에틸렌글리콜이며 X가 A-쇄 14번 아미노산이 아스파르트산인 것 외에는 천연형 인슐린과 서열이 동일한 인슐린 아날로그인 것을 특징으로 한다.
본 발명을 구현하는 다른 양태는 상기 결합체를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터, 및 상기 폴리뉴클레오티드 또는 이를 포함하는 벡터를 포함하는 형질전환체이다.
본 발명을 구현하는 다른 양태는 상기 결합체의 제조방법이다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 결합체를 포함하는 조성물이다.
하나의 구체예로서, 상기 조성물은 약학적 조성물인 것을 특징으로 한다.
다른 구체예로서, 상기 조성물은 인슐린 관련 질환의 예방 또는 치료용 약학적 조성물인 것을 특징으로 한다.
다른 구체예로서, 상기 조성물은 당뇨병의 예방 또는 치료용 약학적 조성물인 것을 특징으로 한다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 인슐린 아날로그의 결합체를 포함하는, 천연형 인슐린의 결합체 대비 생체 내 지속성 및/또는 안정성이 증대된, 지속성 제제이다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 인슐린 아날로그의 결합체 또는 이의 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 인슐린 관련 질환을 치료하는 방법이다.
하나의 양태로서, 상기 인슐린 관련 질환은 당뇨병인 것을 특징으로 한다.
본 발명을 구현하기 위한 다른 하나의 양태는 약제의 제조에 있어 상기 인슐린 아날로그의 결합체의 용도이다.
하나의 양태로서, 상기 약제는 인슐린 관련 질환의 예방 또는 치료용인 것을 특징으로 한다.
다른 양태로서, 상기 약제는 당뇨병의 예방 또는 치료용인 것을 특징으로 한다.
본 발명을 구현하기 위한 다른 하나의 양태는 인슐린 관련 질환, 구체적으로 당뇨병의 치료에 있어 상기 인슐린 아날로그의 결합체의 용도이다.
본 발명에 따른 비천연형인 인슐린 아날로그의 결합체는 인슐린 투여를 필요로 하는 환자들의 편리성을 증대시킬 수 있다.
도 1은 인슐린 아날로그의 순도를 단백질 전기영동으로 분석한 결과를 나타낸 도이다. 대표로 인슐린 아날로그인 9, 10, 11, 12번 아날로그에 대한 결과이다.
1번 레인: 절편 크기 표시(size marker), 2번 레인: 천연형 인슐린, 3번 레인: 인슐린 아날로그 9번, 4번 레인: 인슐린 아날로그 10번, 5번 레인: 인슐린 아날로그 11번, 6번 레인: 인슐린 아날로그 12번
도 2a 내지 2d는 인슐린 아날로그의 순도를 고압 크로마토그래피로 분석한 결과이다. 대표로 인슐린 아날로그 9, 10, 11, 12번 아날로그에 대한 결과를 차례로 나타내었다 (도 2a 내지 2d). 각 도면에서 위에서부터 차례로 RP-HPLC (C18), RP-HPLC (C4) 및 SE-HPLC 결과를 나타낸다.
도 3a 내지 3c는 본 발명에 따른 대표적인 인슐린 아날로그 결합체인 「인슐린 아날로그 10 - PEG - 면역글로불린 Fc」와 천연형 인슐린 결합체인 「천연형 인슐린 - PEG - 면역글로불린 Fc」 결합체 간의 약동학적 특성을 정상 마우스 (도 3a), SD 랫트 (도 3b), 및 비글견 (도 3c)에서 비교 확인한 결과를 나타낸 것이다.
도 4는 본 발명에 따른 대표적인 인슐린 아날로그 결합체인 「인슐린 아날로그 10 - PEG - 면역글로불린 Fc」와 천연형 인슐린 결합체인 「천연형 인슐린 - PEG - 면역글로불린 Fc」 결합체 간의 혈당 강하 능력을 DIO/STZ 랫트에서 확인한 결과를 나타낸 것이다.
이하에서는, 본 발명을 더욱 상세히 설명한다.
한편, 본원에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본원에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 할 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다.
한편, 본 명세서 전반을 통하여, 아미노산에 대한 통상의 1문자 및 3문자 코드가 사용된다. 또한 본 명세서에서 약어로 언급된 아미노산은 IUPAC-IUB 명명법에 따라 기재되었다.
본 발명을 구현하기 위한 하나의 양태는 인슐린 아날로그의 결합체를 제공한다.
구체적으로, 상기 인슐린 아날로그의 결합체는 인슐린 아날로그에 이의 생체 내 반감기를 증가시키기 위한 생체적합성 물질이 결합된, 결합체 형태일 수 있다. 본 명세서에서 상기 생체적합성 물질은 캐리어와 혼용될 수 있다.
본 발명에서 상기 인슐린 아날로그의 결합체는 캐리어가 결합되지 않은 상기 인슐린 아날로그에 비하여 증가된 효력의 지속성을 나타낼 수 있으며, 본 발명에서는 이러한 결합체를 "지속형 결합체"로 지칭한다.
한편, 이러한 결합체는 비자연적인(non-naturally occurring) 것일 수 있다.
보다 구체적으로, 본 발명은 하기 화학식 1로 표시되는 결합체를 제공한다:
[화학식 1]
X - La - F
여기서, X는 천연형 인슐린 B-쇄의 16번 아미노산, B-쇄의 25번 아미노산, A-쇄의 14번 아미노산 및 A-쇄의 19번 아미노산으로 이루어진 군에서 선택된 하나 이상의 아미노산의 변이를 포함하는, 인슐린 아날로그이고;
L은 링커이며;
a는 0 또는 자연수이며, 다만 a가 2 이상일 때 각각의 L은 서로 독립적이고;
F는 X의 반감기를 증가시킬 수 있는 물질임.
본 발명에서 용어, "인슐린 아날로그(insulin analog)"란 천연형 인슐린과 상이한 비천연형 인슐린을 의미한다. 상기 인슐린 아날로그는 천연형 인간 인슐린과 상이한 비천연형 인간 인슐린을 포함한다. 상기 인슐린 아날로그는 본 발명의 결합체를 구성하는 일 모이어티(moeity)로서, 상기 화학식 1에서 X에 해당한다.
이러한 인슐린 아날로그는 천연형 인슐린의 일부 아미노산을 부가, 결실 또는 치환의 형태로 변형시킨 아날로그를 포함한다.
구체적으로, 본 발명의 인슐린 아날로그는 천연형 인슐린 서열과 서열 동일성을 비교하였을 때, 적어도 60% 이상, 65% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 또는 95% 이상의 서열 동일성을 가지는 것일 수 있다. 또한, 본 발명의 인슐린 아날로그는 천연형 인슐린 서열과 상기의 서열 동일성을 가지면서, 천연형 인슐린에 비해 천연형 인슐린 수용체에 대한 결합력이 저하된 것일 수 있다. 또한, 상기 인슐린 아날로그는 천연형 인슐린과 같이 글루코스 흡수능을 보유한 것일 수 있거나/있으며 생체 내에서 혈중 글루코스를 강하시키는 능력을 보유할 수 있다.
본 발명에서 천연형 인슐린 수용체에 대한 어떠한 인슐린 아날로그의 결합력이란 천연형 인슐린 수용체에 대한 어떠한 탐지자 리간드의 결합이 천연형 인슐린 또는 해당 인슐린 아날로그의 존재 하에서 억제되는 경쟁적 수용체 결합 저해(competitive inhibition of receptor binding) 조건 하에서 결합 저해도를 측정하였을 때 천연형 인슐린이 나타내는 결합 저해도와 인슐린 아날로그의 결합 저해도의 백분비를 의미한다. 여기서 결합 저해도는 적절한 기준에 따라 인슐린 수용체의 리간드 결합에 의하여 나타나는 신호가 유효하게 변화하는지 측정한 수치로 간접적으로 정의할 수 있다. 예를 들어 방사능 동위원소 등의 표지로 표지한 인슐린이 인슐린 수용체에 결합할 때 이 표지로부터 발생하는 신호가 표지가 없는 천연형 인슐린이나 인슐린 아날로그의 부가 후 각각 얼마나 줄어드거나 늘어나는지 측정(예를 들어 천연형 인슐린이나 인슐린 아날로그의 신호 감소를 위한 IC50값 측정)하여 얻은 측정값의 백분비(예를 들어 해당 인슐린 아날로그의 IC50에 대한 천연형 인슐린의 IC50의 백분비)로 결합력을 정의할 수 있다. 이러한 경쟁적 저해를 통한 수용체 결합력 측정은 이 분야에 잘 알려져 있다. 본 발명의 구체적 실시 형태에서 이러한 측정에 필요한 천연형 인슐린 수용체로는 사람 천연형 인슐린 수용체(A 아이소폼 또는 B 아이소폼 또는 양쪽 모두)를 발현하는 세포막, 예를 들어 유전공학적 방법을 통해 사람 천연형 인슐린 수용체를 과발현하도록 조작한 세포의 세포막을 이용할 수 있으며, 탐지자 리간드로는 요오드-125를 표지한 천연형 인슐린을 사용할 수 있다. 본 발명의 더 구체적인 실시 형태에서 수용체 결합의 경쟁적 저해의 측정에는 섬광 근접 측정법(scintillation proximity assay, SPA)을 이용할 수 있다. 더욱 구체적인 실시 형태에서는 실험예 1의 방법으로 인슐린 수용체에 대한 결합력을 측정할 수 있다.
보다 구체적으로, 본 발명의 인슐린 아날로그는 천연형 인슐린의 인슐린 수용체 결합력(100%)과 비교하여 약 99% 또는 그 이하, 약 95% 또는 그 이하, 약 90% 또는 그 이하, 약 85% 또는 그 이하, 약 80% 또는 그 이하, 약 75% 또는 그 이하, 약 70% 또는 그 이하, 약 65% 또는 그 이하, 약 60% 또는 그 이하, 약 55% 또는 그 이하, 약 50% 또는 그 이하, 약 45% 또는 그 이하, 약 40% 또는 그 이하, 약 35% 또는 그 이하, 약 30% 또는 그 이하, 약 25% 또는 그 이하, 약 20% 또는 그 이하, 약 15% 또는 그 이하, 약 10% 또는 그 이하, 약 9% 또는 그 이하, 약 8% 또는 그 이하, 약 7% 또는 그 이하, 약 6% 또는 그 이하, 약 5% 또는 그 이하, 약 4% 또는 그 이하, 약 3% 또는 그 이하, 약 2% 또는 그 이하, 약 1% 또는 그 이하, 또는 약 0.1% 또는 그 이하의 인슐린 수용체에 대한 결합력을 나타낼 수 있다(다만, 본 발명의 인슐린 아날로그는 인슐린 수용체에 대한 결합력이 0%에 해당하지는 않는다). 본 발명의 한 구체적인 실시 형태에서 인슐린 아날로그의 천연형 인슐린 수용체에 대한 결합력은 천연형 인슐린의 약 10% 내지 약 90%인 것이 적절하나 그 수치는 한정되지 않으며 결합력이 천연형 인슐린 대비 약하면 본 발명의 범주에 속한다. 결합력이 천연형 인슐린 대비 약할 경우 인슐린 수용체에 의한 인슐린 아날로그의 제거가 약화되어 혈중 반감기가 향상되고 효력의 지속력을 기대할 수 있다.
본 발명의 한 실시 형태에서 인슐린 아날로그 결합체는 링커가 폴리에틸렌글리콜이고, 반감기를 증가시킬 수 있는 물질이 면역글로불린 Fc 영역이고, 천연형 인슐린 수용체에 대한 결합력이 천연형 인슐린의 약 99% 또는 그 이하, 약 95% 또는 그 이하, 약 90% 또는 그 이하, 약 85% 또는 그 이하, 약 80% 또는 그 이하, 약 75% 또는 그 이하, 약 70% 또는 그 이하, 약 65% 또는 그 이하, 약 60% 또는 그 이하, 약 55% 또는 그 이하, 약 50% 또는 그 이하, 약 45% 또는 그 이하, 약 40% 또는 그 이하, 약 35% 또는 그 이하, 약 30% 또는 그 이하, 약 25% 또는 그 이하, 약 20% 또는 그 이하, 약 15% 또는 그 이하, 약 10% 또는 그 이하, 약 9% 또는 그 이하, 약 8% 또는 그 이하, 약 7% 또는 그 이하, 약 6% 또는 그 이하, 약 5% 또는 그 이하, 약 4% 또는 그 이하, 약 3% 또는 그 이하, 약 2% 또는 그 이하, 약 1% 또는 그 이하, 또는 약 0.1% 또는 그 이하의 인슐린 수용체에 대한 결합력을 나타낼 수 있다(다만, 본 발명의 인슐린 아날로그 결합체는 인슐린 수용체에 대한 결합력이 0%에 해당하지는 않는다). 본 발명의 한 구체적인 실시 형태에서 인슐린 아날로그 결합체의 천연형 인슐린 수용체에 대한 결합력은 천연형 인슐린의 0.1 내지 50%인 것이 적절하나 그 수치는 한정되지 않으며 결합력이 천연형 인슐린 대비 약하면 본 발명의 범주에 속한다. 결합력이 천연형 인슐린 대비 약할 경우 인슐린 수용체에 의한 인슐린 아날로그 결합체의 제거가 약화되어 혈중 반감기가 향상되고 효력의 지속력을 기대할 수 있다.
본 발명에서 용어, "약"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
또한, 본 발명의 인슐린 아날로그는 천연형 인슐린과 같이 글루코스 흡수능을 보유할 수 있다.
구체적으로, 본 발명에 따른 인슐린 아날로그는 천연형 인슐린의 글루코스 흡수능 (100%) 대비 약 10% 이상, 약 20% 이상, 약 30% 이상, 약 40% 이상, 약 50% 이상, 약 55% 이상, 약 60% 이상, 약 65% 이상, 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85% 이상, 약 90% 이상, 약 95% 이상, 약 100% 이상, 약 110% 이상, 약 120% 이상, 약 130% 이상, 약 140% 이상, 약 150% 이상, 약 160% 이상, 약 170% 이상, 약 180% 이상, 약 190% 이상, 또는 약 200% 이상의 글루코스 흡수능을 보유한 것일 수 있다.
글루코스 흡수능의 측정은 당업계에 공지된 다양한 글루코스 흡수능 측정 방법을 이용하여 달성될 수 있다.
구체적으로, 상기 인슐린 아날로그는 천연형의 A쇄와 B쇄에 각각 대응하는 두 서열 부위들이 하나의 폴리펩타이드 사슬 안에 연결되어 있는 단쇄이거나, 이러한 서열 부위들이 각각 독립된 폴리펩타이드 사슬로 이루어져 있는 두 폴리펩타이드 사슬 형태일 수 있다. 이하 본 명세서에서 인슐린 아날로그의 A-쇄 또는 B-쇄라고 일컬을 때에는 해당 인슐린 아날로그가 두 폴리펩타이드 사슬 형태일 때의 그 구성 A-쇄 또는 B-쇄를 가리키는 것뿐 아니라, 아날로그가 단쇄 형태일 때에도 해당 단쇄 폴리펩타이드 내에서 천연형 A-쇄에 대응하는 서열 부위 혹은 천연형 B-쇄에 대응하는 서열 부위를 각각 가리키는 의미로 경우에 맞게 해석하여야 한다. 본 발명의 인슐린 아날로그는 천연형 인슐린의 A-쇄 또는 이에 대응되는 폴리펩타이드로부터 선택하는 하나와 천연형 인슐린의 B-쇄 혹은 이에 대응되는 폴리펩타이드로부터 선택한 한 사슬의 조합인 단쇄 또는 두 폴리펩타이드 사슬 형태일 수 있다. 여기서, 상기 천연형 인슐린의 A-쇄 혹은 B-쇄에 대응된다는 것은 예를 들어 해당 폴리펩타이드 중 어느 하나를 천연형 인슐린의 A-쇄 또는 B-쇄와 서열 동일성을 비교하였을 때, 적어도 60% 이상, 65% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 또는 95% 이상의 서열 동일성을 가지는 경우인데, 특별히 이에 제한되지는 않으며, 해당 폴리펩타이드를 구성하는 서열과 천연형 인슐린의 A-쇄 혹은 B-쇄의 서열과의 비교를 통하여 당업자가 용이하게 파악할 수 있다.
상술한 바와 같이, 여기에 기술된 내용은 인슐린 아날로그의 하위 개념에 대한 설명에도 모두 적용되는 것으로 의도된다.
천연형 인슐린은 췌장에서 분비되는 호르몬으로서 일반적으로 세포 내 글루코스 흡수를 촉진하고 지방의 분해를 억제하여 체내의 혈당을 조절하는 역할을 한다. 인슐린은 혈당조절 기능이 없는 프로인슐린(proinsulin) 전구체의 형태에서 프로세싱을 거쳐 혈당 조절 기능을 가지는 인슐린이 된다. 인슐린은 2개의 폴리펩티드 쇄, 즉 각각 21개 및 30개 아미노산 잔기를 포함하는 A-쇄 및 B-쇄로 구성되어 있고, 이들은 2개의 이황화 다리로 상호 연결되어 있다. 천연형 인슐린의 A-쇄 및 B-쇄는 각각 하기 서열번호: 53 및 54로 표시되는 아미노산 서열을 포함한다.
A-쇄:
Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn (서열번호: 53)
B-쇄:
Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys-Thr (서열번호: 54)
본 발명의 일 실시양태에 따르면, 본원에 기술된 인슐린 아날로그는 천연형 인슐린과 같이 생체 내에서 혈당 조절 기능을 보유하면서 수용체 결합력이 저하된 것일 수 있다. 보다 구체적으로, 상기 인슐린 아날로그는 생체 내에서 혈중 글루코스를 강하시키는 능력을 보유할 수 있다.
또한, 본 발명의 일 실시양태에서 상기 인슐린 아날로그는 낮은 수용체-매개 내재화 (receptor-mediated internalization) 또는 수용체-매개 제거 (receptor-mediated clearance)를 나타낼 수 있다면 특별히 그 종류 및 크기에 제한되지 않을 수 있다. 이에 따라, 본 발명의 인슐린 아날로그는 천연형 인슐린에 비해 증가된 혈중 반감기를 나타낼 수 있다.
본 발명의 인슐린 아날로그는 역방향 인슐린, 천연형 인슐린의 유도체, 천연형 인슐린의 단편 등을 포함한다. 이러한 인슐린 아날로그는 유전자 재조합법뿐만 아니라, 고상(solid phase) 방법으로도 제조할 수 있으며, 이에 제한되는 것은 아니다.
본 발명에서 용어, "천연형 인슐린의 유도체"는 천연형 인슐린과 비교하여 아미노산 서열에 하나 이상의 차이가 있는 펩타이드, 천연형 인슐린 서열을 개질 (modification)을 통하여 변형시킨 펩타이드, 천연형 인슐린과 같이 생체 내의 혈당 조절 기능을 조절하는 천연형 인슐린의 모방체를 포함한다. 이러한 천연형 인슐린의 유도체는 생체 내 혈당 조절 기능을 가지는 것일 수 있다.
구체적으로, 천연형 인슐린의 유도체는 천연형 인슐린에서 일부 아미노산이 치환 (substitution), 추가 (addition), 제거 (deletion) 및 수식 (modification) 중 어느 하나의 방법 또는 이러한 방법들의 조합을 통하여 변형시킬 수 있다.
구체적으로, 천연형 인슐린의 A-쇄, B-쇄와 각각 적어도 80% 이상 아미노산 서열에서 상동성을 보이는 것일 수 있고/있거나 인슐린의 아미노산 한 잔기의 일부 그룹이 화학적으로 치환 (예; alpha-methylation, alpha-hydroxylation), 제거 (예; deamination) 또는 수식 (예; N-methylation) 된 형태일 수 있으나, 이에 제한되는 것은 아니다.
유도체 제조를 위한 여러 방법들의 조합으로 본 발명에 적용되는 천연형 인슐린의 유도체를 제조할 수 있다.
또한, 천연형 인슐린의 유도체의 제조를 위한 이러한 변형은 L-형 혹은 D-형 아미노산, 및/또는 비-천연형 아미노산을 이용한 변형; 및/또는 천연형 서열을 개질 혹은 번역 후 변형 (예, 메틸화, 아실화, 유비퀴틴화, 분자 내 공유결합 등) 함으로써 변형하는 것을 모두 포함한다.
또한, 상기 천연형 인슐린의 유도체는 천연형 인슐린의 아미노 및/또는 카르복시 말단에 하나 또는 그 이상의 아미노산이 추가된 것을 모두 포함한다.
상기 치환되거나 추가되는 아미노산은 인간 단백질에서 통상적으로 관찰되는 20개의 아미노산뿐만 아니라 비정형 또는 비-자연적 발생 아미노산을 사용할 수 있다. 비정형 아미노산의 상업적 출처에는 Sigma-Aldrich, ChemPep과 Genzyme pharmaceuticals가 포함된다. 이러한 아미노산이 포함된 펩타이드와 정형적인 펩타이드 서열은 상업화된 펩타이드 합성 회사, 예를 들어 미국의 American peptide company나 Bachem, 또는 한국의 Anygen을 통해 합성 및 구매 가능하나, 특별히 이에 제한되지 않는다.
본 발명에서 용어, "천연형 인슐린 혹은 천연형 인슐린의 유도체의 단편"은 천연형 인슐린 혹은 천연형 인슐린의 유도체의 아미노 말단 혹은 카르복시 말단에 하나 또는 그 이상의 아미노산이 제거된 형태를 말한다. 이러한 인슐린 단편은 체내에서 혈당조절 기능을 보유할 수 있다.
또한, 본 발명의 인슐린 아날로그는 상기 천연형 인슐린의 유도체 및 단편의 제조에 사용된 각각의 제조 방법이 독립적으로 사용되거나, 조합되어 사용되어 제조된 것일 수 있다.
구체적으로, 본 발명에 따른 인슐린 아날로그는 상기와 같은 천연형 인슐린의 A-쇄 및 B-쇄에서 특정 아미노산 잔기의 변형을 포함하는 것으로, 구체적으로는 천연형 인슐린의 A-쇄의 특정 아미노산 잔기가 변형되고/되거나 B-쇄의 특정 아미노산 잔기가 변형된 것일 수 있다.
구체적으로, 상기 인슐린 아날로그는 천연형 인슐린 B-쇄의 16번 아미노산, B-쇄의 25번 아미노산, A-쇄의 14번 아미노산, A-쇄의 19번 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산이 다른 아미노산으로 치환된 것일 수 있으며, 그 예로 글루탐산, 세린, 트레오닌, 아스파르트산, 히스티딘, 라이신, 또는 알라닌으로 치환된 것일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 기술된 아미노산들 중 1 이상, 2 이상, 3 이상, 또는 4개 가 본래의 아미노산이 아닌 다른 아미노산으로 치환된 것일 수 있다.
구체적으로, 상기 변이는 인슐린 B-쇄의 16번 아미노산인 티로신의 글루탐산, 세린, 트레오닌, 또는 아스파르트산으로의 변이; 인슐린 B-쇄의 25번 아미노산인 페닐알라닌의 아스파르트산 또는 글루탐산으로의 변이; 인슐린 A-쇄의 14번 아미노산인 티로신의 히스티딘, 라이신, 알라닌, 또는 아스파르트산으로의 변이; 또는 인슐린 A-쇄의 19번 아미노산인 티로신의 글루탐산, 세린, 또는 트레오닌으로의 변이일 수 있다.
따라서, 상기 인슐린 아날로그는 천연형 인슐린 B-쇄의 16번 아미노산인 티로신의 글루탐산, 세린, 트레오닌, 또는 아스파르트산으로의 변이; 및/또는 천연형 인슐린 B-쇄의 25번 아미노산인 페닐알라닌의 아스파르트산 또는 글루탐산으로의 변이; 및/또는 천연형 인슐린 A-쇄의 14번 아미노산인 티로신의 히스티딘, 라이신, 알라닌, 또는 아스파르트산으로의 변이; 및/또는 천연형 인슐린 A-쇄의 19번 아미노산인 티로신의 글루탐산, 세린, 또는 트레오닌으로의 변이를 포함할 수 있다. 그러나, 이에 제한되는 것은 아니다.
보다 구체적으로는, 상기 인슐린 아날로그는 하기 일반식 2로 표시되는 서열번호: 55 의 A-쇄와 하기 일반식 3으로 표시되는 서열번호: 56의 B-쇄를 포함하는 인슐린 아날로그일 수 있다. 이러한 인슐린 아날로그는 A-쇄와 B-쇄 서열이 이황화 결합으로 상호 연결된 형태이거나, 프로인슐린의 형태일 수 있으나, 이에 제한되는 것은 아니다.
[일반식 2]
Xaa1-Ile-Val-Glu-Xaa5-Cys-Cys-Thr-Ser-Ile-Cys-Xaa12-Leu-Xaa14-Gln-Xaa16-Glu-Asn-Xaa19-Cys-Xaa21 (서열번호: 55)
상기 일반식 2에서,
Xaa1는 알라닌, 글리신, 글루타민, 히스티딘, 글루탐산 또는 아스파라긴이고,
Xaa5는 알라닌, 글루탐산, 글루타민, 히스티딘 또는 아스파라긴이고,
Xaa12는 알라닌, 세린, 글루타민, 글루탐산, 히스티딘 또는 아스파라긴이고,
Xaa14는 티로신, 히스티딘, 라이신, 알라닌 또는 아스파르트산이고,
Xaa16는 알라닌, 류신, 티로신, 히스티딘, 글루탐산 또는 아스파라긴이고,
Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고,
Xaa21은 아스파라긴, 글리신, 히스티딘, 또는 알라닌임.
[일반식 3]
Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Xaa16-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Xaa25-Tyr-Xaa27-Xaa28-Lys-Thr(서열번호: 56)
상기 일반식 3에서,
Xaa16은 티로신, 글루탐산, 세린, 트레오닌, 또는 아스파르트산이고,
Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고,
Xaa27은 트레오닌이거나, 부존재하며,
Xaa28은 프롤린, 글루탐산, 또는 아스파르트산이거나, 부존재함.
여기서, A-쇄가 서열번호: 53과 일치하면서도, B-쇄가 서열번호: 54의 B-쇄와 일치하는 펩티드는 제외될 수 있다.또한, 상기 기술한 특징적인 아미노산 잔기, 특히 A-쇄의 14번 아미노산 및/또는 19번 아미노산 및/또는 B-쇄의 16번 아미노산, 및/또는 25번 아미노산에 대한 특징적인 변이 (즉, 천연형 인슐린에 존재하지 않는 아미노산 잔기)를 포함하면서, 상기 일반식 2의 A-쇄 및 일반식 3의 B-쇄를 포함하는 인슐린 아날로그와 70% 이상, 구체적으로는 80% 이상, 보다 구체적으로는 90% 이상, 보다 더 구체적으로는 95% 이상의 상동성을 가지며, 천연형 인슐린에 비하여 수용체 결합력이 감소된 펩타이드 역시 본 발명의 범주에 포함된다.
본 발명에서 용어, "상동성(homology)"은 천연형(wild type) 단백질의 아미노산 서열 또는 이를 코딩하는 폴리뉴클레오티드 서열과의 유사한 정도를 나타내기 위한 것으로서, 본 발명의 아미노산 서열 또는 폴리뉴클레오티드 서열과 상기와 같은 퍼센트 이상의 동일한 서열을 가지는 서열을 포함한다. 이러한 상동성은 두 서열을 육안으로 비교하여 결정할 수도 있으나, 비교대상이 되는 서열을 나란히 배열하여 상동성 정도를 분석해 주는 생물정보 알고리즘(bioinformatic algorithm)을 사용하여 결정할 수 있다. 상기 두 개의 아미노산 서열 사이의 상동성은 백분율로 표시할 수 있다. 유용한 자동화된 알고리즘은 Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA)의 GAP, BESTFIT, FASTA와 TFASTA 컴퓨터 소프트웨어 모듈에서 이용가능하다. 상기 모듈에서 자동화된 배열 알고리즘은 Needleman & Wunsch와 Pearson & Lipman과 Smith & Waterman 서열 배열 알고리즘을 포함한다. 다른 유용한 배열에 대한 알고리즘과 상동성 결정은 FASTP, BLAST, BLAST2, PSIBLAST와 CLUSTAL W를 포함하는 소프트웨어에서 자동화되어 있다.
구체적인 하나의 양태예서, 상기 인슐린 아날로그는 상기 일반식 2로 표시되는 서열번호: 55의 A-쇄와, 서열번호: 54의 B-쇄를 포함하는 것일 수 있으며, 상기 서열번호: 53의 A-쇄와 일반식 3으로 표시되는 서열번호: 56의 B-쇄를 포함하는, 인슐린 아날로그일 수도 있으나, 특별히 이에 제한되는 것은 아니다.
보다 구체적으로, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신, 히스티딘, 라이신, 알라닌 또는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신, 글루탐산, 세린, 트레오닌, 또는 아스파르트산이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 인슐린 아날로그일 수 있으나, 이에 제한되는 것은 아니다.
보다 구체적으로, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 또는 세린이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신, 글루탐산, 세린, 또는 아스파르트산이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린일 수 있으나, 이에 제한되는 것은 아니다.
보다 구체적으로, 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신 또는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린일 수 있으나, 이에 제한되는 것은 아니다.
구체적인 일 실시양태에 따르면, 본 발명에 따른 인슐린 아날로그는 하기에 해당할 수 있다:
(1) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 히스티딘이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(2) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 라이신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(3) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 글루탐산이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(4) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 세린이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(5) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(6) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 글루탐산이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(7) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 세린이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(8) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 트레오닌이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(9) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 알라닌이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(10) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(11) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 아스파르트산이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(12) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 아스파르트산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
(13) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인 인슐린 아날로그.
또한, 구체적인 일 실시양태에 따르면, 상기 인슐린 아날로그는 서열번호: 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 및 52로 이루어진 군에서 선택된 아미노산 서열을 포함하는 인슐린 아날로그일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 따른 인슐린 아날로그는 상기 기술된 특정 서열을 포함하는 것, 상기 기술된 특정 서열로 (필수적으로) 구성된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본원에서 '특정 서열번호로 구성되는 펩타이드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 펩타이드와 동일 혹은 상응하는 활성을 가지는 경우라면 해당 서열번호의 아미노산 서열 앞뒤의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이 (silent mutation)를 제외하는 것이 아니며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본원의 범위 내에 속하는 것이 자명하다.
한편, 상기 인슐린 아날로그는 펩타이드 그 자체, 이의 염 (예컨대, 상기 펩타이드의 약학적으로 허용가능한 염), 또는 이의 용매화물의 형태를 모두 포함한다.
또한, 펩타이드는 약학적으로 허용되는 임의의 형태일 수 있다.
상기 염의 종류는 특별히 제한되지는 않는다. 다만, 개체, 예컨대 포유류에게 안전하고 효과적인 형태인 것이 바람직하나, 특별히 이에 제한되는 것은 아니다.
상기 용어, "약학적으로 허용되는"은 의약학적 판단의 범위 내에서，과도한 독성，자극, 또는 알레르기 반응 등을 유발하지 않고 원하는 용도에 효과적으로 사용 가능한 물질을 의미한다.
본 발명에서 용어, "약학적으로 허용되는 염"이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. 적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산，말레산, 인산, 글리콜산, 락트산, 살리실산，숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산，시트르산, 메탄설폰산，포름산, 벤조산, 말론산, 나프탈렌-2-설폰산， 벤젠설폰산 등을 들 수 있다. 적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속，마그네슘 등의 알칼리 토금속，및 암모늄 등을 포함할 수 있다.
또한, 본 발명에서 사용된 용어 "용매화물"은 본 발명에 따른 펩타이드 또는 이의 염이 용매 분자와 복합체를 형성한 것을 말한다.
상기 인슐린 아날로그는 펩타이드 제조에 대해 당업계에 공지된 방법을 이용하여 당업자가 용이하게 생산할 수 있다. 예컨대, 다음과 같은 단계를 포함하는 방법으로 생산할 수 있다.
a) 상기 인슐린 아날로그를 코딩하는 핵산을 포함하는 형질전환체를 배양하여 인슐린 아날로그를 발현시키는 단계; 및
b) 발현된 인슐린 아날로그를 분리 및 정제하는 단계.
본 발명에서 형질전환체의 배양에 사용되는 배지는 적절한 방식으로 숙주세포 배양의 요건을 충족해야 한다. 숙주세포의 생장을 위하여 배지 중에 포함될 수 있는 탄소원은 제조된 형질전환체의 종류에 따라 당업자의 판단에 의해 적절하게 선택될 수 있고, 배양 시기 및 양을 조절하기 위해 적당한 배양 조건을 채택할 수 있다.
사용될 수 있는 당원으로는 글루코스, 사카로스, 락토스, 프룩토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함된다. 질소원 또한 개별적으로 또는 혼합물로서 사용될 수 있다.
사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함된다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다.
마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양 도중에 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다. 수산화나트륨, 수산화칼륨, 암모니아와 같은 염기성 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예: 공기)를 주입한다.
본 발명에 따른 형질전환체의 배양은 보통 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃의 온도에서 수행된다. 또한 배양은 원하는 인슐린 아날로그의 생성량이 최대로 얻어질 때까지 지속되는데, 이러한 목적으로 배양은 보통 10 내지 160시간 동안 지속될 수 있다.
전술한 바와 같이 숙주세포에 따라 적절한 배양 조건을 조성해주면 본 발명에 따른 형질전환체는 인슐린 아날로그를 생산하게 되며, 벡터의 구성 및 숙주세포의 특징에 따라 생산된 인슐린 아날로그는 숙주세포의 세포질 내, 원형질막 공간(periplasmic space) 또는 세포 외로 분비될 수 있다.
숙주세포 내 또는 외에서 발현된 단백질은 통상의 방식으로 정제될 수 있다. 정제 방법의 예로는 염석(예: 황산암모늄 침전, 인산나트륨 침전 등), 용매 침전(예: 아세톤, 에탄올 등을 이용한 단백질 분획 침전 등), 투석, 겔 여과, 이온 교환, 역상 칼럼 크로마토그래피와 같은 크로마토그래피 및 한외여과 등의 기법을 단독 또는 조합하여 적용할 수 있다.
본 발명의 구체예에서는, 형질전환체로부터 봉입체 형태로 발현된 인슐린 아날로그를 분리 및 정제하기 위하여 하기 단계를 추가적으로 포함할 수 있다:
b-1) 상기 a) 단계의 배양액으로부터 형질전환체를 수확하여 파쇄하는 단계;
b-2) 파쇄된 세포 용해물로부터 발현된 인슐린 아날로그를 회수하여 리폴딩하는 단계;
b-3) 리폴딩된 인슐린 아날로그를 양이온 교환 크로마토그래피로 정제하는 단계;
b-4) 정제된 인슐린 아날로그를 트립신 및 카복시펩티다제 B로 처리하는 단계;
b-5) 처리된 인슐린 아날로그를 양이온 교환 크로마토그래피 및 음이온 교환 크로마토그래피 또는 역상 크로마토그래피로 순차적으로 정제하는 단계.
본 발명에서 상기 인슐린 아날로그를 코딩하는 핵산은 구체적으로는 서열번호: 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 및 51로 기재되는 염기서열을 포함한다. 본 발명은 일 실시양태에서 서열번호: 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 및 51로 기재되는 염기 서열뿐만 아니라 상기 서열과 70% 이상의 상동성, 구체적으로는 80% 이상의 상동성, 더욱 구체적으로는 90% 이상의 상동성, 보다 더 구체적으로는 95% 이상의 상동성, 가장 구체적으로는 98% 이상의 상동성을 나타내는 서열로서, 실질적으로 핵산이 코딩한 펩티드가 생체 내 혈당조절 기능을 보유하면서, 천연형 인슐린에 비해 수용체 결합력이 저하된 것을 모두 포함한다.
본 발명에 따른 재조합 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있고, 원핵세포 또는 진핵세포를 숙주세포로 하여 구축될 수 있다.
본 발명에서 용어, "벡터"란 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 재조합 벡터로서, 핵산 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절요소를 포함하는 핵산 구조물(construct)을 의미한다. 본 발명은 인슐린 아날로그를 코딩하는 핵산을 포함하는 재조합 벡터를 제조할 수 있는데, 상기 재조합 벡터를 숙주세포에 형질전환(transformation) 또는 형질감염(transfection) 시킴으로써, 본 발명의 인슐린 아날로그를 수득할 수 있다.
본 발명에서 인슐린 아날로그를 코딩하는 핵산은 프로모터에 작동 가능하게 연결될 수 있다.
본 발명에 따른 인슐린 아날로그를 코딩하는 핵산을 포함하는 재조합 벡터를 형질전환시키기 위한 방법은 상기 예들에 국한되지 않으며, 당업계에서 통상적으로 사용되는 형질전환 또는 형질감염 방법이 제한 없이 사용될 수 있다.
목적 핵산인 인슐린 아날로그를 코딩하는 핵산을 포함하는 재조합 벡터를 숙주세포 내로 도입함으로써 본 발명의 형질전환체(transformant)를 획득할 수 있다.
본 발명에 적합한 숙주는 본 발명의 핵산을 발현하도록 하는 한 특별히 제한되지 않는다. 본 발명에 사용될 수 있는 숙주의 특정한 예로는 대장균(E. coli)과 같은 에스케리키아(Escherichia) 속 세균; 바실러스 서브틸리스(Bacillus subtilis)와 같은 바실러스(Bacillus) 속 세균; 슈도모나스 푸티다(Pseudomonas putida)와 같은 슈도모나스(Pseudomonas) 속 세균; 피키아 파스토리스(Pichia pastoris), 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 스키조사카로마이세스 폼베(Schizosaccharomyces pombe)와 같은 효모; 스포도프테라 프루기페르다(SF9)와 같은 곤충세포; 및 CHO, COS, BSC 등과 같은 동물세포가 있다. 구체적으로는, 숙주세포로 대장균을 사용할 수 있으나, 이에 제한되지 않는다.
한편, 상기 결합체에서 F는 X의 반감기를 증가시킬 수 있는 물질로서, 본 발명의 상기 결합체를 구성하는 모이어티의 일 구성에 해당한다.
상기 F는 X와 공유 화학결합 또는 비공유 화학결합으로 서로 결합되는 것일 수 있으며, 공유 화학결합, 비공유 화학결합 또는 이들의 조합으로 L을 통하여 F와 X가 서로 결합되는 것일 수 있다.
보다 구체적으로, X와 L, 및 L과 F는 공유결합으로 서로 연결되는 것일 수 있으며, 이때 상기 결합체는 화학식 1의 순서로, X, L, 및 F가 공유결합을 통하여 각각 연결된 결합체이다.
상기 X의 반감기를 증가시킬 수 있는 물질은 생체적합성 물질일 수 있으며, 예를 들어, 고분자 중합체, 지방산, 콜레스테롤, 알부민 및 이의 단편, 알부민 결합물질, 특정 아미노산 서열의 반복단위의 중합체, 항체, 항체 단편, FcRn 결합물질, 생체 내 결합조직, 뉴클레오타이드, 파이브로넥틴, 트랜스페린(Transferrin), 사카라이드(saccharide), 헤파린, 및 엘라스틴으로 이루어진 군에서 선택되는 것일 수 있으나, 특별히 이에 제한되지 않는다.
상기 엘라스틴의 경우 수용성 전구체인 인간 트로포엘라스틴 (tropoelastin) 일 수 있으며, 이들 중 일부 서열 혹은 일부 반복단위의 중합체일 수 있으며, 예컨대, 엘라스틴 유사 폴리펩타이드인 경우를 모두 포함하나, 특별히 이에 제한되는 것은 아니다.
상기 고분자 중합체의 예로, 폴리에틸렌 글리콜 (PEG), 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 폴리비닐알콜, 폴리사카라이드, 덱스트란, 폴리비닐에틸에테르, 생분해성 고분자, 지질 중합체, 키틴, 히아루론산, 올리고뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는 고분자 중합체를 들 수 있으나, 특별히 이에 제한되지 않는다.
상기 폴리에틸렌 글리콜은, 에틸렌 글리콜 동종 중합체, PEG 공중합체, 또는 모노메틸-치환된 PEG 중합체 (mPEG)의 형태를 모두 포괄하는 용어이나, 특별히 이에 제한되는 것은 아니다.
또한, 상기 생체적합성 물질은 폴리-리신, 폴리-아스파르트산 및 폴리-글루탐산과 같은 폴리-아미노산을 포함하나, 이에 제한되는 것은 아니다.
또한, 지방산은 생체 내 알부민과 결합력을 갖는 것일 수 있으나, 특별히 이에 제한되지 않는다.
보다 구체적인 예로, 상기 FcRn 결합물질은 면역글로불린 Fc 영역일 수 있으며, 보다 구체적으로 IgG Fc 영역일 수 있으나, 특별히 이에 제한되지 않는다.
인슐린 아날로그의 생체 내에서 가용성 및/또는 반감기를 증가시키고/시키거나 생체이용율을 증가시키기 위해 본 발명의 인슐린 아날로그 내의 하나 이상의 아미노산 측쇄에 생체적합성 물질에 접합될 수 있다. 이러한 변형은 또한 치료학적 단백질 및 펩타이드의 소거 (clearance)를 감소시킬 수 있다.
상술한 생체적합성 물질은 수용성 (양친매성 또는 친수성) 및/또는 무독성 및/또는 약학적으로 허용가능한 것일 수 있다.
상기 F는 X와 직접적으로 연결되거나 (즉, 상기 화학식 1에서 a가 0이거나), 또는 링커 (L)를 통해 연결된 것일 수 있다.
구체적으로, 상기 L은 펩타이드성 링커 또는 비펩타이드성 링커일 수 있다.
상기 L이 펩타이드성 링커일 때, 1개 이상의 아미노산을 포함할 수 있으며, 예컨대 1개부터 1000개의 아미노산을 포함할 수 있으나, 특별히 이에 제한되는 것은 아니다. 본 발명에서 F와 X를 연결하기 위하여 공지의 다양한 펩타이드 링커가 본 발명에 사용될 수 있으며, 그 예로 [GS]x 링커, [GGGS]x 링커 및 [GGGGS]x 링커 등을 포함하며, 여기서 x는 1 이상의 자연수일 수 있다. 그러나, 상기 예에 제한되는 것은 아니다.
본 발명에서 "비펩타이드성 링커"는 반복 단위가 2개 이상 결합된 생체 적합성 중합체를 포함한다. 상기 반복 단위들은 펩타이드 결합이 아닌 임의의 공유결합을 통해 서로 연결된다. 상기 비펩타이드성 링커는 본 발명의 결합체의 모이어티를 이루는 일 구성일 수 있으며, 상기 화학식 1에서 L에 해당된다. 본 발명에서 L이 비펩타이드성 링커로서 생체적합성 중합체일 때에는 비펩타이드성 링커의 말단 부에는 이 링커 L을 인슐린 아날로그 X 및/또는 F와 공유결합으로 연결시키기 위한 연결 요소를 더 포함할 수 있다. 이 연결 요소는 상기 생체적합성 중합체의 반복 단위가 아닌 원자 또는 원자단으로서 상기 생체적합성 중합체와 X 및/또는 F를 공유결합으로 연결하기 적절한 것이면 특별히 제한이 없다.
상기 La에서 a는 1 이상일 수 있으며, a가 2 이상일 때 각각의 L은 독립적일 수 있다.
본 발명에서 상기 비펩타이드성 링커는 비펩타이드성 중합체와 혼용되어 사용될 수 있다.
또한, 하나의 구체적인 실시 형태에서 상기 결합체는 양쪽 말단에 F, 구체적으로 면역글로불린 Fc 영역 및 X와 결합될 수 있는 반응기를 포함하는 비펩타이드성 링커를 통하여 F와 X가 서로 공유결합적으로 연결된 것일 수 있다.
구체적으로, 상기 비펩타이드성 링커는 지방산, 사카라이드 (saccharide), 고분자 중합체, 저분자 화합물, 뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는 것일 수 있다.
특별히 이에 제한되지는 않으나, 본 발명에서 상기 고분자 중합체는 0 초과 약 100 kDa 범위, 구체적으로 약 1 내지 약 100 kDa 범위, 보다 더 구체적으로 약 1 내지 약 20 kDa 범위일 수 있으나, 이에 제한되지 않는다.
특별히 이에 제한되지 않으나, 상기 비펩타이드성 링커는 폴리에틸렌 글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜과 프로필렌 글리콜의 공중합체, 폴리옥시 에틸화 폴리올, 폴리비닐 알콜, 폴리사카라이드, 덱스트란, 폴리비닐 에틸에테르, PLA(polylactic acid) 및 PLGA(polylactic-glycolic acid)와 같은 생분해성 고분자, 지질 중합체, 키틴류, 히아루론산, 올리고뉴클레오타이드 및 이들의 조합으로 구성된 군으로부터 선택되는 것일 수 있다.
보다 구체적인 실시형태에서 상기 비펩타이드성 중합체는 폴리에틸렌글리콜일 수 있으나, 이에 제한되지 않는다. 또한, 당해 분야에 이미 알려진 이들의 유도체 및 당해 분야의 기술 수준에서 용이하게 제조할 수 있는 유도체들도 본 발명의 범위에 포함된다.
본 발명에서 사용될 수 있는 비펩타이드성 링커는 생체 내 단백질 분해 효소에 저항성 있는 중합체이면 제한 없이 사용될 수 있다. 비펩타이드성 중합체의 분자량은 0 초과 약 100 kDa 범위, 구체적으로 약 1 내지 약 100 kDa 범위, 보다 더 구체적으로 약 1 내지 약 20 kDa 범위이나, 이에 제한되지 않는다.
본 발명에서 용어, "약"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
또한, 상기 F에 해당하는 폴리펩타이드와 결합되는 본 발명의 비펩타이드성 링커는 한 종류의 중합체뿐만 아니라 상이한 종류의 중합체들의 조합이 사용될 수도 있다.
전술한 바와 같이 하나의 구체적인 실시 형태에서 상기 비펩타이드성 링커의 양 말단은 연결 요소들을 통하여 각각 F와 X에 연결될 수 있다. 예컨대 이 구체적인 실시 형태에서는 면역글로불린 Fc 영역의 아민기 또는 티올기 및 X의 아민기 또는 티올기에 화학 반응을 일으켜 공유결합을 형성할 수 있는(즉 결합체의 연결 요소로 변환되는) 반응기를 그 말단에 보유한 비펩타이드성 중합체(반응기 보유 비펩타이드성 중합체)와 면역글로불린 Fc 영역 및/또는 인슐린 아날로그를 반응(연결 반응)시켜 본 발명의 인슐린 아날로그 결합체를 제조한다. 즉 여기서 반응기 보유 비펩타이드성 중합체는 연결 반응을 통하여 결합체의 일부를 구성하는 비펩타이드성 링커가 되는데, 이때 결합체 내에서 이 비펩타이드성 링커는 상기 반응기 보유 비펩타이드성 중합체의 반복 단위들과 연결 요소로 이루어진다.
구체적으로, 상기 결합체 제조를 위하여 사용할 수 있는 반응기 보유 비펩타이드성 중합체로는 양쪽 말단에 각각 F (예컨대, 면역글로불린 Fc 영역) 및 X와 결합될 수 있는 반응기, 구체적으로는 X 혹은 F (예컨대, 면역글로불린 Fc 영역)의 N-말단 또는 리신에 위치한 아민기, 또는 시스테인의 티올기와 결합될 수 있는 반응기가 있는 비펩타이드성 중합체를 사용할 수 있으나, 이에 제한되지 않는다.
또한, F, 예컨대 면역글로불린 Fc 영역 및 X와 공유결합을 형성할 수 있는, 상기 비펩타이드성 중합체의 반응기는 알데히드기, 말레이미드기 및 석시니미드 유도체로 구성된 군으로부터 선택될 수 있으나, 이에 제한되지 않는다.
상기에서, 알데히드기로 프로피온 알데히드기 또는 부틸 알데히드기를 예로서 들 수 있으나, 이에 제한되지 않는다.
상기에서, 석시니미드 유도체로는 석시니미딜 발레르에이트, 석시니미딜 메틸부타노에이트, 석시니미딜 메틸프로피온에이트, 석시니미딜 부타노에이트, 석시니미딜 프로피오네이트, N-하이드록시석시니미드, 히드록시 석시니미딜, 석시니미딜 카르복시메틸 또는 석시니미딜 카보네이트가 이용될 수 있으나, 이에 제한되지 않는다.
비펩타이드성 링커는 이러한 반응기의 변환을 통하여 X와 F에 연결 요소를 거쳐 이어질 수 있으나, 특별히 이에 제한되는 것은 아니다.
또한, 알데히드 결합에 의한 환원성 아민화로 생성된 최종 산물은 아미드 결합으로 연결된 것보다 훨씬 안정적이다. 알데히드 반응기는 낮은 pH에서 N-말단에 선택적으로 반응하며, 높은 pH, 예를 들어 pH 9.0 조건에서는 라이신 잔기와 공유결합을 형성할 수 있다.
또한, 상기 반응기 보유 비펩타이드성 중합체의 양쪽 말단의 반응기는 서로 동일하거나 또는 서로 상이할 수 있으며, 예를 들어, 한쪽 말단에는 말레이미드기를, 다른 쪽 말단에는 알데히드기, 프로피온 알데히드기, 또는 부틸 알데히드기를 가질 수 있다. 그러나, 반응기 보유 비펩타이드성 중합체의 각 말단에 F, 구체적으로 면역글로불린 Fc 영역과 X가 결합될 수 있다면, 특별히 이에 제한되지 않는다.
예를 들어, 상기 반응기 보유 비펩타이드성 중합체의 한쪽 말단에는 반응기로서 말레이미드기를 포함하고, 다른 쪽 말단에는 알데히드기, 프로피온 알데히드기 또는 부틸 알데히드기 등을 포함할 수 있다.
양쪽 말단에 히드록시 반응기를 갖는 폴리에틸렌 글리콜을 비펩타이드성 중합체로 이용하는 경우에는 공지의 화학반응에 의해 상기 히드록시기를 상기 다양한 반응기로 활성화하거나, 상업적으로 입수 가능한 변형된 반응기를 갖는 폴리에틸렌 글리콜을 이용하여 본 발명의 지속형 단백질 결합체를 제조할 수 있다.
하나의 구체적인 실시 형태에서 상기 비펩타이드성 중합체는 X, 즉 인슐린 아날로그의 N-말단 영역 또는 라이신 잔기에 연결되는 것일 수 있으나, 특별히 이에 제한되지 않는다. 구체적으로, 인슐린 아날로그의 N-말단 영역, 구체적으로 최말단 아미노산의 아민기, 또는 인슐린 아날로그 내부에 존재하는 라이신의 아민기에 상기 비펩타이드성 중합체, 구체적으로 PEG가 연결되는 것일 수 있으나, 특별히 이에 제한되지 않는다.
또한, 구체적인 실시 형태에서 상기 비펩타이드성 중합체는 F, 예컨대 면역글로불린 Fc의 N-말단 영역에 연결되는 것일 수 있으나, 특별히 이에 제한되지 않는다. 구체적으로, 상기 면역글로불린 Fc의 N-말단 영역, 구체적으로 최말단 아미노산의 아민기에 상기 비펩타이드성 중합체가 연결되는 것일 수 있으나, 특별히 이에 제한되지 않는다.
상기에서 용어 "N-말단 영역"은 인슐린 아날로그 또는 면역글로불린 Fc의 아미노 말단 영역을 의미하는 것으로, 본 발명의 목적상 링커와 결합할 수 있는 위치를 말한다. 그 예로, 이에 제한되지는 않으나, N-말단 영역의 최말단 아미노산 잔기뿐만 아니라 N-말단 아미노산 잔기 주변의 아미노산 잔기를 모두 포함할 수 있으며, 구체적으로는 최말단으로부터 첫 번째 내지 20 번째의 아미노산 잔기를 포함할 수 있다. 그러나, 특별히 이에 제한되는 것은 아니다.
만약, 상기 반응기 보유 비펩타이드성 중합체의 하나의 말단에 알데히드기가 존재하여 이 알데히드기를 인슐린 아날로그의 N-말단에 위치한 아민기에 연결하는 경우에는 환원성 아민화 반응을 통하여 연결할 수 있으며, 상기 반응기 보유 비펩타이드성 중합체의 다른 하나의 말단에 알데히드기가 존재하고, 면역글로불린 Fc의 N-말단에 위치한 아민기에 연결하는 경우 역시 환원성 아민화 반응을 통하여 서로 연결될 수 있다.
본 발명 결합체의 한 구체적인 실시 형태에서 상기 결합체는 제조에 사용한 반응기 보유 비펩타이드성 중합체가 양 말단에 알데히드기 반응기를 갖춘 PEG인 경우로서, 환원적 아민화를 통하여 X와 F의 아미노기에 연결되어 결합체를 형성한 것인데 이 때 이 결합체는 다음과 같은 형태의 구조이다.
X-NHCH2-W-PEG모이어티-Z-CH2NH-F
여기서, -CH2W-는 비펩타이드성 중합체와 X를, -Z-CH2-는 비펩타이드성 중합체와 F를 잇는 연결 요소로서 W와 Z는 부존재하거나 알킬렌 등의 2가 작용기이다. -CH2W-와 -Z-CH2-의 메틸렌은 각각의 알데히드 반응기에서 유래한 것이며, X-NH와 NH-F의 질소 원자는 각각 연결 반응에 이용된 인슐린 아날로그와 F의 아미노기에서 유래한다.
상기 구조에서 PEG 모이어티는, -(CH2CH2O)n-구조 뿐만 아니라 연결 요소와 이 -(CH2CH2O)n- 사이에 개재하는 산소 원자도 포함할 수 있다.
본 발명에서, "면역글로불린 Fc 영역"은, 면역글로불린의 중쇄와 경쇄 가변영역을 제외한, 중쇄 불변영역 2(CH2) 및/또는 중쇄 불변영역 3(CH3)부분을 포함하는 부위를 의미한다. 상기 면역글로불린 Fc 영역은 본 발명의 결합체의 모이어티를 이루는 일 구성일 수 있다.
이러한 면역글로불린 Fc 영역은 중쇄 불변영역에 힌지(hinge) 부분을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한 본 발명의 면역글로불린 Fc 영역은 천연형과 실질적으로 동등하거나 향상된 효과를 갖는 한, 면역 글로불린의 중쇄와 경쇄 가변영역만을 제외하고, 일부 또는 전체 중쇄 불변영역 1(CH1) 및/또는 경쇄불변영역 1(CL1)을 포함하는 확장된 Fc 영역일 수 있다. 또한, CH2 및/또는 CH3에 해당하는 상당히 긴 일부 아미노산 서열이 제거된 영역일 수도 있다.
예컨대, 본 발명의 면역글로불린 Fc 영역은 1) CH1 도메인, CH2 도메인, CH3 도메인 및 CH4 도메인, 2) CH1 도메인 및 CH2 도메인, 3) CH1 도메인 및 CH3 도메인, 4) CH2 도메인 및 CH3 도메인, 5) CH1 도메인, CH2 도메인, CH3 도메인 및 CH4 도메인 중 1개 또는 2개의 이상의 도메인과 면역글로불린 힌지 영역(또는 힌지 영역의 일부)와의 조합, 6) 중쇄 불변 영역 각 도메인과 경쇄 불변영역의 이량체일 수 있다. 그러나, 이에 제한되는 것은 아니다.
또한, 하나의 구체예로서, 상기 면역글로불린 Fc 영역은 이합체 형태 (dimeric form)일 수 있으며, 이합체 형태의 하나의 Fc 영역에 X 한 분자가 공유결합적으로 연결될 수 있으며, 이때 상기 면역글로불린 Fc와 X는 비펩타이드성 중합체에 의해 서로 연결될 수 있다. 한편, 이합체 형태의 하나의 Fc 영역에 X 두 분자가 대칭적으로 결합하는 것 역시 가능하다. 이때 상기 면역글로불린 Fc와 X는 비펩타이드성 링커에 의해 서로 연결될 수 있다. 그러나, 상기 기술된 예에 제한되는 것은 아니다.
또한, 본 발명의 면역글로불린 Fc 영역은 천연형 아미노산 서열뿐만 아니라 이의 서열 유도체를 포함한다. 아미노산 서열 유도체란 천연 아미노산 서열 중의 하나 이상의 아미노산 잔기가 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합에 의하여 상이한 서열을 가지는 것을 의미한다.
예를 들면, IgG Fc의 경우 결합에 중요하다고 알려진 214 내지 238, 297 내지 299, 318 내지 322 또는 327 내지 331번 아미노산 잔기들이 변형을 위해 적당한 부위로서 이용될 수 있다.
또한, 이황화 결합을 형성할 수 있는 부위가 제거되거나, 천연형 Fc에서 N-말단의 몇몇 아미노산이 제거되거나 또는 천연형 Fc의 N-말단에 메티오닌 잔기가 부가될 수도 있는 등 다양한 종류의 유도체가 가능하다. 또한, 이펙터 기능을 없애기 위해 보체결합부위, 예로 C1q 결합부위가 제거될 수도 있고, ADCC (antibody dependent cell mediated cytotoxicity) 부위가 제거될 수도 있다. 이러한 면역글로불린 Fc 영역의 서열 유도체를 제조하는 기술은 국제특허공개 제WO 97/34631호, 국제특허공개 제96/32478호 등에 개시되어 있다.
분자의 활성을 전체적으로 변경시키지 않는 단백질 및 펩타이드에서의 아미노산 교환은 당해 분야에 공지되어 있다 (H.Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979). 가장 통상적으로 일어나는 교환은 아미노산 잔기 Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly 간의 교환이다. 경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation), 아세틸화(acetylation) 및 아미드화(amidation) 등으로 수식(modification)될 수도 있다.
상기 기술한 Fc 유도체는 본 발명의 Fc 영역과 동등한 생물학적 활성을 나타내며 Fc 영역의 열, pH 등에 대한 구조적 안정성을 증대시킨 것일 수 있다.
또한, 이러한 Fc 영역은 인간, 소, 염소, 돼지, 마우스, 래빗, 햄스터, 랫트 또는 기니아 픽 등의 동물의 생체 내에서 분리한 천연형으로부터 얻어질 수도 있고, 형질전환된 동물세포 또는 미생물로부터 얻어진 재조합형 또는 이의 유도체일 수 있다. 여기서, 천연형으로부터 획득하는 방법은 전체 면역글로불린을 인간 또는 동물의 생체로부터 분리한 후, 단백질 분해효소를 처리하여 획득하는 방법일 수 있다. 파파인을 처리할 경우에는 Fab 및 Fc로 절단되고, 펩신을 처리할 경우에는 pF'c 및 F(ab)2로 절단된다. 이를 크기 배제 크로마토그래피 (size-exclusion chromatography) 등을 이용하여 Fc 또는 pF'c를 분리할 수 있다. 더 구체적인 실시 형태에서는 인간 유래의 Fc 영역을 미생물로부터 수득한 재조합형 면역글로불린 Fc 영역이다.
또한, 면역글로불린 Fc 영역은 천연형 당쇄, 천연형에 비해 증가된 당쇄, 천연형에 비해 감소한 당쇄 또는 당쇄가 제거된 형태일 수 있다. 이러한 면역글로불린 Fc 당쇄의 증감 또는 제거에는 화학적 방법, 효소학적 방법 및 미생물을 이용한 유전 공학적 방법과 같은 통상적인 방법이 이용될 수 있다. 여기서, Fc에서 당쇄가 제거된 면역글로불린 Fc 영역은 보체(c1q)와의 결합력이 현저히 저하되고, 항체-의존성 세포독성 또는 보체-의존성 세포 독성이 감소 또는 제거되므로, 생체 내에서 불필요한 면역 반응을 유발하지 않는다. 이런 점에서 약물의 캐리어로서의 본래의 목적에 보다 부합하는 형태는 당쇄가 제거되거나 비당쇄화된 면역글로불린 Fc 영역이라 할 것이다.
본 발명에서 "당쇄의 제거(Deglycosylation)"는 효소로 당을 제거한 Fc 영역을 말하며, 비당쇄화(Aglycosylation)는 원핵동물, 더 구체적인 실시 형태에서는 대장균에서 생산하여 당쇄화되지 않은 Fc 영역을 의미한다.
한편, 면역글로불린 Fc 영역은 인간 또는 소, 염소, 돼지, 마우스, 래빗, 햄스터, 랫트, 기니아 픽 등의 동물기원일 수 있으며, 더 구체적인 실시 형태에서는 인간기원이다.
또한, 면역글로불린 Fc 영역은 IgG, IgA, IgD, IgE, IgM 유래 또는 이들의 조합(combination) 또는 이들의 혼성(hybrid)에 의한 Fc 영역일 수 있다. 더 구체적인 실시 형태에서는 인간 혈액에 가장 풍부한 IgG 또는 IgM유래이며 보다 더 구체적인 실시 형태에서는 리간드 결합 단백질의 반감기를 향상시키는 것으로 공지된 IgG 유래이다. 더욱 더 구체적인 실시 형태에서 상기 면역글로불린 Fc 영역은 IgG4 Fc 영역이며, 가장 구체적인 실시 형태에서 상기 면역글로불린 Fc 영역은 인간 IgG4 유래의 비-당쇄화된 Fc 영역이나, 이에 제한되는 것은 아니다.
한편, 본 발명에서 "조합(combination)"이란 이량체 또는 다량체를 형성할 때, 동일 기원 단쇄 면역글로불린 Fc 영역을 암호화하는 폴리펩타이드가 상이한 기원의 단쇄 폴리펩타이드와 결합을 형성하는 것을 의미한다. 즉, IgG Fc, IgA Fc, IgM Fc, IgD Fc 및 IgE의 Fc 단편으로 이루어진 그룹으로부터 선택된 2개 이상의 단편으로부터 이량체 또는 다량체의 제조가 가능하다.
본 발명을 구현하는 다른 양태는 상기 결합체를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터, 및 상기 폴리뉴클레오티드 또는 이를 포함하는 벡터를 포함하는 형질전환체를 제공한다.
상기 결합체에 대해서는 앞서 설명한 바와 같다.
상기 폴리뉴클레오티드는 융합 단백질 형태의 결합체를 코딩하는 것일 수 있다.
또한, 상기 결합체를 코딩하는 분리된 폴리뉴클레오티드는 해당 서열과 75% 이상, 구체적으로는 85% 이상, 보다 구체적으로는 90% 이상, 더욱 구체적으로는 95% 이상의 서열 동일성을 가지는 폴리뉴클레오티드 서열을 본 발명의 범주에 포함한다.
상기 벡터, 형질전환체에 대해 앞서 기술한 설명이 본 양태에도 모두 적용된다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 결합체의 제조 방법을 제공한다.
상기 결합체에 대해서는 앞서 설명한 바와 같다.
구체적으로, 상기 방법은
(a) 2 이상의 말단 반응기를 가지는 비펩타이드성 중합체와 인슐린 아날로그 또는 캐리어 중 하나를 반응시켜 인슐린 아날로그 또는 캐리어가 한쪽 말단에 부착되고, 다른 쪽 말단에 반응기 (reactive end group)를 가지는, 비펩타이드성 중합체를 제조하는 단계; 및
(b) 상기 (a) 단계에서 제조된, 인슐린 아날로그 또는 캐리어가 한쪽 말단에 부착되고, 다른 쪽 말단에 말단 반응기을 가지는, 비펩타이드성 중합체와 캐리어 또는 인슐린 아날로그 중 다른 하나를 반응시켜 인슐린 아날로그와 캐리어가 비펩타이드성 중합체를 통하여 연결된, 결합체를 제조하는 단계를 포함할 수 있다.
상기 비펩타이드성 중합체, 캐리어, 인슐린 아날로그와 이들의 연결 구성에 대해서는 앞서 기술한 설명이 모두 적용된다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 결합체를 포함하는 조성물을 제공한다.
상기 결합체에 대해서는 앞서 설명한 바와 같다.
본 발명에서 상기 조성물은 약학적 조성물일 수 있다. 보다 구체적으로, 상기 조성물은 인슐린 관련 질환의 예방 또는 치료용 약학적 조성물일 수 있다. 보다 더 구체적으로 상기 조성물은 당뇨병의 예방 또는 치료용 약학적 조성물일 수 있다.
본 발명에서 용어, "인슐린 관련 질환"은 인슐린의 생리활성이 없거나 낮아 발생하거나 진행하는 질환으로서, 예컨대 당뇨병을 들 수 있으나, 특별히 이에 제한되지 않는다.
본 발명에서 용어 "예방"은 상기 결합체 또는 이를 포함하는 조성물의 투여로 인슐린 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미하며, "치료"는 상기 결합체 또는 이를 포함하는 조성물의 투여로 인슐린 관련 질환의 증세가 호전되거나 이롭게 되는 모든 행위를 의미한다.
본 발명에 따른 인슐린 아날로그 결합체를 포함하는 약학적 조성물은 약학적으로 허용가능한 담체를 포함할 수 있다. 이러한 담체는 비자연적으로 존재하는 것일 수 있다.
본 발명에서 용어 "약학적으로 허용가능한"이란 치료효과를 나타낼 수 있을 정도의 충분한 양과 부작용을 일으키지 않는 것을 의미하며, 질환의 종류, 환자의 연령, 체중, 건강, 성별, 환자의 약물에 대한 민감도, 투여 경로, 투여 방법, 투여횟수, 치료 기간, 배합 또는 동시 사용되는 약물 등 의학 분야에 잘 알려진 요소에 따라 당업자에 의해 용이하게 결정될 수 있다.
약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활택제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소 및 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장화제 및 안정화제 등을 혼합하여 사용할 수 있으며, 국소 투여용의 경우에는 기제, 부형제, 윤활제 및 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여 시에는 정제, 트로키, 캡슐, 엘릭서, 서스펜션, 시럽 및 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 그 외에도 용액, 현탁액, 정제, 환약, 캡슐 및 서방형 제제 등으로 제형화할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
본 발명에서 "투여"는, 어떠한 적절한 방법으로 환자에게 소정의 물질을 도입하는 것을 의미하며, 상기 결합체의 투여 경로는 약물이 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피 내 투여, 경구 투여, 국소 투여, 비 내 투여, 폐 내 투여 및 직장 내 투여 등이 될 수 있으나, 이에 제한되지는 않는다. 그러나 경구 투여 시 펩티드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화하는 것이 바람직하다. 구체적으로는, 주사제 형태로 투여될 수 있다. 또한, 약학적 조성물은 유효성분이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
또한, 본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별 및 체중 및 질환의 중등도 등의 여러 관련 인자와 함께, 유효성분인 약물의 종류에 따라 결정된다.
본 발명의 조성물의 총 유효량은 단일 투여량 (single dose)으로 환자에게 투여될 수 있으며, 다중 투여량 (multiple dose)으로 장기간 투여되는 분할 치료 방법 (fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 구체적으로, 본 발명의 결합체의 바람직한 전체 용량은 하루에 환자 체중 1 kg당 약 0.0001 mg 내지 500 mg일 수 있다. 그러나 상기 결합체의 용량은 약학적 조성물의 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당분야의 통상적인 지식을 가진 자라면 상기 본 발명의 조성물의 특정한 용도에 따른 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 인슐린 아날로그의 결합체를 포함하는, 천연형 인슐린의 결합체 대비 생체 내 지속성 및/또는 안정성이 증대된, 지속성 제제를 제공한다.
상기 인슐린 아날로그 및 결합체에 대해서는 앞서 설명한 바와 같다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 인슐린 아날로그의 결합체 또는 이의 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 인슐린 관련 질환을 치료하는 방법을 제공한다.
상기 인슐린 아날로그 및 결합체에 대해서는 앞서 설명한 바와 같다.
하나의 양태로서, 상기 인슐린 관련 질환은 당뇨병이나, 특별히 이에 제한되지 않는다.
본 발명을 구현하기 위한 다른 하나의 양태는 약제의 제조에 있어 상기 인슐린 아날로그의 결합체의 용도를 제공한다.
하나의 양태로서, 상기 약제는 인슐린 관련 질환의 예방 또는 치료용이나, 특별히 이에 제한되지 않는다.
다른 양태로서, 당뇨병의 예방 또는 치료용이나, 특별히 이에 제한되지 않는다.
본 발명을 구현하기 위한 다른 하나의 양태는 인슐린 관련 질환, 구체적으로 당뇨병의 치료에 있어 상기 인슐린 아날로그의 결합체의 용도를 제공한다.
상기 인슐린 아날로그, 결합체, 인슐린 관련 질환에 대해서는 앞서 설명한 바와 같다.
이하, 하기 실시예에 의하여 본 발명을 보다 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들로 한정되는 것은 아니다.
실시예 1: 단쇄 인슐린 아날로그 발현 벡터의 제작
보유 중인 천연형 인슐린 발현 벡터를 주형으로 하여 A-쇄 또는 B-쇄의 아미노산을 하나씩 변형시킨 인슐린 아날로그들을 제작하기 위해 순방향 및 역방향 올리고 뉴클레오타이드를 합성한 후(표 2), PCR을 진행하여 각각의 아날로그 유전자를 증폭하였다.
하기 표 1에 각각의 A 쇄 또는 B쇄의 아미노산의 변화 서열 및 아날로그 이름을 나타냈다. 즉, 아날로그 1의 경우 A 쇄의 14번 티로신(Y)이 히스티딘(H)으로 치환, 아날로그 6의 경우 B쇄의 16번 티로신이 글루탐산(E)으로 치환된 형태이다.
인슐린 아날로그 번호 변화서열
아날로그1 A 14Y -> H
아날로그2 A 14Y -> K
아날로그3 A 19Y -> E
아날로그4 A 19Y -> S
아날로그5 A 19Y -> T
아날로그6 B 16Y -> E
아날로그7 B 16Y -> S
아날로그8 B 16Y -> T
아날로그9 A 14Y -> A
아날로그10 A 14Y -> D
아날로그11 B 16Y -> D
아날로그12 B 25F -> D
아날로그13 B 25F -> E
인슐린 아날로그 증폭을 위한 프라이머는 하기 표 2에 나타냈다.
아날로그 서열 서열 번호
아날로그 1 5' CAGCATCTGCTCCCTCCATCAGCTGGAGAACTAC 3' 서열번호 1
5' GTAGTTCTCCAGCTGATGGAGGGAGCAGATGCTG 3' 서열번호 2
아날로그 2 5' CAGCATCTGCTCCCTCAAGCAGCTGGAGAACTAC 3' 서열번호 3
5' GTAGTTCTCCAGCTGCTTGAGGGAGCAGATGCTG 3' 서열번호 4
아날로그 3 5' CTACCAGCTGGAGAACGAGTGCAACTGAGGATCC 3' 서열번호 5
5' GGATCCTCAGTTGCACTCGTTCTCCAGCTGGTAG 3' 서열번호 6
아날로그 4 5' CTACCAGCTGGAGAACTCCTGCAACTGAGGATCC 3' 서열번호 7
5' GGATCCTCAGTTGCAGGAGTTCTCCAGCTGGTAG 3' 서열번호 8
아날로그 5 5' CTACCAGCTGGAGAACACCTGCAACTGAGGATCC 3' 서열번호 9
5' GGATCCTCAGTTGCAGGTGTTCTCCAGCTGGTAG 3' 서열번호 10
아날로그 6 5' CTGGTGGAAGCTCTCGAGCTAGTGTGCGGGGAAC 3' 서열번호 11
5' GTTCCCCGCACACTAGCTCGAGAGCTTCCACCAG 3' 서열번호 12
아날로그 7 5' CTGGTGGAAGCTCTCTCCCTAGTGTGCGGGGAAC 3' 서열번호 13
5' GTTCCCCGCACACTAGGGAGAGAGCTTCCACCAG 3' 서열번호 14
아날로그 8 5' CTGGTGGAAGCTCTCACCCTAGTGTGCGGGGAAC 3' 서열번호 15
5' GTTCCCCGCACACTAGGGTGAGAGCTTCCACCAG 3' 서열번호 16
아날로그 9 5' CAGCATCTGCTCCCTCGCCCAGCTGGAGAACTAC 3' 서열번호 17
5' GTAGTTCTCCAGCTGGGCGAGGGAGCAGATGCTG 3' 서열번호 18
아날로그 10 5' CAGCATCTGCTCCCTCGACCAGCTGGAGAACTAC 3' 서열번호 19
5' GTAGTTCTCCAGCTGGTCGAGGGAGCAGATGCTG 3' 서열번호 20
아날로그 11 5' CTGGTGGAAGCTCTCGACCTAGTGTGCGGGGAAC 3' 서열번호 21
5' GTTCCCCGCACACTAGGTCGAGAGCTTCCACCAG 3' 서열번호 22
아날로그 12 5' GGGGAACGAGGCTTCGACTACACACCCAAGACC 3' 서열번호 23
5' GGTCTTGGGTGTGTAGTCGAAGCCTCGTTCCCC 3' 서열번호 24
아날로그 13 5' GGGGAACGAGGCTTCGAGTACACACCCAAGACC 3' 서열번호 25
5' GGTCTTGGGTGTGTACTCGAAGCCTCGTTCCCC 3' 서열번호 26
인슐린 아날로그 증폭을 위한 PCR 조건은 95℃ 30초, 55℃에서 30초, 68℃에서 6분으로 이 과정을 18회 반복하였다. 이와 같은 조건에서 얻어진 인슐린 아날로그 단편은 세포내의 봉입체 형태로 발현시키기 위하여 pET22b 벡터에 삽입되어 있으며 이렇게 얻어진 발현 벡터를 pET22b-인슐린 아날로그 1 내지 13라 명명하였다. 상기 발현 벡터는 T7 프로모터의 조절 하에 인슐린 아날로그 1 내지 13의 아미노산 서열을 코딩하는 핵산을 포함한다. 상기 발현 벡터를 포함하는 숙주 내에서 인슐린 아날로그 단백질을 봉입체 형태로 발현시켰다.
하기 표 3에 각각의 인슐린 아날로그 1 내지 13의 DNA 서열 및 단백질 서열을 나타냈다.
각각의 서열 변경 확인은 DNA 서열 분석을 통하여 확인하였고, 그 결과, 각각의 인슐린 아날로그가 목적하는 바에 따라, 서열이 변경이 되었음을 확인할 수 있었다.
아날로그 서열 서열번호
아날로그 1 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC CAT CAG CTG GAG AAC TAC TGC AAC 서열번호 27
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu His Gln Leu Glu Asn Tyr Cys Asn 서열번호 28
아날로그 2 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC AAG CAG CTG GAG AAC TAC TGC AAC 서열번호 29
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Lys Gln Leu Glu Asn Tyr Cys Asn 서열번호 30
아날로그 3 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC GAG TGC AAC 서열번호 31
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Glu Cys Asn 서열번호 32
아날로그 4 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TCC TGC AAC 서열번호 33
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ser Cys Asn 서열번호 34
아날로그 5 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC ACC TGC AAC 서열번호 35
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Thr Cys Asn 서열번호 36
아날로그 6 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC GAG CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC 서열번호 37
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Glu Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 서열번호 38
아날로그 7 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TCC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC 서열번호 39
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Ser Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 서열번호 40
아날로그 8 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC ACC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC 서열번호 41
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Thr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 서열번호 42
아날로그 9 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC GCC CAG CTG GAG AAC TAC TGC AAC 서열번호 43
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Ala Gln Leu Glu Asn Tyr Cys Asn 서열번호 44
아날로그 10 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC GAC CAG CTG GAG AAC TAC TGC AAC 서열번호 45
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Asp Gln Leu Glu Asn Tyr Cys Asn 서열번호 46
아날로그 11 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC GAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC 서열번호 47
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Asp Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 서열번호 48
아날로그 12 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC GAC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC 서열번호 49
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Asp Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 서열번호 50
아날로그 13 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC GAG TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC 서열번호 51
단백질 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Glu Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 서열번호 52
실시예 2: 재조합 인슐린 아날로그 융합 펩타이드의 발현
T7 프로모터 조절하의 재조합 인슐린 아날로그 발현을 수행 하였다. 각각의 재조합 인슐린 아날로그 발현 벡터로 E. coli BL21-DE3(E. coli B F-dcm ompT hsdS(rB-mB-) gal λDE3); 노바젠)을 형질전환하였다. 형질 전환 방법은 노바젠사에서 추천하는 방법을 따랐다. 각 재조합 발현 벡터가 형질 전환된 각각의 단일 콜로니를 취하여 암피실린(50 ㎍/ml)이 포함된 2X 루리아 브로스(Luria Broth, LB) 배지에 접종하고, 37℃에서 15시간 배양하였다. 재조합 균주 배양액과 30% 글리세롤이 포함된 2X LB 배지를 1:1(v/v)의 비율로 혼합하여 각 1 ml씩 크라이오-튜브에 분주하고, -140℃에 보관하였다. 이를 재조합 융합 단백질의 생산을 위한 세포 스톡(cell stock)으로 사용하였다.
재조합 인슐린 아날로그들의 발현을 위하여, 각 세포 스톡 1 바이알을 녹여 500 ml의 2X 루리아 브로스에 접종하고 37℃에서 14~16시간 동안 진탕 배양하였다. OD600의 값이 5.0 이상을 나타내면 배양을 종료하고, 이를 종 배양액으로 사용하였다. 50 L 발효기(MSJ-U2, B.E.MARUBISHI, 일본)를 이용하여 종 배양액을 17 L의 발효 배지에 접종하고 초기 배스(bath) 발효를 시작하였다. 배양조건은 온도 37℃, 공기량 20 L/분(1 vvm), 교반 속도 500 rpm 그리고 30% 암모니아수를 사용하여 pH 6.70으로 유지시켰다. 발효 진행은 배양액 내의 영양소가 제한되었을 때, 추가배지(feeding solution)를 첨가하여 유가배양을 진행하였다. 균주의 성장은 OD 값에 의해 모니터링하며, OD 값이 100이상에서 최종 농도 500 μM의 IPTG로 도입하였다. 배양은 도입 후 약 23~25시간까지 더 진행하며, 배양 종료 후, 원심 분리기를 사용하여 재조합 균주를 수획하여 사용 시까지 -80℃에 보관하였다.
실시예 3: 재조합 인슐린 아날로그의 회수 및 재접힘 ( refolding )
상기 실시예 2에서 발현시킨 재조합 인슐린 아날로그들을 가용성 형태로 바꾸기 위해 세포를 파쇄하고 리폴딩하였다. 세포 펠렛 100 g(wet weight)을 1 L 용해 완충액(50 mM Tris-HCl(pH 9.0), 1 mM EDTA(pH 8.0), 0.2 M NaCl 및 0.5% 트리톤 X-100)에 재 부유하였다. 미세용액화 프로세서 Microfluidizer (Microfluidic Corp. Model M-110EH-30)를 이용하여 15,000 psi 압력으로 수행하여 세포를 파쇄하였다. 파쇄된 세포 용해물을 7,000 rpm으로 4~8℃에서 20분 원심분리하여 상층액을 버리고, 3 L 세척완충액(0.5% 트리톤 X-100 및 50 mM Tris-HCl(pH 8.0), 0.2 M NaCl, 1 mM EDTA)에 재부유하였다. 7,000 rpm으로 4~8℃에서 20분 동안 원심 분리하여 펠렛을 증류수에 재부유한 후, 동일한 방법으로 원심 분리하였다. 펠렛을 취하여 완충액(1 M L-Glycine, 3.78 g L-Cysteine-HCl, pH 10.6)에 재 부유하여 상온에서 1시간 동안 교반하였다. 재 부유된 재조합 인슐린 아날로그 회수를 위하여 8M 우레아를 추가한 후 3~5시간 교반하였다. 가용화된 재조합 프로인슐린 아날로그의 재접힘(refolding)을 위하여 7,000 rpm으로 4~8℃에서 30분간 원심분리한 후 상층액을 취한 후, 환원제(15mM L-Cysteine-HCL)을 1시간 처리하고 여기에 일정 배수의 증류수를 연동펌프(peristaltic pump)를 이용하여 넣어주면서 4~8℃에서 12시간 이상 교반하였다.
실시예 4: 양이온 교환 크로마토그래피 정제
45% 에탄올이 포함된 20 mM 소디움 사이트레이트 (pH 2.0) 완충액으로 평형화된 SP FF (GE healthcare사) 컬럼에 재접합이 끝난 시료를 결합시킨 후, 염화칼륨 0.5 M과 45% 에탄올이 포함된 20 mM 소디움 사이트레이트 (pH 2.0) 완충액을 사용하여 농도가 0% 에서 100% 가 되도록 10 컬럼 용량의 선형 농도구배로 인슐린 아날로그 단백질을 용출하였다.
실시예 5: 트립신( Trypsin )과 카복시펩티데이즈 B( Carboxypeptidase B) 처리
용출된 시료를 한외여과막으로 염을 제거하고, 완충용액(10 mM Tris-HCl, pH 8.0)으로 교체하였다. 얻어진 시료 단백량의 약 30,000 몰비에 해당하는 트립신과 약 3,000 몰비에 해당하는 카복시펩티데이즈 B를 첨가한 후, 4~8℃에서 16시간이상 교반하였다.
실시예 6: 양이온 교환 크로마토 그래피 정제
반응이 끝난 시료를 45% 에탄올이 포함된 20 mM 소디움 사이트레이트 (pH 2.0) 완충액으로 평형화된 SP HP (GE healthcare사) 컬럼에 다시 결합시킨 후, 염화칼륨 0.5 M과 45% 에탄올이 포함된 20 mM 소디움 사이트레이트(pH 2.0) 완충액을 사용하여 농도가 0% 에서 100% 가 되도록 10 컬럼 용량의 선형 농도구배로 인슐린 아날로그 단백질을 용출하였다.
실시예 7: 역상 크로마토 그래피 정제
상기 실시예 6에서 얻어진 시료에서 순수한 인슐린 아날로그를 순수 분리하기 위해 소디움포스페이트와 아이소프로판올을 포함한 버퍼로 평형화된 역상 크로마토 그래피 Source30RPC (GE healthcare, 미국)에 결합시킨 후, 소디움포스페이트와 이소프로판올을 포함한 완충액을 사용하여 선형 농도 구배로 인슐린 아날로그 단백질을 용출하였다.
이와 같이 정제된 인슐린 아날로그는 단백질 전기영동(SDS-PAGE, 도 1) 및 고압 크로마토그래피(HPLC)를 사용하여 분석하였으며 이중 대표로 인슐린 아날로그 9번, 10번, 11번, 12번의 순도 분석 결과 나타내었다 (도 2).
실시예 8: 지속형 인슐린 아날로그 결합체의 제조
상기 실시예 1 내지 7을 통하여 제조한 인슐린 아날로그의 결합체를 다음과 같은 방법으로 제조하였다.
대표적으로, 아날로그 10의 지속형 결합체를 다음과 같이 제조하였다.
3.4K propion-ALD(2) PEG (양 말단에 각각 프로피온 알데히드기를 하나씩 지니고 있는 3.4kDa의 PEG, 미국 NOF사)를 인슐린 아날로그 10의 B-쇄의 N-말단에 페길화시키기 위하여, 인슐린 아날로그 10 : PEG의 몰 비를 1 : 4로, 인슐린 아날로그 10의 농도를 5 mg/ml로 4oC에서 약 2시간 반응시켰다. 이때 반응은 50mM 구연산 나트륨 완충액 (pH 5.0)과 45% 아이소프로판올의 혼합 용매에서, 3mM 농도의 소디움 시아노보로하이드라이드 (sodium cyanoborohydride (NaCNBH3))환원제를 첨가하여 반응시켰다. 반응액은 구연산 나트륨 (pH 3.0), 45% EtOH가 포함된 버퍼와 KCl 농도 구배를 이용한 SP-HP (GE Healthcare) 컬럼을 사용하여 정제하였다.
다음으로, 상기 인슐린 아날로그가 부착된 PEG를 면역글로불린 Fc 단편의 N-말단에 연결시키기 위하여, 상기 정제된 모노 페길화된 (mono-PEGylated) 인슐린 아날로그와 면역글로불린 Fc 단편의 몰비가 1 : 1.2가 되도록 하고, 전체 단백질 농도를 20 mg/ml로 하여 25oC에서 15시간 반응시켰다. 이때 반응액은 100 mM 헤페스 (HEPES) 완충액(pH 8.2)과 염화 나트륨에 환원제로서 20 mM 소디움 시아노보로하이드라이드를 첨가하였다.
반응이 종결된 후 반응액은 Tris-HCl(pH 7.5) 버퍼와 NaCl 농도 구배를 이용하여 Q-HP(GE, 미국) 컬럼에 적용하고, 황산암모늄 (ammoniumsulfate)과 Tris-HCl (pH 7.5)의 농도 구배를 이용하여, Source 15ISO (GE, 미국)에 적용하여, 인슐린 아날로그 10 - 3.4K PEG - 면역글로불린 Fc 결합체를 정제하였다.
비교예 : 지속형 천연형 인슐린 결합체의 제조
천연형 인슐린(인도 Biocon사) B-쇄의 N-말단에 3.4K propion-ALD(2) PEG (양 말단에 각각 프로피온 알데히드기를 하나씩 지니고 있는 3.4kDa의 PEG, 미국 NOF사)를 페길화시키기 위하여, 실시예 8과 같이 페길화 반응 및 정제 컬럼을 적용하여 모노 페길화된 (mono-PEGylated) 천연형 인슐린을 정제하였다.
다음으로, 상기 천연형 인슐린이 부착된 PEG를 면역글로불린 Fc 단편의 N-말단에 연결시키기 위하여, 상기 정제된 모노 페길화된 (mono-PEGylated) 천연형 인슐린과 면역글로불린 Fc 단편을 실시예 8과 같은 반응 조건과 정제 컬럼을 적용하여, 천연형 인슐린-3.4K PEG-면역글로불린 Fc 결합체를 제조하였다.
실험예 1: 인슐린 아날로그들의 인슐린 수용체 결합력 비교
인슐린 아날로그의 인슐린 수용체 결합력을 측정하기 위하여, SPA(Scintillation proximity assay) 방법을 이용하여 분석하였다. 먼저, 인슐린 수용체 B 아이소폼이 발현된 세포막을 획득하기 위하여 lipofectamine (Life technology사, 미국)을 이용하여 CHO 세포주에 트랜스팩션 시켜 인슐린 수용체 B 아오소폼이 과발현된 CHO 세포주를 제작하였고, 제작된 세포주로부터 호모게나이저 (Wheaton사, 미국)로 균질화 한 뒤, sucrose cushion법으로 세포막을 분리하여 획득 하였다. 획득한 사람 천연형 인슐린 수용체 B 아이소폼이 발현된 CHO 세포주의 세포막과 PVT SPA 비드를 96-웰 피코 플레이트(PerkinElmer사, 모델번호 6005162, 미국)에 함께 넣고, 경쟁자로서 10 가지 이상의 농도로 반응액(50mM Tris-HCl pH 7.8, 150mM NaCl, 0.1% BSA)에 희석한 인간 인슐린 또는 각각의 인슐린 아날로그, 그리고 탐지자 리간드로서 방사성 동위원소인 요오드-125로 표지한 사람 천연형 인슐린(PerkinElmer사, 모델번호 NEX-420, 미국)을 함께 넣은 뒤 상온에서 4시간 동안 경쟁 반응시켰다. 4 시간 뒤 베타 카운터(PerkinElmer 사, 모델번호 C9904V1, 미국)를 이용하여 인슐린 수용체의 결합력을 측정하였다. 베타카운터에서 측정된 수치는 GraphPad Prism 6 소프트웨어를 이용하여 실험한 각 물질의 IC50을 산출하였으며, 인간 인슐린의 인슐린 수용체 결합력에 대한 인슐린 아날로그의 인슐린 수용체 IC50의 백분비를 결합력으로 수치화하였다.
그 결과, 인간 인슐린과 대비하여 인슐린 아날로그(1번)은 90%, 인슐린 아날로그(2번)은 95%, 인슐린 아날로그(3번)은 1.0%, 인슐린 아날로그(4번)은 <0.1%, 인슐린 아날로그(6번)은 20%, 인슐린 아날로그(7번)은 8.5%, 인슐린 아날로그(9번)은 79%, 인슐린 아날로그(10번)은 79%, 인슐린 아날로그(11번)은 24%, 인슐린 아날로그(12번)은 <0.1%, 인슐린 아날로그(13번)은 <0.1%의 수용체 결합력이 확인되었다(표 4). 이와 같이 본 발명의 인슐린 아날로그들은 천연형 인슐린에 비해 인슐린 수용체 결합력이 감소되었음을 관찰하였다.
물질명 인슐린 수용체 결합력 ( vs . 인간 인슐린)
인슐린 아날로그 인슐린 아날로그 (1번) 90%
인슐린 아날로그 (2번) 95%
인슐린 아날로그 (3번) 1.0%
인슐린 아날로그 (4번) <0.1%
인슐린 아날로그 (6번) 20%
인슐린 아날로그 (7번) 8.5%
인슐린 아날로그 (9번) 79%
인슐린 아날로그 (10번) 79%
인슐린 아날로그 (11번) 24%
인슐린 아날로그 (12번) <0.1%
인슐린 아날로그 (13번) <0.1%
실험예 2: 지속형 인슐린 아날로그 결합체의 수용체 결합력 확인
상기 실험예 1에 기재된 방법으로 지속형 인슐린 아날로그의 인슐린 수용체와 IGF-1 수용체에 대한 결합력을 확인하였다.
그 결과, 인간 천연형 인슐린과 대비하여 인슐린 수용체에 대한 결합력은 천연형 인슐린-PEG-면역글로불린 Fc 결합체가 2.4±0.4%, 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체가 1.3±0.2%로 확인되었으며, IGF-1 수용체에 대한 결합력은 천연형 인슐린-PEG-면역글로불린 Fc 결합체와 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체 모두 사람 천연형 IGF-1에 대하여 1% 미만임을 확인하였다. 이와 같이 본 발명의 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체는 천연형 인슐린-PEG-면역글로불린 Fc 결합체에 비해 인슐린 수용체 결합력이 감소되었고, 두 물질 모두 PEG-면역글로불린 Fc 결합을 통해 낮은 IGF-1 수용체 결합력을 가지는 것을 확인하였다.
In vitro 결합 천연형 인슐린- PEG -면역글로불린 Fc 결합체 인슐린 아날로그 10- PEG -면역글로불린 Fc 결합체
수용체 결합 친화도(% vs 인슐린, SPA 방법) IR-B 결합 2.4±0.4 1.3±0.2
IGF-1R 결합1) <1% <1%
1) 용량 반응 곡선이 가장 높은 농도에서도 포화에 도달하지 않았기 때문에, 정확한 값은 측정되지 않았음
실험예 3: 지속형 인슐린 아날로그 결합체의 약동학적 분석
지속형 인슐린 아날로그 결합체의 약동학을 확인하기 위하여, 일정 기간 실험실에 적응한 정상 랫트 (SD rat, 수컷, 6주령), 정상 마우스, 및 개에서 시간에 따른 혈중 농도 비교 시험을 진행하였다.
천연형 인슐린 - PEG - 면역글로불린 Fc 결합체와 인슐린 아날로그 10 - PEG - 면역글로불린 Fc 결합체들을 마우스에는 43.05 nmol/kg으로, 랫트에는 65.1 nmol/kg으로 각각 단회 피하 투여한 후 0, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168시간에서 채혈하였다. 천연형 인슐린- PEG - 면역글로불린 Fc 결합체와 인슐린 아날로그 10 - PEG - 면역글로불린 Fc 결합체를 개에는 6.3 nmol/kg으로 각각 단회 피하 투여한 후, 0, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240시간에서 채혈하였다.
각 시간에서의 천연형 인슐린- PEG - 면역글로불린 Fc 결합체 및 인슐린 아날로그 10 - PEG - 면역글로불린 Fc 결합체들의 혈중 내 잔여 농도는 효소결합 면역흡착 분석법 (ELISA, enzyme linked immunosorbent assay)이용하여 측정하였으며, 사용된 키트는 Insulin ELISA (ALPCO, 미국)을 사용하였다. 단, 측정항체 (detection antibody)로는 mouse anti-human IgG4 HRP conjugate (Alpha Diagnostic Intl, Inc, 미국)를 사용하였다.
그 결과, 천연형 인슐린-PEG-면역글로불린 Fc 결합체 대비하여 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체는 마우스, 랫트, 개에서의 반감기가 각각 1.9배, 1.2배, 1.6배 증가하였고, MRT는 2.5배, 1.9배, 2.0배 증가하였다. 이와 같이 본 발명의 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체는 천연형 인슐린-PEG-면역글로불린 Fc 결합체에 비해 혈중 지속성이 증가되는 결과를 확인하였다.
시험물질 천연형 인슐린- PEG -면역글로불린 Fc 결합체 인슐린 아날로그 10- PEG -면역글로불린 Fc 결합체
마우스(43.05 nmol/kg sc, n=3) t1/2 (hr) 15.4 29.7
랫트(65.1 nmol/kg, sc, n=3) t1/2 (hr) 18.5 ± 1.4 22.8 ± 2.2
개(6.3 nmol/kg, sc, n=3) t1/2 (hr) 28.8 ± 2.0 44.9 ± 7.1
실험예 4: 지속형 인슐린 아날로그 결합체의 글루코스 강하 효능 확인
지속형 인슐린 아날로그 결합체의 약력학을 2형 당뇨모델에서 확인하기 위하여, 정상 랫트 (SD rat, 수컷, 7주령)에 2주간 고지방식 사료 (60% Fat)을 먹인 후, 췌장베타세포를 파괴할 수 있는 STZ를 30 mg/kg의 용량으로 1주 간격으로 총 2회 투여하여 제2형 당뇨모델을 제작하였다 (이하, DIO/STZ 랫트). 제작한 모델은 지속적 당뇨병 유지를 위해 고지방식 사료섭취를 계속 진행하였다.
천연형 인슐린- PEG - 면역글로불린 Fc 결합체와 인슐린 아날로그 10 - PEG - 면역글로불린 Fc 결합체들을 DIO/STZ 랫트에 각각 12.1 nmol/kg, 8.09 nmol/kg로 피하투여를 진행하되, 3일 간격으로 반복투여를 진행하였다. 천연형 인슐린- PEG - 면역글로불린 Fc 결합체와 인슐린 아날로그 10 - PEG - 면역글로불린 Fc 결합체에 의한 혈중 글루코스 강하 효능을 확인하기 위해 투여 0일, 1일, 3일, 6일, 7일, 9일, 10일, 12일, 13일, 15일, 16일, 21일, 22일, 24일, 25일, 27일, 28일에 미정맥으로 혈액을 채취, 혈중 글루코스 측정기(OneTouch® Ultra®, LifeScan, Inc., USA)를 이용하여 혈중 글루코스 수치를 확인하였다.
그 결과, 천연형 인슐린-PEG-면역글로불린 Fc 결합체 대비하여 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체는 DIO/STZ 랫트에서 50% 적은 용량을 투여해도 동등한 혈중 글루코스 강하 효능을 가짐을 확인하였다. 이를 통해 본 발명의 인슐린 아날로그 10-PEG-면역글로불린 Fc 결합체의 개선된 혈중 지속성이, 천연형 인슐린-PEG-면역글로불린 Fc 결합체 대비 적은 용량만으로도 우수한 혈중 글루코스 강하효능을 지속적으로 유지할 수 있음을 확인하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (32)

  1. 하기 화학식 1로 표시되는, 결합체:
    [화학식 1]
    X - La - F
    여기서, X는 천연형 인슐린 B-쇄의 16번 아미노산, B-쇄의 25번 아미노산, A-쇄의 14번 아미노산 및 A-쇄의 19번 아미노산으로 이루어진 군에서 선택된 하나 이상의 아미노산의 변이를 포함하는, 인슐린 아날로그이고;
    L은 링커이며;
    a는 0 또는 자연수이며, 다만 a가 2 이상일 때 각각의 L은 서로 독립적이고;
    F는 X의 반감기를 증가시킬 수 있는 물질이며;
    상기 결합체에서 X, L, 및 F가 화학식 1의 순서로 공유결합으로 서로 연결됨.
  2. 제1항에 있어서,
    상기 X는 천연형 인슐린 B-쇄의 16번 아미노산인 티로신의 글루탐산, 세린, 트레오닌, 또는 아스파르트산으로의 변이; 천연형 인슐린 B-쇄의 25번 아미노산인 페닐알라닌의 아스파르트산 또는 글루탐산으로의 변이; 천연형 인슐린 A-쇄의 14번 아미노산인 티로신의 히스티딘, 라이신, 알라닌, 또는 아스파르트산으로의 변이; 및 천연형 인슐린 A-쇄의 19번 아미노산인 티로신의 글루탐산, 세린, 또는 트레오닌으로의 변이로 이루어진 군에서 선택된 하나 이상의 변이를 포함하는,
    결합체.
  3. 제1항 또는 제2항에 있어서,
    상기 X는 하기 일반식 2로 표시되는 서열번호: 55의 A-쇄와 하기 일반식 3으로 표시되는 서열번호: 56의 B-쇄를 포함하는 인슐린 아날로그인, 결합체:
    [일반식 2]
    Xaa1-Ile-Val-Glu-Xaa5-Cys-Cys-Thr-Ser-Ile-Cys-Xaa12-Leu-Xaa14-Gln-Xaa16-Glu-Asn-Xaa19-Cys-Xaa21(서열번호: 55)
    상기 일반식 2에서,
    Xaa1는 알라닌, 글리신, 글루타민, 히스티딘, 글루탐산 또는 아스파라긴이고,
    Xaa5는 알라닌, 글루탐산, 글루타민, 히스티딘 또는 아스파라긴이고,
    Xaa12는 알라닌, 세린, 글루타민, 글루탐산, 히스티딘 또는 아스파라긴이고,
    Xaa14는 티로신, 히스티딘, 라이신, 알라닌 또는 아스파르트산이고,
    Xaa16는 알라닌, 류신, 티로신, 히스티딘, 글루탐산 또는 아스파라긴이고,
    Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고,
    Xaa21은 아스파라긴, 글리신, 히스티딘, 또는 알라닌임.
    [일반식 3]
    Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Xaa16-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Xaa25-Tyr-Xaa27-Xaa28-Lys-Thr(서열번호: 56)
    상기 일반식 3에서,
    Xaa16은 티로신, 글루탐산, 세린, 트레오닌, 또는 아스파르트산이고,
    Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고,
    Xaa27은 트레오닌이거나, 부존재하며,
    Xaa28은 프롤린, 글루탐산, 또는 아스파르트산이거나, 부존재함;
    단 여기서 A-쇄가 서열번호: 53과 일치하면서, B-쇄도 서열번호: 54의 B-쇄와 일치하는 펩티드는 제외한다.
  4. 제3항에 있어서,
    상기 일반식 2에서,
    Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신, 히스티딘, 라이신, 알라닌 또는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 세린, 또는 트레오닌이고, Xaa21은 아스파라긴이며,
    상기 일반식 3에서,
    Xaa16은 티로신, 글루탐산, 세린, 트레오닌, 또는 아스파르트산이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인,
    결합체.
  5. 제3항 또는 제4항에 있어서
    상기 일반식 2에서,
    Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신, 글루탐산, 또는 세린이고, Xaa21은 아스파라긴이며,
    상기 일반식 3에서,
    Xaa16은 티로신, 글루탐산, 세린, 또는 아스파르트산이고, Xaa25는 페닐알라닌, 아스파르트산, 또는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인,
    결합체.
  6. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 X는 일반식 2로 표시되는 서열번호: 55의 A-쇄와, 서열번호: 54의 B-쇄를 포함하는, 인슐린 아날로그인, 결합체.
  7. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 X는
    서열번호: 53의 A-쇄와 일반식 3으로 표시되는 서열번호: 56의 B-쇄를 포함하는, 인슐린 아날로그인, 결합체.
  8. 제3항에 있어서,
    상기 X는
    (1) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 히스티딘이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (2) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 라이신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (3) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 글루탐산이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (4) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 세린이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (5) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (6) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 글루탐산이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (7) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 세린이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (8) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 트레오닌이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (9) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 알라닌이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (10) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (11) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 아스파르트산이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (12) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 아스파르트산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린이거나;
    (13) 상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인,
    결합체.
  9. 제1항 내지 제8항 중 어느 한 항에 있어서,
    상기 X는 서열번호: 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 및 52로 이루어진 군에서 선택된 아미노산 서열을 포함하는 인슐린 아날로그인, 결합체.
  10. 제3항에 있어서,
    상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 글루탐산이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 결합체.
  11. 제3항에 있어서,
    상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 세린이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 결합체.
  12. 제3항에 있어서,
    상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 트레오닌이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 결합체.
  13. 제3항에 있어서,
    상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 아스파르트산이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 페닐알라닌이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 결합체.
  14. 제3항에 있어서,
    상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 아스파르트산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 결합체.
  15. 제3항에 있어서,
    상기 일반식 2에서, Xaa1는 글리신이고, Xaa5는 글루타민이고, Xaa12는 세린이고, Xaa14는 티로신이고, Xaa16는 류신이고, Xaa19는 티로신이고, Xaa21은 아스파라긴이며, 상기 일반식 3에서, Xaa16은 티로신이고, Xaa25는 글루탐산이고, Xaa27은 트레오닌이며, Xaa28은 프롤린인, 결합체.
  16. 제1항 내지 제15항 중 어느 한 항에 있어서,
    F는 고분자 중합체, 지방산, 콜레스테롤, 알부민 및 이의 단편, 알부민 결합물질, 특정 아미노산 서열의 반복단위의 중합체, 항체, 항체 단편, FcRn 결합물질, 생체 내 결합조직, 뉴클레오타이드, 파이브로넥틴, 트랜스페린(Transferrin), 사카라이드(saccharide), 헤파린, 및 엘라스틴으로 이루어진 군에서 선택되는, 결합체.
  17. 제1항 내지 제16항 중 어느 한 항에 있어서,
    상기 고분자 중합체는 폴리에틸렌 글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 폴리비닐알콜, 폴리사카라이드, 덱스트란, 폴리비닐에틸에테르, 생분해성 고분자, 지질 중합체, 키틴, 히아루론산, 올리고뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는, 결합체.
  18. 제1항 내지 제17항 중 어느 한 항에 있어서,
    상기 F는 면역글로불린 Fc 영역인, 결합체.
  19. 제1항 내지 제18항 중 어느 한 항에 있어서, 상기 F는 IgG Fc 영역인, 결합체.
  20. 제1항 내지 제19항 중 어느 한 항에 있어서,
    상기 L은 펩타이드, 지방산, 사카라이드 (saccharide), 고분자 중합체, 저분자 화합물, 뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는, 결합체.
  21. 제20항에 있어서, 상기 고분자 중합체는 폴리에틸렌 글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 폴리비닐알콜, 폴리사카라이드, 덱스트란, 폴리비닐에틸에테르, 생분해성 고분자, 지질 중합체, 키틴, 히아루론산, 올리고뉴클레오타이드 및 이들의 조합으로 이루어진 군으로부터 선택되는, 결합체.
  22. 제1항 내지 제21항 중 어느 한 항에 있어서, 상기 L은 폴리에틸렌 글리콜인, 결합체.
  23. 제20항에 있어서, 상기 고분자 중합체는 1 내지 100kDa의 분자량을 가지는, 결합체.
  24. 제1항 내지 제23항 중 어느 한 항에 있어서, 인슐린 아날로그의 B-쇄의 N-말단 또는 인슐린 아날로그 내의 라이신 잔기에 링커가 연결된, 결합체.
  25. 제1항 내지 제24항 중 어느 한 항에 있어서, 상기 F는 면역글로불린 Fc 영역이고, 면역글로불린 Fc 영역의 N-말단에 링커가 연결된, 결합체.
  26. 제1항 내지 제25항 중 어느 한 항에 있어서,
    상기 F는 면역글로불린 Fc 영역이고, 상기 결합체는 링커의 양 말단이 각각 인슐린 아날로그의 B-쇄의 N-말단과 면역글로불린 Fc의 N-말단에 연결된 구조인,
    결합체.
  27. 제1항 내지 제26항 중 어느 한 항에 있어서, 상기 인슐린 아날로그는 천연형 인슐린 대비 천연형 인슐린 수용체에 대한 결합력이 저하된 결합체.
  28. 제27항에 있어서, 상기 인슐린 아날로그의 천연형 인슐린 수용체에 대한 결합력은 천연형 인슐린의 약 10% 내지 약 90%인 결합체.
  29. 제27항에 있어서, 상기 결합체는 F가 면역글로불린 Fc 영역이고, L이 폴리에틸렌글리콜이며 천연형 인슐린 수용체에 대한 결합력은 천연형 인슐린의 0.1% 내지 50%인 결합체.
  30. 제1항 내지 제29항 중 어느 한 항에 있어서, 상기 결합체는 F가 면역글로불린 Fc 영역이고, L이 폴리에틸렌글리콜이며 X가 A-쇄 14번 아미노산이 아스파르트산인 것 외에는 천연형 인슐린과 서열이 동일한 인슐린 아날로그인 결합체.
  31. 제1항 내지 제30항 중 어느 한 항의 결합체를 포함하는, 당뇨병의 예방 또는 치료용 약학적 조성물.
  32. 제1항 내지 제30항 중 어느 한 항의 결합체 또는 이를 포함하는 조성물을 당뇨병 치료를 필요로 하는 개체에 투여하는 단계를 포함하는, 당뇨병을 치료하는 방법.
PCT/KR2018/003489 2017-03-23 2018-03-23 인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도 WO2018174668A2 (ko)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA3054899A CA3054899A1 (en) 2017-03-23 2018-03-23 Insulin analog complex with reduced affinity for insulin receptor and use thereof
AU2018239037A AU2018239037B2 (en) 2017-03-23 2018-03-23 Insulin analog complex with reduced affinity for insulin receptor and use thereof
EP18772695.5A EP3604328A4 (en) 2017-03-23 2018-03-23 REDUCED INSULIN ANALOGUE COMPLEX FOR INSULIN RECEPTOR AND ITS USE
JP2019552181A JP2020511513A (ja) 2017-03-23 2018-03-23 インスリン受容体との結合力が減少されたインスリンアナログの結合体及びその用途
CN201880026742.8A CN110536899B (zh) 2017-03-23 2018-03-23 对胰岛素受体具有降低的亲和力的胰岛素类似物复合物及其用途
MX2019011297A MX2019011297A (es) 2017-03-23 2018-03-23 Complejo de analogo de insulina con afinidad reducida por el receptor de insulina y uso del mismo.
RU2019131593A RU2779462C2 (ru) 2017-03-23 2018-03-23 Комплекс аналога инсулина со сниженной аффинностью к инсулиновому рецептору и его применение
BR112019019823A BR112019019823A2 (pt) 2017-03-23 2018-03-23 conjugado, composição farmacêutica para prevenir ou tratar diabetes e método para tratamento de diabetes
US16/495,884 US11752216B2 (en) 2017-03-23 2018-03-23 Insulin analog complex with reduced affinity for insulin receptor and use thereof
JP2022205798A JP2023024674A (ja) 2017-03-23 2022-12-22 インスリン受容体との結合力が減少されたインスリンアナログの結合体及びその用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170037101 2017-03-23
KR10-2017-0037101 2017-03-23

Publications (2)

Publication Number Publication Date
WO2018174668A2 true WO2018174668A2 (ko) 2018-09-27
WO2018174668A3 WO2018174668A3 (ko) 2018-12-20

Family

ID=63584449

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/003489 WO2018174668A2 (ko) 2017-03-23 2018-03-23 인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도

Country Status (12)

Country Link
US (1) US11752216B2 (ko)
EP (1) EP3604328A4 (ko)
JP (2) JP2020511513A (ko)
KR (1) KR102629006B1 (ko)
CN (1) CN110536899B (ko)
AR (1) AR111341A1 (ko)
AU (1) AU2018239037B2 (ko)
BR (1) BR112019019823A2 (ko)
CA (1) CA3054899A1 (ko)
MX (1) MX2019011297A (ko)
TW (1) TWI798209B (ko)
WO (1) WO2018174668A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3578204A4 (en) * 2017-02-03 2021-01-06 Hanmi Pharm. Co., Ltd. BIOACTIVE SUBSTANCE CONJUGATE WITH ENHANCED DURABILITY AND ITS USE
US11098102B2 (en) 2018-12-11 2021-08-24 Sanofi Insulin conjugates

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3517544A4 (en) 2016-09-23 2020-06-03 Hanmi Pharm. Co., Ltd. INSULIN ANALOG HAVING REDUCED INSULIN RECEPTOR BINDING FORCE AND USE THEREOF
CN114675019B (zh) * 2022-02-10 2022-12-16 江苏省人民医院（南京医科大学第一附属医院） 一种检测胰岛素受体胞外段抗体的试剂盒

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996032478A1 (en) 1995-04-14 1996-10-17 Genentech, Inc. Altered polypeptides with increased half-life
WO1997034631A1 (en) 1996-03-18 1997-09-25 Board Of Regents, The University Of Texas System Immunoglobin-like domains with increased half lives

Family Cites Families (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE2536040A1 (de) 1975-08-13 1977-02-24 Hoechst Ag Insulin-analoga mit biologischer wirkung
US5175145A (en) 1988-08-26 1992-12-29 Amylin Pharmaceuticals, Inc. Treatment of diabetes mellitus with amylin agonists
AU641631B2 (en) 1988-12-23 1993-09-30 Novo Nordisk A/S Human insulin analogues
US5716927A (en) 1988-12-23 1998-02-10 Novo Nordisk A/S Insulin analogs having a modified B-chain
US5422339A (en) 1991-03-19 1995-06-06 Joslin Diabetes Center, Inc. Peptides having insulin autoantibody but not insulin receptor binding capacity
US5424286A (en) 1993-05-24 1995-06-13 Eng; John Exendin-3 and exendin-4 polypeptides, and pharmaceutical compositions comprising same
US6660843B1 (en) 1998-10-23 2003-12-09 Amgen Inc. Modified peptides as therapeutic agents
ATE284415T1 (de) 1999-01-06 2004-12-15 Genentech Inc Mutierte variante des insulin-ähnlichen wachstumsfaktor-i (igf-i)
EP1432430A4 (en) 2001-08-28 2006-05-10 Lilly Co Eli PREMIXTURES OF GLP-1 AND BASALINSULIN
AR036711A1 (es) 2001-10-05 2004-09-29 Bayer Corp Peptidos que actuan como agonistas del receptor del glp-1 y como antagonistas del receptor del glucagon y sus metodos de uso farmacologico
JP2005508360A (ja) 2001-10-19 2005-03-31 イーライ・リリー・アンド・カンパニー Ｇｌｐ−１およびインスリンの二相混合物
DE10227232A1 (de) 2002-06-18 2004-01-15 Aventis Pharma Deutschland Gmbh Saure Insulinzubereitungen mit verbesserter Stabilität
CA2518776A1 (en) 2003-04-29 2004-11-11 Eli Lilly And Company Insulin analogs having protracted time action
ATE433994T1 (de) 2003-07-25 2009-07-15 Conjuchem Biotechnologies Inc Insulinderivative mit langanhaltender wirkung und verfahren zu deren herstellung
KR20050047030A (ko) 2003-11-13 2005-05-19 한미약품 주식회사 약물의 캐리어로서 유용한 ＩｇＧ Ｆｃ 단편 및 그의제조방법
WO2005113606A2 (en) 2004-05-13 2005-12-01 Eli Lilly And Company Fgf-21 fusion proteins
WO2006138572A2 (en) 2005-06-16 2006-12-28 Nektar Therapeutics Al, Corporation Conjugates having a degradable linkage and polymeric reagents useful in preparing such conjugates
WO2007020256A1 (en) 2005-08-16 2007-02-22 Novo Nordisk A/S Method for making mature insulin polypeptides
US20090306337A1 (en) 2006-07-31 2009-12-10 Novo Nordisk A/S Pegylated, Extended Insulins
RU2524150C2 (ru) 2006-09-22 2014-07-27 Ново Нордиск А/С Аналоги инсулина, устойчивые к протеазам
US7790677B2 (en) 2006-12-13 2010-09-07 Elona Biotechnologies Insulin production methods and pro-insulin constructs
JP2008169195A (ja) 2007-01-05 2008-07-24 Hanmi Pharmaceutical Co Ltd キャリア物質を用いたインスリン分泌ペプチド薬物結合体
TW200907056A (en) 2007-03-28 2009-02-16 Astrazeneca Ab New method
WO2008145721A2 (en) 2007-06-01 2008-12-04 Novo Nordisk A/S N-terminal modification of polypeptides for protection against degradation by aminopeptidases
EP2170945A1 (en) 2007-07-16 2010-04-07 Novo Nordisk A/S Protease stabilized, pegylated insulin analogues
EP2017288A1 (en) 2007-07-16 2009-01-21 Novo Nordisk A/S Protease stabilized, pegylated insulin analogues
JP2009019027A (ja) 2007-07-16 2009-01-29 Hanmi Pharmaceutical Co Ltd アミノ末端のアミノ酸が変異したインスリン分泌ペプチド誘導体
AU2008288413B2 (en) 2007-08-15 2013-09-26 Novo Nordisk A/S Insulin analogues with an acyl and aklylene glycol moiety
DK2597103T3 (en) 2007-11-16 2017-02-13 Novo Nordisk As Stable pharmaceutical compositions comprising liraglutide and degludec
MY152979A (en) 2008-01-09 2014-12-15 Sanofi Aventis Deutschland Novel insulin derivatives having an extremely delayed time-action profile
BRPI0907119A2 (pt) 2008-01-09 2015-07-14 Sanofi Aventis Deutschland Derivados de insulina tendo um perfil de ação de tempo extremamente retardado
DE102008025008A1 (de) 2008-05-24 2009-11-26 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008003568A1 (de) 2008-01-09 2009-07-16 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
US9260502B2 (en) 2008-03-14 2016-02-16 Novo Nordisk A/S Protease-stabilized insulin analogues
RU2571857C2 (ru) 2008-03-18 2015-12-20 Ново Нордиск А/С Стабилизированные по отношению к протеазам ацилированные аналоги инсулина
WO2009129250A2 (en) 2008-04-14 2009-10-22 Case Western Reserve University Meal-time insulin analogues of enhanced stability
KR101939557B1 (ko) 2008-10-17 2019-01-17 사노피-아벤티스 도이칠란트 게엠베하 인슐린과 ｇｌｐ－1 효능제의 병용물
JP5789515B2 (ja) 2008-12-19 2015-10-07 インディアナ ユニバーシティー リサーチ アンド テクノロジー コーポレーションＩｎｄｉａｎａ Ｕｎｉｖｅｒｓｉｔｙ Ｒｅｓｅａｒｃｈ Ａｎｄ Ｔｅｃｈｎｏｌｏｇｙ Ｃｏｒｐｏｒａｔｉｏｎ インスリン類似体
WO2010080609A1 (en) 2008-12-19 2010-07-15 Indiana University Research And Technology Corporation Amide-based insulin prodrugs
BRPI1013588A2 (pt) 2009-03-27 2016-04-19 Glaxo Group Ltd composição
US20120184488A1 (en) 2009-09-01 2012-07-19 Case Western Reserve University Insulin analogues of enhanced receptor-binding specificity
RU2537239C2 (ru) 2009-11-13 2014-12-27 Санофи-Авентис Дойчланд Гмбх Фармацевтическая композиция, включающая агонист glp-1, инсулин и метионин
WO2011075606A2 (en) 2009-12-18 2011-06-23 Alios Biopharma, Inc. Hyperglycosylated polypeptide variants and methods of use
US8703701B2 (en) 2009-12-18 2014-04-22 Indiana University Research And Technology Corporation Glucagon/GLP-1 receptor co-agonists
KR101058209B1 (ko) 2009-12-30 2011-08-22 전자부품연구원 Ｏｆｄｍ 방식의 디지털 방송 시스템의 빠른 동기 방법
AR081066A1 (es) 2010-04-02 2012-06-06 Hanmi Holdings Co Ltd Conjugado de insulina donde se usa un fragmento de inmunoglobulina
KR101324828B1 (ko) 2010-06-08 2013-11-01 한미사이언스 주식회사 면역글로불린 단편을 이용한 단쇄 인슐린 아날로그 약물 결합체
KR101330868B1 (ko) 2010-06-08 2013-11-18 한미사이언스 주식회사 면역글로불린 단편을 이용한 인슐린 유도체 약물 결합체
WO2011159895A2 (en) 2010-06-16 2011-12-22 Indiana University Research And Technology Corporation Single chain insulin agonists exhibiting high activity at the insulin receptor
KR101382593B1 (ko) 2010-07-21 2014-04-10 한미사이언스 주식회사 신규한 지속형 글루카곤 결합체 및 이를 포함하는 비만 예방 및 치료용 약학적 조성물
WO2012015692A2 (en) 2010-07-28 2012-02-02 Smartcells, Inc. Recombinantly expressed insulin polypeptides and uses thereof
EP2665487A1 (en) 2011-01-20 2013-11-27 Zealand Pharma A/S Combination of acylated glucagon analogues with insulin analogues
US9528180B2 (en) 2011-03-02 2016-12-27 Oerlikon Surface Solutions Ag, Pfaffikon Sliding component coated with metal-comprising carbon layer for improving wear and friction behavior by tribological applications under lubricated conditions
CN102675452B (zh) 2011-03-17 2015-09-16 重庆富进生物医药有限公司 具持续降血糖和受体高结合的人胰岛素及类似物的偶联物
EP2705325B1 (en) 2011-05-03 2015-04-08 Teijin Aramid B.V. Antiballistic panel
UA113626C2 (xx) 2011-06-02 2017-02-27 Композиція для лікування діабету, що містить кон'югат інсуліну тривалої дії та кон'югат інсулінотропного пептиду тривалої дії
EP2714070B1 (en) 2011-06-02 2024-03-20 OPKO Biologics Ltd. Long-acting glp-1/glucagon receptor agonists
EP3434687B1 (en) 2011-06-10 2021-03-10 Hanmi Science Co., Ltd. Novel oxyntomodulin derivatives and pharmaceutical composition for treating obesity comprising the same
CN103596584B (zh) 2011-06-15 2016-12-14 诺沃—诺迪斯克有限公司 多取代的胰岛素
RU2733544C2 (ru) 2011-06-17 2020-10-05 Ханми Сайенс Ко., Лтд. Конъюгат, содержащий оксинтомодулин и фрагмент иммуноглобулина, и его применение
US9165768B2 (en) 2011-12-16 2015-10-20 Lg Innotek Co., Ltd. Method for deposition of silicon carbide and silicon carbide epitaxial wafer
JP2015507916A (ja) 2012-01-20 2015-03-16 ケース ウェスタン リザーブ ユニバーシティＣａｓｅ Ｗｅｓｔｅｒｎｒｅｓｅｒｖｅ Ｕｎｉｖｅｒｓｉｔｙ グルタミン酸安定化インスリン類似体
JP6382111B2 (ja) 2012-03-01 2018-08-29 ノヴォ ノルディスク アー／エス Ｎ末端改変オリゴペプチド及びその使用
KR101665009B1 (ko) 2012-03-09 2016-10-11 한미사이언스 주식회사 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
AR091902A1 (es) * 2012-07-25 2015-03-11 Hanmi Pharm Ind Co Ltd Formulacion liquida de un conjugado de insulina de accion prolongada
KR101968344B1 (ko) 2012-07-25 2019-04-12 한미약품 주식회사 옥신토모듈린 유도체를 포함하는 고지혈증 치료용 조성물
AR092862A1 (es) 2012-07-25 2015-05-06 Hanmi Pharm Ind Co Ltd Formulacion liquida de insulina de accion prolongada y un peptido insulinotropico y metodo de preparacion
AR094821A1 (es) 2012-07-25 2015-09-02 Hanmi Pharm Ind Co Ltd Formulación líquida de un conjugado de péptido insulinotrópico de acción prolongada
WO2014049610A2 (en) 2012-09-26 2014-04-03 Cadila Healthcare Limited Peptides as gip, glp-1 and glucagon receptors triple-agonist
KR101993393B1 (ko) 2012-11-06 2019-10-01 한미약품 주식회사 옥신토모듈린 유도체를 포함하는 당뇨병 또는 비만성 당뇨병 치료용 조성물
ES2748158T3 (es) 2012-11-06 2020-03-13 Hanmi Pharm Ind Co Ltd Formulación líquida de conjugado de proteínas que comprende la oxintomodulina y un fragmento de inmunoglobulina
WO2014133324A1 (ko) * 2013-02-26 2014-09-04 한미약품 주식회사 신규한 인슐린 아날로그 및 이의 용도
CA2899418C (en) 2013-02-26 2022-05-03 Hanmi Pharm. Co., Ltd. Site-specific insulin conjugate
AR096891A1 (es) * 2013-07-12 2016-02-03 Hanmi Pharm Ind Co Ltd Conjugado de monómero polipéptido biológicamente activo y conjugado de fragmento fc de inmunoglobulina, que muestra aclaramiento mediado por receptor reducido, y el método para la preparación del mismo
WO2015013745A1 (en) 2013-07-29 2015-02-05 Berkeley Information Technology Pty Ltd Systems and methodologies for managing document access permissions
EP3098235A4 (en) 2014-01-20 2017-10-18 Hanmi Pharm. Co., Ltd. Long-acting insulin and use thereof
AR100639A1 (es) 2014-05-29 2016-10-19 Hanmi Pharm Ind Co Ltd Composición para tratar diabetes que comprende conjugados de análogos de insulina de acción prolongada y conjugados de péptidos insulinotrópicos de acción prolongada
TWI684458B (zh) 2014-05-30 2020-02-11 南韓商韓美藥品股份有限公司 包含胰島素及ｇｌｐ-１/昇糖素雙重促效劑之治療糖尿病之組成物
KR20160001391A (ko) * 2014-06-27 2016-01-06 한미약품 주식회사 신규한 지속형 인슐린 아날로그 결합체 및 이의 용도
KR20160007295A (ko) * 2014-07-11 2016-01-20 한미약품 주식회사 인슐린 아날로그
KR101676542B1 (ko) 2014-12-30 2016-11-16 건국대학교 산학협력단 프로인슐린의 면역학적 용도
UY36870A (es) 2015-08-28 2017-03-31 Hanmi Pharm Ind Co Ltd Análogos de insulina novedosos
US20180291077A1 (en) 2015-09-24 2018-10-11 Hanmi Pharm. Co., Ltd Method of insulin production
EP3517544A4 (en) * 2016-09-23 2020-06-03 Hanmi Pharm. Co., Ltd. INSULIN ANALOG HAVING REDUCED INSULIN RECEPTOR BINDING FORCE AND USE THEREOF

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996032478A1 (en) 1995-04-14 1996-10-17 Genentech, Inc. Altered polypeptides with increased half-life
WO1997034631A1 (en) 1996-03-18 1997-09-25 Board Of Regents, The University Of Texas System Immunoglobin-like domains with increased half lives

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DIABETES CARE, vol. 13, 1990, pages 923
DIABETES, vol. 39, 1990, pages 1033
H. NEURATHR. L. HILL: "The Proteins", 1979, ACADEMIC PRESS
J PHARMACOL EXP THER, vol. 286, 1998, pages 959

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3578204A4 (en) * 2017-02-03 2021-01-06 Hanmi Pharm. Co., Ltd. BIOACTIVE SUBSTANCE CONJUGATE WITH ENHANCED DURABILITY AND ITS USE
US11098102B2 (en) 2018-12-11 2021-08-24 Sanofi Insulin conjugates

Also Published As

Publication number Publication date
AR111341A1 (es) 2019-07-03
EP3604328A2 (en) 2020-02-05
EP3604328A4 (en) 2021-01-06
WO2018174668A3 (ko) 2018-12-20
KR102629006B1 (ko) 2024-01-25
MX2019011297A (es) 2019-11-12
AU2018239037A1 (en) 2019-10-24
RU2019131593A3 (ko) 2021-07-05
KR20180108510A (ko) 2018-10-04
RU2019131593A (ru) 2021-04-23
US20200101171A1 (en) 2020-04-02
CN110536899A (zh) 2019-12-03
TWI798209B (zh) 2023-04-11
JP2020511513A (ja) 2020-04-16
JP2023024674A (ja) 2023-02-16
TW201838647A (zh) 2018-11-01
US11752216B2 (en) 2023-09-12
AU2018239037B2 (en) 2022-05-26
CA3054899A1 (en) 2018-09-27
CN110536899B (zh) 2023-12-12
BR112019019823A2 (pt) 2020-04-22

Similar Documents

Publication Publication Date Title
WO2017116205A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체의 지속형 결합체
WO2017052321A1 (ko) 다수의 생리활성 폴리펩타이드 및 면역글로불린 Fc 영역을 포함하는, 단백질 결합체
AU2016287209B2 (en) Glucagon derivative and a composition comprising a long acting conjugate of the same
WO2015108398A1 (ko) 지속형 인슐린 및 그 용도
WO2018004283A2 (ko) 글루카곤 유도체, 이의 결합체, 및 이를 포함하는 조성물, 및 이의 치료적 용도
WO2012173422A9 (en) A conjugate comprising oxyntomodulin and an immunoglobulin fragment, and use thereof
WO2018174668A2 (ko) 인슐린 수용체와의 결합력이 감소된 인슐린 아날로그의 결합체 및 이의 용도
WO2014073845A1 (en) A composition for treating diabetes or diabesity comprising oxyntomodulin analog
WO2018117613A1 (ko) 뇌 표적 지속성 단백질 결합체
WO2019066586A1 (ko) 글루카곤 유사 펩타이드-2(glp-2) 유도체의 지속형 결합체
WO2018056764A1 (ko) 인슐린 수용체와의 결합력이 감소된, 인슐린 아날로그 및 이의 용도
WO2015152618A1 (ko) 면역글로불린 fc 단편 결합을 이용한 단백질 및 펩타이드의 용해도를 개선시키는 방법
WO2018143729A1 (ko) 지속성이 증가된 생리활성 물질의 결합체 및 이의 용도
WO2017116207A1 (ko) Fgf21 아날로그, fgf21 결합체, 및 이의 용도
WO2019066570A1 (ko) 지속형 단쇄 인슐린 아날로그 및 이의 결합체
WO2020130749A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체 및 인슐린을 포함하는 약학 조성물
WO2020071865A1 (ko) 글루카곤 및 이를 포함하는 조합물의 치료학적 용도
WO2023106845A1 (ko) 신규한 아디포넥틴 아날로그 및 결합체
WO2022080986A1 (ko) Glp-1/gip 이중작용제, 이의 지속형 결합체, 및 이를 포함하는 약학적 조성물
WO2022015082A1 (ko) 글루카곤 유도체 또는 이의 결합체의 간질환에 대한 치료적 용도
WO2021215801A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체 또는 이의 결합체를 포함하는 고지혈증 예방 또는 치료용 약학적 조성물 및 예방 또는 치료 방법
WO2022015115A1 (ko) 3중 작용성 지속형 결합체 또는 3중 작용제를 포함하는 조합물의 치료학적 용도
WO2019022563A2 (ko) 이두로네이트 2-설파타제 결합체
WO2021133087A1 (ko) Glp-2 또는 이의 결합체를 포함하는 골 대사성 질환에 대한 예방 또는 치료용 약학적 조성물
WO2020214013A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체 또는 이의 결합체의 고지혈증에 대한 치료적 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18772695

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3054899

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019552181

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019019823

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018239037

Country of ref document: AU

Date of ref document: 20180323

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018772695

Country of ref document: EP

Effective date: 20191023

ENP Entry into the national phase

Ref document number: 112019019823

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190923