WO2019156540A1 - 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물 - Google Patents

코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물 Download PDF

Info

Publication number
WO2019156540A1
WO2019156540A1 PCT/KR2019/001708 KR2019001708W WO2019156540A1 WO 2019156540 A1 WO2019156540 A1 WO 2019156540A1 KR 2019001708 W KR2019001708 W KR 2019001708W WO 2019156540 A1 WO2019156540 A1 WO 2019156540A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
growth factor
composition
revision
under rule
Prior art date
Application number
PCT/KR2019/001708
Other languages
English (en)
French (fr)
Inventor
호성현
박수진
Original Assignee
주식회사 지앤피바이오사이언스
이연제약 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 지앤피바이오사이언스, 이연제약 주식회사 filed Critical 주식회사 지앤피바이오사이언스
Priority to US16/969,092 priority Critical patent/US20210113668A1/en
Priority to CA3093538A priority patent/CA3093538C/en
Priority to EP19751210.6A priority patent/EP3753551A4/en
Priority to JP2020543153A priority patent/JP7301860B2/ja
Priority to CN201980025172.5A priority patent/CN112203644A/zh
Priority to AU2019217186A priority patent/AU2019217186B2/en
Publication of WO2019156540A1 publication Critical patent/WO2019156540A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/02—Halogenated hydrocarbons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/02—Halogenated hydrocarbons
    • A61K31/025—Halogenated hydrocarbons carbocyclic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/02—Halogenated hydrocarbons
    • A61K31/035—Halogenated hydrocarbons having aliphatic unsaturation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/16—Fluorine compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1833—Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/30—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/36—Blood coagulation or fibrinolysis factors
    • A61K38/37—Factors VIII
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A61K47/186—Quaternary ammonium compounds, e.g. benzalkonium chloride or cetrimide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/28—Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/08—Solutions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1605—Excipients; Inactive ingredients
    • A61K9/1617—Organic compounds, e.g. phospholipids, fats
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/19—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles lyophilised, i.e. freeze-dried, solutions or dispersions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005—Wall or coating material
    • A61K9/5015—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/4753—Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric

Definitions

  • the present invention relates to a growth factor gene expression increasing composition comprising the core-shell structure of the microparticles as an active ingredient.
  • HGF Human Hepatocyte Growth Factor
  • hepatocyte growth factor can be developed as a therapeutic for various diseases such as ischemic disease, neurological disease, kidney disease and liver disease.
  • human type 1 insulin like growth factor is a polypeptide hormone consisting of 70 amino acids having insulin-like activity and mitogenic biological growth activity. These hormones enhance cell growth in various tissues such as the musculoskeletal system, liver, kidneys, intestines, nervous system tissues, heart and lungs.
  • IGF1 insulin growth factor 1
  • studies have been reported on the use of IGF1 as a potential therapeutic agent for treating neurodegenerative symptoms. See, eg, Kanje et al ., Brain Res., 486: 396-398 (1989); Hantai et al ., J. Neurol. Sci., 129: 122-126 (1995); Contreras et al ., Pharmac. Exp.
  • IGF1 therapy is prescribed for a number of neurological symptoms, including ALS, stroke, epilepsy, Parkinson's disease, Alzheimer's disease, acute traumatic injury and trauma, aging, disease or other disorders associated with injury.
  • ALS ALS
  • stroke epilepsy
  • Parkinson's disease Alzheimer's disease
  • acute traumatic injury and trauma
  • aging disease or other disorders associated with injury.
  • US Pat. Nos. 5,093,137, 5,652,214, and 5,703,045 See International Publication Nos. 1990-001483 and 1993-002695.
  • IGF1 therapy for a variety of other conditions is mentioned in a number of publications. See, eg, Schalch et al ., "Short-term metabolic effects of recombinant human insulin-like growth factor I (rhIGF-I) in type II diabetes mellitus". Modern Concepts of Insulin-Like Growth Factors, Spencer, ed., New York: Elsevier Science Publ. Co. pp. 705-714 (1991); Clemmons and Underwood, J. Clin. Endocrinol. Metab., 79 (1): 4-6 (1994); And Langford et al ., Eur. J. Clin.
  • the core-shell structure of the core is a halogenated hydrocarbon and / or sulfur halide
  • the outer shell is composed of lipid components
  • the first problem to be solved by the present invention is to provide a composition for increasing the growth factor gene expression comprising the micro-particles of the core-shell structure as an active ingredient.
  • the second problem to be solved by the present invention is to provide a pharmaceutical composition for preventing or treating ischemic disease, neurological disease, kidney disease or liver disease comprising the composition.
  • a third object of the present invention is to provide a pharmaceutical composition for preventing or treating a condition or disease mediated by IGF1 receptor binding, including the composition.
  • the present invention is a composition for increasing the growth factor gene expression comprising micro-particles of the core-shell structure as an active ingredient, the core is a halogenated hydrocarbon, sulfur halide or a mixture thereof as a biocompatible gas,
  • the shell comprises a lipid or a derivative thereof, wherein the growth factor gene is one or more genes selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of human hepatocyte growth factor, and a variant gene thereof. ; Or one or more genes selected from a human type 1 insulin like growth factor (IGF1) gene, a heterologous gene of human type 1 insulin like growth factor, and a variant gene thereof. It provides a composition for increasing gene expression.
  • HGF human hepatocyte growth factor
  • IGF1 insulin like growth factor
  • the biocompatible gas is sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, Chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane and mixtures thereof.
  • the halogenated hydrocarbon may be a perfluorinated hydrocarbon.
  • the perfluorinated hydrocarbon is perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane; Perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-yne, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclo Butane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or mixtures thereof.
  • the lipid may be at least one selected from the group consisting of simple lipids, phospholipids, glycero glycolipids, sphingolipids, cholesterol and cationic lipids.
  • the phospholipid is a phosphatidylcholine derivative, phosphatidylethanolamine derivative, phosphatidylserine derivative, diacetylated phospholipid, L- ⁇ -dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, It may be selected from the group consisting of phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, polyethylene glycolated phospholipid, egg yolk lecithin, soybean lecithin and hydrogenated phospholipid.
  • the glycerol glycolipid is a group consisting of sulfoxy ribosyl glycerides, diglycosyl diglycerides, digalactosyl diglycerides, galactosyl diglycerides and glycosyl diglycerides It may be selected from.
  • the sphingolipid glycolipid may be galactosyl serebroside, lactosyl serebroside or ganglioside.
  • the cationic lipid is 1,2-dioleoyl-3-trimethylammonio propane (DOTAP), N- (2,3-dioleyloxy propan-1-yl) -N, N, N-trimethyl ammonium chloride (DOTMA), 2,3-dioleyloxy-N- [2- (sperminecarboxyamide) ethyl] -N, N-dimethyl-1-propaneamitrifluoro acetic acid ( DOSPA), 1,2-dimyristyloxy propyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyloxy propyl-3-diethyl hydroxyethyl ammonium bromide (DORIE) and 3 ⁇ - [N- (N'N'-dimethylaminoethyl) carbamoyl] cholesterol (DC-Chol) may be selected from the group consisting of.
  • DOTAP 1,2-dioleoyl-3-trimethyl
  • the variant gene of the human hepatocyte growth factor may be made of any one selected from the nucleotide sequences of SEQ ID NOs: 3 to 6.
  • the composition may increase the expression level of the growth factor gene by 30% or more.
  • the present invention provides one or more genes selected from human hepatocyte growth factor (HGF) gene, heterologous gene of human hepatocyte growth factor, and variant genes thereof; and preventing ischemic disease, neurological disease, kidney disease or liver disease, including Or it provides a pharmaceutical composition for treatment.
  • HGF human hepatocyte growth factor
  • the human hepatocyte growth factor gene is composed of the nucleotide sequence of SEQ ID NO: 2, and the variant of the human hepatocyte growth factor is SEQ ID NO: 3 to It may be made of any one selected from the base sequence of 6.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by.
  • IGF1 insulin like growth factor
  • the human type 1 insulin-like growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 7.
  • the symptoms or diseases are, elongation, obesity, weight loss, cachexia, anorexia, neurodegenerative disorders, fibrosis-related symptoms, cartilage disorders, bone disease, inflammatory disorders, bowel disorders, insulin resistance , Diabetes, diabetic ketoacidosis, Rabson-Mendenhall syndrome, retinopathy, acromegaly, fibromuscular hyperplasia, and heart disorders.
  • the subject in need of treatment for short stature is a human pediatric individual with insulin-like growth factor-1 deficiency (IGFD), and the composition is effective for the treatment of IGFD in a human pediatric individual. Can be.
  • IGFD insulin-like growth factor-1 deficiency
  • the growth factor gene expression increasing composition of the present invention may increase the expression level of the growth factor gene at least 30% or more when administered to a living body together with a gene (eg, a polynucleotide encoding a gene or a vector comprising the same). have.
  • a gene eg, a polynucleotide encoding a gene or a vector comprising the same.
  • the composition comprises one or more genes selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of human hepatocyte growth factor and a variant gene thereof suitable for the present invention; Or one or more genes selected from a human Insulin like Growth Factor (IGF1) gene, a heterologous gene of human type 1 insulin-like growth factor, and a variant gene thereof.
  • HGF human hepatocyte growth factor
  • IGF1 Insulin like Growth Factor
  • the expression level of the gene may be increased by at least 30% or more.
  • composition When the composition is administered together with a gene therapy agent, it is useful because a small amount of genes can obtain a therapeutic effect.
  • FIG. 1 illustrates a cleavage map of a pGP vector according to an embodiment of the present invention.
  • Figure 2 shows the expression of HGF protein according to the administration of pGP-HGF (gene only), the pharmaceutical composition of the control group (HGF-JetPEI) and the pharmaceutical composition (HGF-MP1, HGF-MP2 and HGF-MP3) according to Example 1 It is a graph which compares quantity.
  • Figure 3 compares the amount of HGF protein expression according to the administration of pGP-HGFX7 (gene only), the pharmaceutical composition of the control group (HGFX7-JetPEI) and the pharmaceutical composition (HGFX7-MP1 and HGFX7-MP2) according to Example 2 It is a graph.
  • Figure 5 compares the expression level of VEGF protein according to the administration of pGP-VEGF (gene only), the pharmaceutical composition of the control group (VEGF-JetPEI) and the pharmaceutical composition (VEGF-MP1 and VEGF-MP2) according to Comparative Example 1 It is a graph showing.
  • Figure 6 is a graph showing the comparison of the expression level of FGF1 protein according to administration of the pharmaceutical composition (FGF1-MP1, FGF1-MP2) according to pGP-FGF1 (gene only) and Comparative Example 2 in the mouse.
  • FIG. 7 is a graph showing a comparison of the expression level of FGF4 protein according to the administration of pGP-FGF4 (gene only) and the pharmaceutical composition (FGF4-MP1, FGF4-MP2) according to Comparative Example 3 in the mouse.
  • FIG. 8 is a graph showing a comparison of PDGF-B protein expression according to administration of pGP-PDGF-B (gene only) and the pharmaceutical composition (PDGF-B-MP1 and PDGF-B-MP2) according to Comparative Example 4 in the mouse to be.
  • Example 9 is a graph showing that PWT values are significantly increased after 2 weeks of administration of the composition of Example 2 (HGFX7-MP2) to the rat peripheral neuropathy model induced by diabetes.
  • the present invention is a composition for increasing the growth factor gene expression comprising micro-particles of the core-shell structure as an active ingredient, the core is a halogenated hydrocarbon, sulfur halide or a mixture thereof as a biocompatible gas
  • the shell comprises a lipid or a derivative thereof, wherein the growth factor gene is at least one selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of human hepatocyte growth factor, and a variant gene thereof. gene; Or one or more genes selected from a human type 1 insulin like growth factor (IGF1) gene, a heterologous gene of human type 1 insulin like growth factor, and a variant gene thereof. It provides a composition for increasing gene expression.
  • HGF human hepatocyte growth factor
  • IGF1 insulin like growth factor
  • the "core” may be composed of halogenated hydrocarbons, sulfur halides or mixtures thereof as biocompatible gases.
  • the biocompatible gas is sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoro Roethane, dichlorotetrafluoroethane, or mixtures thereof.
  • the halogenated hydrocarbon is preferably a perfluorinated hydrocarbon.
  • perfluorinated hydrocarbons include perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, and perfluoroheptane; Perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-yne, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclo Butane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, or mixtures thereof. .
  • biocompatible gas of the present invention sulfur hexafluoride or perfluorobutane is preferable.
  • the "shell” may be composed of a component including a lipid or a derivative thereof.
  • the lipid may be at least one selected from the group consisting of simple lipids, phospholipids, glycero glycolipids, sphingolipid glycolipids, cholesterol and cationic lipids, particularly phospholipids.
  • phospholipids examples include phosphatidylcholine derivatives, phosphatidylethanolamine derivatives, phosphatidylserine derivatives, diacetylated phospholipids, L- ⁇ -dioleyl phosphatidylethanolamine, diolein, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, and Fingomyelin, polyethylene glycolated phospholipid, egg yolk lecithin, soybean lecithin, hydrogenated phospholipid, and the like.
  • glycerol glycolipids examples include sulfoxy ribosyl glycerides, diglycosyl diglycerides, digalactosyl diglycerides, galactosyl diglycerides, glycosyl diglycerides, and the like.
  • sphingoglycolipid examples include galactosyl cerebromide, lactosyl cerebromide, ganglioside and the like.
  • DOTAP 1,2-dioleoyl-3- trimethylammonio propane
  • DOTMA 2,3-dioleyloxy-N- [2- (sperminecarboxyamide) ethyl] -N, N-dimethyl-1-propaneamitrifluoroacetic acid
  • DOSPA 1, 2-dimyristyloxy propyl-3-dimethylhydroxyethylammonium bromide
  • DORIE 1,2-dioleoyloxy propyl-3-diethyl hydroxyethyl ammonium bromide
  • DC-Chol 3 ⁇ - [N- (N And 'N'-dimethylaminoethyl) carbamoyl] cholesterol
  • microparticles of the present invention are stabilized by a shell surrounding the gas, which is the core, to delay the diffusion of the gas into the surrounding liquid and to prevent fusion between the microparticles.
  • the microparticles When the microparticles are introduced into the living body, the microparticles maintain their shape until they arrive near the target cells or tissues, and are sprayed while being destroyed near the target cells or tissues.
  • the injected gas may change the cell membrane of the target cell and may play a role of promoting the growth factor gene to enter the cytoplasmic environment of the target cell by the blowing force of the gas.
  • the microparticles preferably have an average diameter of 1 to 10 m, preferably 2 to 8 m, more preferably 2 to 4 m.
  • composition for increasing gene expression Composition for increasing gene expression
  • the growth factor gene expression increasing composition according to the present invention may increase the expression level of the growth factor gene at least 30% or more when administered in vivo with the gene.
  • HGF human hepatocyte growth factor
  • IGF1 growth factor-1
  • heterologous gene of human type 1 insulin-like growth factor a heterologous gene of human type 1 insulin-like growth factor
  • the expression level of the gene is at least 30% or more, preferably Can be increased by at least 40%, more preferably at least 50%, most preferably at least 100%.
  • the composition for increasing the gene expression of the present invention was confirmed to significantly increase the amount of expression of the HGF, HGFX7 or IGF1 gene when administered to mice with the HGF, HGFX7 or IGF1 gene. More specifically, it was confirmed that HGF is increased by 45%, HGFX7 is 120% or more, and IGF1 is expressed by 35% or more. Meanwhile, in the case of VEGF, FGF1, FGF4 or PDGF-B, it was confirmed that the gene expression increase rate did not significantly increase even when administered to the mouse together with the gene expression increasing composition of the present invention. Specifically, the expression of VEGF was increased up to 16%, FGF4 up to 14%, and PDGF-B up to 4%. In the case of FGF1, the expression decreased rather than 40%.
  • composition for increasing gene expression of the present invention may include one or more genes selected from human hepatocyte growth factor (HGF), its variants, and variants thereof among growth factor genes; Or one or more genes selected from human type 1 insulin-like growth factor (IGF1), its variants, and variants thereof.
  • HGF human hepatocyte growth factor
  • IGF1 insulin-like growth factor
  • the composition may additionally contain pharmaceutical adjuvants or other therapeutically useful substances such as stabilizers, buffers, salts for controlling osmotic pressure, excipients, preservatives, etc., and may be formulated in various oral or parenteral forms according to conventional methods. It is possible, but is preferably parenteral form. Representative of parenteral formulations are injectable formulations, preferably isotonic aqueous solutions or suspensions. Alternatively, the composition may be powdered and then suspended together with a solvent just before administration.
  • pharmaceutical adjuvants or other therapeutically useful substances such as stabilizers, buffers, salts for controlling osmotic pressure, excipients, preservatives, etc.
  • parenteral formulations are injectable formulations, preferably isotonic aqueous solutions or suspensions.
  • the composition may be powdered and then suspended together with a solvent just before administration.
  • the content of the microparticles is not particularly limited, but may be contained in 0.5 to 2,000 ⁇ l / ml, preferably 1 to 1,000 ⁇ l / ml. Or 5 to 2,000 ⁇ g / ml, preferably 10 to 1,000 ⁇ l / ml.
  • composition is preferably administered in the form of a mixed solution mixed with the gene in terms of effectiveness.
  • composition for increasing gene expression according to the present invention is administered with the following genes, it is possible to further increase the expression efficiency and efficacy of the gene.
  • HGF Human Hepatocyte Growth Factor
  • Human hepatocyte growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 2. Human hepatocyte growth factor genes may be developed in the form of gene therapeutics or in the form of protein therapeutics.
  • isoform of human hepatocyte growth factor refers to an amino acid sequence that is at least 80% identical to the naturally occurring HGF amino acid sequence in an animal, including all allelic variants.
  • HGF polypeptide For example, HGF isoforms have the meaning encompassing both normal or wild types of HGF, and various variants of HGF (eg, splicing and deletion variants).
  • variant of human hepatocyte growth factor may be a hybrid HGF gene capable of expressing both variants of HGF (HGF and dHGF) (see Korean Patent Registration No. 10-0562824).
  • the "hybrid HGF gene” has a high gene expression efficiency between the exon 4 and the exon 5 of the HGF cDNA in which Intron 4 or a fragment sequence of the human HGF gene is inserted, and two of HGF and deleted varient of HGF (dHGF) It refers to a hybrid HGF gene (SEQ ID NOS: 3 to 5) that expresses branched forms at the same time.
  • nucleotide sequences encoding two or more types of heterologs of HGF in terms of therapeutic effect.
  • Two or more types of HGF isoform-encoding nucleotide sequences may be provided as one polynucleotide or as separate polynucleotides.
  • variable of human hepatocyte growth factor may be HGFX6 (SEQ ID NO: 3) (see Republic of Korea Patent No. 10-0562824).
  • variable of human hepatocyte growth factor may be HGFX7 (SEQ ID NO: 4) (see Republic of Korea Patent No. 10-0562824).
  • variable of human hepatocyte growth factor may be HGFX8 (SEQ ID NO: 5) (see Republic of Korea Patent No. 10-0562824).
  • variant of human hepatocyte growth factor may be a deleted variant of HGF (dHGF) (SEQ ID NO: 6) (see Korean Patent No. 10-0562824).
  • dHGF refers to a deleted variant of the HGF protein produced by selective splicing of the HGF gene in an animal, preferably a mammal, more preferably an alpha from a full length HGF sequence (728 amino acids). It refers to human HGF consisting of 723 amino acids missing five amino acids (F, L, P, S and S) in the first Kringle domain of the chain.
  • Human insulin-like growth factor gene in particular human type 1 insulin-like growth factor (IGF1) gene may be composed of the nucleotide sequence of SEQ ID NO: 7.
  • Human insulin-like growth factor genes may be developed in the form of protein therapeutics or in the form of gene therapeutics.
  • IGF1 is secreted by the liver primarily as a result of stimulation by human growth hormone (hGH). Almost all cells of the human body, in particular muscle, cartilage, bone, liver, kidney, nerve, skin and lung, are affected by IGF1. The IGF1 has a cell growth regulation effect as well as an insulin-like effect.
  • hGH human growth hormone
  • IGF1 isoform refers to an IGF1 having an amino acid sequence that is at least 80% identical to the naturally occurring IGF1 amino acid sequence in an animal, including all allelic variants. Means a polypeptide.
  • an IGF1 variant has the meaning encompassing both the normal form or wild type of IGF1, and various variants of IGF1 (eg, splicing variants, deletion variants, substitution variants).
  • IGF1 isoforms include IGF1 Ea, IGF1 Eb, IGF1 Ec, and the like.
  • an "IGF1 variant” may be a deleted variant of IGF1 (dIGF1) or a variant IGF1 substituted with an amino acid at a specific position.
  • dIGF1 refers to a deleted variant of the IGF1 protein produced by selective splicing of the IGF1 gene in an animal, preferably a mammal.
  • the “IGF1 variant” may be a polypeptide in which the amino acid glycine at position 42 is substituted by serine.
  • the "IGF1 variant” may be a polypeptide having a mutation in amino acids G1, P2, E3, R36, R37, K68, S69 and / or A70 of the IGF1 protein.
  • composition for increasing gene expression according to the present invention When the composition for increasing gene expression according to the present invention is administered together with plasmids containing a single chain polynucleotide encoding the gene, it is possible to further increase the expression efficiency and efficacy thereof.
  • plasmid generally refers to a circular DNA molecule formed operably linked to a vector so that a foreign gene can be expressed in a host cell.
  • the plasmid can be used as a vector that is degraded by specific restriction enzymes by gene recombination to incorporate the desired gene and introduces a new gene.
  • plasmids and vectors are used interchangeably herein, and those skilled in the art of genetic engineering will fully understand their meanings even if they do not distinguish their names.
  • vector refers to a DNA molecule as a carrier that can stably transport a foreign gene into a host cell. To be a useful vector, it must be replicable, have a way to enter the host cell, and have a means to detect its presence.
  • composition for increasing gene expression according to the present invention can further increase the expression efficiency and efficacy according to the gene when administered with expression vectors comprising a single chain polynucleotide encoding the gene.
  • the term "expression” refers to the generation of the gene in a cell.
  • expression vector refers to a gene construct that is capable of expressing the gene in a suitable host, and includes a gene construct comprising essential regulatory elements operably linked to express the gene insert.
  • operably linked refers to the functional linkage of a nucleic acid expression control sequence and a polynucleotide encoding the gene to perform a general function.
  • a promoter and a polynucleotide encoding the gene can be operably linked to affect the expression of the polynucleotide.
  • Operational linkage with recombinant vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation uses enzymes commonly known in the art and the like.
  • Expression vectors of the present invention are prepared using a plasmid, a vector or a viral vector, but is not limited thereto.
  • Suitable expression vectors can include expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals and enhancers, and the like, and can be prepared in a variety of ways, and the promoters of the vectors may be constitutive or inducible. Can be. Since plasmids are the most commonly used form of current vectors, "plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors.
  • Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include several to hundreds of plasmid vectors per host cell, and (b) restrictions on which foreign DNA fragments can be inserted. It has a structure including an enzyme cleavage site. Although no suitable restriction enzyme cleavage site is present, synthetic oligonucleotide adapters or linkers according to conventional methods can be used to facilitate ligation of the vector and foreign DNA.
  • Skeletal vectors that can be used in the present invention are not particularly limited, but the group consisting of pCDNA3.1, pGP, pEF, pVAX, pUDK, pCK, pQE40, pT7, pET / Rb, pET28a, pET-22b (+) and pGEX
  • Various vectors selected from can be used, and it is preferable in terms of effects to be prepared using one vector selected from the group consisting of pGP, pCK, pUDK and pVAX.
  • the expression vector of the present invention may be an expression vector comprising a pGP vector having a cleavage map of FIG.
  • the present invention is a composition for increasing gene expression; And one or more genes selected from the above-described human hepatocyte growth factor (HGF) gene, a heterologous gene of human hepatocyte growth factor, and variant genes thereof.
  • HGF human hepatocyte growth factor
  • the pharmaceutical composition for preventing or treating ischemic disease, neurological disease, kidney disease or liver disease may be a small amount of human hepatocyte growth factor (HGF) gene, a heterologous gene of human hepatocyte growth factor, or a variant gene thereof. Since the expression of the gene in the body increases due to the excellent therapeutic effect can be usefully used for the prevention or treatment of ischemic disease, neurological disease, kidney disease or liver disease.
  • the human hepatocyte growth factor may be composed of the nucleotide sequence of SEQ ID NO: 2, the variant of the human hepatocyte growth factor gene may be made of any one selected from the nucleotide sequence of SEQ ID NO: 3 to 6.
  • ischemic disease ischemic cerebrovascular disease, ischemic heart disease, ischemic myocardial infarction, diabetic vascular heart disease, ischemic heart failure, ischemic vascular disease, obstructive arteriosclerosis, cardiomyopathy, ischemic retinopathy, ischemic lower limb disease, ischemic colitis, Ischemic acute renal failure, ischemic lung disease, ischemic stroke, ischemic necrosis, brain trauma, Alzheimer's disease, Parkinson's disease, neonatal hypoxia, glaucoma and diabetic neuropathy.
  • the "nerve disease” is a central nervous disorder selected from the group consisting of atrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, Huntington's chorea, spinal cord cerebellar degeneration, spinal cord injury, cerebral infarction, cerebral ischemia and multiple sclerosis Can be.
  • ALS atrophic lateral sclerosis
  • Alzheimer's disease Parkinson's disease
  • Huntington's chorea spinal cord cerebellar degeneration
  • spinal cord injury cerebral infarction
  • cerebral ischemia cerebral ischemia
  • multiple sclerosis Can be.
  • the "kidney disease” may be acute or chronic renal failure.
  • the "liver disease” may be liver ischemia, fatty liver, hepatitis, liver cancer, liver fibrosis or cirrhosis.
  • the present invention is selected from the composition for increasing the gene expression and human type 1 insulin-like growth factor (IGF1) gene, heterologous gene of human type 1 insulin-like growth factor gene and variant genes thereof. It provides a pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by IGF1 receptor binding, comprising at least one gene.
  • the pharmaceutical composition for the prevention or treatment of the symptoms or diseases mediated by the IGF1 receptor binding shows an excellent therapeutic effect due to the increased expression of the gene in the body even with a small amount of human type 1 insulin-like growth factor gene. It can be usefully used for the prevention or treatment of a condition or disease mediated by receptor binding.
  • the human type 1 insulin-like growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 7.
  • the composition for increasing gene expression the growth factor gene may be included in a volume ratio (w / v) of 1: 0.5 to 30.
  • the above symptoms or disorders may include short stature, obesity, weight loss, cachexia, anorexia, neurodegenerative disorders, fibrosis-related symptoms, cartilage disorders, bone disease, inflammatory disorders, bowel disorders, insulin resistance, diabetes, diabetic ketoacidosis , Rabson-Mendenhall syndrome, retinopathy, acromegaly, fibromuscular hyperplasia, and heart disorders.
  • the subject in need of treatment for short stature is a human pediatric subject with insulin-like growth factor-1 deficiency (IGFD), and the pharmaceutical composition of the present invention is very effective for the treatment of IGFD in human pediatric subjects.
  • IGFD insulin-like growth factor-1 deficiency
  • the pharmaceutical composition of the present invention may be for gene therapy.
  • compositions described herein can be formulated into therapeutic pharmaceutical formulations.
  • compositions of the present invention may be formulated in lyophilized or stable liquid form.
  • the composition of the present invention can be lyophilized through various procedures known in the art. Lyophilized formulations are reconstituted prior to use with the addition of one or more pharmaceutically acceptable diluents, such as sterile water for injection or sterile saline.
  • the formulation of the composition is delivered to the subject by any pharmaceutically suitable means of administration.
  • Various delivery systems are known and can be used to administer the composition by any convenient route.
  • the composition of the present invention is administered systemically.
  • the compositions of the present invention may be used for parenteral (eg intravenous, subcutaneous, intramuscular, intraperitoneal, intracranial, intrapulmonary, intranasal or transdermal) delivery or enteric (eg oral, vaginal or Rectal) for delivery.
  • parenteral eg intravenous, subcutaneous, intramuscular, intraperitoneal, intracranial, intrapulmonary, intranasal or transdermal
  • enteric eg oral, vaginal or Rectal
  • the most preferred route of administration is intravenous and intramuscular administration.
  • These formulations may be administered continuously by infusion or bolus injection. Some formulations include sustained release systems.
  • compositions of the present invention are administered to a patient in a therapeutically effective amount meaning a dose sufficient to produce the desired effect while preventing or reducing the severity or spread of the condition or indication to be treated without reaching a dose that causes unacceptable side effects.
  • the exact dose depends on various factors such as signs, dosage form, mode of administration, etc. and should be determined preclinical and clinically for each indication.
  • composition of the present invention may be administered alone or in combination with other therapeutic agents. Such agents may be included as part of the same agent.
  • the present invention also relates to a method for treating an individual suffering from ischemic disease, neurological disease, kidney disease or liver disease, or an individual suffering from a symptom or disease mediated by IGF1 receptor binding.
  • the method of treatment may comprise administering to a subject an effective amount of a pharmaceutical composition of the invention.
  • genes such as HGF or IGF1 of the present invention may be administered at a dosage of 10 ng to 100 mg.
  • the dosage may be the same or different each time when the administration of the HGF or IGF1, or polynucleotides encoding it, is repeated more than once.
  • HGF Human Hepatocyte Growth Factor
  • HGF human hepatocyte growth factor
  • HGFX7 Human Hepatocyte Growth Factor
  • IGF1 Insulin-like Growth Factor-1
  • VEGF Human Vascular Endothelial Growth Factor
  • VEGF human vascular endothelial growth factor gene
  • FGF1 Human Fibroblast Growth Factor-1
  • FGF4 Human Fibroblast Growth Factor-4
  • PDGF-B Human Platelet-derived Growth Factor
  • Example 1 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and HGF (HGF-MP1, HGF-MP2 and HGF-MP3)
  • composition for increasing gene expression Composition for increasing gene expression
  • microparticles having a core-shell structure represented by the standard code 662900020 were obtained from PNU SM, having an average diameter of about 1.1 to 3.3 ⁇ m, a core composed of perfluoropropane, a shell containing a lipid and a surfactant ( MP3).
  • the microparticles MP1 was prepared as a suspension (composition for increasing gene expression) by mixing 2 ml of physiological saline to 225 ⁇ g according to the manufacturer's manual, and MP2 was mixed with 16 ml of 2 ml of water for injection according to the manufacturer's manual. It was prepared as a suspension (composition for increasing gene expression).
  • the microparticle solution MP3 150 ⁇ l / ml mixed with physiological saline was prepared as a suspension (composition for increasing gene expression) by shaking vigorously for 45 seconds according to the manufacturer's manual.
  • HGF-MP1, HGF-MP2 and HGF-MP3 were prepared by mixing 15 ⁇ l of the respective gene expression increasing compositions (MP1, MP2 and MP3) with 70 ⁇ g / 35 ⁇ l of the pGP-HGF prepared above. .
  • Example 2 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and HGFX7 (HGFX7-MP1 and HGFX7-MP2)
  • composition for increasing gene expression Composition for increasing gene expression
  • HGFX7-MP1 and HGFX7-MP2 were prepared by mixing 15 ⁇ l of the respective gene expression increasing compositions (MP1 and MP2) with 70 ⁇ g / 35 ⁇ l of the pGP-HGFX7 prepared above.
  • Example 3 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and IGF1 (IGF1-MP1, IGF1-MP2 and IGF1-MP3)
  • composition for increasing gene expression Composition for increasing gene expression
  • the pharmaceutical compositions IGF1-MP1, IGF1-MP2 and IGF1-MP3 were prepared by mixing 15 ⁇ l of the respective gene expression increasing compositions (MP1, MP2 and MP3) and 70 ⁇ g / 35 ⁇ l of the pGP-IGF1 prepared above. .
  • Comparative Example 1 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and VEGF (VEGF-MP1 and VEGF-MP2)
  • composition for increasing gene expression Composition for increasing gene expression
  • VEGF-MP1 and VEGF-MP2 were prepared by mixing 15 ⁇ l of the respective gene expression increasing compositions (MP1 and MP2) with 70 ⁇ g / 35 ⁇ l of the pGP-VEGF prepared above.
  • Comparative Example 2 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and FGF1 (FGF1-MP1 and FGF1-MP2)
  • composition for increasing gene expression Composition for increasing gene expression
  • compositions FGF1-MP1 and FGF1-MP2 were prepared by mixing 15 ⁇ l of the respective gene expression increasing compositions (MP1 and MP2) with 70 ⁇ g / 35 ⁇ l of the pGP-FGF1 prepared above.
  • Comparative Example 3 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and FGF4 (FGF4-MP1 and FGF4-MP2)
  • composition for increasing gene expression Composition for increasing gene expression
  • compositions FGF4-MP1 and FGF4-MP2 were prepared by mixing 15 ⁇ l of the respective gene expression increasing compositions (MP1 and MP2) with 70 ⁇ g / 35 ⁇ l of the pGP-FGF4 prepared above.
  • Comparative Example 4 Preparation of a pharmaceutical composition comprising a composition for increasing gene expression and PDGF-B (PDGF-B-MP1 and PDGF-B-MP2)
  • composition for increasing gene expression Composition for increasing gene expression
  • composition comprising a composition for increasing gene expression and PDGF-B
  • Each of the pharmaceutical compositions PDGF-B-MP1 and PDGF-B-MP2 was prepared by mixing 15 ⁇ l of the composition for increasing gene expression (MP1 and MP2) with 70 ⁇ g / 35 ⁇ l of the pGP-PDGF-B prepared above. .
  • composition for increasing gene expression Composition for increasing gene expression
  • a suspension (corresponding to a composition for increasing gene expression) was prepared by mixing 128 ⁇ l of JetPEI with 2 ml 5% glucose according to the manufacturer's manual in vivo JetPEI (Polyplus, USA).
  • HGF-JetPEI HGFX7-JetPEI
  • IGF1-JetPEI VEGF-JetPEI
  • mice were slaughtered and muscles at the injection site were cut out. Each of the cut muscles was pulverized using liquid nitrogen and a protein extraction kit (Cellbiolabs, USA), and total protein was isolated. The isolated total protein mass was measured using a DC protein assay kit (Bio-Rad laboratories, USA).
  • HGF protein measurement the same amount of protein was used to measure the expression level of each gene through an ELISA kit (R & D systems, USA) and is shown in FIGS. 2 and 3.
  • composition of Examples 1 to 3 according to the present invention can significantly increase the amount of HGF or IGF1 gene expression.
  • Diabetic peripheral neuropathy may be caused by ischemic disease in which blood sugar rises due to diabetes, microvascular damage through which peripheral nerve damage is caused, and clinically symptoms such as pain abnormality and It is a complex disease of neurological disease.
  • the streptozotocin induced diabetic peripheral neuropathy used in this study is a representative animal model.
  • Type 1 diabetes was induced by intravenously injecting 70 mg / kg of streptozotocin (STZ) into 6-week-old male Sprague-Dawley rats purchased from Samtaco Bio.
  • STZ streptozotocin
  • One week after STZ injection individuals with non-fasting blood sugar levels of 300 mg / dL or higher were selected and the paw withdrawal threshold (PWT) was measured by manual Von Frey test to measure the degree of pain incidence.
  • the induced individuals (PWT value less than 4.0) were screened and separated into two groups of five animals per group.
  • Neuropathic pain is known as a chronic neurological disease due to nervous system abnormalities, and clinically, the sensitivity of the pain is increased, resulting in abnormal pain.
  • the chronic neurological pain is a representative animal model for chronic constriction injury caused by ligation of the sciatic nerve used in this study.
  • composition of the present invention improves gene efficacy in various disease models by significantly increasing gene expression.
  • an increase in the PWT value means that the magnitude of the pain-feeling force increases significantly, that is, the pain is alleviated.
  • the pain relieving effect in the animal model in which diabetic neuropathy or neuropathic pain is induced may be due to the increased expression of HGF or HGFX7 in the body due to the gene expression increasing composition of the present invention.
  • the pharmaceutical composition comprising the gene expression increasing composition of the present invention and one or more genes selected from human hepatocyte growth factor (HGF), its variants and its variants is a neurological pain animal model and diabetes All animal models of sexual neuropathy were found to have pain-relieving effects. Therefore, diabetic neuropathy or neuropathic pain when using a pharmaceutical composition comprising the composition for increasing gene expression of the present invention and one or more genes selected from human hepatocyte growth factor (HGF), its variants and its variants as an active ingredient. And various neurological diseases can be prevented, alleviated or treated.
  • HGF human hepatocyte growth factor

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Inorganic Chemistry (AREA)
  • Endocrinology (AREA)
  • Dispersion Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)

Abstract

본 발명은 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물에 관한 것이다. 본 발명의 성장인자 유전자 발현 증가용 조성물은 유전자와 함께 생체에 투여되는 경우 함께 투여되는 유전자의 발현량을 적어도 30% 이상 증가시킬 수 있다. 특히, 상기 조성물은 본 발명에 적합한 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자, 또는 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF-1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자와 함께 투여되는 경우에는 상기 유전자의 발현량을 적어도 30% 이상 증가시킬 수 있다. 상기 조성물은 유전자 치료제와 함께 투여하는 경우, 적은 양의 유전자로도 치료 효과를 얻을 수 있어 유용하다.

Description

[규칙 제91조에 의한 정정 18.04.2019]　코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명은 코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물에 관한 것이다.
[규칙 제91조에 의한 정정 18.04.2019]　
인간 간세포 성장인자(Hepatocyte Growth Factor; HGF)는 중배엽 기원의 세포들로부터 분비되어 여러 세포에 작용하며 대상세포와 환경에 따라 다양한 기능들을 수행한다(Stella, M. C. and Comoglio, P. M., The International Journal of Biochemistry & Cell Biology , 31 : 1357-1362(1999)). 그 기능들을 요약하면 첫째, 상피세포의 세포분열을 촉진하고 세포운동성을 촉진하며 기질(matrix) 침투능력을 증진하는데 이러한 기능들은 결과적으로 상피세포가 세뇨관 구조(tubular structure)를 형성하는 것을 유도한다. 둘째, 시험관내(in vitro) 및 생체내(in vivo) 모두에서 내피세포에 의한 혈관신생을 촉진한다. 셋째, 항-세포자멸(anti-apoptosis) 활성을 지니고 있어 간과 신장의 재생과 연관이 있다. 넷째, 발생과정 중에서는 신장, 난소, 정소의 기관형성에 관여한다. 다섯째, 파골세포(osteoclast)와 조골세포(osteoblast)의 기능을 조절하여 뼈 생성과정을 조절한다. 여섯째, 적혈구 조혈 전구세포(Erythropoietic progenitor cell)의 성장과 분화를 촉진한다. 일곱 번째, 신경의 축삭 발생(axon sprouting)에 관여한다. 이러한 다양한 기능들에 근거하여 간세포 성장인자는 다양한 질환, 예를 들어 허혈성 질환, 신경 질환, 신장 질환 및 간질환에 대한 치료제로 개발될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1)는 인슐린 유사 활성 및 미토겐성 생물학적 성장 활성을 가지고 있는 70개의 아미노산으로 이루어진 폴리펩타이드 호르몬이다. 이러한 호르몬은 근골격계, 간, 신장, 장, 신경계 조직, 심장 및 폐 등의 다양한 조직에서 세포 성장을 강화시킨다.
[규칙 제91조에 의한 정정 18.04.2019]　
당해 기술 분야의 당업자에게 잘 알려져 있는 바와 같이, IGF1의 공지된 잠재적인 용도는 다양하며 많은 편이다. 예를 들어, 신경퇴행성 증상을 치료하기 위한 잠재적인 치료제로서의 IGF1의 용도에 대해 많은 연구들이 보고되어 있다. 예로, Kanje et al., Brain Res., 486:396-398(1989); Hantai et al., J. Neurol. Sci., 129:122-126(1995); Contreras et al., Pharmac. Exp. Therap., 274:1443-1499(1995); Di Giulio et al., Society for Neuroscience, 22:1960 (1996); Di Giulio et al., Society for Neuroscience, 23:894(1997); Hsu et al., Biochem. Mol. Med., 60(2):142-148(1997); Gorio et al., Neuroscience, 82:1029-1037(1998)을 참조한다. IGF1 요법은, ALS, 뇌졸증, 간질, 파킨슨 질환, 알츠하이머 질환, 급성 외상성 상해 및 외상, 노화, 질환 또는 상해와 관련된 그외 장애 등의, 수많은 신경 증상들에 대해 처방되고 있다. 예로, 미국등록특허 제5,093,137호, 제5,652,214호 및 제5,703,045호; 국제공개특허 제1990-001483호 및 제1993-002695호를 참조한다.
[규칙 제91조에 의한 정정 18.04.2019]　
다른 다양한 증상에 대한 IGF1 요법의 사용에 대해서는 다수의 공개문헌들에 언급되어 있다. 예로, Schalch et al., "Short-term metabolic effects of recombinant human insulin-like growth factor I(rhIGF-I) in type II diabetes mellitus". Modern Concepts of Insulin-Like Growth Factors, Spencer, ed., New York:Elsevier Science Publ. Co. pp. 705-714(1991); Clemmons and Underwood, J. Clin. Endocrinol. Metab., 79(1):4-6(1994); 및 Langford et al., Eur. J. Clin. Invest., 23(9):503-516(1993) (예로 인슐린-내성 상태 및 당뇨병이 언급됨); O'shea et al., Am. J. Physiol., 264:F917-F922(1993) (예로 신장 기능 감소가 언급됨)을 참조한다. 또한, 미국등록특허 제7,258,864호 (예로 저신장이 언급됨); 미국등록특허 제5,110,604호 및 제5,427,778호 (예로 상처 치유가 언급됨); 미국등록특허 제5,126,324호 (예로 심장 장애 및 성장 지연이 언급됨); 미국등록특허 제5,368,858호 (예로 연골 결함 또는 상해가 언급됨); 미국등록특허 제5,543,441호 및 제5,550,188호 (예로 조직 증대로 언급됨); 미국등록특허 제5,686,425호 (예로 흉터 조직, 국소 근육 기능부전 및 요실금이 언급됨); 및 미국등록특허 제5,656,598호 (예로 골 성장이 언급됨)를 참조한다. 또한, 국제공개특허 제1991-012018호 (예로 장의 장애가 언급됨); 국제공개특허 제1992-009301호 및 국제공개특허 제1992-014480호 (예로 상처 치유가 언급됨); 국제공개특허 제1993-008828호 (예로 허혈증, 저산소증 또는 신경퇴행과 관련된 신경 손상이 언급됨); 국제공개특허 제1994-016722호 (예로 인슐린 내성이 언급됨); 국제공개특허 제1996-002565호 (예로 골 형성 촉진 및 골 리모델링 조절을 위한 IGF/IGFBP 복합체가 언급됨); 미국공개특허 제2003-0100505호 (예로 골다공증이 언급됨); 및 미국공개특허 제2005-0043240호 (예로 비만이 언급됨)를 참조한다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 발명자들은 적은 양의 유전자로도 치료 효과를 얻을 수 있는 유전자 치료제를 개발하기 위해 연구하던 중, 코어가 할로겐화 탄화수소 및/또는 할로겐화 황이고, 외곽 쉘이 지질 성분으로 구성된 코어-쉘 구조의 마이크로 입자가 상기 HGF 또는 IGF1 등의 유전자와 함께 생체 내에 투여되는 경우 성장인자 유전자의 발현량을 현저히 증가시킴을 구체적으로 확인하여 본 발명을 완성하였다.
[선행기술문헌]
[특허문헌]
[규칙 제91조에 의한 정정 18.04.2019]　
(특허문헌 001) 대한민국등록특허 제10-0562824호
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명이 해결하고자 하는 첫 번째 과제는 코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물을 제공하는 것이다.
본 발명이 해결하고자 하는 두 번째 과제는 상기 조성물을 포함하는 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명이 해결하고자 하는 세 번째 과제는 상기 조성물을 포함하는, IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기한 목적을 달성하기 위하여 본 발명은 코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물로서, 상기 코어는 생적합성 기체로서 할로겐화 탄화수소, 할로겐화 황 또는 이들의 혼합물이고, 상기 쉘은 지질 또는 이의 유도체를 포함하여 구성되며, 상기 성장인자 유전자는 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자; 또는 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물을 제공한다.
본 발명의 일 실시예에 있어서, 상기 생적합성 기체는 헥사플루오르화황, 옥타플루오로프로판, 브로모클로로디플루오로메탄, 클로로디플루오로메탄, 디클로로디플루오로메탄, 브로모트리플루오로메탄, 클로로트리플루오로메탄, 클로로펜타플루오로에탄, 디클로로테트라플루오로에탄 및 그것의 혼합물 중에서 선택될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 실시예에 있어서, 상기 할로겐화 탄화수소는 퍼플루오르화 탄화수소일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 실시예에 있어서, 상기 퍼플루오르화 탄화수소는 퍼플루오로메탄, 퍼플루오로에탄, 퍼플루오로프로판, 퍼플루오로부탄, 퍼플루오로펜탄, 퍼플루오로헥산, 퍼플루오로헵탄; 퍼플루오로프로펜, 퍼플루오로부텐, 퍼플루오로부타디엔, 퍼플루오로부트-2-인, 퍼플루오로시클로부탄, 퍼플루오로메틸시클로부탄, 퍼플루오로디메틸시클로부탄, 퍼플루오로트리메틸시클로부탄, 퍼플루오로시클로펜탄, 퍼플루오로메틸시클로펜탄, 퍼플루오로디메틸시클로펜탄, 퍼플루오로메틸시클로헥산, 퍼플루오로메틸시클로헥산, 퍼플루오로메틸시클로헥산 또는 그것의 혼합물일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 실시예에 있어서, 상기 지질은 단순지질, 인지질, 글리세로 당지질, 스핑고 당지질, 콜레스테롤 및 양이온 지질로 이루어진 군에서 선택된 1종 이상일 수 있다.
본 발명의 일 실시예에 있어서, 상기 인지질은 포스파티딜콜린 유도체, 포스파티딜에탄올아민 유도체, 포스파티딜세린 유도체, 디아세틸레이티드 인지질, L-α-디올레일 포스파티딜에탄올아민, 디올레인, 포스파티딘산, 포스파티딜글리세롤, 포스파티딜이노시톨, 리소포스파티딜콜린, 스핑고미엘린, 폴리에틸렌 글리콜화 인지질, 난황 레시틴, 대두 레시틴 및 수소첨가 인지질로 이루어진 군에서 선택된 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 글리세로 당지질은 설폭시 리보실 글리세라이드, 디글리코실 디글리세라이드, 디갈락토실 디글리세라이드, 갈락토실 디글리세라이드 및 글리코실 디글리세라이드로 이루어진 군에서 선택된 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 스핑고 당지질은 갈락토실 세레브로시드, 락토실 세레브로시드 또는 강글리오사이드일 수 있다.
본 발명의 일 실시예에 있어서, 상기 양이온 지질은 1,2-디올레오일-3-트리메틸암모니오 프로판(DOTAP), N-(2,3-디올레일옥시 프로판-1-일)-N,N,N-트리메틸 염화암모늄(DOTMA), 2,3-디올레일옥시-N-[2-(스페르민카르복시아미드) 에틸]-N,N-디메틸-1-프로판아미늄트리플루오로 초산(DOSPA), 1,2-디미리스틸옥시 프로필-3-디메틸하이드록시에틸 브롬화암모늄(DMRIE), 1,2-디올레오일옥시 프로필-3-디에틸 하이드록시에틸 브롬화암모늄(DORIE) 및 3β-[N-(N'N'-디메틸아미노에틸) 카르바모일]콜레스테롤(DC-Chol)로 이루어진 군에서 선택된 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 실시예에 있어서, 상기 인간 간세포 성장인자의 변이체 유전자는 서열번호 3 내지 6의 염기서열 중에서 선택되는 어느 하나로 이루어진 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 실시예에 있어서, 상기 조성물은 성장인자 유전자의 발현량을 30% 이상 증가시킬 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 발명은 상기 조성물; 및 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;를 포함하는 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물을 제공한다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물에서, 상기 인간 간세포 성장인자 유전자는 서열번호 2의 염기서열로 이루어진 것이고, 상기 인간 간세포 성장인자의 변이체는 서열번호 3 내지 6의 염기서열 중에서 선택되는 어느 하나로 이루어진 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 발명은 상기 조성물; 및 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;를 포함하는, IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물을 제공한다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물에서, 상기 인간 1형 인슐린 유사 성장인자 유전자는 서열번호 7의 염기서열로 이루어진 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 증상 또는 질환은, 저신장, 비만, 체중 감소, 악액질, 식욕 부진, 신경퇴행성 장애, 섬유증-관련 증상, 연골 장애, 골 질환, 염증 장애, 장 장애, 인슐린 내성, 당뇨병, 당뇨병성 케톤산증, 랍슨-멘덴할 증후군(Rabson-Mendenhall syndrome), 망막증, 말단 비대증(acromegaly), 섬유근성 이형성증(fibromuscular hyperplasia) 및 심장 장애로 이루어진 군으로부터 선택된 1종일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 실시예에 있어서, 상기 저신장에 대한 치료가 요구되는 개체는 인슐린 유사 성장인자-1 결핍증(IGFD)을 가지고 있는 인간 소아 개체이고, 상기 조성물은 인간 소아 개체에서 IGFD의 치료에 유효한 것일 수 있다.
본 발명의 성장인자 유전자 발현 증가용 조성물은 유전자(예를 들어, 유전자를 암호화하는 폴리뉴클레오타이드 또는 이를 포함하는 벡터)와 함께 생체에 투여되는 경우 성장인자 유전자의 발현량을 적어도 30% 이상 증가시킬 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
특히, 상기 조성물은 본 발명에 적합한 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자; 또는 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;와 함께 투여되는 경우에는 상기 성장인자 유전자의 발현량을 적어도 30% 이상 증가시킬 수 있다.
상기 조성물은 유전자 치료제와 함께 투여하는 경우, 적은 양의 유전자로도 치료 효과를 얻을 수 있어 유용하다.
도 1은 본 발명의 일 실시예에 따른 pGP 벡터의 개열지도를 나타낸 것이다.
도 2는 마우스에서 pGP-HGF(유전자만), 대조군의 약학 조성물(HGF-JetPEI) 및 실시예 1에 따른 약학 조성물(HGF-MP1, HGF-MP2 및 HGF-MP3)의 투여에 따른 HGF 단백질 발현량을 비교하여 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 3은 마우스에서 pGP-HGFX7(유전자만), 대조군의 약학 조성물(HGFX7-JetPEI) 및 실시예 2에 따른 약학 조성물(HGFX7-MP1 및 HGFX7-MP2)의 투여에 따른 HGF 단백질 발현량을 비교하여 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 4는 마우스에서 pGP-IGF1(유전자만), 대조군의 약학 조성물(IGF1-JetPEI) 및 실시예 3에 따른 약학 조성물(IGF1-MP1, IGF1-MP2 및 IGF1-MP3)의 투여에 따른 IGF1 단백질 발현량을 비교하여 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 5는 마우스에서 pGP-VEGF(유전자만), 대조군의 약학 조성물(VEGF-JetPEI) 및 비교예 1에 따른 약학 조성물(VEGF-MP1 및 VEGF-MP2)의 투여에 따른VEGF 단백질 발현량을 비교하여 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 6은 마우스에서 pGP-FGF1(유전자만) 및 비교예 2에 따른 약학 조성물(FGF1-MP1, FGF1-MP2)의 투여에 따른 FGF1 단백질 발현량을 비교하여 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 7은 마우스에서 pGP-FGF4(유전자만) 및 비교예 3에 따른 약학 조성물(FGF4-MP1, FGF4-MP2)의 투여에 따른 FGF4 단백질 발현량을 비교하여 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 8은 마우스에서 pGP-PDGF-B(유전자만) 및 비교예 4에 따른 약학 조성물(PDGF-B-MP1 및 PDGF-B-MP2)의 투여에 따른 PDGF-B 단백질 발현량을 비교하여 나타내는 그래프이다.
도 9는 당뇨병으로 유발된 랫드 peripheral neuropathy 모델에 본 발명의 실시예 2(HGFX7-MP2)의 조성물을 투여하고 2주 경과 후 PWT 값이 현저히 상승함을 나타내는 그래프이다.
[규칙 제91조에 의한 정정 18.04.2019]　
도 10은 chronic constriction injury 수술에 의해 유발된 랫드 neuropathy 모델에서 실시예 1(HGF-MP2)의 조성물을 투여하고 2주 경과 후 PWT 값이 현저히 상승함을 나타내는 그래프이다.
이하, 본 발명을 상세하게 설명한다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 측면에 따르면, 본 발명은 코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물로서, 상기 코어는 생적합성 기체로서 할로겐화 탄화수소, 할로겐화 황 또는 이들의 혼합물이고, 상기 쉘은 지질 또는 이의 유도체를 포함하여 구성되며, 상기 성장인자 유전자는 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자; 또는 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물을 제공한다.
코어
본 발명의 명세서에서, 상기 "코어"는 생적합성 기체로서 할로겐화 탄화수소, 할로겐화 황 또는 이들의 혼합물로 이루어질 수 있다.
상기 생적합성 기체는 헥사플루오르화황, 옥타플루오로프로판, 브로모클로로디플루오로메탄, 클로로디플루오로메탄, 디클로로디플루오로메탄, 브로모트리플루오로메탄, 클로로트리플루오로메탄, 클로로펜타플루오로에탄, 디클로로테트라플루오로에탄, 또는 그것의 혼합물일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 할로겐화 탄화수소로는 퍼플루오르화 탄화수소인 것이 바람직하다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 퍼플루오르화 탄화수소로는, 퍼플루오로메탄, 퍼플루오로에탄, 퍼플루오로프로판, 퍼플루오로부탄, 퍼플루오로펜탄, 퍼플루오로헥산, 퍼플루오로헵탄; 퍼플루오로프로펜, 퍼플루오로부텐, 퍼플루오로부타디엔, 퍼플루오로부트-2-인, 퍼플루오로시클로부탄, 퍼플루오로메틸시클로부탄, 퍼플루오로디메틸시클로부탄, 퍼플루오로트리메틸시클로부탄, 퍼플루오로시클로펜탄, 퍼플루오로메틸시클로펜탄, 퍼플루오로디메틸시클로펜탄, 퍼플루오로메틸시클로헥산, 퍼플루오로메틸시클로헥산, 퍼플루오로메틸시클로헥산 또는 그것의 혼합물을 들 수 있다.
본 발명의 생적합성 기체로는, 헥사플루오르화황 또는 퍼플루오로부탄이 바람직하다.
쉘
본 발명의 명세서에서, 상기 "쉘"은 지질 또는 이의 유도체를 포함하는 성분으로 구성될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 지질은 단순지질, 인지질, 글리세로 당지질, 스핑고 당지질, 콜레스테롤 및 양이온 지질로 이루어진 군에서 선택된 1종 이상일 수 있는데, 특히 인지질인 것이 바람직하다.
상기 인지질로는, 포스파티딜콜린 유도체, 포스파티딜에탄올아민 유도체, 포스파티딜세린 유도체, 디아세틸레이티드 인지질, L-α-디올레일 포스파티딜에탄올아민, 디올레인, 포스파티딘산, 포스파티딜글리세롤, 포스파티딜이노시톨, 리소포스파티딜콜린, 스핑고미엘린, 폴리에틸렌 글리콜화 인지질, 난황 레시틴, 대두 레시틴, 수소첨가 인지질 등을 들 수 있다.
상기 글리세로 당지질로는, 설폭시 리보실 글리세라이드, 디글리코실 디글리세라이드, 디갈락토실 디글리세라이드, 갈락토실 디글리세라이드, 글리코실 디글리세라이드 등을 들 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 스핑고 당지질로는, 갈락토실 세레브로시드, 락토실 세레브로시드, 강글리오사이드 등을 들 수 있다.
또한, 상기 양이온 지질로는, 1,2-디올레오일-3-트리메틸암모니오 프로판(DOTAP), N-(2,3-디올레일옥시 프로판-1-일)-N,N,N-트리메틸 염화암모늄(DOTMA), 2,3-디올레일옥시-N-[2-(스페르민카르복시아미드) 에틸]-N,N-디메틸-1-프로판아미늄트리플루오로 초산(DOSPA), 1,2-디미리스틸옥시 프로필-3-디메틸하이드록시에틸 브롬화암모늄(DMRIE), 1,2-디올레오일옥시 프로필-3-디에틸 하이드록시에틸 브롬화암모늄(DORIE), 3β-[N-(N'N'-디메틸아미노에틸) 카르바모일]콜레스테롤(DC-Chol) 등을 들 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
마이크로 입자
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 마이크로 입자는 코어인 기체를 둘러싸는 쉘에 의해 안정화되어, 기체의 주위 액체로의 확산을 지연시키고 마이크로입자 사이의 융합을 방지한다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 마이크로 입자는 생체 내에 투입되는 경우 표적 세포 또는 조직 부근에 도착하기까지는 모양을 유지하다가 표적 세포 또는 조직 근처에서 파괴되면서 기체를 분사하게 된다. 이때 분사되는 기체는 표적 세포의 세포막에 변화를 일으키고, 기체의 분사력에 의해 성장인자 유전자가 표적 세포의 세포질 환경 중으로 진입될 수 있도록 촉진하는 역할을 할 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 마이크로 입자는 평균 직경이 1 내지 10 ㎛, 바람직하게는 2 내지 8 ㎛, 더욱 바람직하게는 2 내지 4 ㎛인 것이 바람직하다.
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
최근, 기체를 코어로 하는 코어-쉘 마이크로 입자와 관련하여 다양한 연구가 이루어져 왔다. 기존 연구들에서는 마이크로입자와 함께 초음파를 조사하지 않으면 유전자 발현 증가 효과가 나타나지 않았다.
[규칙 제91조에 의한 정정 18.04.2019]　
구체적으로, Sang-Chol Lee et al., Korean Circulation J 2006;36:32-38; "저주파 초음파를 이용한 미세기포 파괴를 통한 근육조직으로의 유전자 전달 증강에 대한 연구"에는, 초음파 조사 없이 luciferase 유전자-마이크로 입자 혼합물만 주입하는 경우에는 유전자 발현 증가 효과가 나타나지 않는다는 내용이 개시되어 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
ZP Shen et al., Gene Therapy(2008) 15, 1147-1155; "Ultrasound with microbubbles enhances gene expression of plasmid DNA in the liver via intraportal delivery"에는 초음파 조사 없이 luciferase 유전자-마이크로 입자 혼합물만 주입하는 경우에는 유전자 발현 증가 효과가 나타나지 않는다는 내용이 개시되어 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, Xingsheng Li et al., J Ultrasound Med 2008; 27:453-460; "Experimental Research on Therapeutic Angiogenesis Induced by Hepatocyte Growth Factor Directed by Ultrasound-Targeted Microbubble Destruction in Rats"에는 초음파 조사 없이 HGF 유전자-리포좀 마이크로 입자 혼합물을 주입하는 경우에는 유전자 발현 증가 효과가 나타나지 않는다는 내용이 개시되어 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
그러나, 본 발명자들은 마이크로 입자의 용도에 대하여 연구하던 중 본 발명에 따른 마이크로 입자를 HGF 또는 IGF1 유전자와 함께 주입하는 경우에는 특이하게도 초음파의 조사 없이도 유전자의 발현량을 현저히 증가시키는 것을 확인하여 본 발명을 완성하게 되었다. 한편, 하기 실험예에서 구체적으로 나타낸 바와 같이, 상기 HGF 및 IGF1 이외의 성장인자 계열의 다른 유전자에서는 상기 마이크로 입자로 인한 유전자 발현량의 증가 효과가 나타나지 않았다.
본 발명에 따른 성장인자 유전자 발현 증가용 조성물은 유전자와 함께 생체에 투여되는 경우 성장인자 유전자의 발현량을 적어도 30% 이상 증가시킬 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
특히, 본 발명에 적합한 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자, 또는 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자와 함께 투여되는 경우에는 상기 유전자의 발현량을 적어도 30% 이상, 바람직하게는 40% 이상, 더욱 바람직하게는 50% 이상, 가장 바람직하게는 100% 이상 증가시킬 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
하기 실시예에서, 본 발명의 유전자 발현 증가용 조성물은 HGF, HGFX7 또는 IGF1 유전자와 함께 마우스에 투여하는 경우 상기 HGF, HGFX7 또는 IGF1 유전자의 발현량을 현저히 증가시키는 것을 확인하였다. 더욱 구체적으로는, HGF는 45% 이상, HGFX7는 120% 이상, IGF1은 35% 이상 발현량을 증가시키는 것을 확인하였다. 한편, VEGF, FGF1, FGF4 또는 PDGF-B의 경우에는 본 발명의 유전자 발현 증가용 조성물과 함께 마우스에 투여하여도 유전자 발현 증가율이 유의하게 증가하지 않음을 확인하였다. 구체적으로는 VEGF는 최대 16%, FGF4는 최대 14%, PDGF-B는 최대 4% 정도로만 발현량이 증가하였고, FGF1의 경우에는 오히려 발현량이 40%이상 감소하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
즉, 본 발명의 유전자 발현 증가용 조성물은 성장인자 유전자 중에서도 인간 간세포 성장인자(HGF), 이의 이형체 및 이의 변이체 중에서 선택되는 1종 이상의 유전자; 또는 인간 1형 인슐린 유사 성장인자(IGF1), 이의 이형체 및 이의 변이체 중에서 선택되는 1종 이상의 유전자;와 함께 투여되는 경우에만 특이적으로 유전자의 발현량을 증가시키는 효과가 있는 것으로 판단된다.
상기 조성물은 안정화제, 완충제, 삼투압 조절을 위한 염, 부형제, 방부제 등의 약제학적 보조제 또는 기타 치료적으로 유용한 물질을 추가적으로 함유할 수 있으며, 통상적인 방법에 따라 다양한 경구 또는 비경구 형태로 제형화할 수 있으나, 비경구 형태인 것이 바람직하다. 비경구 투여용 제형의 대표적인 것은 주사용 제형으로 등장성 수용액 또는 현탁액인 것이 바람직하다. 또는 상기 조성물을 분말화한 후 투여 직전에 용제와 함께 현탁하여 사용할 수도 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 유전자 발현 증가용 조성물에서, 상기 마이크로 입자의 함량은 특별히 제한되지 않으나, 0.5 내지 2,000 ㎕/㎖, 바람직하게는 1 내지 1,000 ㎕/㎖로 함유될 수 있다. 또는, 5 내지 2,000 ㎍/㎖, 바람직하게는 10 내지 1,000 ㎕/㎖로 함유될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 마이크로 입자의 함량이 상기 범위를 벗어나는 경우에는 기대하는 효과를 얻을 수 없게 된다.
그리고, 상기 조성물은 유전자와 혼합된 혼합액의 형태로 투여되는 것이 효과면에서 바람직하다.
유전자
본 발명에 따른 유전자 발현 증가용 조성물은 하기 유전자들과 함께 투여되는 경우 상기 유전자의 발현 효율 및 이에 따른 효능을 더욱 증대시킬 수 있다.
인간 간세포 성장인자(HGF) 유전자
[규칙 제91조에 의한 정정 18.04.2019]　
인간 간세포 성장인자 유전자는 서열번호 2의 염기서열로 이루어진 것일 수 있다. 인간 간세포 성장인자 유전자는 유전자 치료제의 형태로 개발될 수도 있으며 또는 단백질 치료제의 형태로 개발될 수도 있다.
인간 간세포 성장인자의 이형체
본 명세서에서, "인간 간세포 성장인자의 이형체(isoform)"는 모든 대립 유전자 변이체들(variants)을 포함하는，동물에서 자연적으로 생성되는(naturally occurring) HGF 아미노산 서열과 적어도 80% 동일한 아미노산 서열을 갖는 HGF 폴리펩타이드를 의미한다. 예를 들어， HGF 이형체는 HGF의 정상형(normal form) 또는 야생형(wild type), 그리고 HGF의 다양한 변이체(예컨대, 스플라이싱 변이체 및 결손 변이체)를 모두 포괄하는 의미를 갖는다.
인간 간세포 성장인자의 변이체
[규칙 제91조에 의한 정정 18.04.2019]　
본 명세서에서, "인간 간세포 성장인자의 변이체"는 HGF의 두 가지 이형체(HGF 및 dHGF)를 모두 발현할 수 있는 하이브리드 HGF 유전자일 수 있다(대한민국등록특허 제10-0562824호 참조). 구체적으로, 상기 "하이브리드 HGF 유전자"는 HGF cDNA의 엑손 4와 엑손 5 사이에 인간 HGF 유전자의 인트론 4 또는 그의 단편 서열이 삽입된, 유전자 발현효율이 높으며 HGF 및 dHGF(deleted varient of HGF)의 두 가지 이형체를 동시에 발현하는 하이브리드 HGF 유전자(서열번호 3 내지 5)를 의미한다.
본 발명의 유전자 치료제 전략에 따르면，HGF의 두 종류 이상의 이형체를 암호화하는 하나 이상의 뉴클레오타이드 서열을 이용하는 것이 치료 효과면에서 바람직하다. 두 종류 이상의 HGF 이형체-암호화 뉴클레오타이드 서열은 하나의 폴리뉴클레오타이드로 제공되거나 별도의 폴리뉴클레오타이드로 제공될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 명세서에서, "인간 간세포 성장인자의 변이체"는 HGFX6(서열번호 3)(대한민국등록특허 제10-0562824호 참조)일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 명세서에서, "인간 간세포 성장인자의 변이체"는 HGFX7(서열번호 4)(대한민국등록특허 제10-0562824호 참조)일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 명세서에서, "인간 간세포 성장인자의 변이체"는 HGFX8(서열번호 5)(대한민국등록특허 제10-0562824호 참조)일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 명세서에서, "인간 간세포 성장인자의 변이체"는 결손된 변이형 HGF(deleted varient of HGF; dHGF)(서열번호 6)(대한민국 등록특허 제10-0562824호 참조)일 수 있다. 본 명세서에서 사용되는 용어 "dHGF"는 동물, 바람직하게는 포유동물에서 HGF 유전자의 선택적 스플라이싱에 의해 생성되는 HGF 단백질의 결손된 변이체，보다 바람직하게는 전장 HGF 서열(728 개의 아미노산)로부터 알파 사슬의 첫 번째 크링글 도메인에서 5 개의 아미노산(F, L, P, S 및 S)이 결손된 723 개의 아미노산으로 이루어지는 인간 HGF를 지칭한다.
[규칙 제91조에 의한 정정 18.04.2019]　
인간 1형 인슐린 유사 성장인자(IGF1) 유전자
[규칙 제91조에 의한 정정 18.04.2019]　
인간 인슐린 유사 성장인자 유전자, 특히 인간 1형 인슐린 유사 성장인자(IGF1) 유전자는 서열번호 7의 염기서열로 이루어진 것일 수 있다. 인간 인슐린 유사 성장인자 유전자는 단백질 형태의 치료제로 개발될 수도 있으며 또는 유전자 치료제의 형태로 개발될 수도 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
IGF1은 주로 인간 성장 호르몬 (hGH)에 의한 자극의 결과로서 간에 의해 분비된다. 인체의 거의 모든 세포, 특히 근육, 연골, 뼈, 간, 신장, 신경, 피부 및 폐 내의 세포는 IGF1에 의해 영향 받는다. 상기 IGF1은 인슐린-유사 효과 뿐만 아니라, 세포 성장 조절 효과가 있다.
인간 1형 인슐린 유사 성장인자의 이형체
[규칙 제91조에 의한 정정 18.04.2019]　
본 명세서에서 사용되는 용어 "IGF1 이형체(isoform)"는 모든 대립 유전자 변이체들(variants)을 포함하는，동물에서 자연적으로 생성되는(naturally occurring) IGF1 아미노산 서열과 적어도 80% 동일한 아미노산 서열을 갖는 IGF1 폴리펩타이드를 의미한다. 예를 들어， IGF1 이형체는 IGF1의 정상형(normal form) 또는 야생형(wild type), 그리고 IGF1의 다양한 변이체(예컨대, 스플라이싱 변이체, 결손 변이체, 치환 변이체)를 모두 포괄하는 의미를 갖는다.
[규칙 제91조에 의한 정정 18.04.2019]　
IGF1 이형체의 구체적인 예로는 IGF1 Ea, IGF1 Eb, IGF1 Ec 등이 있다.
인간 1형 인슐린 유사 성장인자의 변이체
[규칙 제91조에 의한 정정 18.04.2019]　
본 명세서에서, "IGF1 변이체"는 결손된 변이형 IGF1(deleted varient of IGF1; dIGF1) 또는 특정 위치의 아미노산이 치환된 변이형 IGF1일 수 있다. 본 명세서에서 사용되는 용어 "dIGF1"는 동물, 바람직하게는 포유동물에서 IGF1 유전자의 선택적 스플라이싱에 의해 생성되는 IGF1 단백질의 결손된 변이체를 지칭한다. 또한, 치환된 변이형 IGF1의 구체적인 예로서 "IGF1 변이체"는 위치 42의 아미노산 글리신이 세린에 의해 치환된 폴리펩티드일 수 있다. 또는, 구체적인 다른 예로서 "IGF1 변이체"는 IGF1 단백질의 아미노산 G1, P2, E3, R36, R37, K68, S69 및/또는 A70에 돌연변이가 있는 폴리펩타이드일 수 있다.
플라스미드
본 발명에 따른 유전자 발현 증가용 조성물은 상기 유전자를 암호화하는 단일쇄 폴리뉴클레오타이드를 포함하는 플라스미드들과 함께 투여되는 경우 유전자의 발현 효율 및 이에 따른 효능을 더욱 증대시킬 수 있다.
본 명세서에서, "플라스미드"라는 용어는 일반적으로 외래 유전자가 숙주 세포에서 발현될 수 있도록 벡터에 작동적으로 연결되어 형성된 환상의 DNA 분자를 말한다. 그러나, 플라스미드는 목적하는 유전자를 포함하도록 유전자 재조합에 의해 특정한 제한 효소에 의해 분해되고 새로운 유전자를 도입하는 벡터로 사용될 수 있다. 따라서, 본원에서는 플라스미드와 벡터는 상호교환적으로 사용되며, 유전공학 분야에 통상의 지식으로 가진 자라면 그들의 명칭을 구분하지 않더라도 그 의미를 충분히 이해할 것이다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 명세서에서, "벡터"라는 용어는 외래 유전자를 숙주 세포 내로 안정적으로 운반할 수 있는 운반체로서의 DNA 분자를 말한다. 유용한 벡터가 되기 위해서는 복제될 수 있어야 하며, 숙주 세포 내로 유입할 수 있는 방안을 갖추어야 하고, 자신의 존재를 검출할 수 있는 수단을 구비하여야 한다.
발현
발현벡터
본 발명에 따른 유전자 발현 증가용 조성물은 상기 유전자를 암호화하는 단일쇄 폴리뉴클레오타이드를 포함하는 발현벡터들과 함께 투여되는 경우 유전자의 발현 효율 및 이에 따른 효능을 더욱 증대시킬 수 있다.
본 명세서에서 용어, "발현(expression)"이란 세포에서 상기 유전자의 생성을 의미한다.
본 명세서에서 용어, "발현벡터"란 적당한 숙주에서 상기 유전자를 발현할 수 있는 벡터로서, 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 작제물을 말한다.
본 명세서에서 용어, "작동가능하게 연결된(operably linked)"은 일반적 기능을 수행하도록 핵산 발현 조절 서열과 상기 유전자를 암호화하는 폴리뉴클레오타이드가 기능적으로 연결(functional linkage)되어 있는 것을 말한다. 예를 들어 프로모터와 상기 유전자를 암호화하는 폴리뉴클레오타이드가 작동가능하게 연결되어 상기 폴리뉴클레오타이드의 발현에 영향을 미칠 수 있다. 재조합 벡터와의 작동적 연결은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용한다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 발현벡터는 플라스미드, 벡터 또는 바이러스 벡터를 이용하여 제작되나, 이에 한정되는 것은 아니다. 적합한 발현벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널 및 인핸서 같은 발현 조절 엘리먼트 등을 포함할 수 있으며, 목적에 따라 다양하게 제조될 수 있고, 벡터의 프로모터는 구성적 또는 유도성일 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호 교환적으로 사용된다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 게 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주세포당 수 개에서 수백 개의 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록 하는 복제 개시점, 및 (b) 외래 DNA 절편이 삽입될 수 있는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단 부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고 뉴클레오타이드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation)할 수 있다.
본 발명에 따른 유전자의 과발현을 위하여 사용되는 벡터는 당업계에 공지된 발현 벡터가 사용될 수 있다. 본 발명에서 사용될 수 있는 뼈대 벡터는 특별히 제한되는 것은 아니나, pCDNA3.1, pGP, pEF, pVAX, pUDK, pCK, pQE40, pT7, pET/Rb, pET28a, pET-22b(+) 및 pGEX로 이루어진 군으로부터 선택되는 다양한 벡터를 사용할 수 있고, pGP, pCK, pUDK 및 pVAX로 이루어진 군으로부터 선택되는 하나의 벡터를 이용하여 제조되는 것이 효과면에서 바람직하다.
바람직한 구체예에서, 본 발명의 발현벡터는 도 1의 개열지도를 갖는 pGP 벡터를 포함하는 발현벡터일 수 있다.
약학 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 발명은 상기의 유전자 발현 증가용 조성물; 및 상기의 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;를 포함하는 것을 특징으로 하는 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물을 제공한다. 상기 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물은 적은 양의 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 또는 이의 변이체 유전자로도 체내에서 상기 유전자의 발현이 증가됨으로 인해 우수한 치료 효과를 나타내므로 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료에 유용하게 이용될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 인간 간세포 성장인자는 서열번호 2의 염기서열로 이루어진 것일 수 있고, 상기 인간 간세포 성장인자 유전자의 변이체는 서열번호 3 내지 6의 염기서열 중에서 선택되는 어느 하나로 이루어진 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 "허혈성 질환"은 허혈성 뇌혈관질환, 허혈성 심장질환, 허혈성 심근경색, 당뇨병성 혈관심장질환, 허혈성 심부전, 허혈성 혈관질환, 폐색성 동맥경화증, 심근비대증, 허혈성 망막증, 허혈성 하지질환, 허혈성 대장염, 허혈성 급성 신부전증, 허혈성 폐질환, 허혈성 뇌졸중, 허혈성 괴사, 뇌외상, 알츠하이머 병, 파킨슨 병, 신생아 저산소증, 녹내장 및 당뇨병성 신경병증으로 이루어진 군으로부터 선택되는 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 "신경 질환"은 근위축성 측색 경화증(ALS), 알츠하이머병, 파킨슨병, 헌팅톤 무도병(Huntington's chorea), 척수 소뇌 변성증, 척수 손상, 뇌경색, 뇌허혈 및 다발성 경화증으로 이루어진 군으로부터 선택되는 중추신경 질환일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 "신장 질환"은 급성 신부전 또는 만성 신부전일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 "간 질환"은 간허혈, 지방간, 간염증, 간암, 간섬유화 또는 간경변증일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 발명은 상기의 유전자 발현 증가용 조성물 및 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자 유전자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;를 포함하는, IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물을 제공한다. 상기 IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물은 적은 양의 인간 1형 인슐린 유사 성장인자 유전자로도 체내에서 상기 유전자의 발현이 증가됨으로 인해 우수한 치료 효과를 나타내므로 상기 IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료에 유용하게 이용될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 인간 1형 인슐린 유사 성장인자 유전자는 서열번호 7의 염기서열로 이루어진 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 약학 조성물에서, 상기 유전자 발현 증가용 조성물 : 상기 성장인자 유전자는 1 : 0.5 내지 30의 부피비(w/v)로 포함될 수 있다.
한편, 상기 증상 또는 질환은, 저신장, 비만, 체중 감소, 악액질, 식욕 부진, 신경퇴행성 장애, 섬유증-관련 증상, 연골 장애, 골 질환, 염증 장애, 장 장애, 인슐린 내성, 당뇨병, 당뇨병성 케톤산증, 랍슨-멘덴할 증후군(Rabson-Mendenhall syndrome), 망막증, 말단 비대증(acromegaly), 섬유근성 이형성증(fibromuscular hyperplasia) 및 심장 장애로 이루어진 군으로부터 선택된 1종일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
특히, 상기 저신장에 대한 치료가 요구되는 개체는 인슐린 유사 성장인자-1 결핍증(IGFD)을 가지고 있는 인간 소아 개체이고, 본 발명의 약학 조성물은 인간 소아 개체에서 IGFD의 치료에 매우 유효하다.
상기 본 발명의 약학 조성물은 유전자 치료를 위한 것일 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
[규칙 제91조에 의한 정정 18.04.2019]
[규칙 제91조에 의한 정정 18.04.2019]　
[규칙 제91조에 의한 정정 18.04.2019]　
제형
본 발명에 기술된 약학 조성물은 치료용 약제학적 제제로 제형화될 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
이러한 약제학적 담체 및 부형제 뿐만 아니라 적당한 약제학적 제형은 당업계에 공지되어 있다(예컨대, "Pharmaceutical Formulation Development of Peptides and Proteins", Frokjaer et al., Taylor & Francis(2000) 또는 "Handbook of Pharmaceutical Excipients", 3rd edition, Kibbe et al., Pharmaceutical Press(2000)). 특히, 본 발명의 약학 조성물은 동결건조 형태 또는 안정한 액체 형태로 제형화될 수 있다. 본 발명의 조성물은 당업계에 공지된 다양한 절차를 통해 동결건조될 수 있다. 동결건조된 제형은 주사용 멸균수 또는 멸균 생리식염수와 같은 하나 이상의 약제학적으로 허용되는 희석제를 첨가하여 사용하기 전에 재구성시킨다.
조성물의 제형은 임의의 약제학적으로 적당한 투여 수단에 의해 개체에게 전달된다. 다양한 전달 시스템이 공지되어 있고 조성물을 임의의 편리한 경로로 투여하는데 사용될 수 있다. 주로, 본 발명의 조성물은 전신 투여된다. 전신 투여용인 경우, 본 발명의 조성물은 통상의 방법에 따라 비경구(예: 정맥내, 피하, 근육내, 복강내, 뇌내, 폐내, 비강내 또는 경피) 전달 또는 장(예: 경구, 질 또는 직장) 전달용으로 제형화된다. 가장 우선적인 투여 경로는 정맥내 및 근육내 투여이다. 이 제형들은 주입 또는 일시 주사에 의해 연속해서 투여될 수 있다. 일부 제형은 서방형 시스템을 포함한다.
본 발명의 조성물은 허용할 수 없는 부작용을 일으키는 용량에 이르지 않고 치료할 병태 또는 징후의 병도 또는 확산을 예방하거나 축소시키면서 원하는 효과를 생산하기에 충분한 용량을 의미하는 치료학적 유효량으로 환자에게 투여한다. 정확한 용량은 징후, 제형, 투여 방식 등과 같은 다양한 요인에 따라 달라지는 바, 각각의 징후마다 임상전 및 임상 시험을 통해 결정되어야 한다.
본 발명의 약학 조성물은 단독 투여할 수도 있고 또는 다른 치료제와 병용 투여할 수도 있다. 이러한 제제는 동일한 약제의 일부로서 포함될 수 있다.
치료방법
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 본 발명은 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환을 앓고 있는 개체, 또는 IGF1 수용체 결합에 의해 매개되는 증상 또는 질환을 앓고 있는 개체를 치료하는 방법에 관한 것이다. 상기 치료 방법은 본 발명의 약학 조성물을 유효량으로 개체에게 투여하는 단계를 포함할 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
본 발명의 일 구현예에 따르면, 본 발명의 HGF 또는 IGF1 등의 유전자는 10 ng 내지 100 mg의 투여량으로 투여될 수 있다. 상기 HGF 또는 IGF1, 또는 이를 암호화하는 폴리뉴클레오타이드의 투여가 일회를 초과하여 반복될 때 투여량은 매회 동일하거나 다를 수 있다.
이하, 바람직한 실시예를 들어 본 발명을 더욱 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이에 의하여 제한되지 않는다는 것은 당업계의 통상의 지식을 가진 자에게 자명할 것이다.
[실시예]
재료의 준비
유전자
인간 간세포 성장인자(Hepatocyte Growth Factor; HGF)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 2로 표시되는 인간 간세포 성장인자(HGF)의 유전자(NCBI염기서열 NM_000601.6참고)를 Genscript사(USA)에 의뢰하여 제작하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
인간 간세포 성장인자의 변이체(HGFX6)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 3로 표시되는 인간 간세포 성장인자의 변이체 유전자, HGFX6(대한민국등록특허 제10-0562824호 참고)를 Genscript사(USA)에 의뢰하여 제작하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
인간 간세포 성장인자의 변이체(HGFX7)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 4로 표시되는 인간 간세포 성장인자의 변이체 유전자, HGFX7(대한민국등록특허 제10-0562824호 참고)을 Genscript사(USA)에 의뢰하여 제작하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
인간 간세포 성장인자의 변이체(HGFX8)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 5로 표시되는 인간 간세포 성장인자의 변이체 유전자, HGFX8(대한민국등록특허 제10-0562824호 참고)를 Genscript사(USA)에 의뢰하여 제작하였다.
인간 간세포 성장인자의 변이체(dHGF)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 6으로 표시되는 인간 간세포 성장인자의 변이체 유전자, dHGF(대한민국등록특허 제10-0562824호 참고)를 Genscript사(USA)에 의뢰하여 제작하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 7로 표시되는 인간 1형 인슐린 유사 성장인자 유전자, IGF1(NCBI 염기서열 NM_001111283.2 참고)을 바이오닉스사(대한민국)에 의뢰하여 제작하였다.
인간 혈관 내피세포 성장인자(Vascular Endothelial Growth Factor; VEGF)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 8로 표시되는 인간 혈관내피성장인자 유전자, VEGF(GenBank 염기서열 AB021221.1 참고; VEGF165)을 바이오닉스사(대한민국)에 의뢰하여 제작하였다.
인간 1형 섬유아세포 성장인자(Fibroblast Growth Factor-1; FGF1)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 9로 표시되는 인간 1형 섬유아세포 성장인자 유전자, FGF1(GenBank 염기서열 X65778.1 참고)을 바이오닉스사(대한민국)에 의뢰하여 제작하였다.
인간 4형 섬유아세포 성장인자(Fibroblast Growth Factor-4; FGF4)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 10으로 표시되는 인간 4형 섬유아세포 성장인자 유전자, FGF4(GenBank 염기서열 M17446.1 참고)을 바이오닉스사(대한민국)에 의뢰하여 제작하였다.
인간 B형 혈소판 유래 성장인자(Platelet-derived Growth Factor; PDGF-B)
[규칙 제91조에 의한 정정 18.04.2019]　
서열번호 11로 표시되는 인간 B형 혈소판 유래 성장인자, PDGF-B(GenBank 염기서열 X02811.1 참고)를 바이오닉스사(대한민국)에 의뢰하여 제작하였다.
플라스미드(pGP)
[규칙 제91조에 의한 정정 18.04.2019]　
이 등(Lee Y, et al., Improved expression of vascular endothelial growth factor by naked DNA in mouse skeletal muscles: implication for gene therapy of ischemic diseases. Biochem. Biophys. Res. Commun. 2000;272(1):230-235)의 논문을 참고하여 pCK 플라스미드를 합성한 후 하기 표 1의 프라이머 1 및 2를 이용하여 위에서 기술한 방법과 동일한 방법으로 PCR을 하여 절편을 얻고 EcoRI 효소로 37 ℃에서 1시간 동안 반응한 후 Expin Gel SV (GeneAll, Korea) kit를 이용하여 DNA를 정제하였다. 이후, T4 ligase를 이용하여 30분간 ligation한 후 E.coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 서열번호 1로 표시되는 pGP 플라스미드를 제작하였다. 도 1은 본 발명의 일 실시예에 따른 pGP 벡터의 개열지도를 나타낸 것이다.
프라이머번호 프라이머명 염기서열
1 pGP(F) GACGAATTCACGCGTCTCGAGGCGGCCGCTCTAGAGGGCCCGTTTAAA
2 pGP(R) GACGAATTCGTCGACGGATCCGCTAGCAAGCTTCGTGTCAAGGACGGT
제조예
유전자를 포함하는 플라스미드 DNA의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기에서 준비한 유전자들 각각과 pGP 플라스미드를 각각 NheI과 NotI 효소로 1시간 동안 절단하고 아가로즈젤에 전기영동하여 절편을 분리하였다. 분리된 절편을 T4 ligase를 이용하여 30분간 ligation하고 E. Coli에 overnight 배양하였다. 다음날 colony를 배양한 후 mini-prep하여 DNA를 분리하여 NheI과 NotI으로 확인하였다. 클로닝이 완료된 DNA는 제한효소로 확인된 E. Coli supernatant를 4 L 플라스크 두 병에 kanamycin과 함께 넣고 overnight 배양한 후 Endofree Giga prep. kit(Qiagen, USA)를 이용하여 플라스미드 DNA를 생산하고 동물실험에 사용하였다. 상기 제조된 각각의 플라스미드 DNA를 하기 표 2에 정리하여 나타내었다.
[규칙 제91조에 의한 정정 18.04.2019]　
Figure WO-DOC-TABLE-2
실시예
[규칙 제91조에 의한 정정 18.04.2019]　
실시예 1: 유전자 발현 증가용 조성물 및 HGF를 포함하는 약학 조성물의 제조(HGF-MP1, HGF-MP2 및 HGF-MP3)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
평균 직경이 약 2.5 ㎛이고 코어는 헥사플루오르화황, 쉘은 지질을 포함하여 구성되었으며 표준코드 621400210으로 표시되는 코어-쉘 구조의 마이크로 입자를 브라코이미징코리아로부터 구입하였다(MP1). 또한, 평균 직경이 약 2.4 내지 3.6 ㎛이고, 코어는 퍼플루오로부탄, 쉘은 지질 및 계면활성제를 포함하여 구성되었으며 표준코드 646300210으로 표시되는 코어-쉘 구조의 마이크로 입자를 지이헬스케어 에이에스 대한민국지점으로부터 구입하였다(MP2). 또한, 평균 직경이 약 1.1 내지 3.3 ㎛이고, 코어는 퍼플루오로프로판, 쉘은 지질 및 계면활성제를 포함하여 구성되었으며 표준코드 662900020으로 표시되는 코어-쉘 구조의 마이크로 입자를 부경에스엠으로부터 구입하였다(MP3).
[규칙 제91조에 의한 정정 18.04.2019]　
상기 마이크로 입자 MP1은 제조사의 매뉴얼에 따라 225 ㎍에 2 ㎖ 생리식염수를 혼합하여 현탁액(유전자 발현 증가용 조성물)으로 제조하였고, MP2는 제조사의 매뉴얼에 따라 16 ㎕를 2 ㎖의 주사용수와 혼합하여 현탁액(유전자 발현 증가용 조성물)으로 제조하였다. 또한, 생리식염수와 혼합된 마이크로 입자 용액 MP3(150 ㎕/㎖)는 제조사의 매뉴얼에 따라 45초 동안 강하게 흔들어서 현탁액(유전자 발현 증가용 조성물)으로 제조하였다.
유전자 발현 증가용 조성물 및 HGF를 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1, MP2 및 MP3) 15 ㎕와 상기 제조된 pGP-HGF 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 HGF-MP1, HGF-MP2 및 HGF-MP3을 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
실시예 2: 유전자 발현 증가용 조성물 및 HGFX7을 포함하는 약학 조성물의 제조(HGFX7-MP1 및 HGFX7-MP2)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
상기 실시예 1과 동일한 방법으로 유전자 발현 증가용 조성물을 제조하였다.
유전자 발현 증가용 조성물 및 HGFX7을 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1 및 MP2) 15 ㎕와 상기 제조된 pGP-HGFX7 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 HGFX7-MP1 및 HGFX7-MP2를 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
실시예 3: 유전자 발현 증가용 조성물 및 IGF1을 포함하는 약학 조성물의 제조(IGF1-MP1, IGF1-MP2 및 IGF1-MP3)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
상기 실시예 1과 동일한 방법으로 유전자 발현 증가용 조성물을 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
유전자 발현 증가용 조성물 및 IGF1을 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1, MP2 및 MP3) 15 ㎕와 상기 제조된 pGP-IGF1 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 IGF1-MP1, IGF1-MP2 및 IGF1-MP3을 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
비교예 1: 유전자 발현 증가용 조성물 및 VEGF를 포함하는 약학 조성물의 제조(VEGF-MP1 및 VEGF-MP2)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
상기 실시예 1과 동일한 방법으로 유전자 발현 증가용 조성물을 제조하였다.
유전자 발현 증가용 조성물 및 VEGF를 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1 및 MP2) 15 ㎕와 상기 제조된 pGP-VEGF 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 VEGF-MP1 및 VEGF-MP2를 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
비교예 2: 유전자 발현 증가용 조성물 및 FGF1을 포함하는 약학 조성물의 제조(FGF1-MP1 및 FGF1-MP2)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
상기 실시예 1과 동일한 방법으로 유전자 발현 증가용 조성물을 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
유전자 발현 증가용 조성물 및 FGF1을 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1 및 MP2) 15 ㎕와 상기 제조된 pGP-FGF1 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 FGF1-MP1 및 FGF1-MP2를 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
비교예 3: 유전자 발현 증가용 조성물 및 FGF4을 포함하는 약학 조성물의 제조(FGF4-MP1 및 FGF4-MP2)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
상기 실시예 1과 동일한 방법으로 유전자 발현 증가용 조성물을 제조하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
유전자 발현 증가용 조성물 및 FGF4를 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1 및 MP2) 15 ㎕와 상기 제조된 pGP-FGF4 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 FGF4-MP1 및 FGF4-MP2를 제조하였다.
비교예 4: 유전자 발현 증가용 조성물 및 PDGF-B를 포함하는 약학 조성물의 제조(PDGF-B-MP1 및 PDGF-B-MP2)
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
상기 실시예 1과 동일한 방법으로 유전자 발현 증가용 조성물을 제조하였다.
유전자 발현 증가용 조성물 및 PDGF-B를 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 각각의 유전자 발현 증가용 조성물(MP1 및 MP2) 15 ㎕와 상기 제조된 pGP-PDGF-B 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 PDGF-B-MP1 및PDGF-B-MP2를 제조하였다.
대조군
유전자 발현 증가용 조성물
[규칙 제91조에 의한 정정 18.04.2019]　
in vivo JetPEI(Polyplus, USA)의 제조사의 매뉴얼에 따라 JetPEI 128 ㎕를 2 ml 5% glucose와 혼합하여 현탁액(유전자 발현 증가용 조성물에 대응)을 제조하였다.
유전자 발현 증가용 조성물 및 각각의 유전자를 포함하는 약학 조성물의 제조
[규칙 제91조에 의한 정정 18.04.2019]　
상기 유전자 발현 증가용 조성물 15 ㎕와 각 DNA 70 ㎍/35 ㎕을 혼합하여 각각의 약학 조성물 HGF-JetPEI, HGFX7-JetPEI, IGF1-JetPEI, 및 VEGF-JetPEI을 제조하였다.
실험예
실험예 1: 마우스에서의 단백질 발현량
상기 대조군, 실시예 및 비교예에 따른 약학 조성물 각각을 Balb/c 마우스(샘타코바이오)의 하지 장딴지근에 75 ㎍/50 ㎕/leg씩 주사하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
투여 후 7일째에 마우스를 도살하고 주사한 부위의 근육을 잘라내었다. 그리고, 상기 잘라낸 각각의 근육들을 액체 질소 및 단백질 추출킷트(Cellbiolabs, USA)를 이용하여 분쇄한 후 총단백질을 분리하였다. 분리된 총단백질량은 DC 단백질 분석킷트(Bio-Rad laboratories, USA)를 이용하여 측정하였다.
HGF 단백질 측정을 위해서는 동일한 양의 단백질을 사용하여 ELISA 킷트(R&D systems, USA)를 통해 각 유전자의 발현량을 측정하여 도 2 및 도 3에 나타내었다.
[규칙 제91조에 의한 정정 18.04.2019]　
IGF1 단백질 측정을 위해서는 동일한 양의 단백질을 사용하여 IGF1 ELISA 킷트 (R&D systems, USA)를 통해 각 유전자의 발현량을 측정하여 도 4에 나타내었다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기 도 2 내지 도 4를 통해, 본 발명에 따른 약학 조성물(실시예 1 내지 실시예 3)을 투여한 경우 대조군들의 조성물에 비해 통계적으로 유의하게 높은 HGF 또는 IGF1 유전자 발현량을 나타내는 것을 알 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
VEGF 단백질 측정을 위해서는 동일한 양의 단백질을 사용하여 VEGF ELISA 킷트(R&D systems, USA)를 통해 각 유전자의 발현량을 측정하여 도 5에 나타내었다.
[규칙 제91조에 의한 정정 18.04.2019]　
FGF1 단백질 측정을 위해서는 동일한 양의 단백질을 사용하여 FGF1 ELISA 킷트(Abcam, USA)를 통해 각 유전자의 발현량을 측정하여 도 6에 나타내었다.
[규칙 제91조에 의한 정정 18.04.2019]　
FGF4 단백질 측정을 위해서는 동일한 양의 단백질을 사용하여 FGF4 ELISA 킷트(Abcam, USA)를 통해 각 유전자의 발현량을 측정하여 도 7에 나타내었다.
[규칙 제91조에 의한 정정 18.04.2019]　
PDGF-B 단백질 측정을 위해서는 동일한 양의 단백질을 사용하여 PDGF-B ELISA 킷트(R&D systems, USA)를 통해 각 유전자의 발현량을 측정하여 도 8에 나타내었다.
상기 도 5 내지 도 8을 통해, 비교예 1 내지 4의 조성물을 투여한 경우에는 대조군들의 조성물에 비해 유의하게 발현량이 증가하지 않음을 알 수 있다.
[규칙 제91조에 의한 정정 18.04.2019]　
이상의 결과들을 통해 본 발명에 따른 실시예 1 내지 3의 조성물이 HGF 또는 IGF1 유전자의 발현량을 유의적으로 증가시킬 수 있음을 확인하였다.
실험예 2: 당뇨병으로 유발된 랫드 peripheral neuropathy 모델에서 본 발명의 약학 조성물의 효능 평가
당뇨병성 신경병증(diabetic peripheral neuropathy, DPN)의 원인은 당뇨병 유발로 인해 혈당이 상승하고 이를 통한 미세혈관이 손상으로 인해 말초신경 손상이 유발되며 임상적으로 통증 이상 등의 증상이 발병되는 허혈성 질환 및 신경 질환의 복합 질환이다. 본 연구에서 사용한 streptozotocin induced diabetic peripheral neuropathy가 대표적인 동물모델이다.
[규칙 제91조에 의한 정정 18.04.2019]　
샘타코 바이오에서 구입한 6주령 수컷 Sprague-Dawley 랫드에 streptozotocin(STZ) 70 mg/kg을 정맥에 주입하여 1형 당뇨를 유발하였다. STZ 주입 후 1주째에 비절식 혈당이 300 mg/dL 이상이 되는 개체를 선별하고, 각 개체별로 통증유발정도를 측정하기 위한 manual Von Frey 테스트를 통해 paw withdrawal threshold(PWT)를 측정하여, 통증이 유발된 개체(PWT 값이 4.0 이하)를 선별한 후 각군당 5마리씩 2군으로 분리하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
이후, 대조군으로는 pGP-HGFX7 DNA 400 ㎍을 양측 장딴지근에 각각 200 ㎍/200 ㎕씩 투여하였고, 실시예 2의 HGFX7-MP2를 양측 장딴지근에 대조군과 동량(400 ㎍)으로 투여하였다.
투여 후 2주째에 통증 척도인 PWT를 측정한 결과, 실시예 2의 HGFX7-MP2를 투여한 군에서 대조군과 비교하여 통계적으로 유의하게 PWT 값이 상승한 것을 확인하였다(도 9 참조).
실험예 3: chronic constriction injury 수술에 의해 유발된 랫드 neuropathy 모델에서 본 발명의 약학 조성물의 효능 평가
신경성 동통(neuropathic pain)은 신경계 이상에 기인한 만성 신경 질환으로 알려져 있으며 임상적으로 통증의 민감성이 증가되어 이상 통증 등을 나타내게 된다. 이러한 만성 신경성 통증은 본 연구에서 사용한 좌골신경을 결찰함으로써 발생되는 chronic constriction injury가 대표적인 동물모델이다.
[규칙 제91조에 의한 정정 18.04.2019]　
오리엔트바이오에서 구입한 5주령 수컷 Sprague-Dawley 랫드를 호흡마취(isoflurane, 이산화질소, 산소 혼합)하고 좌측 대퇴부 중간부를 절개하여 좌골신경을 노출하였다. 노출된 좌골신경을 4-0 catgut 봉합사를 이용하여 1.0 내지 1.5mm 간격으로 3가닥을 느슨하게 결찰하고 봉합하였다. 수술 1주째에 manual Von Frey 테스트를 통해 paw withdrawal threshold(PWT)를 측정하여 통증이 유발된 개체(PWT 값이 4.0 이하)를 선별하여 각 군당 5마리씩 2군으로 분리하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
이후, 대조군으로는 pGP-HGF DNA 1 mg을 좌측 대퇴근에 250 ㎍/250 ㎕씩 4곳에 투여하였고, 실시예 1의 HGF-MP2을 대조군과 동일한 부위에 동일하게 250 ㎍/250 ㎕씩 4곳(총 1 mg)에 투여하였다.
투여 후 2주째에 통증 척도인 PWT를 측정한 결과, 실시예 1의 HGF-MP2를 투여한 군에서 대조군과 비교하여 통계적으로 유의하게 PWT 값이 상승하여 통증을 느끼는 힘의 크기가 유의적으로 증가함이 확인되었다(도 10 참조).
이상의 결과를 통해 본 발명의 조성물이 유전자 발현량을 현저하게 증가시킴으로써 여러 가지 질환모델에서 유전자 효능을 향상시킴을 증명하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
구체적으로, 상기 실험예 2에서는 본 발명의 유전자 발현 증가용 조성물 및 HGFX7과 함께 당뇨병성 신경병증이 유발된 랫드 모델에 투여한 후 2주째 되는 날에 PWT 값을 측정한 결과, 대조군에 비해 80% 가량 PWT값이 상승한 것을 확인하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
또한, 상기 실험예 3에서는 본 발명의 유전자 발현 증가용 조성물을 HGF와 함께 신경성 동통이 유발된 랫드 모델에 투여한 후 2주째 되는 날에 PWT 값을 측정한 결과, 대조군에 비해 40% 이상 PWT 값이 상승한 것을 확인하였다.
[규칙 제91조에 의한 정정 18.04.2019]　
상기에서, PWT 값이 상승한다는 것은 통증을 느끼는 힘의 크기가 유의적으로 증가한다는 것, 즉 통증이 완화되는 것을 의미한다. 이와 같이, 당뇨병성 신경병증 또는 신경성 동통이 유발된 동물 모델에서 통증이 완화되는 효과가 나타나는 것은 본 발명의 유전자 발현 증가용 조성물로 인해 체내에서 HGF 또는 HGFX7의 발현이 증가되었기 때문인 것으로 보인다.
[규칙 제91조에 의한 정정 18.04.2019]　
즉, 상기 실험예들을 통해서, 본 발명의 유전자 발현 증가용 조성물 및 인간 간세포 성장인자(HGF), 이의 이형체 및 이의 변이체 중에서 선택되는 1종 이상의 유전자를 포함하는 약학 조성물이 신경성 통증 동물모델과 당뇨병성 신경병증 동물모델에서 모두 통증을 완화시키는 효과가 있는 것을 확인할 수 있었다. 따라서, 본 발명의 유전자 발현 증가용 조성물 및 인간 간세포 성장인자(HGF), 이의 이형체 및 이의 변이체 중에서 선택되는 1종 이상의 유전자를 유효성분으로 포함하는 약학 조성물을 이용하는 경우 당뇨병성 신경병증 또는 신경성 동통 등 다양한 신경 질환을 예방, 완화 또는 치료할 수 있을 것으로 판단된다.
[규칙 제91조에 의한 정정 18.04.2019]　
[규칙 제91조에 의한 정정 18.04.2019]　
비록 본 발명이 상기에 언급된 바람직한 실시예로서 설명되었으나, 발명의 요지와 범위로부터 벗어남이 없이 다양한 수정이나 변형을 하는 것이 가능하다. 또한, 첨부된 특허청구범위는 본 발명의 요지에 속하는 이러한 수정이나 변형을 포함한다.

Claims (17)

  1. [규칙 제91조에 의한 정정 18.04.2019]
    코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물로서,
    상기 코어는 생적합성 기체로서 할로겐화 탄화수소, 할로겐화 황 또는 이들의 혼합물이고, 상기 쉘은 지질 또는 이의 유도체를 포함하여 구성되며,
    상기 성장인자 유전자는 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자, 또는 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF-1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  2. 제1항에 있어서,
    상기 생적합성 기체는 헥사플루오르화황, 옥타플루오로프로판, 브로모클로로디플루오로메탄, 클로로디플루오로메탄, 디클로로디플루오로메탄, 브로모트리플루오로메탄, 클로로트리플루오로메탄, 클로로펜타플루오로에탄, 디클로로테트라플루오로에탄 및 그것의 혼합물 중에서 선택되는 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  3. [규칙 제91조에 의한 정정 18.04.2019]
    제1항에 있어서,
    상기 할로겐화 탄화수소는 퍼플루오르화 탄화수소인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  4. [규칙 제91조에 의한 정정 18.04.2019]
    제3항에 있어서,
    상기 퍼플루오르화 탄화수소는 퍼플루오로메탄, 퍼플루오로에탄, 퍼플루오로프로판, 퍼플루오로부탄, 퍼플루오로펜탄, 퍼플루오로헥산, 퍼플루오로헵탄; 퍼플루오로프로펜, 퍼플루오로부텐, 퍼플루오로부타디엔, 퍼플루오로부트-2-인, 퍼플루오로시클로부탄, 퍼플루오로메틸시클로부탄, 퍼플루오로디메틸시클로부탄, 퍼플루오로트리메틸시클로부탄, 퍼플루오로시클로펜탄, 퍼플루오로메틸시클로펜탄, 퍼플루오로디메틸시클로펜탄, 퍼플루오로메틸시클로헥산, 퍼플루오로메틸시클로헥산, 퍼플루오로메틸시클로헥산 또는 그것의 혼합물인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  5. [규칙 제91조에 의한 정정 18.04.2019]
    제1항에 있어서,
    상기 지질은 단순지질, 인지질, 글리세로 당지질, 스핑고 당지질, 콜레스테롤 및 양이온 지질로 이루어진 군에서 선택된 1종 이상인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  6. 제5항에 있어서,
    상기 인지질은 포스파티딜콜린 유도체, 포스파티딜에탄올아민 유도체, 포스파티딜세린 유도체, 디아세틸레이티드 인지질, L-α-디올레일 포스파티딜에탄올아민, 디올레인, 포스파티딘산, 포스파티딜글리세롤, 포스파티딜이노시톨, 리소포스파티딜콜린, 스핑고미엘린, 폴리에틸렌 글리콜화 인지질, 난황 레시틴, 대두 레시틴 및 수소첨가 인지질로 이루어진 군에서 선택되는 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  7. 제5항에 있어서,
    상기 글리세로 당지질은 설폭시 리보실 글리세라이드, 디글리코실 디글리세라이드, 디갈락토실 디글리세라이드, 갈락토실 디글리세라이드 및 글리코실 디글리세라이드로 이루어진 군에서 선택되는 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  8. 제5항에 있어서,
    상기 스핑고 당지질은 갈락토실 세레브로시드, 락토실 세레브로시드 또는 강글리오사이드인 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  9. 제5항에 있어서,
    상기 양이온 지질은 1,2-디올레오일-3-트리메틸암모니오 프로판(DOTAP), N-(2,3-디올레일옥시 프로판-1-일)-N,N,N-트리메틸 염화암모늄(DOTMA), 2,3-디올레일옥시-N-[2-(스페르민카르복시아미드) 에틸]-N,N-디메틸-1-프로판아미늄트리플루오로 초산(DOSPA), 1,2-디미리스틸옥시 프로필-3-디메틸하이드록시에틸 브롬화암모늄(DMRIE), 1,2-디올레오일옥시 프로필-3-디에틸 하이드록시에틸 브롬화암모늄(DORIE) 및 3β-[N-(N'N'-디메틸아미노에틸) 카르바모일]콜레스테롤(DC-Chol)로 이루어진 군에서 선택되는 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  10. [규칙 제91조에 의한 정정 18.04.2019]
    제1항에 있어서,
    상기 조성물은 성장인자 유전자의 발현량을 30% 이상 증가시키는 것을 특징으로 하는 성장인자 유전자 발현 증가용 조성물.
  11. [규칙 제91조에 의한 정정 18.04.2019]　
    제1항의 조성물, 및 인간 간세포 성장인자(Hepatocyte Growth Factor; HGF) 유전자, 인간 간세포 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;를 포함하는 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물.
  12. [규칙 제91조에 의한 정정 18.04.2019]
    제11항에 있어서,
    상기 인간 간세포 성장인자 유전자는 서열번호 2의 염기서열로 이루어진 것을 특징으로 하는 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물.
  13. [규칙 제91조에 의한 정정 18.04.2019]
    제11항에 있어서,
    상기 인간 간세포 성장인자의 변이체 유전자는 서열번호 3 내지 6의 염기서열 중에서 선택되는 어느 하나로 이루어진 것을 특징으로 하는 허혈성 질환, 신경 질환, 신장 질환 또는 간 질환의 예방 또는 치료용 약학 조성물.
  14. [규칙 제91조에 의한 정정 18.04.2019]　
    제1항의 조성물; 및 인간 1형 인슐린 유사 성장인자(Insulin like Growth Factor-1; IGF1) 유전자, 인간 1형 인슐린 유사 성장인자의 이형체 유전자 및 이의 변이체 유전자 중에서 선택되는 1종 이상의 유전자;를 포함하는, IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물.
  15. [규칙 제91조에 의한 정정 18.04.2019]
    제14항에 있어서,
    상기 인간 1형 인슐린 유사 성장인자 유전자는 서열번호 7의 염기서열로 이루어진 것을 특징으로 하는, IGF1 수용체 결합에 의해 매개되는 증상 또는 질환의 예방 또는 치료용 약학 조성물.
  16. 제14항에 있어서,
    상기 증상 또는 질환은, 저신장, 비만, 체중 감소, 악액질, 식욕 부진, 신경퇴행성 장애, 섬유증-관련 증상, 연골 장애, 골 질환, 염증 장애, 장 장애, 인슐린 내성, 당뇨병, 당뇨병성 케톤산증, 랍슨-멘덴할 증후군(Rabson-Mendenhall syndrome), 망막증, 말단 비대증(acromegaly), 섬유근성 이형성증(fibromuscular hyperplasia) 및 심장 장애로 이루어진 군으로부터 선택된 1종인 것을 특징으로 하는 약학 조성물.
  17. [규칙 제91조에 의한 정정 18.04.2019]
    제16항에 있어서,
    상기 저신장에 대한 치료가 요구되는 개체는 인슐린 유사 성장인자-1 결핍증(IGFD)을 가지고 있는 인간 소아 개체이고,
    상기 조성물은 인간 소아 개체에서 IGFD의 치료에 유효한 것을 특징으로 하는 약학 조성물.
PCT/KR2019/001708 2018-02-12 2019-02-12 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물 WO2019156540A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US16/969,092 US20210113668A1 (en) 2018-02-12 2019-02-12 Composition for increasing the expression of a growth factor gene, comprising coreshell structured microparticles as active ingredient
CA3093538A CA3093538C (en) 2018-02-12 2019-02-12 Composition for increasing expression of a growth factor gene, comprising core-shell structured microparticles as active ingredient
EP19751210.6A EP3753551A4 (en) 2018-02-12 2019-02-12 COMPOSITION FOR INCREASING THE EXPRESSION OF A GROWTH FACTOR WITH CORE-ENVELOPE-STRUCTURED MICROPARTICLE AS THE ACTIVE SUBSTANCE
JP2020543153A JP7301860B2 (ja) 2018-02-12 2019-02-12 コア－シェル構造のマイクロ粒子を有効成分として含む成長因子遺伝子発現増加用組成物
CN201980025172.5A CN112203644A (zh) 2018-02-12 2019-02-12 包含核壳结构的微粒作为活性成分的用于增加生长因子基因表达的组合物
AU2019217186A AU2019217186B2 (en) 2018-02-12 2019-02-12 Composition for increasing expression of growth factor gene, comprising core-shell structured microparticles as active ingredient

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180017075 2018-02-12
KR10-2018-0017075 2018-02-12
KR10-2019-0014955 2019-02-08
KR1020190014955A KR102245539B1 (ko) 2018-02-12 2019-02-08 코어-쉘 구조의 마이크로 입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물

Publications (1)

Publication Number Publication Date
WO2019156540A1 true WO2019156540A1 (ko) 2019-08-15

Family

ID=67808171

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2019/001708 WO2019156540A1 (ko) 2018-02-12 2019-02-12 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물
PCT/KR2019/001709 WO2019156541A1 (ko) 2018-02-12 2019-02-12 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 혈액응고 인자 유전자 발현 증가용 조성물

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/001709 WO2019156541A1 (ko) 2018-02-12 2019-02-12 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 혈액응고 인자 유전자 발현 증가용 조성물

Country Status (8)

Country Link
US (3) US20210113668A1 (ko)
EP (2) EP3753550A4 (ko)
JP (2) JP7236446B2 (ko)
KR (2) KR102245539B1 (ko)
CN (2) CN112218622B (ko)
AU (2) AU2019217187B2 (ko)
CA (1) CA3093538C (ko)
WO (2) WO2019156540A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3823982A4 (en) * 2018-07-17 2022-04-13 Helixmith Co., Ltd TREATMENT OF NEUROPATHY WITH IGF-1-ENCODING DNA CONSTRUCTS AND HGF-ENCODING DNA CONSTRUCTS
US11510999B2 (en) 2018-07-17 2022-11-29 Helixmith Co., Ltd Treatment of neuropathy with DNA constructs expressing IGF-1 isoforms

Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990001483A1 (en) 1988-08-11 1990-02-22 Asahi Kasei Kogyo Kabushiki Kaisha Tetrahydropyridine derivatives
WO1991012018A1 (en) 1990-02-13 1991-08-22 Gropep Pty. Ltd. Method for treating intestinal diseases
US5093137A (en) 1990-10-17 1992-03-03 Shazer Jr William H Reduced calorie frozen dairy desserts and processes for producing them
US5110604A (en) 1988-06-30 1992-05-05 Collagen Corporation Processes for producing collagen matrixes and methods of using same
WO1992009301A1 (en) 1990-11-27 1992-06-11 The American National Red Cross Tissue sealant and growth factor containing compositions that promote accelerated wound healing
US5126324A (en) 1990-06-07 1992-06-30 Genentech, Inc. Method of enhancing growth in patients using combination therapy
WO1992014480A1 (en) 1991-02-22 1992-09-03 Amgen Inc. Use of gm-csf and g-csf to promote accelerated wound healing
WO1993002695A1 (en) 1991-08-01 1993-02-18 Genentech, Inc. Igf-1 to improve the neural condition
WO1993008828A1 (en) 1991-11-08 1993-05-13 Syntex-Synergen Neuroscience Joint Venture Methods for the treatment of neuronal damage associated with ischemia, hypoxia or neurodegeneration
WO1994016722A1 (en) 1993-01-25 1994-08-04 The Beth Israel Hospital Association Method for modifying, diagnosing, and screening for igf-i sensitive cell barrier properties
US5368858A (en) 1991-01-31 1994-11-29 Robert F. Shaw Methods and compositions for the treatment and repair of defects or lesions in cartilage
US5427778A (en) 1987-09-18 1995-06-27 Ethicon, Inc. Gel formulations containing growth factors and acrylamide polymer
WO1996002565A1 (en) 1994-07-20 1996-02-01 Celtrix Pharmaceuticals, Inc. Igf/igfbp complex for promoting bone formation and for regulating bone remodeling
US5543441A (en) 1988-11-21 1996-08-06 Collagen Corporation Implants coated with collagen-polymer conjugates
US5550188A (en) 1988-11-21 1996-08-27 Collagen Corporation Polymer conjugates ophthalmic devices comprising collagen-polymer conjugates
US5652214A (en) 1989-06-05 1997-07-29 Cephalon, Inc. Treating disorders by application of insulin-like growth factors and analogs
US5656598A (en) 1994-03-08 1997-08-12 Rhone-Poulenc Rorer Pharmaceuticals Inc. Use of fibroblast growth factors to stimulate bone growth
US5686425A (en) 1991-07-10 1997-11-11 C.R. Bard Composition and method for revitalizing scar tissue
JP2001507207A (ja) * 1996-05-01 2001-06-05 イマアーレクス・フアーマシユーチカル・コーポレーシヨン 化合物を細胞に送達する方法
US20030100505A1 (en) 1999-11-01 2003-05-29 Chiron Corporation Compositions and methods of therapy for IGF-I-responsive conditions
US20050043240A1 (en) 2003-08-21 2005-02-24 Tercica, Inc. Methods of reducing visceral fat by increasing levels of insulin-like growth factor-I (IGF-I)
KR100562824B1 (ko) 2002-03-20 2006-03-23 주식회사 바이로메드 유전자 발현효율이 높으며 간세포 성장인자의 두 가지이형체를 동시에 발현하는 하이브리드 간세포 성장인자유전자
JP2007505140A (ja) * 2003-09-12 2007-03-08 テルシカ インコーポレーティッド インスリン様成長因子−１（ｉｇｆ−１）欠損症の治療法
KR20140063697A (ko) * 2011-09-19 2014-05-27 제너럴 일렉트릭 캄파니 미세기포 복합체 및 사용방법
KR20150032944A (ko) * 2012-05-23 2015-03-31 더 오하이오 스테이트 유니버시티 지질 나노입자 조성물 및 이를 제조하는 방법 및 사용하는 방법
KR20170075771A (ko) * 2014-10-30 2017-07-03 랜티우스 메디컬 이메징, 인크. 지질 캡슐화된 기체 마이크로스피어 조성물 및 관련된 방법

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5585112A (en) * 1989-12-22 1996-12-17 Imarx Pharmaceutical Corp. Method of preparing gas and gaseous precursor-filled microspheres
US5733572A (en) * 1989-12-22 1998-03-31 Imarx Pharmaceutical Corp. Gas and gaseous precursor filled microspheres as topical and subcutaneous delivery vehicles
JP4021286B2 (ja) 1995-08-29 2007-12-12 アンジェスＭｇ株式会社 Ｈｇｆ遺伝子からなる医薬
WO1998024922A1 (en) 1996-12-02 1998-06-11 Valentis, Inc. Insulin-like growth factor i (igf-i) expression system and methods of use
US7427602B1 (en) * 1998-05-13 2008-09-23 The Regents Of The University Of Michigan Sustained DNA delivery from structural matrices
EP1793865A4 (en) * 2004-08-05 2009-05-13 Baylor Res Inst GENETIC OR DRUG DELIVERY SYSTEM
EP1714642A1 (en) 2005-04-18 2006-10-25 Bracco Research S.A. Pharmaceutical composition comprising gas-filled microcapsules for ultrasound mediated delivery
CN100551440C (zh) * 2006-08-30 2009-10-21 中国人民解放军第三军医大学第二附属医院 一种用于肿瘤超声治疗的治疗型超声微泡及其制备方法
KR101542752B1 (ko) 2006-12-22 2015-08-10 체에스엘 베링 게엠베하 연장된 생체내 반감기를 갖는 변형된 응고 인자
US8642333B2 (en) 2008-02-04 2014-02-04 Massachusetts Institute Of Technology Particulate delivery vehicles for embryoid bodies
CN102311495A (zh) * 2010-06-30 2012-01-11 上海同科生物科技有限公司 新型重组人凝血因子ⅷ及其生产方法
US20130017997A1 (en) * 2010-08-19 2013-01-17 Amunix Operating Inc. Factor VIII Compositions and Methods of Making and Using Same
US10279053B2 (en) * 2011-07-19 2019-05-07 Nuvox Pharma Llc Microbubble compositions, method of making same, and method using same
WO2016039163A1 (ja) * 2014-09-10 2016-03-17 クリングルファーマ株式会社 神経疾患の治療に適したｈｇｆ製剤
MX2017005186A (es) * 2014-10-20 2017-07-26 Neuralstem Inc Celulas madre neurales estables que comprenden un polinucleótido exógeno que codifica un factor de crecimiento y métodos de uso de las mismas.
EP3274548A4 (en) 2015-03-23 2019-01-16 President and Fellows of Harvard College METHODS AND COMPOSITIONS FOR INJECTING ACTIVE SOLUTIONS OF HIGH CONCENTRATION AND / OR HIGH VISCOSITY
PL3411478T3 (pl) 2016-02-01 2022-10-03 Bioverativ Therapeutics Inc. Geny zoptymalizowanego czynnika VIII

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5427778A (en) 1987-09-18 1995-06-27 Ethicon, Inc. Gel formulations containing growth factors and acrylamide polymer
US5110604A (en) 1988-06-30 1992-05-05 Collagen Corporation Processes for producing collagen matrixes and methods of using same
WO1990001483A1 (en) 1988-08-11 1990-02-22 Asahi Kasei Kogyo Kabushiki Kaisha Tetrahydropyridine derivatives
US5550188A (en) 1988-11-21 1996-08-27 Collagen Corporation Polymer conjugates ophthalmic devices comprising collagen-polymer conjugates
US5543441A (en) 1988-11-21 1996-08-06 Collagen Corporation Implants coated with collagen-polymer conjugates
US5652214A (en) 1989-06-05 1997-07-29 Cephalon, Inc. Treating disorders by application of insulin-like growth factors and analogs
US5703045A (en) 1989-06-05 1997-12-30 Cephalon, Inc. Treating disorders by application of insulin-like growth factors and analogs
WO1991012018A1 (en) 1990-02-13 1991-08-22 Gropep Pty. Ltd. Method for treating intestinal diseases
US5126324A (en) 1990-06-07 1992-06-30 Genentech, Inc. Method of enhancing growth in patients using combination therapy
US5093137A (en) 1990-10-17 1992-03-03 Shazer Jr William H Reduced calorie frozen dairy desserts and processes for producing them
WO1992009301A1 (en) 1990-11-27 1992-06-11 The American National Red Cross Tissue sealant and growth factor containing compositions that promote accelerated wound healing
US5368858A (en) 1991-01-31 1994-11-29 Robert F. Shaw Methods and compositions for the treatment and repair of defects or lesions in cartilage
WO1992014480A1 (en) 1991-02-22 1992-09-03 Amgen Inc. Use of gm-csf and g-csf to promote accelerated wound healing
US5686425A (en) 1991-07-10 1997-11-11 C.R. Bard Composition and method for revitalizing scar tissue
WO1993002695A1 (en) 1991-08-01 1993-02-18 Genentech, Inc. Igf-1 to improve the neural condition
WO1993008828A1 (en) 1991-11-08 1993-05-13 Syntex-Synergen Neuroscience Joint Venture Methods for the treatment of neuronal damage associated with ischemia, hypoxia or neurodegeneration
WO1994016722A1 (en) 1993-01-25 1994-08-04 The Beth Israel Hospital Association Method for modifying, diagnosing, and screening for igf-i sensitive cell barrier properties
US5656598A (en) 1994-03-08 1997-08-12 Rhone-Poulenc Rorer Pharmaceuticals Inc. Use of fibroblast growth factors to stimulate bone growth
WO1996002565A1 (en) 1994-07-20 1996-02-01 Celtrix Pharmaceuticals, Inc. Igf/igfbp complex for promoting bone formation and for regulating bone remodeling
JP2001507207A (ja) * 1996-05-01 2001-06-05 イマアーレクス・フアーマシユーチカル・コーポレーシヨン 化合物を細胞に送達する方法
US20030100505A1 (en) 1999-11-01 2003-05-29 Chiron Corporation Compositions and methods of therapy for IGF-I-responsive conditions
KR100562824B1 (ko) 2002-03-20 2006-03-23 주식회사 바이로메드 유전자 발현효율이 높으며 간세포 성장인자의 두 가지이형체를 동시에 발현하는 하이브리드 간세포 성장인자유전자
US20050043240A1 (en) 2003-08-21 2005-02-24 Tercica, Inc. Methods of reducing visceral fat by increasing levels of insulin-like growth factor-I (IGF-I)
JP2007505140A (ja) * 2003-09-12 2007-03-08 テルシカ インコーポレーティッド インスリン様成長因子−１（ｉｇｆ−１）欠損症の治療法
US7258864B2 (en) 2003-09-12 2007-08-21 Tercica, Inc. Methods for treatment of insulin-like growth factor-1 (IGF-1) deficiency
KR20140063697A (ko) * 2011-09-19 2014-05-27 제너럴 일렉트릭 캄파니 미세기포 복합체 및 사용방법
KR20150032944A (ko) * 2012-05-23 2015-03-31 더 오하이오 스테이트 유니버시티 지질 나노입자 조성물 및 이를 제조하는 방법 및 사용하는 방법
KR20170075771A (ko) * 2014-10-30 2017-07-03 랜티우스 메디컬 이메징, 인크. 지질 캡슐화된 기체 마이크로스피어 조성물 및 관련된 방법

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
CLEMMONSUNDERWOOD, J. CLIN. ENDOCRINOL. METAB., vol. 79, no. 1, 1994, pages 4 - 6
CONTRERAS, PHARMAC. EXP. THERAP., vol. 274, 1995, pages 1443 - 1499
DI GIULIO ET AL., SOCIETY FOR NEUROSCIENCE, vol. 22, 1996, pages 1960
DI GIULIO, SOCIETY FOR NEUROSCIENCE, vol. 23, 1997, pages 894
GORIO, NEUROSCIENCE, vol. 82, 1998, pages 1029 - 1037
HANTAI, J. NEUROL. SCI., vol. 129, 1995, pages 122 - 126
HSU, BIOCHEM. MOL. MED., vol. 60, no. 2, 1997, pages 142 - 148
KANJE ET AL., BRAIN RES., vol. 486, 1989, pages 396 - 398
LANGFORD ET AL., EUR. J. CLIN. INVEST., vol. 23, no. 9, 1993, pages 503 - 516
LEE Y ET AL.: "Improved expression of vascular endothelial growth factor by naked DNA in mouse skeletal muscles: implication for gene therapy of ischemic diseases", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 272, no. 1, 2000, pages 230 - 235
O'SHEA ET AL., AM. J. PHYSIOL., vol. 264, 1993, pages F917 - F922
SANG-CHOL LEE ET AL., KOREAN CIRCULATION J, vol. 36, 2006, pages 32 - 38
SCHALCH ET AL.: "Modern Concepts of Insulin-Like Growth Factors", 1991, ELSEVIER SCIENCE PUBL. CO., article "Short-term metabolic effects of recombinant human insulin-like growth factor I (rhIGF-I) in type II diabetes mellitus", pages: 705 - 714
STELLA, M. C.COMOGLIO, P. M., THE INTERNATIONAL JOURNAL OF BIOCHEMISTRY & CELL BIOLOGY, vol. 31, 1999, pages 1357 - 1362
XINGSHENG LI ET AL., J ULTRASOUND MED, vol. 27, 2008, pages 453 - 460
ZP SHEN ET AL., GENE THERAPY, vol. 15, 2008, pages 1147 - 1155

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3823982A4 (en) * 2018-07-17 2022-04-13 Helixmith Co., Ltd TREATMENT OF NEUROPATHY WITH IGF-1-ENCODING DNA CONSTRUCTS AND HGF-ENCODING DNA CONSTRUCTS
US11510999B2 (en) 2018-07-17 2022-11-29 Helixmith Co., Ltd Treatment of neuropathy with DNA constructs expressing IGF-1 isoforms

Also Published As

Publication number Publication date
US20210113480A1 (en) 2021-04-22
WO2019156541A1 (ko) 2019-08-15
US20210113668A1 (en) 2021-04-22
AU2019217186A1 (en) 2020-10-01
EP3753551A4 (en) 2021-12-22
AU2019217187A1 (en) 2020-10-01
CN112218622A (zh) 2021-01-12
JP2021513544A (ja) 2021-05-27
CA3093538A1 (en) 2019-08-15
CN112203644A (zh) 2021-01-08
EP3753551A1 (en) 2020-12-23
EP3753550A4 (en) 2021-12-22
JP7301860B2 (ja) 2023-07-03
JP2021513545A (ja) 2021-05-27
KR102245539B1 (ko) 2021-04-29
KR20190098073A (ko) 2019-08-21
CN112218622B (zh) 2023-10-24
KR20190098060A (ko) 2019-08-21
US20230390211A1 (en) 2023-12-07
AU2019217187B2 (en) 2022-03-17
CA3093538C (en) 2024-02-27
EP3753550A1 (en) 2020-12-23
KR102230593B1 (ko) 2021-03-23
AU2019217186B2 (en) 2022-03-17
JP7236446B2 (ja) 2023-03-09

Similar Documents

Publication Publication Date Title
AU2016346870B2 (en) Dual function proteins and pharmaceutical composition comprising same
AU2016346864B2 (en) Long-acting FGF21 fusion proteins and pharmaceutical composition comprising same
WO2018088838A1 (en) Pharmaceutical composition for preventing or treating hepatitis, hepatic fibrosis, and hepatic cirrhosis comprising fusion proteins
WO2019156540A1 (ko) 코어-쉘 구조의 마이크로입자를 유효성분으로 포함하는 성장인자 유전자 발현 증가용 조성물
WO2017188731A1 (ko) 경구 투여용 유전자 전달을 위한 나노입자 및 이를 포함하는 약학 조성물
WO2013029279A1 (zh) 新的glp-ⅰ类似物及其制备方法和用途
WO2022080986A1 (ko) Glp-1/gip 이중작용제, 이의 지속형 결합체, 및 이를 포함하는 약학적 조성물
WO2022164260A1 (ko) 신경 퇴행성 질환의 치료를 위한 유전자 요법
WO2008121009A1 (en) Modified adiponectin proteins
WO2022164259A1 (ko) 신경 퇴행성 질환의 치료를 위한 유전자 요법
WO2018004294A9 (ko) 인간 성장호르몬 변이 단백질 또는 이의 트랜스페린 융합 단백질을 유효성분으로 포함하는 약학적 조성물
WO2022164288A1 (ko) 비염증성 식세포작용 유도 활성을 갖는 융합분자
US20230357346A1 (en) Fusion protein including glucagon-like peptide-1 and interleukin-1 receptor antagonist and use thereof
WO2022010273A1 (ko) 보체 경로 억제제를 포함하는 융합단백질 및 이의 용도
WO2017142331A1 (en) Pharmaceutical composition comprising recombinant hgh for the treatment of growth hormone deficiency
WO2020184941A1 (en) Glp-1 fusion proteins and uses thereof
WO2021182928A1 (ko) 신규 이중 특이성 단백질 및 그의 용도
EP3416677A1 (en) Pharmaceutical composition comprising recombinant hgh for the treatment of growth hormone deficiency
WO2023059112A1 (ko) 최적의 재조합 발현 구축물의 개발
KR20050059258A (ko) Ｇｌｐ-2 화합물, 제제, 및 그것의 사용
WO2021162460A1 (ko) 신규 비알코올성 간질환의 치료용 약학적 조성물
WO2022211454A1 (ko) 샤르코-마리-투스병 예방 또는 치료용 약제학적 조성물
WO2024111982A1 (ko) Fgf5의 전사체 변이체-2 및 이의 단백질의 간섬유화증의 예방, 억제, 및 치료 용도
WO2022015039A1 (ko) 글루카곤-유사 펩타이드-1 및 글루카곤-유사 펩타이드-2를 포함하는 융합 단백질 및 이의 용도
WO2023158214A1 (ko) 인슐린-유사 성장인자-1의 이형체를 이용한 근감소증 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19751210

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020543153

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 3093538

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019751210

Country of ref document: EP

Effective date: 20200914

ENP Entry into the national phase

Ref document number: 2019217186

Country of ref document: AU

Date of ref document: 20190212

Kind code of ref document: A