WO2023038489A1 - 조절 t 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물 - Google Patents

조절 t 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2023038489A1
WO2023038489A1 PCT/KR2022/013610 KR2022013610W WO2023038489A1 WO 2023038489 A1 WO2023038489 A1 WO 2023038489A1 KR 2022013610 W KR2022013610 W KR 2022013610W WO 2023038489 A1 WO2023038489 A1 WO 2023038489A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
disease
pharmaceutical composition
preventing
degenerative brain
Prior art date
Application number
PCT/KR2022/013610
Other languages
English (en)
French (fr)
Inventor
이승원
김재윤
김형준
박현웅
Original Assignee
주식회사 브이티바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 브이티바이오 filed Critical 주식회사 브이티바이오
Publication of WO2023038489A1 publication Critical patent/WO2023038489A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/462—Cellular immunotherapy characterized by the effect or the function of the cells
    • A61K39/4621—Cellular immunotherapy characterized by the effect or the function of the cells immunosuppressive or immunotolerising
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/46433—Antigens related to auto-immune diseases; Preparations to induce self-tolerance
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating degenerative brain disease comprising regulatory T cells as an active ingredient.
  • AD Alzheimer's disease
  • AD Alzheimer's disease
  • the causes of Alzheimer's disease have not been fully elucidated, and neuroinflammation is considered a central process in the pathogenesis of Alzheimer's disease.
  • Studies of patients with Alzheimer's disease provide evidence for persistent neuroinflammation in the early stages of Alzheimer's disease prior to neuronal atrophy.
  • Tregs regulatory T cells
  • CD4+CD25+Foxp3+ regulatory T cells account for 5-10% of CD4+ T cells and play an important role in inducing immune tolerance and maintaining immune homeostasis.
  • Studies on patients and animal models of ischemic stroke have demonstrated the therapeutic efficacy of Treg cells to block bleeding and improve sensorimotor function.
  • Treg cells In addition to autoimmune brain diseases, it is also being studied for the treatment of neurodegenerative diseases, but it is still unclear whether injection of Treg cells is helpful in treating Alzheimer's disease.
  • Microglia the main immune cells of the central nervous system, play an important role in regulating brain inflammation. In Alzheimer's disease, it is known that activated microglia regulate neuroinflammation by inducing various inflammatory responses. In general, microglia have two different activation phenotypes: pro-inflammatory M1 and immunosupperssive M2. Microglia of the M1 phenotype induce an inflammatory response primarily by releasing inflammatory cytokines and chemokines and expressing genes essential for the inflammatory response. On the other hand, microglia of the M2 phenotype release many anti-inflammatory cytokines, chemokines, and anti-neurotropic factors to protect or treat the inflammatory response.
  • DAM disease-associated microglia
  • neurodegenerative a phenotype
  • DAM neurodegenerative phenotype
  • An object of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative brain disease comprising regulatory T cells as an active ingredient.
  • Another object of the present invention is to provide a method for preventing or treating degenerative brain diseases.
  • the present invention provides a pharmaceutical composition for preventing or treating degenerative brain disease comprising regulatory T cells as an active ingredient.
  • the present invention provides a method for preventing or treating a degenerative brain disease comprising administering the pharmaceutical composition to a subject.
  • the pharmaceutical composition of the present invention inhibits M1 microglia activation or progression to DAM, promotes M2 polarization, inhibits phosphorylation of tau protein, and increases the expression of anti-inflammatory cytokines to protect neurons, thereby protecting degenerative brain It can be usefully used for the prevention or treatment of diseases.
  • Figure 1 is a schematic diagram showing the preparation process of the animal model simply schematically.
  • Figure 3 is a graph showing the mRNA expression level of the M1 marker in the hippocampus.
  • FIG. 4 is a graph showing mRNA expression levels of DAM markers in the hippocampus.
  • 5 is a graph showing protein expression levels of M1, M2, brain-derived nerve growth factor, and DAM markers in the hippocampus.
  • Figure 6 is a graph showing the mRNA expression level of the M2 marker in the hippocampus.
  • FIG. 7 is a photograph showing the results of immunofluorescence staining for CD116 and Trem2 in the hippocampus.
  • FIG. 8 is a photograph showing the results of immunofluorescence staining for phosphorylated tau protein in the hippocampus.
  • the present invention provides a pharmaceutical composition for preventing or treating a degenerative brain disease comprising regulatory T cells as an active ingredient.
  • regulatory T cell is a cell that is the only cell capable of inducing immunosuppression among subtypes of T cells, and is a T cell that plays a role in reducing excessively activated immune responses or suppressing unnecessary immune responses ( A type of T cell).
  • the regulatory T cells suppress an immune response to regulate allergy, autoimmunity, inflammation, response to microorganisms, and the like.
  • regulatory T cells may be human regulatory T cells, but are not limited thereto.
  • the regulatory T cells may suppress the expression of M1 microglia-related markers NOS2, CD86, IL-12a, IL-1 ⁇ , IL-1 ⁇ , IL-23, IL-6, and TNF- ⁇ .
  • the regulatory T cell may suppress the expression of DAM (disease-associated microglia) markers Trem2, Tmem119, Cc3cr1, Itgax, and Ccl6.
  • DAM disease-associated microglia
  • the regulatory T cells may increase the expression of IL-4, IL-10, TGF- ⁇ , Arg1, Ym1, Mrc1, and IL-2, which are markers related to M2 polarization of microglia.
  • the degenerative brain diseases include Alzheimer's disease, Parkinson's disease, dementia, progressive supranuclear palsy, multiple system strophy, olive nucleus-pons-cerebellar Olivopontocerebellar atrophy (OPCA), Shy-Drager syndrome, striatonigral degeneration, Huntington's disease, Amyotrophic lateral sclerosis (ALS), this Essential tremor, Cortico-basal ganlionic degeneration, Diffuse Lewy body disease, Parkinson-ALS-dementia complex of Guam and It may be selected from the group consisting of Pick's disease, but it may be included without limitation if it is a neurological disease caused by nerve inflammation.
  • ALS Amyotrophic lateral sclerosis
  • Diffuse Lewy body disease Parkinson-ALS-dementia complex of Guam and It may be selected from the group consisting of Pick's disease, but it may be included without limitation if it is a neurological disease caused by nerve inflammation.
  • composition may be for intrathecal administration, but is not limited thereto.
  • prevention refers to any activity that inhibits or delays the occurrence, development, and recurrence of degenerative brain diseases by administration of the composition according to the present invention.
  • treatment means any activity that improves or beneficially changes the symptoms of degenerative brain diseases and complications resulting therefrom by administration of the composition according to the present invention.
  • Those of ordinary skill in the art to which the present invention pertains will be able to determine the degree of improvement, enhancement and treatment by knowing the exact criteria of the disease for which the composition of the present application is effective by referring to the data presented by the Korean Medical Association, etc. will be.
  • composition according to the present invention may contain a pharmaceutically effective amount of regulatory T cells alone or may contain one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the pharmaceutically effective amount refers to an amount sufficient to prevent, improve, and treat symptoms of immune diseases.
  • pharmaceutically acceptable refers to a composition that is physiologically acceptable and does not cause allergic reactions such as gastrointestinal disorders and dizziness or similar reactions when administered to humans.
  • composition of the present invention can be administered orally or parenterally during clinical administration and can be used in the form of general pharmaceutical preparations.
  • Dosage forms may be oral, mucosal (eg nasal, sublingual, vaginal, buccal, or rectal), parenteral (eg subcutaneous, intravenous, bolus infusion, intramuscular or intraarterial), topical (eg subcutaneous, intravenous, bolus infusion, intramuscular or intraarterial). , eye), transdermal or transcutaneous method, but is not limited thereto.
  • dosage forms include tablets; caplets; capsule agents such as soft elastic gelatin capsules; cachets; Troki; lozenges; dispersant; suppositories; powder; aerosols (eg, nasal sprays or inhalers); gel; liquid dosage forms suitable for oral or mucosal administration to patients, including suspension preparations (eg, aqueous or non-aqueous liquid suspension preparations, oil-in-water emulsions, or water-in-oil liquid emulsions) solutions and elixirs; liquid dosage forms suitable for injectable administration to patients; eye drops or other ophthalmic preparations suitable for topical administration; and sterile solid preparations (eg, crystalline or amorphous solids) that can be reconstituted to provide a liquid dosage form suitable for injectable administration to a patient.
  • suspension preparations eg, aqueous or non-aqueous liquid suspension preparations, oil-in-water emulsions, or water-in-oil liquid emulsions
  • a dosage form used for acute treatment of a condition may contain a higher amount of the active ingredient than a dosage form used for chronic treatment of the same condition.
  • a parenteral dosage form may contain a smaller amount of the active ingredient than an oral dosage form used to treat the same condition.
  • composition including a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • the carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, It may be at least one selected from the group consisting of polyvinyl pyrrolidone, physiological saline, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, dextrin, calcium carbonate, propylene glycol, and liquid paraffin. It is not limited, and all conventional carriers, excipients or diluents can be used. The above components may be added independently or in combination with the regulatory T cells, which are the active ingredients.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intrathecal, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method, and the dosage is determined by the patient's body weight, age , the range varies according to gender, health condition, diet, administration time, administration method, excretion rate, and severity of disease.
  • parenterally eg, intrathecal, intravenous, subcutaneous, intraperitoneal or topical application
  • solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and such solid preparations may contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc., in one or more compounds. Alternatively, it may be prepared by mixing lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is.
  • formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, freeze-dried formulations, suppositories, and the like.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • injectable esters such as ethyl oleate
  • a base for suppositories witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerol, gelatin, and the like may be used.
  • the pharmaceutical composition of the present invention can be used parenterally in the form of an injection of a sterile solution or suspension in water or other pharmaceutically acceptable liquids, if necessary.
  • a pharmacologically acceptable carrier or medium specifically, sterile water or physiological saline, vegetable oil, emulsifier, suspending agent, surfactant, stabilizer, excipient, vehicle, preservative, binder, etc.
  • a pharmacologically acceptable carrier or medium specifically, sterile water or physiological saline, vegetable oil, emulsifier, suspending agent, surfactant, stabilizer, excipient, vehicle, preservative, binder, etc.
  • the amount of the active ingredient in the formulation is such that an appropriate dose within the indicated range can be obtained.
  • a sterile composition for injection can be prescribed according to conventional formulation practice using a vehicle such as distilled water for injection.
  • aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants, such as D-sorbitol, D-mannose, D-mannitol and sodium chloride;
  • isotonic solutions containing glucose and other adjuvants such as D-sorbitol, D-mannose, D-mannitol and sodium chloride
  • alcohols specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, and nonionic surfactants such as polysorbate 80 (TM) and HCO-50 can be used in combination.
  • sesame oil and soybean oil can be cited as the oily liquid, and it can be used in combination with benzyl benzoate and benzyl alcohol as a solubilizing agent. It can also be combined with buffers such as phosphate buffer, sodium acetate buffer, analgesics such as procaine hydrochloride, stabilizers such as benzyl alcohol, phenol, antioxidants.
  • buffers such as phosphate buffer, sodium acetate buffer, analgesics such as procaine hydrochloride, stabilizers such as benzyl alcohol, phenol, antioxidants.
  • administration of the pharmaceutical composition of the present invention to the body of a patient is preferably parenteral administration, and specifically intrathecal intrathecal administration once to three times is basic, but further administration may be used.
  • the administration time may be a short period of time or a long period of continuous administration. More specifically, injection form, transdermal administration form, etc. are mentioned.
  • the injection formulation include intrathecal injection, intravenous injection, intraarterial injection, selective intraarterial injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, intraventricular injection, intracerebral injection, intramedullary injection, etc. can do.
  • the pharmaceutical composition of the present invention is a group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories. It may have any one formulation selected from.
  • a base for suppositories witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerol, gelatin, and the like may be used.
  • the effective dosage of the active substance of the present invention for the human body may vary depending on the patient's age, weight, sex, dosage form, health condition, and degree of disease.
  • the pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, hormone therapy, drug therapy, and biological response modifiers for the prevention or treatment of degenerative brain diseases.
  • the present invention provides a method for preventing or treating a degenerative brain disease comprising administering the pharmaceutical composition to a subject.
  • the method of the present invention includes the above-described pharmaceutical composition, descriptions of overlapping descriptions of the above-described pharmaceutical composition of the present invention are omitted in order to avoid excessive complexity of the present specification due to overlapping descriptions.
  • the pharmaceutical composition of the present invention can be administered in a therapeutically effective amount or a pharmaceutically effective amount.
  • the term "therapeutically effective amount” refers to an amount of a pharmaceutically acceptable salt of a composition effective for preventing or treating a target disease
  • the therapeutically effective amount of the composition of the present invention is various factors, such as It may vary depending on the administration method, the target site, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined in an appropriate amount considering both safety and efficiency. It is also possible to estimate the amount to be used in humans from the effective amount determined through animal experiments. These considerations in determining effective amounts are discussed, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
  • the term "pharmaceutically effective amount” means an amount that is sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level is the patient's health condition Depending on the type and severity of the disease, the activity of the drug, the sensitivity to the drug, the method of administration, the time of administration, the route of administration and the rate of excretion, the duration of treatment, factors including drugs used in combination or concurrently, and other factors well known in the medical field. can be determined
  • the composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. Considering all of the above factors, it is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.
  • composition may be for intrathecal administration, but is not limited thereto.
  • mammals including humans.
  • the mammal refers to non-primates (cattle, pigs, horses, cats, dogs, rats, mice, etc.) and primates (humans, monkeys such as cynomolgous monkeys and chimpanzees).
  • the degenerative brain diseases include Alzheimer's disease, Parkinson's disease, dementia, progressive supranuclear palsy, multiple system strophy, olive nucleus-pons-cerebellar Olivopontocerebellar atrophy (OPCA), Shy-Drager syndrome, striatonigral degeneration, Huntington's disease, Amyotrophic lateral sclerosis (ALS), this Essential tremor, Cortico-basal ganlionic degeneration, Diffuse Lewy body disease, Parkinson-ALS-dementia complex of Guam and It may be selected from the group consisting of Pick's disease, but it may be included without limitation if it is a neurological disease caused by nerve inflammation.
  • ALS Amyotrophic lateral sclerosis
  • Diffuse Lewy body disease Parkinson-ALS-dementia complex of Guam and It may be selected from the group consisting of Pick's disease, but it may be included without limitation if it is a neurological disease caused by nerve inflammation.
  • Amyloid beta (A ⁇ 1-42 ) peptide was purchased from GenScript (Piscataway, NJ, USA). The A ⁇ 1-42 peptide was suspended in 450 ⁇ l distilled water (DW) and mixed with 50 ⁇ l 10x phosphate buffered saline (PBS) to prepare 1x PBS. For the production of fibrillary A ⁇ , the dissolved peptide was incubated overnight at 37°C.
  • bvPLA2 was purchased from Sigma (St. Louis, MO, USA), dissolved in PBS, and stored at -20°C until use.
  • 3xTg AD mice [B6;129-Tg(APPSwe,tauP301L)1Lfa Psen1 tm1Mpm /Mmjax] were purchased from Jackson Laboratory (Bar Harbor, ME, USA). A total of 18 male 3xTg AD mice were used. In the animal model, extracellular A ⁇ was observed to occur after 6 months of age, and from 12 months of age, tau pathology appeared after 12 months. All mice were housed with free access to food and water on a 12-hour light/dark cycle, and 10-month-old mice were used for administration of human regulatory T cells (hTreg).
  • hTreg human regulatory T cells
  • mice were anesthetized with isoflurane and a 25-gauge lumbar puncture needle was inserted into the spinal canal at the L3-L4 or L4-L5 level.
  • 1 ⁇ 10 2 , 1 ⁇ 10 3 , 1 ⁇ 10 4 , 1 ⁇ 10 5 hTreg cells were injected into cerebrospinal fluid over 20 seconds.
  • Animal experiments were performed in accordance with animal protection regulations, and guidelines for animal experiments were approved by the Institutional Animal Care & Use Committee (IACUC) of Kyung Hee University (KHUASP(SE)-21-102).
  • the cells are resuspended with MACS buffer (VTRS03) to 1x10 8 cells/500uL.
  • the number of cells is less than 6x10 6 cells, stand the T12.5 Flask and seed in 3 mL. At the time of 6 ⁇ 10 6 cells or more, seeding is performed at 1 ⁇ 10 6 cells/mL.
  • Human regulatory T cells were isolated using CD4 + CD25 + CD127 dim/- Regulatory T Cell Isolation Kit II according to the following procedure.
  • VTRS03 After removing the supernatant, resuspend the cells with 10 mL of MACS buffer (VTRS03), then collect the cells in one of the 4 tubes. Then, collect the remaining cells in another tube with 10 mL of MACS buffer (VTRS03).
  • Cells are counted according to the “5.7.1 Live Cell Counting” method. Cells were then centrifuged at 1000 xg for 5 minutes at 4 °C.
  • the cells are resuspended with MACS buffer (VTRS03) to a concentration of 0.8x10 7 cells/40uL.
  • step 35) Proceed with step 35) one more time (using a total of 2 mL MACS buffer for each 1 mL).
  • Retention memory was measured with a fear-motivated avoidance system (Hamilton-Kinder LLC, San Diego, CA), and passive avoidance was observed by suppression of previously displayed responses.
  • the manual avoidance experiment consisting of two chamber boxes separated by a software-controlled mechanical gate consisted of three training trials and one retetion test. During the training trial, each mouse was placed on the right side of a chamber box with lights off for 10 seconds for acclimatization. After a 10-second acclimatization period, the light in the right chamber was turned on, and then the guillotine door to the dark compartment on the left was opened. At this time, the mouse entering the dark compartment receives electrical stimulation. Mice were removed from the box after the end of electrical stimulation or after 180 seconds had elapsed.
  • the Y maze experiment is based on rodents' preference for exploring novel areas over familiar ones and is designed to measure several aspects of spatial working memory.
  • the maze consists of three transparent plastic arms, each measuring 39 X 8 X 16 cm, set at a 120° angle to each other.
  • the mouse was free to explore the start arm and the other arm, and the third arm was blocked by an opaque door. To avoid bias-related errors, random arm assignment within each experimental group was balanced. Afterwards, mice were returned to their home cages for 2 min.
  • the mouse was placed at the end of the start arm and allowed to explore the third arm for 2 minutes.
  • the maze was cleaned with a 70% ethanol solution between each exploratory step to remove olfactory cues.
  • ⁇ CT delta cycle threshold
  • Tween 20 Tween 20
  • HRP-conjugated secondary antibody anti-rabbit or anti-mouse IgG
  • Western Blotting Detection Reagent Kit Abclon, Seoul, South Korea
  • Antibody binding was measured with a chemiluminescence detection system (Davinch-Chemi, Seoul, South Korea). Densitometric analysis was performed using Image J software.
  • mice were anesthetized with isoflurane, transcardially perfused with cold PBS, and fixed with a 4% paraformaldehyde solution dissolved in PBS.
  • the brain was removed, fixed in 4% paraformaldehyde solution at 4°C for 48 hours, and then stored in 30% surose/PBS solution at 4°C.
  • each hemi-brain was divided into anterior, central, and posterior portions by coronal section incision. Each part was individually embedded in Optimal Cutting Temperature (O.C.T.; WVR) mounting medium, frozen in liquid nitrogen and stored at -80 °C.
  • O.C.T. Optimal Cutting Temperature
  • Cryosections (7 ⁇ m) were prepared from the central part of the brain using a Leica RM2145 cryostat and mounted on SuperFrostTM Plus slide glass. In addition, at least three non-contiguous (more than 100 ⁇ m apart) sections were designated in each mouse. Each section was first washed with PBS, then blocked with PBS-5% BSA-0.05% Tween 20 for 1 hour at room temperature, and then incubated with rabbit anti-Iba1 antibody (1/200) (Wako) overnight at 4°C. or incubated with rabbit anti-GFAP antibody (1/200) (Dako) for 30 minutes at room temperature.
  • Sections were washed three times with PBS-0.1% BSA, incubated with mouse anti-CD11b (1/200) (ab8878; Abcam) for 30 minutes at room temperature, washed three times, and then stained with Alexa Fluor® 488-conjugated goat anti-rat. and Alexa Fluor® 594-conjugated goat anti-goat antibody (1/1000 each) for 30 minutes at room temperature.
  • Brain sections washed three times were stained with DAPI (1 ⁇ g/ml in PBS) and coverslipped with Immu-MountTM medium (ThermoShandon). Images were obtained using Zen2 (blue edition) software and a confocal fluorescence microscope (LSM800, Carl Zeiss). Quantitative analysis of microglia in all fields/images was analyzed based on pixel intensity, and cells were counted using Image J (National Institutes of Health).
  • hTreg human regulatory T cells
  • mice at 10 months of age were then evaluated for short-term attentional memory.
  • all items showed a significant decrease only in the 3xTg AD mouse group compared to the WT (Fig. 2C), and in the case of spontaneous alteration change, compared to the WT mouse group, the 3xTg AD mouse group compared to the WT.
  • Significant changes were found, and 10 2 and The 10 3 hTreg group also showed significant changes (Fig. 2D).
  • DAM disease-associated microglia
  • M1 microglia are activated in 3xTg AD mice, and hTreg inhibits M1 microglia activation and progression to DAM by suppressing the expression of M1 microglia and DAM-related markers increased by Alzheimer's disease. do.
  • FIG. 7A Immunoreactivity against CD11b and Trem2 was observed in the hippocampal dentate gyrus (DG) (Fig. 7A).
  • Trem2+ cells were significantly decreased in the 10 2 hTreg administration group compared to the 3xTg AD group, but not in the other experimental groups (FIG. 7C).
  • FIG. 7B, D No significant changes were observed in all experimental groups of CD116b+ cells and CD116b+Trem2+ cells.
  • Trem2 is a receptor expressed on the surface of microglia, which is an immune cell in the brain, and plays a role in allowing microglia to develop into complete DAM (disease-associated microglia). Therefore, through these results, it can be seen that hTreg has an effect of inhibiting the progression of microglia to disease-associated microglia (DAM).
  • DAM disease-associated microglia
  • Tregs influence the progression of Alzheimer's disease.
  • intrathecal administration of Tregs could reduce phosphorylation of tau protein in the hippocampus of an AD mouse model.
  • hTreg is an innate immune cell of the CNS (Central nervous system) that maintains the homeostasis of the inflammatory process and suppresses the M1 activation of microglia that regulates cognitive function and promotes the M2 polarization, thereby removing tau protein and reducing nerve damage. induce protective action. Therefore, these results suggest that human regulatory T cells (hTreg) can be used as a composition for preventing or treating central nervous system diseases, particularly degenerative brain diseases.
  • CNS Central nervous system

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Hospice & Palliative Care (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Psychiatry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Psychology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 조절 T 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물에 관한 것으로, 본 발명의 약학적 조성물은 M1 미세아교세포 활성화 억제 또는 DAM으로 진행을 억제하고 M2 분극화를 촉진하며, 타우 단백질의 인산화를 억제하고, 항염증성 사이토카인의 발현을 증가시켜 신경 세포를 보호하므로 퇴행성 뇌질환의 예방 또는 치료에 유용하게 사용될 수 있다.

Description

조절 T 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물
본 발명은 조절 T 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물에 관한 것이다.
알츠하이머병(Alzheimer’s disease, AD)은 기억과 인지 기능의 점진적 상실이 특징인 일반적인 신경퇴행성 질환이다. 현재까지 알츠하이머병의 원인은 완전히 밝혀지지 않았으며, 신경 염증은 알츠하이머병의 병리 발생의 중심 과정으로 여겨지고 있다. 알츠하이머병 환자들에 대한 연구는 신경 위축에 앞서 알츠하이머병 초기 단계에서 지속적인 신경염증에 대한 증거를 제공한다.
한편, 최근 면역 요법 분야의 발전은 신경질환에 대한 새로운 강력한 양상을 만들어 냈다. 구체적으로, 조절 T 세포 요법은 뇌 치료의 판도를 재편하기 시작하고 있다. 조절 T 세포(Treg)는 면역 체계를 조절하고 면역 항상성을 유지하는 T 세포의 작은 하위 집합이다. CD4+CD25+Foxp3+ 조절 T 세포는 CD4+ T 세포 중 5-10%를 차지하며 면역 관용을 유도하고 면역 항상성을 유지하는 데 중요한 역할을 한다. 허혈성 뇌졸중의 환자와 동물 모델에 대한 연구는 출혈을 차단하고 감각운동(sensorimotor) 기능을 개선하는 Treg 세포의 치료 효능을 입증하였다. 또한, 허혈성 생쥐에게 조절 T 세포를 정맥주사로 투여했을 때 뇌출혈 변형이 극적으로 완화되어 주입된 Treg 세포의 신경보호 효과를 시사하였다. 자가면역성 뇌 질환 이외에 신경퇴생성 질환의 치료 용도로도 연구되고 있으나, Treg 세포의 주입이 알츠하이머병 치료에 도움이 되는지는 여전히 모호하다.
중추신경계의 주요 면역 세포인 미세아교세포(microglia)는 뇌 염증을 조절하는데 중요한 역할을 한다. 알츠하이머병에서는 활성화된 미세아교세포가 다양한 염증 반응을 유도하여 신경 염증을 조절하는 것으로 알려져 있다. 일반적으로 미세아교세포는 전염증성(pro-inflammatory) M1 및 면역억제성(immunosupperssive) M2로 두 가지 다른 활성화 표현형을 가지고 있다. M1 표현형의 미세아교세포는 주로 염증성 사이토카인 및 케모카인을 방출하고 염증 반응에 필수적인 유전자를 발현함으로써 염증 반응을 유도한다. 반면에, M2 표현형의 미세아교세포는 염증 반응에 대한 보호 또는 치료를 위해 많은 항염증성 사이토카인, 케모카인, 항신경성 인자를 방출합니다. 그러므로, 미세아교세포의 M1 분극화를 억제하고 M2 분극화를 유도한다면 알츠하이머병에 대한 높은 잠재적 치료효과를 가질 것으로 예상된다. 최근 연구에 따르면, 알츠하이머병, ALS, 전두엽성치매, 노화 등 신경퇴행성 질환에서 상향조절된 유전자의 집합으로 정의되는 DAM(disease-associated microglia) 또는 ‘신경퇴행성’ 표현형이 관찰되었다. 그러나 미세아교세포 또는 DAM 표현형에서 항상성 기능의 손실이 신경 세포의 손실과 어느정도 상관관계가 있는지, DAM가 신경퇴행성 질환에 이로운지 또는 해로운지는 여전히 불분명하다.
따라서, 본 발명자들은 알츠하이머병 치료를 위해 척수강내에 주입된 인간 조절 T 세포(hTreg)의 영향을 조사하고자 하였으며, hTreg는 뇌의 신경 염증을 억제하고, 염증성 미세아교세포 발현을 억제하여 신경보호 효과가 있다는 것을 확인하고 본 발명을 완성하였다.
본 발명의 목적은 조절 T 세포(regulatory T cell)를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물을 제공하는 데 있다.
또한, 본 발명의 다른 목적은 퇴행성 뇌질환의 예방 또는 치료 방법을 제공하는 데 있다.
상기와 같은 목적을 달성하기 위해, 본 발명은 조절 T 세포(regulatory T cell)를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물을 제공한다.
이어서, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 퇴행성 뇌질환의 예방 또는 치료 방법을 제공한다.
본 발명의 약학적 조성물은 M1 미세아교세포 활성화 억제 또는 DAM으로 진행을 억제하고 M2 분극화를 촉진하며, 타우 단백질의 인산화를 억제하고, 항염증성 사이토카인의 발현을 증가시켜 신경 세포를 보호하므로 퇴행성 뇌질환의 예방 또는 치료에 유용하게 사용될 수 있다.
도 1은 동물모델의 준비과정을 간단히 도식화하여 나타낸 모식도이다.
도 2는 AD 마우스의 수동 회피 실험 결과를 나타낸 그래프이다.
도 3은 해마에서 M1 마커의 mRNA 발현 수준을 나타낸 그래프이다.
도 4는 해마에서 DAM 마커의 mRNA 발현 수준을 나타낸 그래프이다.
도 5는 해마에서 M1, M2, 뇌유래신경성장인자 및 DAM 마커의 단백질 발현 수준을 나타낸 그래프이다.
도 6은 해마에서 M2 마커의 mRNA 발현 수준을 나타낸 그래프이다.
도 7은 해마에서 CD116 및 Trem2에 대한 면역형광염색 결과를 나타낸 사진이다.
도 8은 해마에서 인산화된 타우 단백질에 대한 면역형광염색 결과를 나타낸 사진이다.
이하, 첨부된 도면을 참조하여 본 발명의 실시예로 본 발명을 상세히 설명하기로 한다. 다만, 하기 실시예는 본 발명에 대한 예시로 제시되는 것으로, 당업자에게 주지 저명한 기술 또는 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략할 수 있고, 이에 의해 본 발명이 제한되지는 않는다. 본 발명은 후술하는 특허 청구범위의 기재 및 이로부터 해석되는 균등 범주 내에서 다양한 변형 및 응용이 가능하다.
또한, 본 명세서에서 사용되는 용어(terminology)들은 본 발명의 바람직한 실시 예를 적절히 표현하기 위해 사용된 용어들로서, 이는 사용자, 운용자의 의도 또는 본 발명이 속하는 분야의 관례 등에 따라 달라질 수 있다. 따라서 본 용어들에 대한 정의는 본 명세서 전반에 걸친 내용을 토대로 내려져야 할 것이다. 명세서 전체에서, 어떤 부분이 어떤 구성요소를 “포함”한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다.
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 '%'는 별도의 언급이 없는 경우, 고체/고체는 (w/w) %, 고체/액체는 (w/v) %, 그리고 액체/액체는 (v/v) %이다.
이하, 본 발명에 대하여 보다 상세하게 설명하도록 한다.
본 발명은 조절 T 세포(regulatory T cell)를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서 사용되는 용어 “조절 T 세포”는 T 세포 아형 중에서 유일하게 면역억제를 유도할 수 있는 세포로서, 과도하게 활성화된 면역반응을 감소시키거나 불필요한 면역반응을 억제하는 역할을 하는 T세포(T cell)의 일종을 말한다. 상기 조절 T 세포는 면역반응(immune response)을 억제하여 알레르기, 자가면역, 염증, 미생물에 대한 반응 등을 조절한다.
또한, 상기 조절 T 세포는 인간 조절 T 세포(human regulatory T cell)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 조절 T 세포는 M1 미세아교세포 관련 마커인 NOS2, CD86, IL-12a, IL-1β, IL-1β, IL-23, IL-6 및 TNF-α의 발현을 억제하는 것일 수 있다.
또한, 상기 조절 T 세포는 DAM(disease-associated microglia) 마커인 Trem2, Tmem119, Cc3cr1, Itgax 및 Ccl6의 발현을 억제하는 것일 수 있다.
또한, 상기 조절 T 세포는 미세아교세포의 M2 분극화 관련 마커인 IL-4, IL-10, TGF-β, Arg1, Ym1, Mrc1 및 IL-2의 발현을 증가시키는 것일 수 있다.
또한, 상기 퇴행성 뇌질환은 알츠하이머병(Alzheimer's disease), 파킨슨병(Parkinson's disease), 치매(dementia), 진행성 핵상마비(Progressive supranuclear palsy), 다계통 위축증(Multiple system strophy), 감람핵-뇌교-소뇌 위축증(Olivopontocerebellar atrophy; OPCA), 샤이-드래거 증후군(Shy-Drager syndrome), 선조체-흑질 퇴행증 (Striatonigral degeneration), 헌팅톤병(Huntington's disease), 근위축성 측색 경화증(Amyotrophic lateral sclerosis; ALS), 본태성 진전증(Essential tremor), 피질-기저핵 퇴행증(Cortico-basal ganlionic degeneration), 미만성 루이 소체 질환(Diffuse Lewy body disease), 파킨스-ALS-치매 복합증(Parkinson-ALS-dementia complex of Guam) 및 픽병(Pick's disease)으로 이루어진 군에서 선택되는 것일 수 있으나, 신경 염증으로 인해 야기되는 신경질환이라면 제한되지 않고 포함될 수 있다.
또한, 상기 약학적 조성물은 척수강내 투여용일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 사용된 용어 "예방"이란 본 발명에 따른 조성물의 투여에 의해 퇴행성 뇌질환의 발생, 발달 및 재발을 억제 또는 지연시키는 모든 행위를 의미한다.
본 발명에서 사용된 용어 "치료"란 본 발명에 따른 조성물의 투여로 퇴행성 뇌질환 및 이로 인한 합병증의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 본원의 조성물이 효과가 있는 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
본 발명에 따른 조성물은 약학적으로 유효한 양의 조절 T 세포를 단독으로 포함하거나 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함할 수 있다. 상기에서 약학적으로 유효한 양이란 면역질환의 증상을 예방, 개선 및 치료하기에 충분한 양을 말한다. 상기에서 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다.
또한, 본 발명의 조성물은 임상 투여 시에 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다. 투여 형태는 경구, 점막(예를 들어, 비강, 설하, 질, 버칼, 또는 직장), 비경구적(예를 들어, 피하, 정맥, 볼루스 주입, 근육내 또는 동맥내), 국소(예를 들어, 눈), 경피(transdermal) 또는 피부통과(transcutaneous) 방식 일 수 있으며, 이에 한정되는 것은 아니다. 투여 형태의 예는 정제; 캐프릿(caplets); 부드러운 탄성 젤라틴 캅셀과 같은 캅셀제; 캐세트(cachets); 트로키; 로젠즈(lozenges); 분산제; 좌제; 파우더; 에어로솔(예를 들어, 비강 스프레이 또는 인홀러); 겔; 현탁제제(예를 들어, 수상 또는 비-수상 액상 현탁제제, 수중유형 유제, 또는 유중수형 액상 유제) 용액제 및 엘릭실제를 포함하는 환자에게 경구 또는 점막 투여하기에 알맞은 액상 투여 제형; 환자에게 주사 투여하기에 알맞은 액상 투여 제형; 국소 투여하기에 적당한 아이 드랍(eye drop) 또는 다른 안과 제제; 및 환자에게 주사 투여하기에 적당한 액상 투여 형태를 제공하기 위하여 재구성될 수 있는 멸균 고상제제(예를 들어, 결정형 또는 무정형 고체)를 포함하나 이에 한정되는 것은 아니다. 본 발명의 투여 형태의 종류, 모양, 및 타입은 일반적으로 그들의 사용에 따라 매우 다양하다. 예를 들어, 질환의 급성 치료를 위해 사용된 투여 형태는 동일한 질환의 만성 치료를 위해 사용되는 투여 형태보다 많은 양의 활성 성분을 포함할 수 있다. 또한, 비경구적 투여 형태는 동일 질환을 치료하기 위해 사용된 경구 투여 형태보다 더 적은 양의 활성 성분을 포함할 수 있다. 본 발명에 의해 포함되는 투여 형태 및 방식들은 매우 다양하며, 이는 본 발명이 속한 분야에 있어 통상의 지식을 가진 자에게 자명하다 (Remington's Pharmaceutical Sciences, 18th ed.,Mack Publishing, Easton PA (1990) 참조.)
또한, 약학적으로 허용 가능한 담체를 포함하는 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 상기 담체, 부형제 및 희석제로는 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 생리식염수, 메틸히드록시벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유, 덱스트린, 칼슘카보네이트, 프로필렌글리콜 및 리퀴드 파라핀으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니며, 통상의 담체, 부형제 또는 희석제 모두 사용 가능하다. 상기 성분들은 상기 유효성분인 조절 T 세포에 독립적으로 또는 조합하여 추가될 수 있다.
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여 (예를 들어, 척수강내, 정맥내, 피하, 복강내 또는 국소에 적용)할 수 있으며, 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다.
또한, 경구 투여를 위한 고형제제에는 정제환제, 산제, 과립제, 캡슐제 등이 포함될 수 있으며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로오스 (sucrose) 또는 락토오스 (lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
또한, 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁용제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔 (witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
또한, 본 발명의 약학적 소성물은 필요에 따라서 물 혹은 그 이외의 약학적으로 허용할 수 있는 액과의 무균성 용액, 또는 현탁액제의 주사제의 형태로 비경구적으로 사용할 수 있다. 예를 들면, 약리학상 허용되는 담체 혹은 매체, 구체적으로는, 멸균수나 생리 식염수, 식물유, 유화제, 현탁제, 계면활성제, 안정제, 부형제, 비히클(vehicle), 방부제, 결합제 등과 적당히 조합하여, 일반적으로 인정된 제약 실시에 요구되는 단위 용량 형태로 혼화하는 것에 의해 제제화하는 것을 생각된다. 상기 제제에 있어서 유효 성분량은 지시받은 범위의 적당한 용량을 얻을 수 있도록 하는 것이다.
또한, 주사를 위한 무균 조성물은 주사용 증류수와 같은 부형액을 이용해 통상의 제제 실시에 따라 처방할 수가 있다.
또한, 주사용의 수용액으로서는, 예를 들면 생리 식염수, 포도당이나 그 외의 보조약을 포함한 등장용액, 예를 들면 D-소르비톨, D-만노스, D-만니톨, 염화 나트륨을 들 수 있어 적당한 용해 보조제, 예를 들면 알코올, 구체적으로는 에탄올, 폴리 알코올, 예를 들면 프로필렌 글리콜, 폴리에틸렌 글리콜, 비이온성 계면활성제, 예를 들면 폴리소르베이트 80(TM), HCO-50으로 병용할 수 있다.
또한, 상기 유성액으로서는 참기름, 콩기름을 들 수 있어 용해 보조제로서 안식향산벤질, 벤질 알코올과 병용할 수 있다. 또한, 완충제, 예를 들면 인산염 완충액, 초산나트륨 완충액, 무통화제, 예를 들면, 염산 프로 카인, 안정제, 예를 들면 벤질 알코올, 페놀, 산화 방지제와 배합할 수 있다. 조제된 주사액은 통상, 적당한 앰플에 충전시킨다.
또한, 본 발명의 약학적 조성물의 환자의 체내에의 투여는 바람직하게는 비경구투여이며, 구체적으로는 척수강내 1회 내지 3회의 투여가 기본이지만 그 이상의 투여라도 좋다. 또, 투여 시간은 단시간이라도 장시간 지속 투여라도 좋다. 더욱 구체적으로는, 주사제형, 경피투여형등을 들 수 있다. 주사제형의 예로서는 예를 들면, 척수강내 주사, 정맥내 주사, 동맥내 주사, 선택적 동맥내 주사, 근육내 주사, 복강내 주사, 피하주사, 뇌실내 주사, 뇌내 주사, 골수액강내 주사 등에 의해 투여할 수있다.
또한, 본 발명의 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다. 좌제의 기제로는 위텝솔 (witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
또한, 본 발명의 유효물질의 인체에 대한 효과적인 투여량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있다.
본 발명의 약학적 조성물은 퇴행성 뇌질환의 예방 또는 치료 효과를 위하여 단독으로, 또는 수술, 호르몬 치료, 약물 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
이어서, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 퇴행성 뇌질환의 예방 또는 치료 방법을 제공한다.
본 발명의 방법은 상술한 약학적 조성물을 포함하기 때문에, 상술한 본 발명의 약학적 조성물과 중복된 내용은 중복된 내용의 기재에 의한 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 약학적 조성물은 치료학적으로 유효한 양 또는 약학적으로 유효한 양으로 투여될 수 있다.
본 발명에서, 용어 "치료학적으로 유효한 양"은 대상 질환을 예방 또는 치료하는데 유효한 조성물의 약학적으로 허용가능한 염의 양을 의미하며, 본 발명의 조성물의 치료적으로 유효한 양은 여러 요소, 예를 들면 투여방법, 목적부위, 환자의 상태 등에 따라 달라질 수 있다. 따라서, 인체에 사용 시 투여량은 안전성 및 효율성을 함께 고려하여 적정량으로 결정되어야 한다. 동물실험을 통해 결정한 유효량으로부터 인간에 사용되는 양을 추정하는 것도 가능하다. 유효한 양의 결정시 고려할 이러한 사항은, 예를 들면 Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; 및 E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.에 기술되어있다.
본 발명에서, 용어 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키지 않을 정도의 양을 의미하며, 유효용량 수준은 환자의 건강상태, 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와 순차적으로 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여, 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
또한, 상기 약학적 조성물은 척수강 내 투여용일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 "개체"는 퇴행성 뇌질환을 예방 또는 치료를 목적으로 하는 개체이면 특별히 한정되지 않고, 바람직하게는 인간을 포함한 포유동물을 나타낸다. 상기 포유동물은 비-영장류 (소, 돼지, 말, 고양이, 개, 래트, 마우스 등) 및 영장류 (인간, 원숭이, 예를 들어 사이노몰구스 (cynomolgous) 원숭이 및 침팬지)를 나타낸다.
또한, 상기 퇴행성 뇌질환은 알츠하이머병(Alzheimer's disease), 파킨슨병(Parkinson's disease), 치매(dementia), 진행성 핵상마비(Progressive supranuclear palsy), 다계통 위축증(Multiple system strophy), 감람핵-뇌교-소뇌 위축증(Olivopontocerebellar atrophy; OPCA), 샤이-드래거 증후군(Shy-Drager syndrome), 선조체-흑질 퇴행증 (Striatonigral degeneration), 헌팅톤병(Huntington's disease), 근위축성 측색 경화증(Amyotrophic lateral sclerosis; ALS), 본태성 진전증(Essential tremor), 피질-기저핵 퇴행증(Cortico-basal ganlionic degeneration), 미만성 루이 소체 질환(Diffuse Lewy body disease), 파킨스-ALS-치매 복합증(Parkinson-ALS-dementia complex of Guam) 및 픽병(Pick's disease)으로 이루어진 군에서 선택되는 것일 수 있으나, 신경 염증으로 인해 야기되는 신경질환이라면 제한되지 않고 포함될 수 있다.
이하, 본 발명을 실시예를 통하여 더욱 상세히 설명하기로 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
<실시예 1> 실험재료 및 실험방법
1-1. 실험재료
아밀로이드 베타 (Aβ 1-42) 펩타이드는 GenScript(Piscataway, NJ, USA)에서 구입하였다. Aβ 1-42 펩타이드는 450㎕ 증류수 (DW)에 현탁되었으며, 50㎕ 10x 인산염 완충 식염수(PBS)와 혼합하여 1x PBS를 제조하였다. 섬유소 Aβ (fibrillary Aβ) 생성을 위하여 용해된 펩타이드는 37℃에서 밤새 인큐베이션하였다. bvPLA2는 Sigma(St. Louis, MO, USA)에서 구입하여 PBS에 녹이고 사용할 때까지 -20℃에서 보관하였다.
1-2. 동물모델의 준비
3xTg AD 마우스 [B6;129-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/Mmjax]는 Jackson Laboratory(Bar Harbor, ME, USA)에서 구매하였다. 총 18마리의 수컷 3xTg AD 마우스가 사용되었다. 상기 동물 모델에서 세포외 Aβ는 생후 6개월 이후에 발생하는 것으로 나타나는 것으로 관찰되었으며, 12개월부터는 타우(tau) 병리(pathology)는 12개월 후에 나타났다. 모든 마우스는 12시간의 명암 주기로 음식과 물에 자유롭게 접근할 수 있는 곳에 수용되었으며, 인간 조절 T 세포(hTreg)를 투여하기 위해 생후 10개월된 마우스를 사용하였다. 마우스는 이소플루란(isoflurane)으로 마취되었고, 25-게이지 요추천자바늘(lumbar puncture needle)은 L3-L4 또는 L4-L5 레벨에서 척추관(spinal canal) 안으로 들어갔다. 1×102,1×103,1×104,1×105 hTreg 세포(10 μl PBS 포함)는 뇌척수액 (cerebrospinal fluid)에 20초에 걸쳐 주입되었다. 동물 실험은 동물보호 규정에 따라 수행되었으며, 동물 실험에 대한 가이드 라인은 경희대학교 동물실험윤리위원회(Institutional Animal Care & Use Committee, IACUC)로부터 승인받았다 (KHUASP(SE)-21-102).
1-3. 단핵세포의 분리
단핵세포는 다음과 같은 절차에 따라 분리하였다.
1) 혈액 팩을 부드럽게 흔들어 섞어준 후, 500 mL Square Media Bottle에 혈액을 옮겨 붓는다. 공정 검사를 위한 검체로 30 uL 혈액을 채취한다.
2) D-PBS와 혈액이 1:2 비율이 되도록 D-PBS를 넣어준 후 inverting하여 혈액과 D-PBS가 충분히 혼합될 수 있게 하여 균질한 혈액 샘플을 준비한다.
3) Leucosep tube에 Ficoll-paqueTMPLUS 15mL를 넣어준 후 1000 xg로 2분간 원심분리하여 준비한다. 준비된 leucosep tube에 희석된 혈액 30 mL를 조심히 넣는다.
4) 3)에서 준비된 leucosep tube를 상온(15~25 ℃)에서 400 xg로 30분간 원심분리 한다. *원심분리기의 설정을 acceleration-9, deceleration-1으로 바꾸어 진행한다.
5) PBMC 위의 혈장 층을 제거한다.
6) PBMC층을 채취하여 새 50 mL tube에 분리한다. *채취할 수 있는 최대한으로 PBMC를 회수한다.
7) D-PBS를 회수 용량에 2:1 비율로 희석한다. (ex) PBMC 10 mL：D-PBS 20 mL)
8) 7)에서 준비된 tube를 inverting 한 후, 상온(15~25 ℃)에서 500 xg로 10분간 원심분리 한다. 그리고 상등액을 제거한다.
9) D-PBS 10 mL로 각각 tube의 세포 pellet을 재부유하여 한곳으로 수집한다. 그리고 D-PBS 10 mL로 tube에 남아있는 세포를 tube에 회수하고 이를 2회 더 수행한다.
10) 총 D-PBS 40 mL에 재부유된 세포를 “5.7.1 생세포 계수” 방법에 따라 세포를 계수한다.
11) 나머지 세포를 300 xg에서 10분간 원심분리 한다.
12) 상등액을 제거 후, 5 % AB serum 2 mM EDTA CliniMACS buffer(이하 “MACS buffer”, VTRS03)로 0.8x107 cells/70uL가 되도록 재부유한다. * 세포 pellet을 단일세포가 되도록 조심스럽게 풀어준다.
13) 세포에 CliniMACS CD8 GMP MicroBeads 0.8x107 cells/30uL를 처리한다.
14) MACS Buffer와 beads가 처리된 세포를 상온(15~25 ℃)에서 30분간 반응시킨다.
15) 반응을 시킨 세포에 MACS buffer(VTRS03)를 1x107 cells/1mL가 되도록 추가로 넣고 섞어준 후에 300 xg으로 10분간 상온(15~25 ℃)에서 원심분리 한다.
16) QuadroMACS Separator에 LD column을 준비한다.
17) MACS buffer(VTRS03) 2 mL로 column을 적셔준다. *Column은 마르지 않도록 주의한다.
18) 원심분리 완료된 15)의 상등액을 제거한 후, MACS buffer(VTRS03)로 1x108 cells/500uL가 되도록 세포를 재부유한다.
19) 재부유한 세포를 LD column에 내린다.
20) MACS buffer(VTRS03)를 1 mL씩 2번 column에 내려 label되지 않은 세포를 50 mL tube에 모은다. * MACS buffer(VTRS03)가 모두 내려가는 것을 확인하고 넣어준다.
21) 50 mL tube에 수집한 세포에 MACS buffer(VTRS03)를 추가하여 최종 부피가 40 mL가 되도록 한다. “5.7.1 생세포 계수” 방법에 따라 세포를 계수한다.
22) 나머지 세포는 1000 xg으로 5분간 상온(15~25 ℃)에서 원심분리 한다.
23) 계수된 세포 수로 4x106 cells/mL이 되도록 세포배양액을 준비한 후, 최종 부피에 맞게 IL-2 (500 unit/mL), bvPLA2 (0.4 ug/mL), fibrillary amyloid beta(5 uM)이 되도록 넣어준다.
24) 원심분리가 완료된 세포의 상등액을 제거하고 8x106 cells/mL이 되도록 재부유한다.
25) 21)에서 계수된 세포수를 기준으로 공정 검사를 위한 검체를 5x104 cells이상을 채취한다.
26) 하기 표 1을 참고하여 T75 Flask에 분주 될 최종 volume의 절반을 분주한다. 23)에서 준비된 세포배양액으로 Flask에 4x106 cells/mL이 되도록 채워준다. 분주 후 잔여량은 같은 방법으로 하기 표 1을 참고하여 적정 Flask에 분주한다. 단, T75 Flask의 최소배양용량은 20 mL로 한다.
27) Flask 표면에 배양시작날짜, 제조번호, 담당자를 표기하고, 현미경으로 세포 상태를 관찰한 후, 37 ℃인 5 % CO2 incubator에서 3일 동안 배양한다.
세포 농도 1x106cells/mL
ExpAct beads농도 1x106cells/40uL
IL-2 농도 1000 unit/mL
Flask 적정 배양 부피
Flask 종류 이상 미만 또는 이하
T12.5 Flask 3 mL < 5 mL
T25 Flask 5 mL ≤ 7.5 mL
T75 Flask 15 mL ≤ 22 mL
단, 세포수가 6x106 cells 미만일 때, T12.5 Flask를 세워서 3 mL에 seeding 한다. 6×106 cells 이상이 되는 시점에서는 1×106 cells/mL로 seeding 한다.
1-4. 조절 T 세포의 분리
인간 조절 T 세포는 CD4+CD25+CD127dim/- Regulatory T Cell Isolation Kit II를 사용하여 다음과 같은 절차에 따라 분리하였다.
1) 240mm 스크래퍼를 이용하여 T75 Flask 바닥에 붙어있는 세포를 긁어 떨어뜨린다.
2) 1)에서 부유시킨 세포를 50mL tube에 수집하고, Flask에 남은 세포를 MACS buffer(VTRS03) 10mL로 세포를 수집한다. 그리고 1000xg로 5분간 4℃에서 원심분리 한다.
3) 상등액을 제거한 후, MACS buffer(VTRS03) 10mL로 각각 세포를 재부유한 다음 4개의 tube 중 하나의 tube에 세포를 모은다. 그리고 MACS buffer(VTRS03) 10mL로 다른 tube에 남아 있는 세포를 모은다.
4) 세포를 “5.7.1 생세포 계수” 방법에 따라 세포를 계수한다. 이후 세포는 1000 xg로 5분간 4 ℃에서 원심분리 한다.
5) 상등액을 제거한 후, 세포를 MACS buffer(VTRS03)로 0.8x107cells/40uL가 되도록 재부유 한다.
6) 세포에 CD4+CD25+CD127dim/- T CELL Biotin-Antibody Cocktail Ⅱ를 0.8x107cells/10uL가 되도록 넣는다.
7) 처리된 세포를 잘 혼합하여 4 ℃에서 5분간 반응시킨다.
8) 반응이 완료된 세포에 MACS buffer(VTRS03)를 0.8x107cells/30uL와 Anti-biotin MicroBeads 0.8x107cells/20uL가 되도록 넣는다.
9) 처리된 세포를 잘 혼합하여 4 ℃에서 10분간 반응시킨다.
10) QuadroMACS Separator에 LD column을 준비한다.
11) LD column에 MACS buffer(VTRS03) 2 mL를 내려 column을 적셔준다. *Column은 마르지 않도록 주의한다.
12) 9)에서 반응이 완료된 세포에 MACS buffer(VTRS03)를 1x108cells/500uL가 되도록 넣어 재부유 한다.
13) LD column에 재부유한 세포를 넣고, MACS buffer(VTRS03)를 1 mL씩 2번 column에 내린다. *MACS buffer(VTRS03)가 모두 내려가는 것을 확인하고 넣어준다.
14) Column 아래로 떨어지는 세포를 15mL tube에 모은 후, 1000 xg에 5분간 4 ℃에서 원심분리 한다.
15) 상등액을 제거한 후, 세포에 MACS buffer(VTRS03)를 0.8x107cells/90uL가 되도록 넣어 재부유한다.
16) CD25 Micro beads Ⅱ를 0.8x107cells/10uL가 되도록 처리한 후, 잘 혼합하여 4 ℃에서 30분간 반응시킨다.
17) 반응이 완료된 세포에 MACS buffer(VTRS03) 1mL를 넣고, 1000 xg로 5분간 4 ℃에서 원심분리 한다.
18) OctoMACS separator에 MS column을 준비한다.
19) MACS buffer(VTRS03) 1 mL을 내려 MS Column을 적셔준다.
20) 원심분리가 완료된 17)의 상등액을 제거한 후, MACS buffer(VTRS03)로 1x108cells/500uL가 되도록 재부유 한다.
21) 재부유된 세포를 MS Column에 내리고 MACS buffer(VTRS03)를 500 uL씩 2번 내려주고 column 아래로 떨어지는 세포(CD25-세포)를 15 mL tube에 모은다. * MACS buffer(VTRS03)가 모두 내려가는 것을 확인하고 넣어준다.
22) MS column에 MACS buffer(VTRS03) 1 mL를 넣고, plunger로 MS column에 압력을 가하여 MS column에 붙은 세포 (CD25+세포)를 tube에 모은다. 이 과정을 1회 더 실시한다 (총 2 mL MACS buffer 사용).
23) 21)에서 준비된 15mL tube를 1000 xg로 2분간 4 ℃에서 원심분리 한다.
24) OctoMACS separator에 MS column을 준비한다.
25) MACS buffer(VTRS03) 1 mL을 내려 MS Column을 적셔준다.
26) 원심분리가 완료된 23)의 상등액을 제거한 후, MACS buffer(VTRS03)로 20)과 동일한 용량으로 재부유 한다.
27) MS Column에 재부유된 세포를 내리고 MACS buffer(VTRS03)를 500 uL씩 2번 내려 Column 아래로 떨어지는 세포 (CD25-세포)를 15 mL tube에 모은다. * MACS buffer(VTRS03)가 모두 내려가는 것을 확인하고 넣어준다.
28) MS column에 MACS buffer(VTRS03) 1 mL를 넣고, plunger로 MS column에 압력을 가하여 MS column에 붙은 세포 (CD25+세포)를 22)에서 준비된 tube에 같이 모은다. 이 과정을 1회 더 실시한다 (총 2 mL MACS buffer 사용).
29) 위와 같은 절차를 완료하면 총 4 mL의 MS column에 붙은 세포(CD25+세포)를 얻을 수 있다.
30) MS column을 통해 회수된 세포를 1000×g로 5분간 4 ℃에서 원심분리 한다.
31) OctoMACS separator에 MS column을 준비한다.
32) MACS buffer(VTRS03) 1 mL을 내려 MS Column을 적셔준다.
33) 원심분리가 완료된 30)의 상등액을 제거한 후, MACS buffer(VTRS03)로 20)과 동일한 용량으로 재부유 한다.
34) 33)에 준비된 세포를 MS column에 내리고 MACS buffer(VTRS03)으로 500uL씩 2번 내려준 다음 Column 아래로 떨어지는 세포 (CD25-세포)를 15 mL tube에 모은다.
35) MS column에 MACS buffer(VTRS03) 1 mL를 넣고, plunger로 MS column에 압력을 가하여 MS column에 붙은 세포 (CD25+세포)를 tube에 모은다.
36) 35)번을 한번 더 진행한다 (1 mL씩 총 2 mL MACS buffer 사용).
37) MS column을 통해 회수된 세포를 1000 xg로 5분간 4 ℃에서 원심분리 한다.
38) 세포를 세포배양액(VTRS04) 10 mL로 재부유한 후 세포를 계수하고, 1000 xg로 5분간 4 ℃에서 원심분리 한다.
1-5. 수동회피실험
retention memory는 a fear-motivated avoidance system (Hamilton-Kinder LLC, San Diego, CA)로 측정하였으며, 수동 회피는 이전에 나타난 반응의 억제에 의해 관찰되었다. software-controlled mechanical gate로 분리된 2개의 챔버 상자로 이루어진 수동 회피 실험은 3회의 training trial과 1회의 retetion test로 구성하였다. training trial 동안 각 마우스는 순응을 위해 10초 동안 소등된 챔버 상자의 오른쪽에 배치되었다. 10초의 적응 기간 후 오른쪽 챔버에 조명을 켠 후, 좌측에 있는 어두운 구획으로 가는 길로틴 도어(guillotine door)를 열었다. 이때 어두운 구획에 들어간 마우스는 전기 자극을 받게 된다. 전기 자극이 끝난 후 또는 180초가 경과한 후에는 마우스를 상자에서 꺼냈다. 또한, 어두운 구획에 전기 충격을 가한 것을 제외하고는 상기와 동일한 방법으로 retetion test를 2회 수행하였다. 조명이 어두운 구획에 들어가기 전의 대기 시간(latency)과 오류 발생 시간을 기록했으며, 대기 시간이 증가하고 오류 발생 시간이 감소함에 따라 이전에 전기 자극이 발생한 어두운 구획에 대한 retention memory가 향상되었음을 알 수 있다.
1-6. Y maze 실험
Y maze 실험은 친숙한 영역보다 새로운 영역을 탐색하는 설치류의 선호도를 기반으로 하며 공간 작업 기억의 여러 측면을 측정하도록 설계되었다. 미로는 각각 39 X 8 X 16 cm인 3개의 투명한 플라스틱 암(plastic arm)으로 구성되어 있으며, 각각에 대하여 120° 각도로 설정되어 있다. 첫 번째 실험에서 마우스는 start arm 과 other arm을 자유롭게 탐색할 수 있으며, 세 번째 암(arm)은 불투명한 문으로 막아두었다. 선호도와 관련된 오차를 피하기 위해 각 실험 그룹 내에서 무작위로 암(arm)에 할당하여 균형을 잡아 주었다. 그 후, 마우스는 2 분 동안 홈 케이지로 되돌렸다. 두 번째 실험에서는 마우스를 start arm 끝에 놓고 2분 동안 3 번째 암(arm)도 탐색 가능하도록 하였다. 미로는 각 탐색 단계 사이에 70% 에탄올 용액으로 청소하여 후각 신호를 제거하였다.
1-7. RT-PCR
RT-PCR은 TRizol 방법으로 total RNA를 추출하고 CycleScript Reverse Transcriptase(Bioneer, Daejoon, South Korea)를 사용하여 상보적인 DNA를 합성하였다. PCR 증폭은 Thermal cycler(Bio-rad lab, Hercules, USA)를 사용하였다. 모든 반응은 제조사의 프로토콜에 따라 SYBR Green I mix(Bioline, London, UK)와 함께 Light-cycler 2.0 instrument (Roche Diagnostics, Mannheim, Germany)를 사용하여 수행되었다. 증폭에 사용된 프라이머는 표 2에 나타내었다. 모든 프라이머에 대한 PCR 조건은 95℃에서 30초, 40 cycle 95℃에서 15초, 60℃에서 30초로 수행되었다. RT-qPCR 데이터는 표적 하우스키핑 유전자인 β-actin의 delta cycle threshold (ΔCT) 값으로 계산되었다.
Gene Sequence (5’→3’)
CD86 Forward GACCGTTGTGTGTGTTCTGG
Reverse GATGAGCAGCATCACAAGGA
NOS2 Forward CAGCTGGGCTGTACAAACCTT
Reverse CATTGGAAGTGAAGCGTTTCG
IL-12a Forward AAGCTCTGCATCCTGCTTCAC
Reverse GATAGCCCATCACCCTGTTGA
IL-1β Forward AAGCCTCGTGCTGTCGGACC
Reverse TGAGGCCCAAGGCCACAGG
IL-23 Forward CCTTCTCCGTTCCAAGATCCT
Reverse ACTAAGGGCTCAGTCAGAGTTGCT
IL-6 Forward TTCCATCCAGTTGCCTTCTTG
Reverse GGGAGTGGTATCCTCTGTGAAGTC
TNF-α Forward GGCAGGTTCTGTCCCTTTCAC
Reverse TTCTGTGCTCATGGTGTCTTTTCT
IL-4 Forward ATCCTGCTCTTCTTTCTCGAATGT
Reverse GCCGATGATCTCTCTCAAGTGATT
IL-10 Forward CAGCCGGGAAGACAATAACTG
Reverse CCGCAGCTCTAGGAGCATGT
TGF-β Forward GAGGTCACCCGCGTGCTA
Reverse TGTGTGAGATGTCTTTGGTTTTCTC
Arg1 Forward CTCCAAGCCAAAGTCCTTAGAG
Reverse AGGAGCTGTCATTAGGGACATC
Ym1 Forward TGGAGGATGGAAGTTTGGAC
Reverse GAGTAGCAGCCTTGGAATGT
Mrc1 Forward TTCGGTGGACTGTGGACGAGC
Reverse ATAAGCCACCTGCCACTCCGG
IL-21 Forward TGCTAGCTCCAGCCTCAGTCT
Reverse TTAAGTGCTGAACTTGTTTGGATTG
Trem2 Forward CTACCAGTGTCAGAGTCTCCGA
Reverse CCTCGAAACTCGATGACTCCTC
Tmem119 Forward GGATAGTGGACTTCTTCCGCCA
Reverse GGAAGGACGATGGGTAATAGGC
Cx3cr1 Forward GAGCATCACTGACATCTACCTCC
Reverse AGAAGGCAGTCGTGAGCTTGCA
Itgax Forward TGCCAGGATGACCTTAGTGTCG
Reverse CAGAGTGACTGTGGTTCCGTAG
Ccl6 Forward CACCAGTGGTGGGTGCATCAAG
Reverse GTGCTTAGGCACCTCTGAACTC
Csf1 Forward GCCTCCTGTTCTACAAGTGGAAG
Reverse ACTGGCAGTTCCACCTGTCTGT
β-Actin Forward GTGCTATGTTGCTCTAGACTTCG
Reverse ATGCCACAGGATTCCATACC
1-8. 웨스턴블롯세포를 4°C에서 20분 동안 proprep (iNtRON Biotechnology, Seongnam, South Korea)로 용해시켰다. 각 샘플의 단백질 농도는 Bradford 분석으로 결정되었으며, 샘플(단백질 30μg)을 10% SDS-폴리아크릴아미드 겔에서 분리하고 니트로셀룰로오스 멤브레인으로 옮기고 실온(20~25°C)에서 5% 탈지유에서 30분 동안 차단하였다. 차단 30분 후, 멤브레인을 4℃에서 밤새 배양하기 위해 1차 항체(항-CD86, 항-NOS2 또는 항-β-액틴)와 순차적으로 반응시켰다. 25mM Tris-Cl, 150mM NaCl 및 0.05% Tween-20을 포함하는 Tween 20(TBS-T)으로 tris-완충 식염수로 세척한 후, blot을 HRP가 결합된 이차 항체(anti-rabbit or anti-mouse IgG)와 2 시간 동안 인큐세이션 하였다. 면역반응성은 Western Blotting Detection Reagent Kit(Abclon, Seoul, South Korea)를 사용하여 시각화하였다. 항체 결합은 화학발광 검출 시스템(Davinch-Chemi, Seoul, South Korea)으로 측정하였다. Densitometric analysis는 Image J 소프트웨어를 사용하여 분석을 수행하였다.
1-9. 면역조직화학염색(IHC)
마우스를 아이소플루레인(isoflurane)으로 마취시킨 다음 차갑게 보관한 PBS을 경심관류(transcardially perfused) 시키고, PBS에 녹인 4% 파라포름알데히드 용액으로 고정하였다. 뇌는 제거하여 4% 파라포름알데히드 용액에 4°C에서 48시간동안 고정시킨 후, 30% surose/PBS 용액에 4°C에서 보관하였다. midline을 따라 뇌를 이등분한 후, 각 반구 뇌(hemi-brain)를 관상 절편(coronal section) 절개로 앞부분, 중앙부분, 뒷부분으로 나누었다. 각 부분은 Optimal Cutting Temperature(O.C.T.; WVR) 봉입제(mounting medium)에 개별적으로 내장되었고, 액체 질소에서 동결되어 -80°C에서 보관되었다. Leica RM2145 크라이오스탯(cryostat)을 사용하여 뇌 중앙부분으로부터 Cryosections(7 μm)를 준비하고, SuperFrost™ Plus 슬라이드 글라스에 장착하였다. 또한, 각 마우스에서 최소 3개의 인접하지 않은(100 μm 이상 떨어진) 섹션을 지정하였다. 각 섹션은 먼저 PBS로 세척한 후, PBS-5% BSA-0.05% Tween 20으로 실온에서 1 시간 동안 block시킨 다음, rabbit anti-Iba1 항체(1/200)(Wako) 와 4°C에서 밤새 인큐베이션하거나 rabbit anti-GFAP 항체(1/200)(Dako)와 실온에서 30 분 동안 인큐베이션 하였다. 섹션을 PBS-0.1% BSA로 3회 세척 후, mouse anti-CD11b(1/200)(ab8878; Abcam)와 실온에서 30 분 동안 인큐베이션하고, 3회 세척 후 Alexa Fluor® 488-conjugated goat anti-rat와 Alexa Fluor® 594-conjugated goat anti-goat 항체(1/1000 each)와 실온에서 30 분 동안 인큐베이션 하였다. 3회 세척된 뇌 섹션을 DAPI(1 μg/ml in PBS)로 염색시키고 Immu-Mount™ medium(ThermoShandon)로 커버슬립(coverslip)하였다. Zen2 (blue edition) 소프트웨어 및 공초점 형광 현미경(LSM800, Carl Zeiss)을 사용하여 이미지를 얻었다. 모든 필드/이미지에서 미세아교세포의 정량적 분석은 픽셀 intensity를 기반으로 분석되었으며, 세포는 Image J(National Institutes of Health)를 사용하여 계산하였다.
1-10. 통계적 분석
GraphPad Prism 소프트웨어(GraphPad, La Jolla, CA, United States)를 사용하여 통계 분석을 수행했다. Condition은 one-way ANOVA 분석 후 사후 그룹 비교(post hoc groug comparison)를 사용하여 비교했다. 데이터는 평균 ± SEM으로 표현되었고, P < 0.05는 유의한 것으로 간주되었다.
<실시예 2> 실험 결과
2-1. 알츠하이머병에서 Treg의 치료 효과
알츠하이머병에서 Treg의 치료 효과를 조사하기 위해 인간 조절 T 세포(hTreg)를 분리하고 ex vivo-expansion을 수행하였다(도 1). 확장된 hTreg는 10 ㎕ PBS 중 1×102 cells/mice, 1×103 cells/mice, 1×104 cells/mice 및 1×105 cells/mice의 세포 용량으로 3xTg AD 마우스에 척수강내(intrathecally)로 투여되었다. 대조군 마우스는 동일한 투여방법으로 PBS만 투여하였다.
수동 회피 실험 결과, 3xTg AD 마우스는 대기 시간동안 기억개선을 나타내지 않았다(도 2A). 이와 대조적으로, WT와 3xTg AD 마우스는 평균 잠재적 유지(retention latency) 기간의 차이는 통계적으로 유의한 결과에 도달하였다(도 2B). 훈련 지연(training latency) 또한 모든 hTreg 투여 그룹(102, 103, 104, 105)에서 유의한 차이를 보여주었다(각각 p = 0.0361, 0.0091, 0.0096, 0.0143).
이어서, 생후 10개월된 마우스는 단기 집중력 기억에 대해 평가되었다. Y maze 실험 결과, 모든 항목에서 WT와 비교하여 3xTg AD 마우스 그룹에서만 상당한 감소를 나타내었으며(도 2C), 변경행동력(spontaneous alteration) 변화의 경우, WT 마우스와 비교하여 3xTg AD 마우스 그룹에서 WT에 비해 유의한 변화가 나타났으며, 102 및 103 hTreg 그룹도 상당한 변화를 보였다(그림 2D). 이러한 결과는 hTreg의 투여가 알츠하이머병 마우스의 학습 및 기업 능력을 현저하게 향상시켰음을 의미한다.
2-2. M1 microglia 및 DAM(disease-associated microglia)에 대한 hTreg의 영향
먼저, 해마에서 M1 microglia mRNA 발현에 대한 hTreg의 직접적인 영향을 확인하기 위해 real-time qPCR을 수행하였다. 그 결과, NOS2, CD86, IL-12a, IL-1β, IL-1β, IL-23, IL-6 및 TNF-α의 발현이 3xTg AD 마우스에서 상승하였으나, hTreg가 투여된 마우스에서는 대조군인 WT 마우스와 유사하게 발현되는 것을 확인하였다(도 3).
해마에서 DAM(disease-associated microglia) 마커의 mRNA 발현을 확인하기 위해 real-time PCR을 수행하였다. 상기 실시예 2-1의 결과와 유사하게, DAM 마커는 3xTg AD 마우스에서 발현이 증가하는 것으로 나타났다. 그러나, hTreg는 Trem2, Tmem119, Cc3cr1, Itgax, Ccl6의 발현을 유의하게 억제하였다(도 4).
이어서, 우리는 또한 웨스턴 블롯으로 M1(도 5A), M2(도 5B) 미세아교세포 및 신경성장인자(도 5C) 및 DAM(도 5D)의 단백질 발현을 측정하였다. 3xTg AD 그룹에서 CD86의 발현 수준은 WT 그룹에 비해 증가하였다(p < 0.01). 해마에서 CD86의 단백질 발현 수준은 3xTg AD 그룹에 비해 모든 hTreg 투여군에서 감소하였다(도 5A, p < 0.01). NOS2, Arg1, CD206, Iba-1 및 BDNF 발현의 웨스턴 블롯 분석은 단백질 수준에서 유의한 변화를 나타내지 않았다(도 5B 및 C). 그러나 Trem2 발현은 3xTg에 비해 105 hTreg 주사군에서 유의하게 감소하였다(도 5D).
이러한 결과는 3xTg AD 마우스에서 M1 미세아교세포가 활성화되고, hTreg는 알츠하이머병에 의해 증가된 M1 미세아교세포 및 DAM 관련 마커의 발현을 억제시켜 M1 미세아교세포 활성화 및 DAM으로 진행을 억제한다는 것을 의미한다.
2-3. M2 microglia mRNA 발현에 대한 hTreg의 영향
해마에서 M2 microglia mRNA 발현에 대한 hTreg의 직접적인 영향을 확인하기 위해 real-time qPCR을 수행하였다. 그 결과, 상기 실시예 2-1의 결과와 대조적으로 M2 미세아교세포 관련 마커인 IL-4, IL-10, TGF-β, Arg1, Ym1, Mrc1, IL-2는 3xTg AD 마우스에서는 유의하게 감소하였다. 또한, 102 및 103 hTreg 투여 마우스에서는 IL-10의 발현을 유의하게 증가시키는 것으로 나타났다 (도 6).
2-4. CD116 및 Trem2에 대한 면역반응 분석
CD11b와 Trem2에 대한 면역반응은 해마 치아 이랑(hippocampal dentate gyrus, DG)에서 관찰되었다(도 7A). 특히, Trem2+ 세포는 3xTg AD 그룹에 비해 102 hTreg 투여군에서 유의하게 감소하였으나, 다른 실험군에서는 감소하지 않았다 (도 7C). CD116b+ 세포와 CD116b+Trem2+ 세포의 모든 실험군에서 유의한 변화는 관찰되지 않았다 (도 7B, D). 이러한 결과는 hTreg는 CD11b를 변화시키지 않고 Trem2를 선택적으로 억제했다는 것을 의미한다.
Trem2는 뇌속 면역세포인 미세아교세포(microglia)의 표면에 발현하는 수용체로, 미세아교세포가 완전한 DAM(disease-associated microglia)으로 진행되도록 하는 역할을 한다. 따라서, 이러한 결과를 통해 hTreg는 미세아교세포의 DAM(disease-associated microglia)으로 진행을 억제하는 효과가 있음을 알 수 있다.
2-5. 아밀로이드 베타 및 타우 단백질에 대한 Treg의 영향
Treg가 알츠하이머병의 진행에 어떻게 영향을 미치는지 이해하기 위해 Treg의 척수강내 투여가 AD 마우스 모델의 해마에서 타우 단백질의 인산화를 감소시킬 수 있는지 여부를 조사하였다.
구체적으로, hTreg 투여세포 수에 따른 p-Tau 발현 수준 변화를 확인하기 위해 10개월령 3xTg AD 마우스에 각각 1 × 102, 103, 104 hTregs 혹은 PBS를 주입하였다. 그 후 12개월령 마우스의 해마에서 인산화된 타우 단백질(p-Tau)에 대한 면역형광염색을 수행하였으며, 그 결과는 도 8 A,B에 나타내었다.
도 8A,B에 나타낸 바와 같이, 대조군 3xTg AD 마우스는 해마에서 인산화된 타우 단백질 수준이 유의하게 증가되었으며, hTreg 투여군의 경우 hTreg를 처리하지 않은 3xTg AD 마우스에 비해 인산화된 타우 단백질 수준이 크게 감소한 것으로 나타났다(도 8A,B). 특히 극소량인 1 × 102 hTregs 투여한 마우스에서도 p-Tau 발현 수준을 유의하게 감소시킨 것으로 확인되었다.
이러한 결과를 종합해보면, hTreg는 CNS(Central nervous system)의 선천 면역 세포로서 염증 과정의 항상성을 유지하고 인지 기능을 조절하는 미세아교세포의 M1 활성화를 억제하고 M2 분극화를 촉진시켜 타우 단백질 제거 및 신경 보호 작용을 유도한다. 따라서, 이러한 결과는 인간 조절 T 세포(hTreg)는 중추신경계 질환 특히, 퇴행성 뇌질환 예방 또는 치료용 조성물로 이용될 수 있다.

Claims (9)

  1. 조절 T 세포(regulatory T cell)를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 조절 T 세포는 인간 조절 T 세포(human regulatory T cell)인 것을 특징으로 하는, 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서,
    상기 조절 T 세포는 NOS2, CD86, IL-12a, IL-1β, IL-1β, IL-23, IL-6, TNF-α, Trem2, Tmem119, Cc3cr1, Itgax 및 Ccl6의 발현을 억제하는 것인, 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서,
    상기 조절 T 세포는 IL-4, IL-10, TGF-β, Arg1, Ym1, Mrc1, IL-2의 발현을 증가시키는 것인, 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물.
  5. 제1항에 있어서,
    상기 퇴행성 뇌질환은 알츠하이머병(Alzheimer's disease), 파킨슨병(Parkinson's disease), 치매(dementia), 진행성 핵상마비(Progressive supranuclear palsy), 다계통 위축증(Multiple system strophy), 감람핵-뇌교-소뇌 위축증(Olivopontocerebellar atrophy; OPCA), 샤이-드래거 증후군(Shy-Drager syndrome), 선조체-흑질 퇴행증 (Striatonigral degeneration), 헌팅톤병(Huntington's disease), 근위축성 측색 경화증(Amyotrophic lateral sclerosis; ALS), 본태성 진전증(Essential tremor), 피질-기저핵 퇴행증(Cortico-basal ganlionic degeneration), 미만성 루이 소체 질환(Diffuse Lewy body disease), 파킨스-ALS-치매 복합증(Parkinson-ALS-dementia complex of Guam) 및 픽병(Pick's disease)으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는, 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물.
  6. 제1항에 있어서,
    상기 조성물은 척수강내 투여용인 것을 특징으로 하는, 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물.
  7. 제1항의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 퇴행성 뇌질환의 예방 또는 치료 방법.
  8. 제7항에 있어서,
    상기 조절 T 세포는 인간 조절 T 세포(human regulatory T cell)인 것을 특징으로 하는, 퇴행성 뇌질환의 예방 또는 치료 방법.
  9. 제7항에 있어서,
    상기 약학적 조성물은 척수강 내 투여용인 것을 특징으로 하는, 퇴행성 뇌질환의 예방 또는 치료 방법.
PCT/KR2022/013610 2021-09-13 2022-09-13 조절 t 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물 WO2023038489A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0121783 2021-09-13
KR1020210121783 2021-09-13

Publications (1)

Publication Number Publication Date
WO2023038489A1 true WO2023038489A1 (ko) 2023-03-16

Family

ID=85506768

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/013610 WO2023038489A1 (ko) 2021-09-13 2022-09-13 조절 t 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR102596140B1 (ko)
WO (1) WO2023038489A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170127258A (ko) * 2016-05-11 2017-11-21 경희대학교 산학협력단 조절 t 세포를 유효성분으로 하는 퇴행성 뇌질환 예방 또는 치료용 세포치료제 조성물
KR20210004888A (ko) * 2019-07-04 2021-01-13 주식회사 굳티셀 T 세포의 세포 표면 항원 및 이의 다양한 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170127258A (ko) * 2016-05-11 2017-11-21 경희대학교 산학협력단 조절 t 세포를 유효성분으로 하는 퇴행성 뇌질환 예방 또는 치료용 세포치료제 조성물
KR20210004888A (ko) * 2019-07-04 2021-01-13 주식회사 굳티셀 T 세포의 세포 표면 항원 및 이의 다양한 용도

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, PERGAMON PRESS
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO.
BAEK HYUNJUNG, YE MINSOOK, KANG GEUN-HYUNG, LEE CHANJU, LEE GIHYUN, CHOI DA BIN, JUNG JAEHOON, KIM HYUNSEONG, LEE SEONHWA, KIM JIN: "Neuroprotective effects of CD4+CD25+Foxp3+ regulatory T cells in a 3xTg-AD Alzheimer’s disease model", ONCOTARGET, vol. 7, no. 43, 4 October 2016 (2016-10-04), pages 69347 - 69357, XP093043966, DOI: 10.18632/oncotarget.12469 *
DANSOKHO CIRA; AHMED DYLLA AIT; AID SABA; TOLY-NDOUR CECILE; CHAIGNEAU THOMAS; CALLE VANESSA; CAGNARD NICOLAS; HOLZENBERGER MARTIN: "REGULATORY T CELLS DELAY DISEASE PROGRESSION IN ALZHEIMER’S-LIKE PATHOLOGY", ALZHEIMER'S & DEMENTIA, ELSEVIER, NEW YORK, NY, US, vol. 12, no. 7, 1 January 1900 (1900-01-01), US , XP029769065, ISSN: 1552-5260, DOI: 10.1016/j.jalz.2016.06.432 *
MACHHI JATIN, KEVADIYA BHAVESH D., MUHAMMAD IJAZ KHAN, HERSKOVITZ JONATHAN, OLSON KATHERINE E., MOSLEY R. LEE, GENDELMAN HOWARD E.: "Harnessing regulatory T cell neuroprotective activities for treatment of neurodegenerative disorders", MOLECULAR NEURODEGENERATION, vol. 15, no. 1, 1 December 2020 (2020-12-01), XP093009924, DOI: 10.1186/s13024-020-00375-7 *

Also Published As

Publication number Publication date
KR20230039547A (ko) 2023-03-21
KR102596140B1 (ko) 2023-11-01

Similar Documents

Publication Publication Date Title
US20160022720A1 (en) Compositions and methods for treating disease states associated with activated t cells and/or b cells
KR20110093925A (ko) 항세균성 화합물
WO2014182051A1 (ko) Ａｓｍ 억제제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
WO2021230487A1 (ko) 양막상피세포 유래 엑소좀을 유효성분으로 함유하는 안구질환 예방 또는 치료용 조성물
WO2022131428A1 (ko) 오를리스타트 및 아커만시아 뮤시니필라 eb-amdk19 균주를 포함하는 조성물
WO2020235954A1 (en) Administration method and dosage regimen for treatment of neurodegenerative diseases using trametinib and markers
Kauffmann et al. Ocular Lyme disease: case report and review of the literature.
WO2023038489A1 (ko) 조절 t 세포를 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물
WO2019103436A9 (ko) Nk 세포 배양용 조성물 및 이를 이용하여 nk 세포를 배양하는 방법
WO2019031729A2 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 비알콜성 단순 지방간 또는 비알콜성 지방간염의 개선 용도
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2020116810A1 (ko) Ｆａｓ 신호전달 억제용 펩티드를 포함하는 비만, 지방간 또는 지방간염의 예방 또는 치료용 약학적 조성물
WO2022145656A1 (ko) 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 안질환 예방 또는 치료용 조성물
WO2023027317A1 (ko) 편도 중간엽 줄기세포 유래 엑소좀을 포함하는 근육 감소 관련 질환 치료용 조성물
WO2018034523A1 (ko) Jak 억제제를 포함하는 면역반응 억제용 조성물
WO2021149971A1 (ko) 신규 화합물 및 이의 용도
WO2022108165A1 (ko) 역분화 줄기세포 유래 중간엽 줄기세포로부터 분리된 엑소좀의 제조방법 및 이의 용도
WO2022119060A1 (ko) 불멸화 개 줄기세포 또는 이의 용도
WO2014193060A1 (ko) 인간골수유래 중간엽줄기세포와 미노사이클린 병용투여를 통한 다발성경화증 치료제 및 치료방법
WO2020096371A1 (ko) 신규 화합물 및 칼시뉴린 억제제를 포함하는 이식 거부 반응 또는 이식 거부 질환의 예방 및 치료용 조성물
WO2024090922A1 (ko) 줄기세포 배양액 및 상기로부터 분리된 세포외소포를 유효성분으로 포함하는 뇌신경계 질환의 예방 또는 치료용 약학적 조성물
US20210023074A1 (en) Treatment of demyelinating diseases
WO2022231080A1 (ko) 옥시캄계 화합물을 포함하는 근육 질환의 예방 또는 치료용 조성물
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
WO2022244929A1 (ko) 이노토디올을 포함하는 근육 질환의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22867757

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022867757

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022867757

Country of ref document: EP

Effective date: 20240415