WO2022119060A1 - 불멸화 개 줄기세포 또는 이의 용도 - Google Patents

불멸화 개 줄기세포 또는 이의 용도 Download PDF

Info

Publication number
WO2022119060A1
WO2022119060A1 PCT/KR2021/004674 KR2021004674W WO2022119060A1 WO 2022119060 A1 WO2022119060 A1 WO 2022119060A1 KR 2021004674 W KR2021004674 W KR 2021004674W WO 2022119060 A1 WO2022119060 A1 WO 2022119060A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
immortalized
canine
exosome
culture medium
Prior art date
Application number
PCT/KR2021/004674
Other languages
English (en)
French (fr)
Inventor
김윤배
최은경
Original Assignee
충북대학교 산학협력단
주식회사 디자인셀
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단, 주식회사 디자인셀 filed Critical 충북대학교 산학협력단
Publication of WO2022119060A1 publication Critical patent/WO2022119060A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/20—Animal feeding-stuffs from material of animal origin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/01—DNA viruses
    • C07K14/025—Papovaviridae, e.g. papillomavirus, polyomavirus, SV40, BK virus, JC virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/02—Atmosphere, e.g. low oxygen conditions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/25—Tumour necrosing factors [TNF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C12N2510/04—Immortalised cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Definitions

  • the present invention relates to immortalized canine stem cells or uses thereof, and more particularly, to immortalized canine stem cells obtained by transducing and differentiating canine stem cells with a lentiviral vector containing papillomavirus E6 and E7 genes, and uses thereof will be.
  • OA degenerative osteoarthritis
  • RA inflammatory rheumatoid arthritis
  • Osteoarthritis is a disease in which joint cartilage is degeneratively worn by load with age, causing pain as the surface of the bone collides, and the head grows sideways to form an osteophyte, which causes movement disorders.
  • rheumatoid arthritis causes severe swelling and pain by infiltrating inflammatory cells into the joint cavity and proliferating an inflammatory synovial membrane to form a pannus, and causes movement disorders due to deformation and union of the articular head. This inflammatory response is sometimes extended to systemic chronic inflammatory diseases that invade several organs in addition to the joints.
  • rheumatoid arthritis has not yet been clearly identified, it is currently reported that it is an autoimmune disease that is caused by the biased differentiation of immune cells by genetic and environmental factors.
  • corticosteroids which are nitric oxide synthase (NOS) inhibitors
  • non-steroidal anti-inflammatory drugs which are COX-II inhibitors
  • NOS nitric oxide synthase
  • NSAIDs non-steroidal anti-inflammatory drugs
  • COX-II inhibitors are widely used for the treatment of inflammatory diseases such as atopic dermatitis or rheumatoid arthritis.
  • steroids when used for a long period of time, steroids are less effective and can cause serious side effects that suppress immune function.
  • Non-steroidal anti-inflammatory drugs temporarily relieve pain and inflammation, but have limitations in fundamental treatment and cause secondary side effects such as gastric ulcer.
  • stem cells can be used for the treatment of various diseases.
  • the development of various therapeutic agents using stem cells is actively progressing.
  • stem cells for cell therapy by repeatedly collecting and proliferating from a patient. Therefore, if a stem cell line that can be used continuously is established by immortalizing the stem cells once collected, the cost of the procedure is reduced by not collecting the stem cells repeatedly, and the specificity of the stem cells can be maintained continuously. It is possible to solve problems such as a decrease in the proliferative capacity of stem cells when repeatedly cultured.
  • Embryonic stem cells originate from the inner cells of the embryo and can be differentiated into any cell in the body, but they can develop into tumors, so there are still many technical problems to be solved before being used as a therapeutic agent.
  • adult stem cells can be obtained from mature individuals and have the advantage of being utilized without the risk of tumor development.
  • Adult stem cells can be obtained from bone marrow, umbilical cord blood, and adipose tissue.
  • Another object of the present invention is to provide an immortalized canine stem cell or use of the canine stem cell culture medium.
  • the present invention provides immortalized canine stem cells transduced with E6 and E7 genes of papillomavirus (HPV).
  • the present invention provides an exosome-rich conditioned medium (ERCM) obtained by culturing the immortalized dog stem cells.
  • ERCM exosome-rich conditioned medium
  • the present invention provides a veterinary composition for preventing or treating inflammatory diseases comprising, as an active ingredient, any one or more selected from the group consisting of immortalized dog stem cells and an exosome-rich culture medium according to the present invention.
  • the present invention provides a feed additive comprising, as an active ingredient, any one or more selected from the group consisting of immortalized dog stem cells and an exosome-rich culture medium according to the present invention.
  • the present invention provides for the prevention and improvement of inflammatory diseases in animals other than humans, comprising administering to animals other than humans any one or more selected from the group consisting of immortalized dog stem cells and an exosome-rich culture medium according to the present invention or a method of treatment.
  • the present invention provides any one or more uses selected from the group consisting of immortalized canine stem cells according to the present invention and an exosome-enriched culture medium for use in the manufacture of a veterinary medicament for the prevention or treatment of inflammatory diseases.
  • the immortalized canine stem cells of the present invention can be obtained by transducing human papillomavirus E6 and E8 genes into canine stem cells, thereby obtaining canine stem cells with the same characteristics and efficacy without repeated stem cell collection, and the immortalized dog stem cells Exosome-rich culture medium (ERCM), which is a culture medium of cells and the stem cells, exhibits excellent effects such as suppression of systemic shock reaction due to allergy, alleviation of itching due to atopic dermatitis, suppression of increase in histamine, improvement of clinical symptoms due to rheumatoid arthritis, etc. It can be usefully used in the treatment of various inflammatory diseases including these diseases.
  • ERCM Exosome-rich culture medium
  • FIG. 1 is a schematic diagram showing a vector for transducing E6 and E7 genes of HPV for immortalization of canine stem cells.
  • FIG. 2 is a schematic diagram showing a method for immortalizing canine stem cells.
  • FIG. 3 is a view showing the results of confirming immortalized dog stem cells by microscopic observation (A), RT-PCT (B) and immunostaining (C).
  • 4 is a graph showing the change in survival rate when immortalized dog stem cells are cultured at normoxic concentration and hypoxic concentration.
  • CM normal culture medium
  • ERCM exosome-rich culture medium
  • FIG. 6 is a graph showing the results of confirming the itch inhibitory effect of immortalized dog stem cells due to atopic dermatitis.
  • FIG. 7 is a graph showing the results of confirming the inhibitory effect of immortalized dog stem cells on the increase of histamine in blood due to atopic dermatitis.
  • FIG. 8 is a graph showing the results of confirming the skin lesion alleviation effect due to atopic dermatitis of immortalized dog stem cells.
  • 9 is a graph of the results of visually confirming the symptom relief effect of rheumatoid arthritis of immortalized dog stem cells.
  • FIG. 10 is a graph showing the results of confirming the effect of immortalized dog stem cells in alleviating histopathological abnormalities caused by rheumatoid arthritis.
  • 11 is a graph showing the microscopic effect of immortalized canine stem cells for alleviating arthritis symptoms caused by rheumatoid arthritis.
  • the present invention provides immortalized canine stem cells transduced with E6 and E7 genes of papillomavirus (HPV).
  • stem cell refers to a cell that has not been differentiated into a specific cell, and, if necessary, has the ability to differentiate into all types of cells constituting the body, such as nerves, skin, blood, muscle, bone, and cartilage.
  • cells that have The stem cells may include all types of stem cells known in the art, for example, may be mesenchymal stem cells.
  • the stem cells may include any tissue derived from any tissue as long as the stem cells can be obtained.
  • the stem cells may be adipose stem cells derived from fat.
  • the canine stem cells may be immortalized by transducing E6 and E7 genes of papillomavirus.
  • the E6 and E7 genes may include all E6 and E7 genes known in the art. Specifically, the E6 and E7 genes may be composed of nucleotide sequences encoding the amino acid sequences set forth in SEQ ID NOs: 1 and 3, respectively, and more specifically, the E6 and E7 genes are nucleotide sequences set forth in SEQ ID NOs: 2 and 4, respectively. can be configured.
  • the E6 and E7 genes can induce the immortalization of canine stem cells by promoting the activation of the hTERT promoter and telomerase.
  • the E6 and E7 genes may be transduced into stem cells by methods known in the art. Specifically, the transduction can be performed by introducing an expression vector expressing E6 and E7 genes into stem cells in a conventional manner. The transduction may be performed by an appropriate method by a person skilled in the art, and may also be performed by a modified method if necessary. In one embodiment of the present invention, the E6 and E7 genes may be inserted into a viral vector and transduced into stem cells.
  • the viral vector may be a lentiviral vector or a retroviral vector.
  • the lentiviral vector may insert a target gene into the genome during disintegration of the nuclear membrane that occurs during cell division.
  • the lentiviral vector can actively pass through the nuclear membrane and insert the target gene into the genome, so that the target gene can be transduced not only in dividing cells but also in non-dividing cells.
  • the viral vector may be prepared as a viral particle for delivery of a target gene.
  • the viral particle may contain a protein necessary for the production of the recombinant virus.
  • the immortalized dog stem cells according to the present invention were deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center as of November 26, 2020 under the deposit number KCTC14389BP.
  • the present invention provides an exosome-rich conditioned medium (ERCM) obtained by culturing the immortalized dog stem cells.
  • ERCM exosome-rich conditioned medium
  • Exosomes are small-sized (30-150 nm) vesicles containing sophisticated RNA and protein transporters, and refer to membrane-structured vesicles secreted from various types of cells.
  • the exosome-rich culture medium may be a culture medium obtained by culturing immortalized dog stem cells having the characteristics as described above.
  • the culture medium may be obtained by culturing immortalized dog stem cells according to a method well known in the art.
  • the culture medium may be cultured at a low oxygen concentration using a culture medium containing TNF- ⁇ .
  • the TNF- ⁇ may be added in an appropriate amount by a person skilled in the art.
  • the low oxygen concentration may be a low oxygen concentration of 1 to 5%.
  • the present invention provides a veterinary composition for preventing or treating inflammatory diseases comprising, as an active ingredient, any one or more selected from the group consisting of immortalized dog stem cells and an exosome-rich culture medium according to the present invention.
  • the culture medium rich in immortalized dog stem cells and exosomes contained in the veterinary composition according to the present invention may have the characteristics as described above.
  • the immortalized canine stem cells may be transduced with papillomavirus E6 and E7 genes.
  • the immortalized dog stem cells may be deposited under the accession number KCTC14389BP.
  • the exosome-rich culture medium may be a culture medium of immortalized dog stem cells according to the present invention.
  • the culture medium may be cultured under a low oxygen concentration using a culture medium containing TNF- ⁇ .
  • the veterinary composition can be used to prevent or treat inflammatory diseases in all non-human animals known in the art.
  • the veterinary composition may be for canine animals.
  • the inflammatory disease may include any inflammatory disease known to occur in mammals other than humans.
  • the inflammatory disease is atopic dermatitis, dermatitis, encephalitis, inflammatory enteritis, chronic obstructive pulmonary disease, septic shock, pulmonary fibrosis, undifferentiated spondyloarthropathies, undifferentiated arthropathy, arthritis, inflammatory osteolysis, chronic viral or bacterial Chronic inflammatory disease caused by infection, colitis, inflammatory bowel disease, type 1 diabetes, rheumatoid arthritis, reactive arthritis, osteoarthritis, degenerative arthritis, psoriasis, scleroderma, osteoporosis, atherosclerosis, myocarditis, endocarditis, pericarditis, cystic Fibrosis, Hashimoto's Thyroiditis, Graves' Disease, Leprosy, Syphilis, Lyme, Borreliosis, Neuro-Borreliosis, Tuberculosis, Sarco
  • the veterinary composition for the prevention or treatment of inflammatory diseases is a powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. oral formulations, sterile injections, according to conventional methods for each purpose of use. It can be formulated and used in various forms, such as a solution, and can be administered through various routes including oral administration, intravenous, intraperitoneal, subcutaneous, rectal, topical administration, and the like.
  • Suitable carriers, excipients and diluents that may be included in the veterinary composition according to the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.
  • the veterinary composition according to the present invention may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier, a preservative, and the like.
  • the present invention provides a feed additive comprising, as an active ingredient, any one or more selected from the group consisting of immortalized dog stem cells and an exosome-rich culture medium according to the present invention.
  • the culture medium rich in immortalized dog stem cells and exosomes contained in the feed additive according to the present invention may have the characteristics as described above.
  • the immortalized canine stem cells may be transduced with papillomavirus E6 and E7 genes.
  • the immortalized dog stem cells may be deposited under the accession number KCTC14389BP.
  • the exosome-rich culture medium may be a culture medium of immortalized dog stem cells according to the present invention.
  • the culture medium may be cultured under a low oxygen concentration using a culture medium containing TNF- ⁇ .
  • the feed additive may be used to prevent or improve inflammatory diseases in all animals except humans known in the art.
  • the animal other than a human may be a canine animal.
  • the feed additive may have anti-inflammatory activity.
  • the feed additive may further include a carrier acceptable to the unit animal.
  • the feed additive may include the immortalized dog stem cells and exosome-rich culture medium according to the present invention as it is, or may further include a known carrier, stabilizer, and the like.
  • various nutrients such as vitamins, amino acids, and minerals, antioxidants, and other additives may be added as needed.
  • the feed additive may be prepared in a suitable form such as powder, granule, pellet, suspension, and the like.
  • the feed additive may be supplied alone or mixed with other feed.
  • the present invention provides for the prevention and improvement of inflammatory diseases in animals other than humans, comprising administering to animals other than humans any one or more selected from the group consisting of immortalized dog stem cells and an exosome-rich culture medium according to the present invention or a method of treatment.
  • the culture medium rich in immortalized dog stem cells and exosomes used in the method for preventing, improving or treating inflammatory diseases in animals other than humans according to the present invention may have the characteristics as described above.
  • the immortalized canine stem cells may be transduced with papillomavirus E6 and E7 genes.
  • the immortalized dog stem cells may be deposited under the accession number KCTC14389BP.
  • the exosome-rich culture medium may be a culture medium of immortalized dog stem cells according to the present invention.
  • the culture medium may be cultured under a low oxygen concentration using a culture medium containing TNF- ⁇ .
  • the mammals other than humans may be canines.
  • the inflammatory disease may have the characteristics as described above.
  • the administration may be administered by administering the immortalized dog stem cell or exosome-rich culture according to the present invention as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple have.
  • the pharmaceutically effective amount of the administration may vary depending on the age, sex, and weight of the individual, in general, the stem cells are 100 to 200 million cells per individual, and the exosome-rich culture medium is 1 to 50 per kg of body weight. mg may be administered daily or every other day, or divided into several times a day.
  • the dosage since the dosage may be increased or decreased depending on the route of administration, disease severity, sex, weight, age, etc., the dosage does not limit the scope of the present invention in any way.
  • the administration may be administered orally or parenterally according to a desired method.
  • Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection.
  • the present invention provides any one or more uses selected from the group consisting of immortalized canine stem cells according to the present invention and an exosome-enriched culture medium for use in the manufacture of a veterinary medicament for the prevention or treatment of inflammatory diseases.
  • the culture medium rich in immortalized canine stem cells and exosomes used for the use according to the present invention may have the characteristics as described above.
  • the immortalized canine stem cells may be transduced with papillomavirus E6 and E7 genes.
  • the immortalized dog stem cells may be deposited under the accession number KCTC14389BP.
  • the exosome-rich culture medium may be a culture medium of immortalized dog stem cells according to the present invention.
  • the culture medium may be cultured under a low oxygen concentration using a culture medium containing TNF- ⁇ .
  • the veterinary drug may target animals other than humans, and specifically may target canine animals.
  • the inflammatory disease may have the characteristics as described above.
  • Adipose tissue was collected from a two-year-old healthy male Pomeranian dog, and adipose stem cells were isolated and cultured according to the method already presented in the reference. Meanwhile, a lentivirus was produced by a conventional method using the lentiviral vector (abm, Canada) according to FIG. 1 expressing the E6 gene (SEQ ID NO: 2) and the E7 gene (SEQ ID NO: 4) of HPV16.
  • the prepared adipose stem cells were cultured to 70% in a 60 mm 2 culture dish, and then cultured by adding 1 ml of culture medium, 2 ml of lentivirus and 5 ⁇ g/ml of polybrene (Sigma-Aldrich).
  • FIG. 3A The result of observing the morphology of the prepared immortalized dog stem cells under a microscope is shown in FIG. 3A.
  • the immortalized dog stem cells have a slightly shorter cell length and a reduced cell division cycle, thereby increasing the growth rate.
  • RNA was extracted from the cultured cells using trizol (Terizol, Thermo Fisher Scientific, USA). 2 ⁇ g of RNA was used as a template and cDNA was synthesized using dT primer and TOP scriptTM reverse transcriptase.
  • Introduction of E6 and E7 genes of HPV was confirmed by performing RT-PCR using the synthesized cDNA and primers as shown in Table 1 below. At this time, RT-PCR was performed using a mixture of 10 ⁇ l of 2 ⁇ enzyme mastermix, 10 ⁇ l of RNase-free distilled water, 1 ⁇ l of forward and reverse primers, and 1 ⁇ l of template cDNA as shown in Table 2 below. The conditions were as described. As a result, the results of confirming the expression of the E6 and E7 genes are shown in FIG. 3B, and the ⁇ -actin gene was used as a control.
  • the prepared immortalized canine stem cells were dispensed on a 4 well chamber slide, and cultured at 37° C. and 5% CO 2 conditions to stabilize them. Stabilized cells were treated with 4% paraformaldehyde to fix them, and permeability was enhanced by adding 0.25% Triton-X 100 and reacting for 20 minutes. Thereafter, 1% BSA (bovine serum albumin) was added to pre-treat for 2 hours, and a primary antibody was added to react at 4° C. overnight. After the reaction was completed, the cells were washed with PBS, treated with a secondary antibody, and then nuclear staining was performed in a conventional manner. In this case, the antibodies described in Table 3 below were used. As a result, the result of observing the stained cells using a fluorescence microscope (Eclipse Ti-S, Nikon, Tokyo, Japan) at a magnification of 600 times is shown in FIG. 3C.
  • HPV E6 and E7 proteins in immortalized canine stem cells were confirmed by fluorescence.
  • the viability of the immortalized canine stem cells prepared above was confirmed as follows.
  • the control cells non-immortalized stem cells, proliferated nearly double (188%) for 2 days at normoxic concentration, but mostly died (17%) at hypoxic concentration.
  • the immortalized stem cells proliferated more than twice (225%) even at the normal oxygen concentration, showing a faster proliferation rate, and showed a proliferation rate of 152% even at the low oxygen concentration. Therefore, it was confirmed from the above that the immortalized canine stem cells according to the present invention showed a significantly rapid proliferation rate at normal or hypoxic concentration.
  • immortalized dog stem cells were cultured under an oxygen concentration of 21%, or treated with TNF- ⁇ and cultured at an oxygen concentration of 3%. Thereafter, the culture medium was taken and the exosome content and CD9 gene expression level were analyzed by RT-PCR, and the results are shown in FIG. 5 .
  • CD9 was significantly higher when the immortalized canine stem cells were cultured under a hypoxic concentration of TNF- ⁇ (ERCM), compared to when cultured (CM) under a normal oxygen concentration of 21%. was high as
  • an exosome-rich conditioned medium (ERCM) could be prepared by treating immortalized dog stem cells with TNF- ⁇ .
  • mice were divided into 9 groups, and as shown in Table 4 below, normal canine stem cells, immortalized canine stem cells, normal culture medium (CM), or exosome-enriched culture medium were intraperitoneally injected. 30 minutes after the injection, a lethal dose of compound 48/80 (8 mg/5 ml/kg) was injected intraperitoneally, and the mortality of the animals was confirmed for 60 minutes. As a result, the mouse mortality of each group is shown in Table 4 below.
  • mice administered with immortalized dog stem cells or a culture medium rich in exosomes thereof had a lower mortality rate than the mice administered the normal canine stem cells, which was decreased in a dose-dependent manner of the immortalized canine stem cells. In particular, it showed a better effect when the exosome-rich culture was administered than when the immortalized dog stem cells were administered.
  • compound 48/80 was administered and all mice died for 60 minutes.
  • the atopic therapeutic effect of the prepared immortalized dog stem cells was confirmed by observing the degree of itch inhibition, serum histamine concentration, and skin tissue.
  • mice were treated with 3 ⁇ 10 4 cells of normal canine stem cells (cADMSC), 3 ⁇ 10 4 cells of im-cADMSC treated group, 100 ⁇ l of normal culture medium, 100 ⁇ l of exo.
  • cADMSC normal canine stem cells
  • im-cADMSC treated group 100 ⁇ l of normal culture medium
  • exo 100 ⁇ l of exo.
  • Each drug was subcutaneously injected as described above, divided into 6 groups: a small rich culture treatment group, a compound 48/80 (50 ⁇ g/50 ⁇ l/site) treatment group, and an untreated group. Thereafter, the number of times of scratching for 30 minutes was checked, and the results are shown in FIG. 6 .
  • the mouse exhibited the number of scratching 78 times for 30 minutes, whereas the immortalized dog stem cell treatment group exhibited the number of scratching 28 times, indicating that itching was relieved. This was significant compared to the normal dog stem cell treatment group. On the other hand, it was confirmed that the exosome-rich culture medium treatment group also had a better anti-itching effect than the normal culture medium treatment group.
  • the concentration of serum histamine increased by the administration of compound 48/80 was significantly decreased by the administration of immortalized dog stem cells. This was even better compared to the group administered with normal dog stem cells, and the culture medium rich in exosomes also showed a more significant effect compared to the normal culture medium.
  • the skin tissues of 6 groups of mice of Experimental Example 2-1 were collected, tissue slides were prepared in a conventional manner, and the results of scoring the skin lesions are shown in FIG. 8 .
  • mice induced by atopic dermatitis by administration of compound 48/80 exhibited severe skin lesions, which were alleviated by administration of immortalized dog stem cells. This effect was even better compared to the group administered with normal dog stem cells, and the culture medium rich in exosomes also showed a more significant effect compared to the normal culture medium.
  • the culture medium rich in immortalized dog stem cells and exosomes of the present invention can be usefully used for the treatment of atopic dermatitis.
  • a mouse animal model induced with rheumatoid arthritis was treated with an immortalized dog stem cell or exosome-enriched culture medium, and the therapeutic effect of rheumatoid arthritis was observed with the naked eye or a microscope.
  • the average score was 2.8 on the 45th day, and no mice showing severe edema or joint stiffness were found. This was superior to the case of administration of normal dog stem cells, and the culture medium rich in exosomes also showed a more significant effect compared to the normal culture medium.
  • mice On day 45 from the first administration of collagen-II, necropsy of the mice was performed. Specifically, the mice were anesthetized by inhalation with ether, blood was collected from the abdominal vena cava, and the hind legs were excised. The excised leg was fixed in 10% formalin solution for 1 week, and after demineralization for 1 week again, tissue slides were prepared in a conventional manner. The prepared tissue slides were stained with hematocillin & eosin (H&E). The result of confirming histopathological abnormality by observing it under an optical microscope is shown in FIG.
  • H&E hematocillin & eosin
  • mice administered with collagen-II severe infiltration of inflammatory cells inside and outside the joint cavity and deformation and union of joint bones due to pannus formation were observed.
  • arthritis symptoms were alleviated by treatment with immortalized canine stem cells.
  • the inflammatory response inside and outside the joint was significantly alleviated, and in particular, there was almost no deformation of the articular bone marrow.
  • only local inflammation was confirmed in some animals, but the overall structure of the joint was moderately preserved. This was superior to the case of administration of normal dog stem cells, and the culture medium rich in exosomes also showed a more significant effect compared to the normal culture medium.
  • the arthritis index evaluation result was an average of 2.78 points in the collagen-II-induced arthritis group, but when the immortalized dog stem cells were administered, inflammation and joint deformation were greatly alleviated, resulting in 0.44 points. Confirmed. This was superior to the case of administration of normal dog stem cells (1.11 points), and the culture medium rich in exosomes also showed a more significant effect compared to the normal culture medium.
  • the culture medium rich in immortalized dog stem cells and exosomes of the present invention can be usefully used for the treatment of rheumatoid arthritis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Developmental Biology & Embryology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • Rheumatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Hematology (AREA)
  • Pain & Pain Management (AREA)
  • Epidemiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Dermatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Physiology (AREA)

Abstract

본 발명은 불멸화 개 줄기세포 또는 이의 용도에 관한 것으로, 구체적으로 개 줄기세포에 HPV16의 E6 및 E7 유전자를 포함하는 렌티바이러스 벡터를 형질도입하고 분화시켜 얻은 불멸화 개 줄기세포와 이의 용도에 관한 것이다. 구체적으로, 본 발명의 불멸화 개 줄기세포는 개 줄기세포에 인간 파필로마바이러스 E6 및 E8 유전자를 형질도입함으로써, 반복적인 줄기세포 채취 없이 동일 특성 및 효능을 가진 개 줄기세포를 수득할 수 있으며, 상기 불멸화 개 줄기세포 및 상기 줄기세포의 배양액인 엑소좀 풍부 배양액(ERCM)은 알레르기에 의한 전신성 쇼크반응 억제, 아토피 피부염에 의한 가려움증 완화 및 히스타민의 증가 억제, 류마티스 관절염에 의한 임상증상 개선 등에 우수한 효과를 나타냄으로써, 이들 질환을 포함하는 다양한 염증성 질환의 치료에 유용하게 사용될 수 있다.

Description

불멸화 개 줄기세포 또는 이의 용도
본 발명은 불멸화 개 줄기세포 또는 이의 용도에 관한 것으로, 구체적으로 개 줄기세포에 파필로마바이러스의 E6 및 E7 유전자를 포함하는 렌티바이러스 벡터를 형질도입하고 분화시켜 얻은 불멸화 개 줄기세포와 이의 용도에 관한 것이다.
최근 피부질환이 도시인과 반려동물에서 매우 증가하고 있다. 그에 따라, 감염성 피부질환은 물론, 미세먼지 등의 환경오염 물질과 건조한 기후, 꽃가루, 집안의 카펫에 서식하는 진드기와 같이 직접적으로 접촉성 피부질환을 유발하거나 면역 과민반응을 유발하는 다양한 알레르기원(allergen)에 노출되는 경향이 증가하였다. 특히, 반려동물은 외부에서 흙이나 잔디밭에서 뒹굴기도 하고, 서로 싸우기도 하며, 쓰레기통 등 환경오염 물질에 노출될 기회가 많아 피부염 발생이 빈번하다. 더욱이 반려동물 중 개는 수명이 10~15년으로 10세 이상에서는 감염병, 피부염, 관절염, 호흡기질병 등과 같은 염증성 질환으로 고통받기도 한다.
관절염은 퇴행성 골관절염(osteoarthritis, OA)과 염증성 류마티스 관절염(rheumatoid arthritis, RA)으로 구별된다. 골관절염은 나이가 들어감에 따라 하중에 의해 관절 연골이 퇴행성으로 마모되면서 뼈의 표면이 부딪히면서 통증을 유발하고, 골두가 옆으로 자라 골증식체(osteophyte)가 형성되어 운동장애를 유발하는 질환이다. 반면에, 류마티스 관절염은 관절강 내로 염증세포가 침윤되면서 염증성 활막(synovial membrane)이 증식하여 판누스(pannus)를 형성함으로써 심하게 붓고 통증이 유발되며, 관절골두의 변형 및 유합으로 운동장애를 유발한다. 이러한 염증반응은 관절 이외에도 여러 장기를 침범하는 전신성 만성 염증성 질환으로 확대되기도 한다. 류마티스 관절염의 원인은 아직 명확히 밝혀지지는 않았으나 현재는 자가면역 질환의 일종으로 유전적 및 환경적 요인에 의한 면역세포의 편향된 분화가 그 원인인 것으로 보고되고 있다.
따라서, 아토피 피부염이나 류마티스 관절염과 같은 염증성 질환의 치료를 위해 NOS(nitric oxide synthase) 억제제인 스테로이드(corticosteroids)와 COX-II 억제제인 비스테로이드성 소염제(non-steroidal anti-inflammatory drug, NSAID)가 널리 사용되고 있다. 하지만 스테로이드는 장기간 사용 시 효과가 떨어지고 면역기능을 억제하는 심각한 부작용을 유발할 수 있으며, 비스테로이드성 소염제는 일시적인 통증과 염증을 완화시켜 주지만 근본적인 치료에는 한계가 있고 위궤양 등 2차적인 부작용을 야기한다.
한편, 최근에는 줄기세포(stem cell)가 다양한 질환의 치료에 사용될 수 있다는 잠재적 가능성이 알려지면서, 줄기세포를 이용한 다양한 치료제의 개발이 활발히 진행되고 있다. 그러나, 줄기세포를 이용한 세포 치료제는 환자로부터 반복적으로 채취하여 증식시켜 사용해야 하는 어려움이 있다. 따라서 한 번 채취한 줄기세포를 불멸화하여 계속 사용할 수 있는 줄기세포주(stem cell line)를 확립하면, 줄기세포를 반복적으로 채취하지 않아 시술비용이 감소하고, 줄기세포의 특정을 지속적으로 유지할 수 있으며, 반복 배양하였을 때 줄기세포의 증식능 저하 등의 문제를 해결할 수 있다.
세포 이식에 사용되는 줄기세포는 크게 배아줄기세포와 성체줄기세포로 구분된다. 배아줄기세포는 배아의 내부 세포(inner cell)에서 기원하며 체내의 모든 세포로 분화할 수 있지만 종양으로 발전할 수 있어서 아직 치료제로 사용하기에는 기술적으로 풀어야 할 문제가 많이 남아 있다. 반면, 성체줄기세포는 성숙한 개체에서 얻을 수 있으며, 종양발생 위험이 없이 활용할 수 있는 장점이 있다. 성체줄기세포는 골수, 제대혈, 지방조직 등에서 얻을 수 있다
본 발명의 목적은 불멸화 개 줄기세포 또는 상기 개 줄기세포 배양액을 제공하는 것이다.
본 발명의 다른 목적은 불멸화 개 줄기세포 또는 상기 개 줄기세포 배양액의 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 파필로마바이러스(HPV)의 E6 및 E7 유전자가 형질도입된 불멸화 개 줄기세포를 제공한다.
또한, 본 발명은 상기 불멸화 개 줄기세포를 배양하여 수득된 엑소좀 풍부 배양액(exosome-rich conditioned medium, ERCM)을 제공한다.
또한, 본 발명은 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 수의학적 조성물을 제공한다.
또한, 본 발명은 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 포함하는 사료첨가제를 제공한다.
또한, 본 발명은 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 인간을 제외한 동물에 투여하는 단계를 포함하는 인간을 제외한 동물에서 염증성 질환의 예방, 개선 또는 치료 방법을 제공한다.
나아가, 본 발명은 염증성 질환의 예방 또는 치료를 위한 수의학적 약제의 제조에 사용하기 위한 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상의 용도를 제공한다.
본 발명의 불멸화 개 줄기세포는 개 줄기세포에 인간 파필로마바이러스 E6 및 E8 유전자를 형질도입함으로써, 반복적인 줄기세포 채취 없이 동일 특성 및 효능을 가진 개 줄기세포를 수득할 수 있으며, 상기 불멸화 개 줄기세포 및 상기 줄기세포의 배양액인 엑소좀 풍부 배양액(ERCM)은 알레르기에 의한 전신성 쇼크반응 억제, 아토피 피부염에 의한 가려움증 완화 및 히스타민의 증가 억제, 류마티스 관절염에 의한 임상증상 개선 등에 우수한 효과를 나타냄으로써, 이들 질환을 포함하는 다양한 염증성 질환의 치료에 유용하게 사용될 수 있다.
도 1은 개 줄기세포의 불멸화를 위해 HPV의 E6 및 E7 유전자를 형질도입하기 위한 벡터를 나타내는 모식도이다.
도 2는 개 줄기세포를 불멸화하는 방법을 나타내는 모식도이다.
도 3은 불멸화 개 줄기세포를 현미경 관찰(A), RT-PCT(B) 및 면역염색(C) 방법으로 확인한 결과 도면이다.
도 4는 불멸화 개 줄기세포를 정상 산소농도와 저산소농도에서 배양하였을 때 생존율 변화를 나타낸 그래프이다.
도 5는 정상 배양액(CM) 및 엑소좀 풍부 배양액(ERCM) 내 엑소좀 함량을 CD9 지표에 대한 RT-PCR 분석방법으로 확인한 결과이다.
도 6은 불멸화 개 줄기세포의 아토피 피부염에 의한 가려움증 억제 효과를 확인한 결과 그래프이다.
도 7은 불멸화 개 줄기세포의 아토피 피부염에 의한 혈액 내 히스타민 증가 억제 효과를 확인한 결과 그래프이다.
도 8은 불멸화 개 줄기세포의 아토피 피부염에 의한 피부병변 완화 효과를 확인한 결과 그래프이다.
도 9는 불멸화 개 줄기세포의 류마티스 관절염에 의한 증상 완화 효과를 육안으로 확인한 결과 그래프이다.
도 10은 불멸화 개 줄기세포의 류마티스 관절염에 의한 조직병리학적 이상 완화 효과를 확인한 결과 그래프이다.
도 11은 불멸화 개 줄기세포의 류마티스 관절염에 의한 관절염 증상 완화 효과를 현미경으로 확인한 결과 그래프이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 파필로마바이러스(HPV)의 E6 및 E7 유전자가 형질도입된 불멸화 개 줄기세포를 제공한다.
본 명세서에서 사용된 용어, “줄기세포”는 특정 세포로 분화가 진행되지 않은 세포로서, 필요한 경우, 신경, 피부, 혈액, 근육, 골, 연골 등 신체를 구성하는 모든 종류의 세포로 분화할 능력을 가진 세포를 의미한다. 상기 줄기세포는 통상의 기술분야에 알려진 모든 종류의 줄기세포를 포함할 수 있고, 일례로, 중간엽 줄기세포일 수 있다. 또한, 상기 줄기세포는 줄기세포를 수득할 수 있는 조직이면 어떤 조직으로부터 유래된 것도 모두 포함할 수 있다. 본 발명의 일 실시예에서 상기 줄기세포는 지방으로부터 유래된 지방줄기세포일 수 있다.
상기 개 줄기세포는 파필로마바이러스의 E6 및 E7 유전자가 형질도입되어 불멸화된 것일 수 있다. 상기 E6 및 E7 유전자는 통상의 기술분야에 알려진 모든 E6 및 E7 유전자를 포함할 수 있다. 구체적으로 상기 E6 및 E7 유전자는 서열번호 1 및 3으로 각각 기재된 아미노산 서열을 암호화하는 염기서열로 구성될 수 있고, 더욱 구체적으로, 상기 E6 및 E7 유전자는 서열번호 2 및 4로 각각 기재된 염기서열로 구성될 수 있다. 상기 E6 및 E7 유전자는 hTERT의 프로모터 및 텔로머레이즈(telomerase)의 활성화를 촉진하여 개 줄기세포의 불멸화를 유도할 수 있다.
상기 E6 및 E7 유전자는 통상의 기술분야에 알려진 방법으로 줄기세포 내로 형질도입될 수 있다. 구체적으로, 상기 형질도입은 E6 및 E7 유전자를 발현하는 발현 벡터를 통상적인 방법으로 줄기세포 내로 도입함으로써 수행될 수 있다. 상기 형질도입은 통상의 기술자에 의해 적절한 방법으로 수행될 수 있으며, 필요에 따라 변형된 방법으로도 수행가능하다. 본 발명의 일 실시예에서, 상기 E6 및 E7 유전자는 바이러스 벡터에 삽입되어 줄기세포 내로 형질도입된 것일 수 있다.
일례로, 상기 바이러스 벡터는 렌티바이러스 벡터 또는 레트로바이러스 벡터일 수 있다. 상기 렌티바이러스 벡터는 세포가 분열하는 동안 나타나는 핵막의 분해(disintegration) 과정에서 표적 유전자를 유전체 내로 삽입할 수 있다. 한편, 렌티바이러스 벡터는 핵막을 능동적으로 통과하여 표적 유전자를 유전체 내로 삽입할 수 있어 분열하는 세포뿐 아니라, 비분열 세포에서도 표적 유전자를 형질도입시킬 수 있다.
상기 바이러스 벡터는 표적 유전자의 전달을 위해 바이러스 입자로서 준비될 수 있다. 상기 바이러스 입자는 표적 유전자가 포함된 바이러스 벡터 외에도, 재조합 바이러스의 생산에 필요한 단백질을 포함할 수 있다.
본 발명에 따른 불멸화 개 줄기세포는 2020년 11월 26일자로 한국생명공학연구원 생물자원센터에 기탁번호 KCTC14389BP로 수탁되었다.
또한, 본 발명은 상기 불멸화 개 줄기세포를 배양하여 수득된 엑소좀 풍부 배양액(exosome-rich conditioned medium, ERCM)을 제공한다.
본 명세서에서 사용된 용어. “엑소좀(exosomes)”은 정교한 RNA 및 단백질 운반물질이 들어있는 작은 크기(30~150 nm)의 소포로, 여러 종류의 세포들로부터 분비되는 막 구조의 소낭체를 의미한다.
상기 엑소좀 풍부 배양액은 상기 서술한 바와 같은 특징을 갖는 불멸화 개 줄기세포를 배양하여 수득된 배양액일 수 있다. 상기 배양액은 통상의 기술분야에 잘 알려진 방법에 따라 불멸화 개 줄기세포를 배양하여 수득된 것일 수 있다. 일례로, 상기 배양액은 TNF-α를 포함하는 배양배지를 이용하여 저산소농도에서 배양된 것일 수 있다. 상기 TNF-α는 통상의 기술자에 의해 적절한 양으로 첨가될 수 있다. 한편, 상기 저산소농도는 1 내지 5%의 저산소농도일 수 있다.
또한, 본 발명은 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 수의학적 조성물을 제공한다.
본 발명에 따른 수의학적 조성물에 포함되는 불멸화 개 줄기세포 및 엑소좀 풍부 배양액은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 불멸화 개 줄기세포는 파필로마바이러스의 E6 및 E7 유전자가 형질도입된 것일 수 있다. 또한, 상기 불멸화 개 줄기세포는 기탁번호 KCTC14389BP로 수탁된 것일 수 있다.
한편, 상기 엑소좀 풍부 배양액은 본 발명에 따른 불멸화 개 줄기세포를 배양한 배양액일 수 있다. 상기 배양액은 TNF-α를 포함하는 배양배지를 사용하여 저산소농도하에서 배양된 것일 수 있다.
상기 수의학적 조성물은 통상의 기술분야에 알려진 모든 인간을 제외한 동물에서 염증성 질환을 예방 또는 치료하기 위해 사용될 수 있다. 일례로, 상기 수의학적 조성물은 개과 동물을 대상으로 할 수 있다.
상기 염증성 질환은 인간을 제외한 포유동물에서 발생하는 것으로 알려진 모든 염증성 질환을 포함할 수 있다. 구체적으로, 상기 염증성 질환은 아토피성 피부염, 피부염, 뇌염, 염증성 장염, 만성 폐쇄성 폐질환, 폐혈병성 쇼크증, 폐섬유증, 미분화 척추관절증, 미분화 관절병증, 관절염, 염증성 골용해, 만성 바이러스 또는 박테리아 감염에 의한 만성 염증질환, 대장염, 염증성 장질환, 1형 당뇨병, 류마티스 관절염, 반응성 관절염(Reactive Arthritis), 골관절염, 퇴행성 관절염, 건선, 공피증, 골다공증, 아테롬성 동맥경화증, 심근염, 심내막염, 심낭염, 낭성 섬유증, 하시모토 갑상선염, 그레이브스병, 나병, 매독, 라임 질환(Lyme), 보렐리아증(Borreliosis), 신경성-보렐리아증, 결핵, 사르코이드증(Sarcoidosis), 낭창, 원판성 낭창, 동창성 루프스, 루프스 신염, 전신성 홍반성 루프스, 황반변성, 포도막염, 과민대장 증후군, 크로씨병, 쇼그랜 증후군, 섬유근통, 만성피로 증후군, 만성피로 면역부전 증후군, 근육통성 뇌척수염, 근위축성 측삭경화증, 파킨스병, 다발경화증 또는 알레르기에 의한 전신성 쇼크를 포함할 수 있다. 본 발명의 일 실시예에서, 상기 염증성 질환은 아토피 피부염, 류마티스 관절염 또는 알레르기에 의한 전신성 쇼크일 수 있다.
본 발명에 따른 염증성 질환의 예방 또는 치료용 수의학적 조성물은 각각의 사용 목적에 맞게 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁제, 에멀젼, 시럽, 에어로졸 등의 경구 제형, 멸균 주사 용액의 형태 등 다양한 형태로 제형화하여 사용할 수 있으며, 경구 투여하거나 정맥 내, 복강 내, 피하, 직장, 국소 투여 등을 포함한 다양한 경로를 통해 투여될 수 있다.
본 발명에 따른 수의학적 조성물에 포함될 수 있는 적합한 담체, 부형제 및 희석제의 예로는 락토오스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 비정질 셀룰로즈, 폴리비닐 피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등을 포함할 수 있다.
본 발명에 따른 수의학적 조성물은 충전제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
또한, 본 발명은 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 포함하는 사료첨가제를 제공한다.
본 발명에 따른 사료첨가제에 포함되는 불멸화 개 줄기세포 및 엑소좀 풍부 배양액은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 불멸화 개 줄기세포는 파필로마바이러스의 E6 및 E7 유전자가 형질도입된 것일 수 있다. 또한, 상기 불멸화 개 줄기세포는 기탁번호 KCTC14389BP로 수탁된 것일 수 있다.
한편, 상기 엑소좀 풍부 배양액은 본 발명에 따른 불멸화 개 줄기세포를 배양한 배양액일 수 있다. 상기 배양액은 TNF-α를 포함하는 배양배지를 사용하여 저산소농도하에서 배양된 것일 수 있다.
상기 사료첨가제는 통상의 기술분야에 알려진 모든 인간을 제외한 동물에서 염증성 질환을 예방 또는 개선하기 위해 사용될 수 있다. 일례로, 상기 인간을 제외한 동물은 개과 동물일 수 있다. 일례로, 상기 사료 첨가제는 항염증 활성을 가질 수 있다.
상기 사료첨가제는 단위동물에 허용되는 담체를 추가로 포함할 수 있다. 구체적으로, 상기 사료첨가제는 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액을 그대로 포함하거나, 여기에 공지의 담체, 안정제 등을 추가로 포함할 수 있다. 또한, 필요에 따라 비타민, 아미노산류, 미네랄과 같은 각종 양분, 항산화제 및 기타의 첨가제 등을 가할 수 있다. 상기 사료첨가제는 분체, 과립, 펠릿, 현탁액 등과 같은 적당한 형태로 제조될 수 있다. 또한, 상기 사료첨가제는 단독 또는 다른 사료와 혼합하여 공급될 수 있다.
또한, 본 발명은 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 인간을 제외한 동물에 투여하는 단계를 포함하는 인간을 제외한 동물에서 염증성 질환의 예방, 개선 또는 치료 방법을 제공한다.
본 발명에 따른 인간을 제외한 동물에서 염증성 질환의 예방, 개선 또는 치료 방법에 사용되는 불멸화 개 줄기세포 및 엑소좀 풍부 배양액은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 불멸화 개 줄기세포는 파필로마바이러스의 E6 및 E7 유전자가 형질도입된 것일 수 있다. 또한, 상기 불멸화 개 줄기세포는 기탁번호 KCTC14389BP로 수탁된 것일 수 있다.
한편, 상기 엑소좀 풍부 배양액은 본 발명에 따른 불멸화 개 줄기세포를 배양한 배양액일 수 있다. 상기 배양액은 TNF-α를 포함하는 배양배지를 사용하여 저산소농도하에서 배양된 것일 수 있다.
상기 인간을 제외한 포유동물은 개과 동물일 수 있다.
상기 염증성 질환은 상기 서술한 바와 같은 특징을 가질 수 있다.
상기 투여는 본 발명에 따른 불멸화 개 줄기세포 또는 엑소좀 풍부 배양액을 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 통상의 기술자에 의해 용이하게 결정될 수 있다. 구체적으로, 상기 투여의 약제학적으로 유효한 양은 개체의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로 줄기세포는 개체당 1천~2억개의 세포, 엑소좀 풍부 배양액은 체중 ㎏당 1 내지 50 ㎎을 매일 또는 격일로 투여하거나 1일 수회로 나누어 투여할 수 있다. 그러나, 상기 투여량은 투여 경로, 질병의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
상기 투여는 목적하는 방법에 따라 경구 또는 비경구로 투여될 수 있다. 비경구 투여는 복강내, 직장내, 피하, 정맥, 근육내 또는 흉부내 주사 방식을 포함할 수 있다.
나아가, 본 발명은 염증성 질환의 예방 또는 치료를 위한 수의학적 약제의 제조에 사용하기 위한 본 발명에 따른 불멸화 개 줄기세포 및 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상의 용도를 제공한다.
본 발명에 따른 용도에 사용되는 불멸화 개 줄기세포 및 엑소좀 풍부 배양액은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 불멸화 개 줄기세포는 파필로마바이러스의 E6 및 E7 유전자가 형질도입된 것일 수 있다. 또한, 상기 불멸화 개 줄기세포는 기탁번호 KCTC14389BP로 수탁된 것일 수 있다.
한편, 상기 엑소좀 풍부 배양액은 본 발명에 따른 불멸화 개 줄기세포를 배양한 배양액일 수 있다. 상기 배양액은 TNF-α를 포함하는 배양배지를 사용하여 저산소농도하에서 배양된 것일 수 있다.
상기 수의학적 약제는 인간을 제외한 동물을 대상으로 할 수 있고, 구체적으로 개과의 동물을 대상으로 할 수 있다.
상기 염증성 질환은 상기 서술한 바와 같은 특징을 가질 수 있다.
이하, 본 발명을 하기 실시예에 의해 상세히 설명한다, 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 이들에 의해 본 발명이 제한되는 것은 아니다. 본 발명의 청구범위에 기재된 기술적 사상과 실질적으로 동일한 구성을 갖고 동일한 작용 효과를 이루는 것은 어떠한 것이라도 본 발명의 기술적 범위에 포함된다.
실시예 1. 개 줄기세포의 불멸화
인간 파필로마바이러스(HPV)의 E6 및 E7 유전자를 형질도입하여 개 줄기세포의 불멸화를 다음과 같이 유도하였다.
1-1. E6 및 E7 유전자의 도입
나이 2살의 건강한 수컷 포메라이언종 개로부터 지방조직을 채취하고, 이미 참고문헌에 제시된 방법에 따라 지방줄기세포를 분리 및 배양하여 준비하였다. 한편, HPV16의 E6 유전자(서열번호 2) 및 E7 유전자(서열번호 4)를 발현하는 도 1에 따른 렌티바이러스 벡터(abm, 캐나다)를 이용하여 통상적인 방법으로 렌티바이러스를 생산하였다. 준비된 지방줄기세포를 60 ㎟의 배양접시에 70%가 되도록 배양한 후 1 ㎖의 배양배지, 2 ㎖의 렌티바이러스 및 5 ㎍/㎖의 폴리브렌(Sigma-Aldrich)을 첨가하여 배양하였다. 8시간 후, 배양액을 제거하고 상기와 동일한 조건으로 렌티바이러스를 다시 첨가하여 3일을 추가 배양하였다(도 2). 배양이 끝난 후, 배양액을 제거하고 통상적인 배양 배지를 첨가하여 세포를 배양하여 불멸화 개 줄기세포를 제조하였다. 제조된 불멸화 개 줄기세포의 형태를 현미경으로 관찰한 결과를 도 3A에 나타내었다.
도 3A에 나타난 바와 같이, E6 및 E7 유전자가 도입되지 않은 세포와 비교하였을 때, 불멸화 개 줄기세포에서 약간의 형태변화가 관찰되었다. 구체적으로, 불멸화 개 줄기세포는 세포의 길이가 약간 짧아지고, 세포의 분열 주기가 감소하여 성장 속도가 빨라진 것으로 확인되었다.
1-2. 개 줄기세포의 불멸화 확인-(1)
실시예 1-1에서 제조된 불멸화 개 줄기세포의 불멸화를 RT-PCT 방법으로 확인하였다.
구체적으로, 상기 제조된 불멸화 개 줄기세포를 일주일 동안 배양하고, 배양된 세포로부터 트리졸(trizol, Thermo Fisher Scientific, USA)을 사용하여 전체 RNA를 추출하였다. 2 ㎍의 RNA를 주형으로 올리고 dT 프라이머 및 TOP script™ 역전사 효소를 사용하여 cDNA를 합성하였다. 합성된 cDNA를 이용하여 하기 표 1에 기재된 바와 같은 프라이머를 사용하여 RT-PCR을 수행함으로써, HPV의 E6 및 E7 유전자의 도입을 확인하였다. 이때, RT-PCR은 10 ㎕의 2×효소 마스터믹스(enzyme mastermix), 10 ㎕의 RNase-free 증류수, 1 ㎕의 정방향 및 역방향 프라이머, 및 1 ㎕의 주형 cDNA의 혼합물을 사용하여 하기 표 2에 기재된 바와 같은 조건으로 수행되었다. 그 결과, E6 및 E7 유전자의 발현을 확인한 결과를 도 3B에 나타내었고, 대조군으로서 β-액틴 유전자를 사용하였다.
프라이머 서열(5'→3') 서열번호
HPV-16 E6/E7 forward CGCAAATGGGCGGTAGGCGTG 서열번호 5
HPV-16 E6/E7 reverse TAGTCAGCCATGGGGCGGAGA 서열번호 6
canine β-actin forward GAGCTACGAACTACCCGACG 서열번호 7
canine β-actin reverse ACTCCTGCTTGCTGATCCAC 서열번호 8
초기 변성 단계 95℃, 10분 1회
변성 단계 95℃, 15초 35회
어닐링(annealing) 단계 67.4℃, 15초
연신 단계 72℃, 10초
도 3B에 나타난 바와 같이, HPV의 E6 및 E7 유전자를 형질도입한 불멸화 개 줄기세포에서 상기 유전자의 발현이 확인되었다.
1-3. 개 줄기세포의 불멸화 확인-(2)
실시예 1-1에서 제조된 불멸화 개 줄기세포의 불멸화를 면역염색 방법으로 확인하였다.
구체적으로, 상기 제조된 불멸화 개 줄기세포를 4웰 챔버 슬라이드(4 well chamber slide)에 분주하고, 37℃ 및 5% CO 2 조건하에서 배양하여 안정화시켰다. 안정화된 세포에 4% 파라포름알데히드를 처리하여 이를 고정시키고, 0.25% 트리톤-X 100을 첨가하여 20분 동안 반응시킴으로써 투과성을 증진시켰다. 이후, 1% BSA(bovine serum albumin)를 첨가하여 2시간 동안 전처리하고, 1차 항체를 첨가하여 4℃에서 하룻밤 동안 반응시켰다. 반응이 끝난 세포를 PBS로 세척하고, 2차 항체를 처리한 후, 통상적인 방법으로 핵 염색을 수행하였다. 이때, 항체는 하기 표 3에 기재된 항체를 사용하였다. 그 결과, 염색된 세포를 600배의 배율로 형광현미경(Eclipse Ti-S, Nikon, Tokyo, Japan)을 이용하여 관찰한 결과를 도 3C에 나타내었다.
검출 단백질 항체 이름 카탈로그 넘버
HPV-16 E6 1차 Mouse monoclonal antibody SC-460
2차 Anti-mouse IgG (H+L), F(ab’) 2
Alexa Fluor 555 conjugate		 4409S
HPV-16 E7 1차 Mouse monoclonal antibody SC-264
2차 Anti-mouse IgG (H+L), F(ab’) 2
Alexa Fluor 555 conjugate		 4409S
도 3C에 나타난 바와 같이, 불멸화된 개 줄기세포에서 HPV의 E6 및 E7 단백질의 발현을 형광 발색으로 확인하였다.
실시예 2. 불멸화 개 줄기세포의 생존율 확인
상기에서 제조된 불멸화 개 줄기세포의 생존율을 다음과 같이 확인하였다.
구체적으로, 불멸화 개 줄기세포를 정상 산소농도(20%) 및 저산소농도(3%)에서 2일 동안 배양하면서 통상적인 방법으로 생존율 변화를 확인하고, 그 결과를 도 4에 나타내었다. 이때, 대조군으로서 E6 및 E7 유전자가 도입되지 않은 개 지방줄기세포를 사용하였다.
도 4에 나타난 바와 같이, 대조군 세포인 비불멸화 줄기세포는 정상 산소농도에서 2일 동안 2배 가까이 증식(188%)했으나, 저산소농도에서는 대부분 사멸(17%)하였다. 반면, 불멸화 줄기세포는 정상 산소농도에서도 2배 이상 증식(225%)하여 더 빠른 증식 속도를 보였으며, 저산소농도에서도 152%의 증식율을 나타내었다. 따라서, 상기로부터 본 발명에 따른 불멸화 개 줄기세포가 정상 또는 저산소농도에서 유의적으로 빠른 증식율을 보임을 확인하였다.
실시예 3. 불멸화 개 줄기세포 배양액 내 엑소좀 함량 분석
상기에서 제조된 불멸화 개 줄기세포의 배양액 내 엑소좀 함량을 다음과 같이 확인하였다.
구체적으로, 불멸화 개 줄기세포를 21%의 산소농도하에서 배양하거나, TNF-α를 처리하고 3%의 산소농도에서 배양하였다. 이후, 배양액을 취하여 엑소좀 함량을 CD9 유전자 발현량을 RT-PCR 방법으로 분석하고, 그 결과를 도 5에 나타내었다.
도 5에 나타난 바와 같이, 불멸화 개 줄기세포를 21%의 정상 산소농도하에서 배양(CM)한 경우에 비해, 저산소농도하에서 TNF-α를 처리하여 배양한 경우(ERCM)에 CD9의 발현이 유의적으로 높았다.
따라서, 불멸화 개 줄기세포에 TNF-α를 처리하여 엑소좀 풍부 배양액(exosome-rich conditioned medium, ERCM)을 제조할 수 있음을 확인하였다.
실험예 1. 불멸화 개 줄기세포의 전신성 쇼크 억제 효과
상기에서 제조된 불멸화 개 줄기세포가 알레르기 반응을 유도하는 컴파운드 48/80(compound 48/80)에 의한 전신성 쇼크(active systemic anaphylaxis, ASA)의 치료 효과를 나타내는지 다음과 같이 확인하였다.
구체적으로, 마우스를 9개 그룹으로 나누어 하기 표 4에 기재된 바와 같이 정상 개 줄기세포, 불멸화 개 줄기세포, 정상 배양액(CM) 또는 엑소좀 풍부 배양액을 복강 내로 주사하였다. 주사 30분 후, 치사량의 컴파운드 48/80(8 ㎎/5 ㎖/㎏)을 복강 내로 주사하고, 60분 동안 동물의 사망률을 확인하였다. 그 결과, 각 그룹의 마우스 사망률을 하기 표 4에 나타내었다.
투여군(용량) 사망률(%)
대조군 - 10/10 (100)
정상 개 줄기세포(cADMSC) 1×10 4 cells 7/10 (70)
3×10 4 cells 3/10 (30)
1×10 5 cells 1/10 (10)
불멸화 개 줄기세포(im-cADMSC) 1×10 4 cells 5/10 (50)
3×10 4 cells 1/10 (10)
1×10 5 cells 0/10 (0)
정상 배양액 100 ㎕ 3/10 (30)
엑소좀 풍부 배양액 100 ㎕ 1/10 (10)
표 4에 나타난 바와 같이, 불멸화 개 줄기세포나 이의 엑소좀 풍부 배양액을 투여한 마우스에서 사망률이 유의적으로 감소하였다. 구체적으로, 불멸화 개 줄기세포를 투여한 마우스는 정상 개 줄기세포를 투여한 마우스보다 사망률이 낮았으며, 이는 불멸화 개 줄기세포의 투여량에 의존적으로 감소하였다. 특히, 불멸화 개 줄기세포를 투여한 경우보다 엑소좀 풍부 배양액을 투여한 경우에 더 우수한 효과를 나타내었다. 한편, 아무것도 투여하지 않은 대조군의 경우 컴파운드 48/80을 투여하고 60분 동안 모든 마우스가 사망하였다.
따라서, 상기 결과로부터 불멸화 개 줄기세포와 엑소좀 풍부 배양액이 알레르기에 의해 유도되는 전신성 쇼크의 치료에 유용하게 사용될 수 있음을 확인하였다.
실험예 2. 불멸화 개 줄기세포의 아토피 치료 효과
상기 제조된 불멸화 개 줄기세포의 아토피 치료 효과를 가려움증 억제 정도, 혈청 히스타민 농도 및 피부조직 관찰을 통해 확인하였다.
2-1. 가려움증 억제 확인
먼저, 마우스를 3×10 4 cells의 정상 개 줄기세포(cADMSC) 처리군, 3×10 4 cells의 불멸화 개 줄기세포(im-cADMSC) 처리군, 100 ㎕의 정상 배양액 처리군, 100 ㎕의 엑소좀 풍부 배양액 처리군, 컴파운드 48/80(50 ㎍/50 ㎕/site) 처리군, 및 무처리군의 6개 그룹으로 나누어 각각의 약물을 상기 서술한 바와 같이 피하주사하였다. 이후, 30분 동안 긁는 횟수를 확인하여 그 결과를 도 6에 나타내었다.
도 6에 나타난 바와 같이, 컴파운드 48/60 처리군에서는 마우스가 30분 동안 78회의 긁는 횟수를 나타낸 반면, 불멸화 개 줄기세포 처리군에서는 28회의 긁는 횟수를 나타내어, 가려움증이 완화된 것을 알 수 있었다. 이는 정상 개 줄기세포 처리군에 비해서 유의적이었다. 한편, 엑소좀 풍부 배양액 처리군 역시 정상 배양액 처리군에 비해 더 우수한 가려움증 억제 효과가 있음을 확인하였다.
2-2. 히스타민 증가 억제 확인
상기 실험예 2-1의 6개 그룹의 마우스로부터 혈액을 채취하여 혈청 히스타민 농도를 통상적인 방법으로 확인하고, 그 결과를 도 7에 나타내었다.
도 7에 나타난 바와 같이, 컴파운드 48/80의 투여로 인해 증가한 혈청 히스타민의 농도가 불멸화 개 줄기세포의 투여에 의해 유의적으로 감소하였다. 이는 정상 개 줄기세포를 투여한 군과 비교하여도 더 우수하였으며, 엑소좀 풍부 배양액 또한 정상 배양액과 비교하여 더욱 유의적인 효과를 나타내었다.
2-3. 피부조직 관찰
상기 실험예 2-1의 6개 그룹의 마우스로부터 피부조직을 채취하여 통상적인 방법으로 조직슬라이드를 제작하고, 피부병변을 점수화(scoring)한 결과를 도 8에 나타내었다.
도 8에 나타난 바와 같이, 컴파운드 48/80의 투여로 아토피 피부염이 유발된 마우스는 심한 피부병변을 나타내었고, 이는 불멸화 개 줄기세포의 투여에 의해 완화되었다. 이와 같은 효과는 정상 개 줄기세포를 투여한 군과 비교하여도 더 우수하였으며, 엑소좀 풍부 배양액 또한 정상 배양액과 비교하여 더욱 유의적인 효과를 나타내었다.
따라서, 상기 결과로부터 본 발명의 불멸화 개 줄기세포 및 엑소좀 풍부 배양액이 아토피 피부염의 치료에 유용하게 사용될 수 있음을 확인하였다.
실험예 3. 불멸화 개 줄기세포의 류마티스 관절염 치료 효과
류마티스 관절염이 유발된 마우스 동물모델에 불멸화 개 줄기세포 또는 엑소좀 풍부 배양액을 처리하고, 류마티스 관절염의 치료 효과를 육안 또는 현미경으로 관찰하였다.
3-1. 불멸화 개 줄기세포의 투여
9주령의 수컷 DBA 1J 마우스에 2차례에 걸쳐 콜라겐-II(bovine type II collagen)를 투여하여 관절염을 유발하였다. 구체적으로, 콜라겐-II를 동량의 FCA(Freund's complete adjuvant)와 혼합한 200 ㎕의 유화액(200 ㎍)을 마우스 꼬리의 기저부에 피내로 투여하였다. 투여 21일 후, 동일한 방법으로 100 ㎕의 유화액(200 ㎍)을 1차 투여부위로부터 조금 떨어진 부위에 피내로 투여하였다. 다음날, 1×10 5 cells의 불멸화 개 줄기세포, 1×10 5 cells의 정상 개 줄기세포, 100 ㎕의 정상 배양액, 또는 100 ㎕의 엑소좀 풍부 배양액을 마우스의 복강 내로 주사하였다.
3-2. 육안 관찰
콜라겐-II의 2차 투여일인 21일부터 2일 간격으로 45일까지 마우스를 육안으로 관찰하거나 촉진하여 염증의 발생 여부 및 증상의 정도를 관절염 지수(0점: 정상, 1점: 발가락과 발목에 국한된 약한 부종 및 발적, 2점: 발가락과 발목 이상으로 확대된 약한 부종 및 발적, 3점: 발가락과 발목 이상으로 확대된 중등도의 부종 및 발적, 4점: 전체 다리로 확장(또는 유합)된 심한 부종 및 발적)에 따라 점수화하여 기록하고, 사지의 점수를 합산하여 관절염 정도를 평가하였다. 평가 결과는 도 9에 나타내었다.
도 9에 나타난 바와 같이, 콜라겐-II의 첫 투여일로부터 23일째에 관절의 부종이 확인되었으며, 이후 지속적으로 관절염 지수가 상승하여 1주일 후에는 평균 2.7점, 2주 후에는 약 4.2점, 종료시점인 45일째에 약 6.3점에 도달하였다. 특히, 투여일로부터 35일째에 심한 발적 및 부종과 함께 관절의 변형 및 유합으로 인해 관절강직(ankylosis)이 발생하는 마우스가 발견되었다. 한편, 불멸화 개 줄기세포를 투여한 마우스는 관절염 지수가 현저히 낮아져 콜라겐-II를 투여한 대조군과 비교하여 50~65%의 억제율을 보였다. 종료시점엔 45일째에도 평균 2.8점에 머물렀으며, 심한 부종이나 관절강직을 보이는 마우스는 발견되지 않았다. 이는 정상 개 줄기세포를 투여한 경우보다 더욱 우수하였으며, 엑소좀 풍부 배양액 또한 정상 배양액과 비교하여 더욱 유의적인 효과를 나타내었다.
3-3. 현미경 관찰
콜라겐-II의 첫 투여일로부터 45일째에 상기 마우스의 부검을 수행하였다. 구체적으로, 마우스를 에테르로 흡입마취시킨 후, 배대정맥으로 혈액을 채취하고, 뒷다리를 적출하였다. 적출한 다리를 10% 포르말린 용액에 1주일 동안 고정하고, 이를 다시 1주일 동안 탈회한 후, 통상적인 방법으로 조직 슬라이드를 제작하였다. 제작된 조직 슬라이드를 헤마토실린 & 에오신(H&E)으로 염색하였다. 이를 광학 현미경으로 관찰하여 조직병리학적 이상을 확인한 결과를 도 10에, 그 정도를 관절염 지수(0점: 이상 없음, 1점: 미약한 국소적 염증세포 침윤(<20%), 2점: 중등도의 염증세포 침윤(20-30%), 3점: 심한 염증세포 침윤(30-50%), 단 판누스(pannus)는 형성되지 않음, 4점: 심한 염증세포 침윤(>50%), 단 판누스 형성)에 따라 점수화하여 도 11에 나타내었다.
도 10에 나타난 바와 같이, 아무것도 처리하지 않은 무처리군 마우스의 관절은 관절강 내 및 주위조직에 염증반응이 전혀 없고, 관절의 골두 역시 매끈한 원형을 유지하였다. 반면, 콜라겐-II를 투여한 마우스에서는 관절강 내외의 심한 염증세포의 침윤과 함께 판누스 형성에 따른 관절 뼈의 변형 및 유합이 관찰되었다. 그러나, 이와 같은 관절염에 의한 증상은 불멸화 개 줄기세포의 처리에 의해 완화되었다. 구체적으로, 불멸화 개 줄기세포를 처리한 마우스에서는 관절 내외의 염증반응이 상당히 완화되었으며, 특히 관절골수의 변형이 거의 없었다. 또한, 일부 동물에서만 국소적 염증이 확인되었을 뿐, 관절의 전체적인 구조가 온건히 보존되었다. 이는 정상 개 줄기세포를 투여한 경우보다 더욱 우수하였으며, 엑소좀 풍부 배양액 또한 정상 배양액과 비교하여 더욱 유의적인 효과를 나타내었다.
한편, 도 11에 나타난 바와 같이, 관절염 지수 평가 결과는 콜라겐-II에 의해 관절염이 유발된 군에서 평균 2.78점이었으나, 불멸화 개 줄기세포를 투여한 경우에 염증과 관절변형이 크게 완화되어 0.44점으로 확인되었다. 이는 정상 개 줄기세포를 투여한 경우(1.11점)보다 더욱 우수하였으며, 엑소좀 풍부 배양액 또한 정상 배양액과 비교하여 더욱 유의적인 효과를 나타내었다.
따라서, 상기 결과로부터 본 발명의 불멸화 개 줄기세포 및 엑소좀 풍부 배양액이 류마티스 관절염의 치료에 유용하게 사용될 수 있음을 확인하였다.
<수탁번호>
기탁기관명: 한국생명공학연구원
기탁번호: KCTC14389BP
기탁일자: 20201126
Figure PCTKR2021004674-appb-img-000001

Claims (12)

  1. 파필로마바이러스(HPV)의 E6 및 E7 유전자가 형질도입된 불멸화 개 줄기세포.
  2. 제1항에 있어서, 상기 E6 및 E7 유전자는 서열번호 1 및 3으로 각각 기재된 아미노산 서열을 암호화하는 염기서열로 구성된, 불멸화 개 줄기세포.
  3. 제1항에 있어서, 상기 줄기세포는 지방줄기세포인, 불멸화 개 줄기세포.
  4. 제1항에 있어서, 상기 불멸화 개 줄기세포는 기탁번호 KCTC14389BP로 수탁된, 불멸화 개 줄기세포.
  5. 제1항의 불멸화 개 줄기세포를 배양하여 수득된 엑소좀 풍부 배양액(exosome-rich conditioned medium, ERCM).
  6. 제5항에 있어서, 상기 엑소좀 풍부 배양액은 TNF-α를 포함하는 배양배지를 이용하여 저산소농도하에서 배양된, 엑소좀 풍부 배양액.
  7. 제1항의 불멸화 개 줄기세포 및 제5항의 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 수의학적 조성물.
  8. 제7항에 있어서, 상기 수의학적 조성물은 개과 동물을 대상으로 하는, 염증성 질환 예방 또는 치료용 수의학적 조성물.
  9. 제7항에 있어서, 상기 염증성 질환은 아토피성 피부염, 피부염, 뇌염, 염증성 장염, 만성 폐쇄성 폐질환, 폐혈병성 쇼크증, 폐섬유증, 미분화 척추관절증, 미분화 관절병증, 관절염, 염증성 골용해, 만성 바이러스 또는 박테리아 감염에 의한 만성 염증질환, 대장염, 염증성 장질환, 1형 당뇨병, 류마티스 관절염, 반응성 관절염(Reactive Arthritis), 골관절염, 건선, 공피증, 골다공증, 아테롬성 동맥경화증, 심근염, 심내막염, 심낭염, 낭성 섬유증, 하시모토 갑상선염, 그레이브스병, 나병, 매독, 라임 질환(Lyme), 보렐리아증(Borreliosis), 신경성-보렐리아증, 결핵, 사르코이드증(Sarcoidosis), 낭창, 원판성 낭창, 동창성 루프스, 루프스 신염, 전신성 홍반성 루프스, 황반변성, 포도막염, 과민대장 증후군, 크로씨병, 쇼그랜 증후군, 섬유근통, 만성피로 증후군, 만성피로 면역부전 증후군, 근육통성 뇌척수염, 근위축성 측삭경화증, 파킨스병, 다발경화증 또는 알레르기에 의한 전신성 쇼크인, 염증성 질환 예방 또는 치료용 수의학적 조성물.
  10. 제1항의 불멸화 개 줄기세포 및 제5항의 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 포함하는 사료첨가제.
  11. 제1항의 불멸화 개 줄기세포 및 제5항의 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상을 인간을 제외한 동물에 투여하는 단계를 포함하는 인간을 제외한 동물에서 염증성 질환의 예방, 개선 또는 치료 방법.
  12. 염증성 질환의 예방 또는 치료를 위한 수의학적 약제의 제조에 사용하기 위한 제1항의 불멸화 개 줄기세포 및 제5항의 엑소좀 풍부 배양액으로 구성된 군으로부터 선택되는 어느 하나 이상의 용도.
PCT/KR2021/004674 2020-12-02 2021-04-13 불멸화 개 줄기세포 또는 이의 용도 WO2022119060A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200166703A KR102456805B1 (ko) 2020-12-02 2020-12-02 불멸화 개줄기세포 또는 이의 엑소좀풍부배양액을 유효성분으로 포함하는 염증성 질환의 예방 또는 치료용 조성물
KR10-2020-0166703 2020-12-02

Publications (1)

Publication Number Publication Date
WO2022119060A1 true WO2022119060A1 (ko) 2022-06-09

Family

ID=81767955

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/004674 WO2022119060A1 (ko) 2020-12-02 2021-04-13 불멸화 개 줄기세포 또는 이의 용도

Country Status (3)

Country Link
KR (1) KR102456805B1 (ko)
CN (1) CN114574445B (ko)
WO (1) WO2022119060A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114574445A (zh) * 2020-12-02 2022-06-03 忠北大学校产学协力团 永生化狗干细胞或其用途

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240103937A (ko) 2022-12-26 2024-07-04 건국대학교 산학협력단 개의 지방 유래 줄기세포 또는 인간 체세포로부터 분리된 세포외 소포체를 유효성분으로 포함하는 피부 마이크로바이옴 균형 유지용 조성물

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010046019A (ja) * 2008-08-21 2010-03-04 Toyama Univ ヒト羊膜由来間葉系細胞及びこれを用いた糖尿病治療薬
KR20150009528A (ko) * 2012-03-28 2015-01-26 가부시키가이샤 쿠오리맨 불사화 줄기세포 및 그 생산물을 유효 성분으로 하는 의약 조성물 및 의약 제제
JP2016210730A (ja) * 2015-05-08 2016-12-15 上田　実 医薬組成物及びその製造方法並びに医薬品
WO2017078176A1 (ja) * 2015-11-05 2017-05-11 株式会社Ｑｕａｒｒｙｍｅｎ＆Ｃｏ． 不死化幹細胞、及びその作製方法
KR20190066885A (ko) * 2017-12-06 2019-06-14 주식회사 디자인셀 줄기세포 유래 엑소좀 함유 배양액을 유효성분으로 포함하는 관절염의 예방 또는 치료용 조성물

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL144359A0 (en) * 1999-01-21 2002-05-23 Vitro Diagnostics Inc Immortalized cell lines and methods of making the same
EP1103615A1 (en) * 1999-11-25 2001-05-30 Universite De Geneve Vectors capable of immortalizing non-dividing cells and cells immortalized with said vectors
EP1465984A1 (en) * 2002-01-17 2004-10-13 Kobenhavns Universitet A suprabasal breast cell line with stem cell properties
DE102007035659A1 (de) * 2007-07-27 2009-01-29 Justus-Liebig-Universität Giessen Immortalisierte Keratinozyten-Zelllinie und Verfahren zur Messung von protektiven Mitteln
US10472647B2 (en) * 2012-12-21 2019-11-12 The Administrators Of The Tulane Educational Fund Primary mesenchymal stem cells as a vaccine platform
KR101740357B1 (ko) 2016-05-18 2017-06-01 (주)아이셀뱅크 아토피 피부염 개선, 주름 개선 및 미백활성을 갖는 불멸화 세포주 및 이의 용도
KR101985941B1 (ko) * 2017-05-31 2019-06-04 충북대학교 산학협력단 줄기세포로부터 엑소좀 분비를 촉진시키는 방법 및 줄기세포 유래 엑소좀을 유효성분으로 포함하는 기능성 화장료 조성물
KR20190098028A (ko) * 2018-02-13 2019-08-21 주식회사 엑소코바이오 지방줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 궤양성 대장염의 개선 용도
KR102456805B1 (ko) * 2020-12-02 2022-10-24 충북대학교 산학협력단 불멸화 개줄기세포 또는 이의 엑소좀풍부배양액을 유효성분으로 포함하는 염증성 질환의 예방 또는 치료용 조성물
CN113563452B (zh) * 2021-07-15 2022-03-15 样美生物科技(北京)有限公司 一种生物活性肽及其与脂肪干细胞外泌体在皮肤增殖修复中的应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010046019A (ja) * 2008-08-21 2010-03-04 Toyama Univ ヒト羊膜由来間葉系細胞及びこれを用いた糖尿病治療薬
KR20150009528A (ko) * 2012-03-28 2015-01-26 가부시키가이샤 쿠오리맨 불사화 줄기세포 및 그 생산물을 유효 성분으로 하는 의약 조성물 및 의약 제제
JP2016210730A (ja) * 2015-05-08 2016-12-15 上田　実 医薬組成物及びその製造方法並びに医薬品
WO2017078176A1 (ja) * 2015-11-05 2017-05-11 株式会社Ｑｕａｒｒｙｍｅｎ＆Ｃｏ． 不死化幹細胞、及びその作製方法
KR20190066885A (ko) * 2017-12-06 2019-06-14 주식회사 디자인셀 줄기세포 유래 엑소좀 함유 배양액을 유효성분으로 포함하는 관절염의 예방 또는 치료용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 20 March 2018 (2018-03-20), ANONYMOUS : "E6 [Human papillomavirus type 16]", XP055935970, retrieved from Genbank Database accession no. Protein *
DATABASE Protein 5 April 2014 (2014-04-05), ANONYMOUS : "E7 protein [Human papillomavirus type 16] ", XP055935973, retrieved from Genbank Database accession no. AHN92488 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114574445A (zh) * 2020-12-02 2022-06-03 忠北大学校产学协力团 永生化狗干细胞或其用途
CN114574445B (zh) * 2020-12-02 2024-09-06 忠北大学校产学协力团 永生化狗干细胞或其用途

Also Published As

Publication number Publication date
CN114574445B (zh) 2024-09-06
CN114574445A (zh) 2022-06-03
KR102456805B1 (ko) 2022-10-24
KR20220077986A (ko) 2022-06-10

Similar Documents

Publication Publication Date Title
WO2022119060A1 (ko) 불멸화 개 줄기세포 또는 이의 용도
US20150366917A1 (en) Composition for preventing or treating inflammatory disease
RU95119854A (ru) Ингибитор пролиферации стволовых клеток и его использование
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
KR101469167B1 (ko) 봉독-ｐｌａ2를 포함하는 이상 조절 ｔ 세포 활성 저하 관련 질환의 치료 또는 예방용 약학적 조성물
WO2021206459A1 (ko) 통증조절인자를 함유한 줄기세포유래 엑소좀 및 그 용도
WO2020222483A1 (ko) 분리된 미토콘드리아를 유효성분으로 포함하는 패혈증 또는 전신성 염증 반응 증후군 치료용 약학 조성물
AU2020234373B9 (en) Novel peptide and use thereof
WO2015023147A1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2023113541A1 (en) Pharmaceutical composition for preventing or treating cancer or inflammatory disease
WO2023027317A1 (ko) 편도 중간엽 줄기세포 유래 엑소좀을 포함하는 근육 감소 관련 질환 치료용 조성물
WO2022211396A1 (ko) 배암차즈기 추출물 또는 이의 유래 화합물을 유효성분으로 포함하는 근위축 예방 또는 치료용 약학적 조성물
WO2019235789A1 (ko) 편도 유래 중간엽 줄기세포의 조정 배지를 포함하는 이식편대숙주 질환 예방 혹은 치료용 조성물
WO2015023165A1 (ko) 염증조절복합체 및 ｓｔａｔ３ 신호분자 차단을 통한 면역조절능 최적화된 안정화 중간엽줄기세포
WO2022245138A1 (ko) 기능강화 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 조성물
WO2016126139A1 (ko) 과면역반응에 의해 유발되는 염증성 질환 치료용 조성물
WO2022015106A1 (ko) 종양괴사인자-자극된 유전자 6을 발현하는 중간엽 줄기세포를 포함하는 골관절염의 예방 또는 치료용 조성물
WO2022119061A1 (ko) 불멸화 고양이 줄기세포 또는 이의 용도
WO2021182913A1 (ko) 태반 추출물을 포함하는 간 질환 예방 또는 치료용 및 간 기능 개선용 조성물
WO2021149971A1 (ko) 신규 화합물 및 이의 용도
WO2020096371A1 (ko) 신규 화합물 및 칼시뉴린 억제제를 포함하는 이식 거부 반응 또는 이식 거부 질환의 예방 및 치료용 조성물
WO2022255848A1 (ko) Agkistrodon piscivorus piscivorus 또는 naja melanoleuca로부터 유래된 신규한 펩타이드, 및 이를 포함하는 베체트병 또는 류마티스 관절염의 치료용 조성물
WO2023243934A1 (ko) 기능강화 줄기세포를 포함하는 관절염 예방 또는 치료용 조성물
WO2024158103A1 (ko) 스트렙토코커스 속 균주를 포함하는 피부 질환의 예방, 개선 또는 치료용 조성물
WO2023219460A1 (ko) 락토바실러스 퍼멘텀 균주 및 대사조절제를 포함하는 병용 요법을 이용한 대사질환 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21900748

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21900748

Country of ref document: EP

Kind code of ref document: A1