WO2015023147A1 - mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물 - Google Patents

mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물 Download PDF

Info

Publication number
WO2015023147A1
WO2015023147A1 PCT/KR2014/007583 KR2014007583W WO2015023147A1 WO 2015023147 A1 WO2015023147 A1 WO 2015023147A1 KR 2014007583 W KR2014007583 W KR 2014007583W WO 2015023147 A1 WO2015023147 A1 WO 2015023147A1
Authority
WO
WIPO (PCT)
Prior art keywords
mesenchymal stem
stem cells
rapamycin
treated
cell
Prior art date
Application number
PCT/KR2014/007583
Other languages
English (en)
French (fr)
Inventor
양철우
조미라
박성환
문수진
김은경
정병하
김경운
이선영
이성희
양은지
정정희
박민정
김석중
이은정
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020140104575A external-priority patent/KR101723265B1/ko
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Priority to US14/912,391 priority Critical patent/US10851346B2/en
Publication of WO2015023147A1 publication Critical patent/WO2015023147A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0665—Blood-borne mesenchymal stem cells, e.g. from umbilical cord blood
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/06—Anti-neoplasic drugs, anti-retroviral drugs, e.g. azacytidine, cyclophosphamide

Definitions

  • the present invention relates to a mesenchymal stem cell having rapamycin-treated immunomodulatory ability and a cell therapeutic composition for preventing or treating immune diseases including the same.
  • Immunity is one of the body's self-protection systems against all foreign polymers (antigens) that invade or are injected into living tissue.
  • the main component of the immune system is lymphocytes, which are white blood cells that are made in the bone marrow and circulate along the blood into lymph tissues and organs, mainly lymph node spleen and tonsils.
  • B cells multiply rapidly when stimulated by the appropriate antigen, forming clones that produce specific antibodies (immunoglobulins) that neutralize the antigen.
  • Antibodies produced by B cells circulate in body fluids and perform humoral immunity. T cells are made in the thymus and travel to lymphoid tissue, responsible for cell-mediated immunity that directly attacks antigens.
  • one of the most important traits of all normal individuals is that they do not deleteriously react with the antigenic substances that make up self, while many non-self antigens can be recognized and reacted to eliminate them. It has the ability to The non-response of the body to autoantigens is called immunologic unresponsiveness or tolerance. When a problem arises in inducing or maintaining such self-tolerance, an immune response occurs to autoantigens, and as a result, various autoimmune diseases occur while attacking one's own tissues.
  • the main method for treating such autoimmune diseases is mainly used drugs that inhibit the autoimmune function.
  • drugs that inhibit the autoimmune function.
  • cell therapies for the treatment of immune diseases have been developed, and studies to use stem cells as cell therapies are increasing.
  • the mesenchymal stem cells of the stem cells has not yet been investigated the exact mechanism of action on the immunomodulatory ability and there is little research on the production of stem cells with excellent immune disease treatment effect.
  • the present inventors have been studying cell therapy for immunotherapy by using stem cells, and confirming that mesenchymal stem cells prepared by treating rapamycin have an excellent immune disease treatment effect.
  • the invention has been completed.
  • an object of the present invention is in mesenchymal stem cells having immunomodulatory capacity to which rapamycin is treated; To provide mesenchymal stem cells expressing any one or more cell surface factors selected from the group consisting of CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 and CXCR4.
  • Another object of the present invention is to provide a cell therapy composition for the prevention or treatment of immune diseases, including mesenchymal stem cells having an immunomodulatory ability according to the present invention as an active ingredient.
  • Another object of the present invention is to provide a method for producing mesenchymal stem cells having the immunomodulatory ability.
  • the present invention is in mesenchymal stem cells having an immunomodulatory ability to be treated with rapamycin;
  • mesenchymal stem cells expressing any one or more cell surface factors selected from the group consisting of CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 and CXCR4.
  • the mesenchymal stem cells may be isolated from peripheral blood or adipose tissue.
  • the rapamycin may be treated at a concentration of 10-100mM based on the number of mesenchymal stem cells 2.5 ⁇ 10 5 to 7.5 ⁇ 10 5 cells.
  • the mesenchymal stem cells may be increased expression of any one or more factors selected from the group consisting of IDO, TGF- ⁇ and IL-10 by rapamycin treatment.
  • the mesenchymal stem cells may be one in which the expression of Phospho-mTOR, Rictor and Ractor, which are mTOR signaling factors, is reduced in the cells by rapamycin treatment.
  • the mesenchymal stem cells are treated by rapamycin;
  • the expression of any one or more autophagy inducers selected from the group consisting of Beclin1, ATG5, ATG7, LC3I and LCII may be increased in the mesenchymal stem cells.
  • the present invention also provides a cell therapy composition for the prevention or treatment of immune diseases, including mesenchymal stem cells having an immunomodulatory ability according to the present invention as an active ingredient.
  • the composition may be administered in the number of 1 ⁇ 10 6 to 5 ⁇ 10 7 cells per kilogram of body weight of the administration individual mesenchymal stem cells.
  • the present invention is treated with rapamycin at a concentration of 10-100 nM on mesenchymal stem cells of 2.5 ⁇ 10 5 -7.5 ⁇ 10 5 cells isolated from peripheral blood or adipose tissue, and 28-42 ° C. for 18-27 hours.
  • mesenchymal stem cells having an immunomodulatory capacity to which rapamycin is treated comprising the step of culturing under the conditions of culturing;
  • the present invention is in mesenchymal stem cells having immunomodulatory ability to be treated with rapamycin; Mesenchymal stem cells expressing any one or more cell surface factors selected from the group consisting of CCR1, CCR2, CCR3, CCR4, CCR7, CCR9, and CXCR4, cell therapeutic composition for preventing or treating immune diseases including the mesenchymal stem cells and It relates to a method for producing mesenchymal stem cells with immunomodulatory capacity.
  • Mesenchymal stem cells having immunomodulatory capacity treated with rapamycin according to the present invention have increased expression of one or more factors selected from the group consisting of IDO, TGF- ⁇ , and IL-10 having immunomodulatory capacity, and mTOR Expression of Phospho-mTOR, Rictor and Ractor, which are signaling factors, is reduced, and the mesenchymal stem cells are treated with rapamycin; Mesenchymal stem cells having an increased expression of at least one autophagy inducer selected from the group consisting of Beclin1, ATG5, ATG7, LC3I and LCII, wherein the cells are used as cell therapeutics in an immune disease individual. In this case, there is an effect that can effectively treat immune diseases.
  • Figure 1a is a result of analyzing the expression level of IL-10, IDO and TGF- ⁇ expressed in cells by treating rapamycin in the mesenchymal stem cells isolated from peripheral blood, Figure 1b prepared by treating rapamycin The amount of IDO and IL-10 expressed in human adipose tissue-derived mesenchymal stem cells was observed by fluorescence microscopy.
  • Figure 2 shows the results of analyzing the effect of Th17 cell proliferation inhibitory pathogenesis of mesenchymal stem cells.
  • Figure 3 shows the results of analyzing the expression changes of HMGB-1, IL-6, IL-1 ⁇ of rapamycin-treated mesenchymal stem cells.
  • Figure 4 shows the results of analyzing the phenotype of mesenchymal stem cells treated with rapamycin and mesenchymal stem cells not treated with rapamycin.
  • Figure 5 is a photograph of the degree of formation of autophagy vesicles formed in human adipose tissue-derived mesenchymal stem cells prepared by treatment with rapamycin through a microscope.
  • FIGS. 6A to 6C show the results of RT-PCR analysis of mRNA expression levels of ATG5, LC3A and LC3B, which are factors involved in autophagy, in human adipose tissue-derived mesenchymal stem cells prepared by treating rapamycin, respectively.
  • Figure 6a a picture of the expression of the factors involved in autophagy by Western blot analysis (Fig. 6c), and the result of quantifying the expression amount of each factor (Fig. 6b) is shown.
  • Figure 7 shows the results of comparing the expression level of factors involved in cell migration expressed on the cell surface of human adipose tissue-derived mesenchymal stem cells prepared by treatment with rapamycin.
  • FIG. 8 shows the results of analysis of cell migration of human adipose tissue-derived mesenchymal stem cells prepared by treating rapamycin using a cell migration assay kit
  • FIG. 8A shows the degree of staining of migrated cells.
  • FIG. 8B shows a graph of counting the moved cell numbers.
  • FIG. 9 is a group injected with human adipose tissue-derived mesenchymal stem cells prepared by treating rapamycin in a mouse model induced osteoarthritis (Rapa-MSC), a group injected only with mesenchymal stem cells (MSC), but not treated with the mouse model.
  • Rapa-MSC mouse model induced osteoarthritis
  • MSC mesenchymal stem cells
  • Figure 10 is a picture of H & E, Toluidin blue staining, saffranin O staining to analyze the degree of arthritis and cartilage destruction of osteoarthritis-induced animals.
  • Figure 11 shows the results of confirming the disease treatment effect of rapamycin-treated mesenchymal stem cells in the mouse model of inflammatory bowel disease.
  • Figure 13 shows the results of monitoring the concentration of IgG, IgG1, IgG2a in serum as a disease treatment effect by rapamycin-treated mesenchymal stem cells in a mouse model arthritis.
  • Figure 14 in one embodiment of the present invention, the osteoarthritis-induced animal model treated with mesenchymal stem cells alone (MSC) and rapamycin-treated mesenchymal stem cells (Rapa-MSC) for each
  • the graph shows the change in arthritis index.
  • Figures 15a to 15c shows the results of the treatment effect by injecting rapamycin-treated mesenchymal stem cells into a transplant rejection disease animal model.
  • Figure 16 shows the results of confirming the immunomodulatory ability of rapamycin on lupus animal model cells by adipose derived mesenchymal stem cells treated.
  • Figure 17 shows the results confirmed by the flow cytometry (FACS) Th17 and Treg cell regulation effect by rapamycin and mesenchymal stem cells of the present invention according to an embodiment of the present invention.
  • the present invention is in mesenchymal stem cells having an immunomodulatory ability to be treated with rapamycin, having an excellent immune disease treatment effect; CC chemokine receptor type 1 (CCR1), CC chemokine receptor type 2 (CCR2), CC chemokine receptor type 3 (CCR3), CC chemokine receptor type 4 (CCR4), CC chemokine receptor type 7 (CCR7), CC chemokine receptor CCR9 It is characterized by providing mesenchymal stem cells expressing any one or more cell surface factors selected from the group consisting of type 9) and CXCR4 (CXC chemokine receptor type 4).
  • rapamycin is IUPAC nomenclature (3S, 6R, 7E, 9R, 10R, 12R, 14S, 15E, 17E, 19E, 21S, 23S, 26R, 27R, 34aS) -9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-9,27-dihydroxy-3 -[(1R) -2-[(1S, 3R, 4R) -4-hydroxy-3-methoxycyclohexyl] -1-methylethyl] -10,21-dimethoxy-6,8,12,14,20,26-hexamethyl -23,27-epoxy-3H-pyrido [2,1-c] [1,4] -oxaazacyclohentriacontine-1,5,11,28,29 (4H, 6
  • mesenchymal stem cells prepared by treating with rapamycin have a remarkable therapeutic effect of immune disease compared to mesenchymal stem cells not treated with rapamycin. Excellent was confirmed through experiments.
  • the present invention can provide mesenchymal stem cells having an immunomodulatory ability to which rapamycin is treated, and a cell therapeutic composition for the prevention or treatment of immune diseases comprising the mesenchymal stem cells having the immunomodulatory ability as an active ingredient Can be provided.
  • the mesenchymal stem cells are stem cells that are separated from bone marrow, blood, dermis and periosteum, and are pluripotent capable of differentiating into various cells such as adipocytes, chondrocytes and bone cells. ) Or multipotent cells.
  • the mesenchymal stem cells used in the present invention may be mesenchymal stem cells of animals, preferably mammalian, more preferably human mesenchymal stem cells.
  • the mesenchymal stem cells of the present invention may be derived from bone marrow, adipose tissue, peripheral blood, liver, lung, amniotic fluid, placental chorion or umbilical cord blood, preferably derived from adipose tissue or peripheral blood.
  • mesenchymal stem cells can be obtained from a variety of sources as described above.
  • the process of obtaining mesenchymal stem cells is described in detail as follows: (1) a mammal including a human or a mouse, preferably, a human Separating the mesenchymal stem cells from the mesenchymal stem cell source of, for example, blood or bone marrow or adipose tissue; (2) culturing the isolated cells in a suitable medium; And (3) can be obtained through the step of removing the floating cells in the culturing process and passaging the cells attached to the culture plate to obtain the finally constructed mesenchymal stem cells.
  • the medium used in the above process any medium commonly used for culturing stem cells can be used.
  • the medium contains serum (eg fetal calf serum, horse serum and human serum).
  • serum eg fetal calf serum, horse serum and human serum.
  • Medium that can be used in the present invention is, for example, RPMI series, Eagles's MEM, ⁇ -MEM, Iscove's MEM, 199 medium, CMRL 1066, RPMI 1640, F12, F10, DMEM (Dulbecco's modification of Eagle's medium), DMEM And mixtures of and F12, Way-mouth's MB752 / 1, McCoy's 5A, and MCDB series.
  • the medium may include other components such as antibiotics or antifungal agents (eg, penicillin, streptomycin), glutamine, and the like.
  • identification of the mesenchymal stem cells isolated and cultured can be performed through flow cytometry.
  • flow cytometry is carried out using specific surface markers of mesenchymal stem cells.
  • mesenchymal stem cells have a positive response to CD44, CD29, and / or MHC class I, thereby allowing mesenchymal stem cells to be validated.
  • rapamycin was treated to prepare new mesenchymal stem cells having immunomodulatory ability.
  • the rapamycin is a compound well known as an antimicrobial agent and has been found in microorganism Streptomyces and on an ester island famous for its giant gargoyle. It is known that such rapamycin has an activity of inhibiting cell division of fungi, and it is also known that it has an immunosuppressive effect. In recent years, it has also been found to have anticancer activity.
  • the present inventors treated mesenchymal stem cells with rapamycin to develop a new immune disease therapeutic agent using rapamycin and mesenchymal stem cells.
  • the expression of TGF- ⁇ , IDO and IL-10 genes associated with regulatory capacity was found to be significantly increased (see FIGS. 1A and 1B).
  • the TGF- ⁇ , IDO, and IL-10 which are related to immunomodulatory ability, may be used to promote or inhibit the growth of TGF- ⁇ (TGF- ⁇ ) cells.
  • TGF- ⁇ TGF- ⁇
  • the rapamycin-treated adipose tissue-derived mesenchymal stem cells were found to increase the expression level of TGF- ⁇ almost 30-fold compared to the case without rapamycin.
  • IDO indoleamine 2,3-dioxygenase
  • mesenchymal stem cells of the present invention prepared by treating rapamycin were also found to have increased expression of genes involved in autophagy, and mTOR signaling was inhibited in these cells. (See FIGS. 6A-6C).
  • Autophagy is a process in which bacteria break down their organelles and cellular components, and is distinct from heterophages that accept polymers from cells by intracellular uptake such as negative or phagocytosis.
  • cells act to break down their proteins or to remove unnecessary cellular components in the process of rebuilding the cells.
  • the cellular components are surrounded by membranes derived from the endoplasmic reticulum, forming a follicle. It is fused with cotton to form a child pagolyosomal to decompose.
  • the mesenchymal stem cells treated with rapamycin in the present invention because the autophagy action can control the beneficial or harmful effects of immunity and inflammation and can prevent infectious diseases, autoimmunity and inflammatory diseases. It has autophagy and may be more useful for the treatment of immune and inflammatory diseases.
  • the degree of mTOR phosphorylation is decreased when rapamycin is treated as a result of analyzing the degree of mTOR phosphorylation of the active type. And the expression of Rictor and Ractor was also reduced.
  • mTOR signaling pathway is very important in regulating protein synthesis and is known to be activated in various cancer cells. Hsieh et al. Have found that several genes involved in cancer cell invasion in both prostate and mouse prostate cancer are regulated by mTOR. In addition, mTOR signal suppression has been reported to have a wide range of regulatory effects on immune cells as well as the effect on tumor cells, in particular the inhibition of mTOR is known to be directly linked to the immunosuppressive effect.
  • the present inventors investigated whether mesenchymal stem cells prepared by treating rapamycin have cell mobility. As a result, in the case of mesenchymal stem cells treated with rapamycin, expression of chemokines related to cell mobility in cells is increased. It was confirmed that it is (see FIG. 7 and FIG. 8).
  • the present inventors could expect that when the mesenchymal stem cells according to the present invention is used as a cell therapeutic agent, cells can be efficiently moved to the target lesion site to derive a therapeutic effect at a target point.
  • the mesenchymal stem cells prepared in the present invention are prepared by treating rapamycin at a concentration of 10-100 nM based on the number of mesenchymal stem cells 1 ⁇ 10 6 to 5 ⁇ 10 7 cells per kilogram of body weight of the subject administered. More preferably, rapamycin is treated at a concentration of 100 nM in 5 ⁇ 10 5 cells of mesenchymal stem cells isolated from peripheral blood or adipose tissue, and cultured at a temperature of 28-42 ° C. for 18-27 hours. It may be prepared through the step.
  • the present invention can provide a cell therapeutic composition for the prevention or treatment of immune diseases, including mesenchymal stem cells having the immunomodulatory capacity as an active ingredient.
  • the cell therapeutic agent refers to a method of proliferating or screening live autologous, allogenic, or xenogenic cells in vitro or restoring biological characteristics of cells in order to restore the function of cells and tissues.
  • These cell therapies can be broadly classified into two fields. The first is stem cell therapy for tissue regeneration or long-term function recovery, and the second is immunization for the regulation of immune responses such as suppressing the immune response or enhancing the immune response in vivo. Can be classified as a cell therapy.
  • the route of administration of the cell therapy composition of the present invention may be administered via any general route as long as it can reach the desired tissue.
  • Parenteral administration for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration may be, but is not limited thereto.
  • composition may be formulated in a suitable form with a pharmaceutical carrier generally used for cell therapy.
  • a pharmaceutical carrier generally used for cell therapy.
  • 'Pharmaceutically acceptable' refers to a composition that is physiologically acceptable and does not cause an allergic or similar reaction, such as gastrointestinal disorders, dizziness or the like, when administered to a human.
  • Pharmaceutically acceptable carriers include, for example, water, suitable oils, saline, carriers for parenteral administration such as aqueous glucose and glycols, and the like, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
  • Other pharmaceutically acceptable carriers may be referred to those described in the following documents (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
  • composition may also be administered by any device in which the cell therapy agent can migrate to the target cell.
  • the cell therapy composition of the present invention may include a therapeutically effective amount of cell therapy for the treatment of a disease.
  • therapeutically effective amount means an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, as thought by a researcher, veterinarian, doctor or other clinician. This includes amounts that induce alleviation of the symptoms of the disease or disorder being treated.
  • the cell therapy agent included in the composition of the present invention will vary depending on the desired effect. Therefore, the optimal cell therapy content can be readily determined by one skilled in the art and includes the type of disease, the severity of the disease, the amount of other components contained in the composition, the type of formulation, and the age, weight, general health, sex and diet of the patient.
  • the composition of the present invention may include a cell therapy agent having a number of 1 ⁇ 10 6 to 5 ⁇ 10 7 cells per kg of mesenchymal stem cells having immunomodulatory capacity.
  • the present invention also provides a method for preventing or treating an immune disease comprising administering to a mammal a therapeutically effective amount of the cell therapy composition of the present invention.
  • mammal refers to a mammal that is the subject of treatment, observation or experiment, preferably human.
  • the cell therapy agent included in the composition is 1 ⁇ 10 4 to 1 ⁇ 10 8 cells per kg of body weight. It is preferable to include.
  • the composition comprising the cell therapy of the present invention as an active ingredient is rectal, intravenous (intravenou s therapy, iv), intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, intraocular or Administration can be in a conventional manner via the intradermal route.
  • intravenous intravenou s therapy, iv
  • intraarterial intraperitoneal
  • intramuscular intrasternal
  • transdermal topical
  • intraocular or Administration can be in a conventional manner via the intradermal route.
  • the immune disease to be treated by mesenchymal stem cells prepared by rapamycin treatment and cell therapy composition for treating immune diseases comprising the cells is not limited thereto, osteoarthritis, rheumatoid arthritis, asthma, dermatitis , Psoriasis, cystic fibrosis, late organ transplantation and chronic rejection, graft-versus-host disease, graft rejection disease, multiple sclerosis, systemic lupus erythematosus, Sjogren's syndrome, Hashimoto's thyroid, polymyositis, scleroderma, Addison's disease, vitiligo, pernicious anemia, Glomerulonephritis and pulmonary fibrosis, inflammatory growth disease, Crohn's disease, autoimmune diabetes, diabetic retinopathy, rhinitis, ischemia-reperfusion injury, restenosis after angioplasty, chronic obstructive heart disease, Grave disease, gastrointestinal allergy, conjunctivitis, at
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • Adipose tissue obtained by liposuction or adipose tissue obtained after surgery was washed 10 times or more with PBS containing 10% penicillin-streptomycin to remove blood and foreign bodies, and then the tissue was chopped to 0.2-0.3 g. . 0.2% collagenase (Roche, Sandhofer Strasse, Mannheim, Germany) in a solution was reacted for 1 hour at 100 °C water bath, 37 °C. After separating the solution layer and the undecomposed pieces by the collagenase using a 100 ⁇ m mesh, the same amount of PBS was added to the separated collagenase solution. Subsequently, centrifugation was performed at 4 ° C.
  • MSCGM mesenchymal stem cell growth media: MSC basal medium (Cambrex, Walkersville, MD, USA), mesenchymal growth aid (Cambrex, Walkersville, MD, USA), 4 mM L, to remove remaining collagenase solution from submerged MSC -Glutamine and penicillin (0.025unit / 500ml) / Streptomycin (0.025mg / 500ml)] was added again centrifuged for 5 minutes at 4 °C, 1200rpm.
  • MSCGM is a medium based on DMEM containing fetal calf serum. Subsequently, the supernatant was removed, and the obtained MSC was inoculated in a culture plate and incubated in a 37%, 5% CO 2 incubator with MSCGM. Incubate while replacing the culture medium every other day.
  • Rapamycin was treated in the mesenchymal stem cells isolated and cultured in Example 1, and then the expression changes of IDO, IL-10 and TGF- ⁇ , which are genes related to immunomodulatory activity, were analyzed.
  • adipose tissue-derived mesenchymal stem cells were treated with rapamycin at a concentration of 100 nM for 5 ⁇ 10 5 cell numbers under 60 mm dish conditions.
  • mesenchymal stem cells not treated with rapamycin were used as a control group, and the expression level of the immunomodulatory genes in rapamycin-treated mesenchymal stem cells was analyzed using real time PCR.
  • FIG. 1A when rapamycin was treated in mesenchymal stem cells, the expression levels of IL-10, IDO, and TGF- ⁇ were increased by 5 times as compared to the rapamycin-treated group.
  • FIG. 1B light microscopic analysis showed that IL-10 cytokine also significantly increased its expression by the treatment of rapamycin.
  • the present inventors have found that the mesenchymal stem cells treated with rapamycin significantly increase the expression of IDO, IL-10 and TGF- ⁇ in comparison with cells not treated with rapamycin.
  • the present inventors examined the T cell proliferation response by treating with cymidine to investigate the inhibitory effect of T cell proliferation by mesenchymal stem cells treated with rapamycin.
  • mouse CD4 + T cells (1 ⁇ 10 5 ) and mesenchymal stem cells (1 ⁇ 10 4 ) were added at a ratio of 1:10 and co-cultured at 37 ° C. in 96-well plates for 3 days.
  • T cell proliferation was examined by treating cymidine to analyze T cell proliferation inhibitory ability.
  • HMGB-1 IL-mobility group protein B1
  • IL-6 IL-mobility group protein B1
  • IL-6 IL-6
  • adipose tissue-derived mesenchymal stem cells were treated with rapamycin at a concentration of 100 nM for 5 ⁇ 10 5 cell numbers under 60 mm dish conditions.
  • mesenchymal stem cells not treated with rapamycin were used as a control group, and the expression level of the immunomodulatory genes in rapamycin-treated mesenchymal stem cells was analyzed using real time PCR.
  • Rapamycin was treated to the mesenchymal stem cells isolated and cultured in Example 1, and then the phenotypes of the mesenchymal stem cells were analyzed. In this case, mesenchymal stem cells not treated with rapamycin were used as a control group, and the expression level of cell markers in rapamycin-treated mesenchymal stem cells was analyzed using flow cytometry.
  • the group treated with rapamycin in mesenchymal stem cells expressed the same positive markers CD105, CD29, and CD44 similarly to the group not treated with rapamycin, and the negative markers CD45, HLA- Expression of DR was all negative.
  • Beclin-1 and LC3 are proteins that increase expression during autophagy. Beclin-1 is known to play an important role in the formation of sutophagosomes.
  • LC3I form is converted to LC3II form among LC3 forms. As it binds to the membrane of the autophagosome, it is a direct indicator of the autophagosome.
  • the mesenchymal stem cells treated with rapamycin in the present invention are autologous. Having a phagocytosis may be more useful for the treatment of immune and inflammatory diseases.
  • the present inventors treated the rapamycin with mesenchymal stem cells at a concentration of 50 ⁇ M, and after 1 hour, observed the degree of autophagy vesicle formation with an electron microscope.
  • a cDNA synthesis kit (Roche, Transcriptor First Strand cDNA Synthesis Kit) was prepared based on the RNA. Thereafter, the expression levels of the ATG5, LC3A, and LC3B genes, which have the synthesized cDNA, were analyzed by real-time PCR. And at this time, each primer sequence performed for PCR is as described below.
  • the present inventors performed western blot for the rapamycin-treated mesenchymal stem cells following the results of ⁇ 6-1>, in which the mTOR signal pathway can be regulated by rapamycin.
  • 10 ng / ml of rapamycin was applied to mesenchymal stem cells derived from human adipose tissue, and after 1 hour, the cells were lysed to extract proteins.
  • the extracted protein was subjected to SDS-PAGE electrophoresis, followed by electrophoresis of the proteins onto a nitrocellulose membrane, followed by blocking for 1 hour with 5% skim milk, followed by Beclin1, ATG5, ATG7, LC3I, II, React by attaching primary antibodies against Phospho-mTOR, mTOR, Rictor, and Ractor, reacting with secondary antibodies against them, and then exposing these genes to photosensitized Kodak X-rays using Enhanced Chemilunimoecence (ECL) solution. The degree of protein expression was analyzed (Fig. 6c).
  • ECL Enhanced Chemilunimoecence
  • rapamycin treatment showed that mTOR activation (phosphorylation) was inhibited in mesenchymal stem cells, whereas Beclin1, ATG5, ATG7, LC3I, II expression was increased.
  • ATG7 was found to have a very high degree of expression increase.
  • mesenchymal stem cells treated with rapamycin have suppressed the activation of mTOR and expression of mTOR signaling factor, whereas the expression of genes related to autophagy is increased. I could see that.
  • adipose-derived mesenchymal stem cells treated with rapamycin (treated with 50 nM) have cell migration ability, they can move to the lesion site, and CCR1, CCR2, CCR3, which are factors related to the movement of mesenchymal stem cells,
  • CCR1, CCR2, CCR3, which are factors related to the movement of mesenchymal stem cells The expression levels of CCR4, CCR7, CCR9 and CXCR4 were analyzed by real-time PCR.
  • CCR1 about 115-fold
  • CCR2 about 25-fold
  • CCR3 about 70-fold
  • CCR4 in mesenchymal stem cells treated with rapamycin compared to the group without rapamycin treatment.
  • CCR7 about 200-fold
  • CCR9 about 150-fold
  • CXCR4 about 60-fold
  • the cell migration kit (Chemicon, Temecula, CA) was used for analysis. That is, in the lower chamber, CD4 + T cell alone group, CD4 + T cell and Rapamycin (10ng / ml) treated group, SDF-1 and CD4 + T cell treated group were placed, respectively, and the mesenchymal stem cells were placed in the upper chamber. Put it in. Since the adipose tissue-derived mesenchymal stem cells put on the above stained the cells passing through the polycarbonate membrane in order to move to the lower chamber, counting the number was observed.
  • the therapeutic effects of the osteoarthritis-induced animal models were first examined.
  • a 5-week-old male Wistar rat central test animal
  • 200-250 g was bred at a temperature of 21-22 ° C. at a light-dark cycle at 12-hour intervals. Feed was raised.
  • osteoarthritis-induced mouse animals were prepared by injecting 50 mg of 3 mg monosodium iodoacdtate (Sigma, ST. Louis, MO) using an intra-articular 26.5G syringe to induce osteoarthritis. .
  • the osteoarthritis-induced mice were injected with iv twice a week, once every two weeks, with mesenchymal stem cells treated with rapamycin at a concentration of 100 nM and mesenchymal stem cells of 2 ⁇ 10 6 cells. Then, after 7 days, pain was measured, which is an indicator for evaluating the effect on the behavior of osteoarthritis-inducing animals, and the destruction of cartilage was analyzed by india ink staining.
  • the mouse group injected with rapamycin-treated mesenchymal stem cells As a result, as shown in Figure 9, compared to the mouse group injected with mesenchymal stem cells, the mouse group injected with rapamycin-treated mesenchymal stem cells, the pain response was found to be close to the normal mouse, cartilage The degree of destruction was similar to that of the rapamycin-treated mesenchymal stem cells.
  • the picture shown in Fig. 9B shows the cartilage damage site, from the left, the first picture is osteoarthritis-induced mouse group, the second picture is a group treated with MSC after osteoarthritis induction, the third photo after induction of osteoarthritis The group treated with rapamycin-treated MSCs showed that cartilage damage was the lowest in the third photograph compared to the other groups.
  • test animals used C57BL / 6 (H-2kb) mice, which were infused with 3.5% dextran sulfate sodium (DSS) water for 1 week. Inflammatory bowel disease induction animal models were constructed. The inflammatory bowel disease mouse was then infused with adipose tissue-derived mesenchymal stem cells and rapamycin-treated adipose tissue-derived mesenchymal stem cells twice a week in iv at a cell number of 2 ⁇ 10 6 , and symptoms (weight) , Colon length, and DAI (disease activity index) were checked.
  • DSS dextran sulfate sodium
  • Fig. 11 compared with the group treated with adipose tissue-derived mesenchymal stem cells alone, mesenchymal stem cells treated with rapamycin showed that the weight of mice reduced by inflammatory bowel disease was more effectively recovered.
  • a in FIG. 11 IBD disease activity was also markedly reduced (B in FIG. 11), and the thickness and length of the large intestine were also recovered, and the shortening of the long length recovered similarly to normal. (C of FIG. 11).
  • the present inventors confirmed the disease control effect of mesenchymal stem cells treated with rapamycin in the inflammatory bowel disease mouse model used in Example 10, through H & E staining in tissues.
  • FIG. 12A IHC staining of the inflammatory cytokine TNF-a in the intestine revealed a significant decrease in the amount of TNF-a in the model injected with rapamycin-treated mesenchymal stem cells compared to the disease-induced group.
  • FIG. 12B IHC staining of the inflammatory cytokine TNF-a in the intestine revealed a significant decrease in the amount of TNF-a in the model injected with rapamycin-treated mesenchymal stem cells compared to the disease-induced group.
  • the present inventors performed the following experiment to determine whether rapamycin-treated mesenchymal stem cells have a therapeutic effect on arthritis.
  • a IL-1Ra knockout mouse was produced according to a method published by the Y. Iwakura team, which lacks the IL-1 receptor gene.
  • the IL-1 receptor antagonist (IL-1Ra) acts directly on the IL-1 receptor, preventing IL-1 ⁇ and IL-1 ⁇ from acting on the receptor, thereby naturally causing autoimmune arthritis diseases. Way.
  • mice with arthritis induced rapamycin-treated mesenchymal stem cells prepared in the present invention were injected into the diseased mouse, rapamycin-treated mesenchymal stem cells were injected into the mice at a cell number of 2 ⁇ 10 6 .
  • a total of three injections were made once a week, and after one week, serum was separated from these mice and analyzed for the amount of IgG, IgG1 and IgG2a present in the serum.
  • the control group was used to measure the amount of immunoglobin in the serum of arthritis-induced mice and the serum of arthritis mice injected with only adipose tissue-derived mesenchymal stem cells.
  • mice treated with rapamycin-treated mesenchymal stem cells showed improved symptoms of arthritis, compared with those treated with mesenchymal stem cells alone. Both production of IgG2a was found to be significantly reduced (FIG. 13).
  • rapamycin-treated mesenchymal stem cells have an activity that can modulate an immune response, and thus can be useful as a therapeutic agent for immune diseases, particularly autoimmune diseases.
  • the present inventors confirmed the therapeutic effect after administration to an animal model of rheumatoid arthritis through induction of autoantigen activity in order to confirm the therapeutic effect of rapamycin-treated mesenchymal stem cells and normal mesenchymal stem cells.
  • DBA / 1J mice were mixed with type II collagen (CII) and CFA (adjuvant) 1: 1, injected 100 ⁇ g of CII per mouse in 50 ⁇ l dose into the tail base, and after 2 weeks CII And IFA 1: 1, and the mixed solution was injected secondly at 100 ⁇ g / 50 ⁇ l.
  • CII type II collagen
  • CFA adjuvant
  • Arthritis evaluation was performed. Arthritis was evaluated after administration of arteritis induced mouse mesenchymal stem cells treated with intravenous 1 ⁇ 10 6 or mesenchymal stem cells treated with rapamycin once a week after arthritis induced mice. In order to measure the arthritis index, three observers, who did not know the contents of the experiment, evaluated the severity of joint inflammation three times a week and observed it until 29 days.
  • the evaluation of arthritis is based on the average arthritis index by Rossolinec et al.,
  • the average score divided by 3 is obtained by adding the scores according to the following scales on the three legs except the legs to which CII / CFA was administered at the time of the second dose per horse.
  • the mean obtained by summing the values obtained by three observers in the animal model was used.
  • the scores and criteria according to arthritis evaluation are as follows.
  • the best arthritis index per maridang is 4, so the best disease index per rat is 16.
  • arthritis was significantly suppressed in the mouse group injected with rapamycin-treated mesenchymal stem cells compared with the mouse group injected with mesenchymal stem cells.
  • the present inventors carried out the following experiment to determine whether rapamycin-treated mesenchymal stem cells have a therapeutic effect against transplant rejection disease.
  • mice Balb / c H-2k / d
  • TBI systemic irradiation
  • femur and tibia of the donor mouse C57BL / 6
  • Hematopoietic stem cells and splenocytes were isolated from and transplanted into hematopoietic stem cells 5 ⁇ 10 6 and splenocytes 1 ⁇ 10 6 in mouse Balb / c (H-2k / d ).
  • the mesenchymal stem cells treated with nothing or the rapamycin-treated mesenchymal stem cells the next day were administered at a cell number of 1 ⁇ 10 6 intraperitoneally, and their efficacy evaluation was performed.
  • mice were compared with those of the mice treated with rapamycin-treated mesenchymal stem cells compared with those injected with mesenchymal stem cells. It was confirmed that the degree was improved and the survival of the mice was also maintained for 30 days (FIG. 15A).
  • the mesenchymal stem cells treated with rapamycin prepared in the present invention were injected into the diseased mice in a transplant rejection disease model mouse.
  • the skin and organs (liver) of the mice were collected, fixed in 10% neutral buffered formalin, embedded in paraffin, and tissue sections made and attached to slides.
  • xylen xylen
  • ethanol was hydrated from high to low concentrations. The staining process was hematoxylin and eosin staining.
  • spleens were collected from transplant rejection disease model mice. Cytokines (IFN- ⁇ , IL-17, IL-4, Foxp) were stained from the spleens, and analyzed by light microscopy, and analyzed for splenocyte T cell subsets in each mouse.
  • Cytokines IFN- ⁇ , IL-17, IL-4, Foxp
  • mice treated with rapamycin-treated mesenchymal stem cells showed significantly decreased Th1 (IFN- ⁇ ) and Th17 (IL-17) cells.
  • Th2 (IL-4), Treg (Foxp3 +) cells were found to be significantly increased (Fig. 15c).
  • rapamycin-treated mesenchymal stem cells have an activity that can modulate an immune response, and thus can be useful as a therapeutic agent for immune diseases, particularly autoimmune diseases.
  • the present inventors investigated the immunomodulatory ability of rapamycin on lupus animal model cells treated with adipose derived mesenchymal stem cells.
  • Roquin gene mutant mouse is an autoimmune disease mouse model similar to lupus due to hypersecretion of autoantibodies due to increased induction of Th cells and increased germinal center response due to overexpression of inducible costimulator (ICOS), and to separate cells from Roquin mouse, a lupus animal model After 3 days of co-culture with mesenchymal stem cells at a ratio of 1:10, the activity of immunoregulatory T cells (Foxp3 + Treg) was analyzed by flow cytometry.
  • ICS inducible costimulator
  • the amount of IL-17 in the culture medium was significantly decreased in the treated group compared to the group not treated with rapamycin, and the activity of immunoregulatory T cells was further increased. .
  • rapamycin can be applied to mesenchymal stem cells to be used as a cell therapy for the treatment of immune diseases.
  • the present inventors examined the immunomodulatory ability of mesenchymal stem cells derived from rapamycin-treated rheumatoid arthritis patients.
  • Mouse CD4 + T cells (1 ⁇ 10 5 cells) and mesenchymal stem cells derived from rheumatoid arthritis patients (1 ⁇ 10 4 cells) were co-cultured at 37 ° C. in 96-well plates for 3 days at a ratio of 1:10.
  • the activity of immunoregulatory T cells (Foxp3 + Tregs) was analyzed by flow cytometry.
  • the amount of IL-17 in the culture medium was decreased in the treated group compared to the group not treated with rapamycin, and the activity of immunoregulatory T cells was further increased.
  • rapamycin can be applied to mesenchymal stem cells to be used as a cell therapy for the treatment of immune diseases.
  • the present invention was carried out with the support of the following national R & D program.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Rheumatology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 면역조절능을 갖는 간엽 줄기세포 및 이의 제조방법에 관한 것으로, 보다 구체적으로 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서; CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포, 상기 간엽 줄기세포를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물 및 면역조절능을 갖는 간엽 줄기세포의 제조방법에 관한 것이다. 본 발명에 따른 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포는 면역조절능을 갖는 인자인 IDO, TGF-β 및 IL-10의 발현이 증가되어 있고, mTOR의 신호전달 인자인 Phospho-mTOR, Rictor 및 Ractor의 발현은 감소되어 있으며, 자가포식 유도인자인 Beclin1, ATG5, ATG7, LC3I 또는 LCII의 발현이 상기 세포 내에서 증가되어 있는 세포로서, 이 세포를 면역질환 개체에 세포치료제로 사용하는 경우, 효과적으로 면역질환을 치료할 수 있다.

Description

mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
본 발명은 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물에 관한 것이다.
면역(Immunity)은 생체 조직으로 침입하거나 주입되는 모든 외부 고분자물질(항원)에 대한 생체의 자기보호 체계의 하나이다. 면역체계의 주요한 구성성분으로 림프구가 있는데, 이는 골수에서 만들어져서 혈액을 따라 림프 조직이나 기관, 주로 림프절비장편도 등으로 순환하는 백혈구다. B 세포는 적절한 항원에 의해 자극되면 빠르게 증식하여, 그 항원을 중화시킬 특별한 항체(면역글로불린)를 만들어내는 클론을 형성한다. B 세포가 생성하는 항체는 체액에서 순환하면서 체액성면역을 수행한다. T 세포는 흉선에서 만들어져 림프 조직으로 이동하는데, 항원을 직접 공격하는 세포매개성면역을 담당한다.
또한, 모든 정상 개체에 있어서 가장 중요한 특성 중의 하나는 자기(self)를 구성하고 있는 항원 물질에 대해서는 해롭게 반응하지 않는 반면, 많은 비자기(non-self) 항원에 대해서는 이를 인식하고 반응하여 제거할 수 있는 능력을 갖고 있다는 것이다. 이처럼 자기항원에 대한 생체의 무반응을 면역학적 무반응성(immunologic unresponsiveness) 또는 관용(tolerance)이라 한다. 이러한 자기관용을 유도하거나 계속 유지하는데 있어서 문제가 생기게 되면 자기항원에 대하여 면역반응이 일어나게 되고, 이로 인하여 자신의 조직을 공격하는 현상이 발생하면서 각종 자가면역질환이 발병하게 된다.
한편, 이러한 자가면역질환을 치료하는 주된 방법은 주로 자기면역 기능을 억제하는 약물이 사용되고 있다. 그러나 부작용이 많아 지속적으로 사용하기 곤란하고 재발을 충분히 막지 못하여 치료에 한계가 있다. 따라서 보다 효과적인 새로운 면역질환 치료제의 개발이 연구 및 개발되고 있는데, 최근 들어 면역질환 치료를 위한 세포치료제가 개발이 되고 있으며, 세포치료제로서 줄기세포를 이용하려는 연구가 점점 증가하고 있다. 특히, 줄기세포 중 중간엽 줄기세포(mesenchymal stem cell)는 아직까지 면역조절능력에 대한 정확한 작용기전이 밝혀져 있지 않고 우수한 면역질환 치료 효과를 갖는 줄기세포의 제조에 대한 연구도 거의 없는 실정이다.
이에 본 발명자들은 줄기세포를 이용하여 효과적으로 면역치료를 위한 세포치료제를 연구하던 중, 라파마이신을 처리하여 제조한 간엽 줄기세포(mesenchymal stem cell)가 우수한 면역질환 치료 효과를 갖는다는 사실을 확인함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 라파마이신(rapamycin)이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서; CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포를 제공하는 것이다.
또한, 본 발명의 다른 목적은 상기 본 발명에 따른 면역조절능을 갖는 간엽 줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물을 제공하는 것이다.
또한, 본 발명의 다른 목적은 상기 면역조절능을 갖는 간엽 줄기세포의 제조방법을 제공하는 것이다.
상기와 같은 본 발명의 목적을 달성하기 위해서, 본 발명은 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서; CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포를 제공한다.
본 발명의 한 구현예에 있어서, 상기 간엽 줄기세포는 말초혈액 또는 지방조직으로부터 분리된 것일 수 있다.
본 발명의 한 구현예에 있어서, 상기 라파마이신은 간엽 줄기세포 2.5×105 내지 7.5×105 세포수를 기준으로 10-100mM의 농도로 처리하는 것일 수 있다.
본 발명의 한 구현예에 있어서, 상기 간엽 줄기세포는 라파마이신 처리에 의해 IDO, TGF-β 및 IL-10으로 이루어진 군으로부터 선택되는 어느 하나 이상의 인자의 발현이 증가된 것일 수 있다.
본 발명의 한 구현예에 있어서, 상기 간엽 줄기세포는 라파마이신 처리에 의해 mTOR의 신호전달 인자인 Phospho-mTOR, Rictor 및 Ractor의 발현이 상기 세포 내에서 감소되어 있는 것일 수 있다.
본 발명의 한 구현예에 있어서, 상기 간엽 줄기세포는 라파마이신 처리에 의해; Beclin1, ATG5, ATG7, LC3I 및 LCII로 이루어진 군으로부터 선택된 어느 하나 이상의 자가포식 유도인자의 발현이 상기 간엽 줄기세포 내에서 증가되어 있는 것일 수 있다.
또한, 본 발명은 상기 본 발명에 따른 면역조절능을 갖는 간엽 줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물을 제공한다.
본 발명의 한 구현예에 있어서, 상기 조성물은 면역조절능을 갖는 간엽 줄기세포를 투여개체의 체중 ㎏ 당 1×106 내지 5×107 세포수로 투여할 수 있다.
본 발명의 한 구현예에 있어서, 상기 면역질환은 골관절염, 류마티스 관절염(Rheumatoid Arthritis), 천식(Asthma), 피부염(Dermititis), 건선(Psoriasis), 낭섬유증(Cystic Fibrosis), 고형장기 이식 후기 및 만성 거부증(Post transplantation late and chronic solid organ rejection), 이식편대숙주질환(graft-versus-host disease), 이식거부질환, 다발성 경화증(Multiple Sclerosis), 전신성 홍반성 루푸스(systemic lupus erythematosus), 쇼그렌 증후군(Sjogren syndrome), 하시모토 갑상선(Hashimoto thyroiditis), 다발성근염(polymyositis), 경피증(scleroderma), 아디슨병(Addison disease), 백반증(vitiligo), 악성빈혈(pernicious anemia), 사구체신염(glomerulonephritis) 및 폐섬유증(pulmonary fibrosis), 염증성장질환(Inflammatory Bowel Diesese), 크론 병(Crohns disease), 자가면역성 당뇨(Autoimmune Diabetes), 당뇨 망막증(Diabetic retinopathy), 비염(Rhinitis), 허혈-재관류 손상(Ischemia-reperfusion injury), 혈관성형술후 재협착(Post-angioplasty restenosis), 만성 폐색성 심장 질환(Chronic obstructive pulmonary disease; COPD), 그레이브병(Graves disease), 위장관 알러지(Gastrointestinal allergy), 결막염(Conjunctivitis), 죽상경화증(Atherosclerosis), 관상동맥질환(Coronary artery disease), 협심증(Angina), 암 전이, 소동맥 질환 및 미토콘드리아 질환(mitochondrial disease)으로 이루어진 군으로부터 선택되는 것일 수 있다.
나아가, 본 발명은 말초혈액 또는 지방조직으로부터 분리된 2.5×105-7.5×105 세포수의 간엽 줄기세포에 라파마이신을 10-100nM의 농도로 처리하고, 18-27 시간 동안 28-42℃ 배양의 조건으로 배양하는 단계를 포함하는, 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서; CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포의 제조방법을 제공한다.
본 발명은 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서; CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포, 상기 간엽 줄기세포를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물 및 면역조절능을 갖는 간엽 줄기세포의 제조방법에 관한 것이다. 본 발명에 따른 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포는 면역조절능을 갖는 IDO, TGF-β 및 IL-10으로 이루어진 군으로부터 선택되는 어느 하나 이상의 인자의 발현이 증가되어 있고, mTOR의 신호전달 인자인 Phospho-mTOR, Rictor 및 Ractor의 발현은 감소되어 있으며, 상기 간엽 줄기세포는 라파마이신 처리에 의해; Beclin1, ATG5, ATG7, LC3I 및 LCII로 이루어진 군으로부터 선택된 어느 하나 이상의 자가포식 유도인자의 발현이 상기 간엽 줄기세포 내에서 증가되어 있는 간엽 줄기세포로서, 이 세포를 면역질환 개체에 세포치료제로 사용하는 경우, 효과적으로 면역질환을 치료할 수 있는 효과가 있다.
도 1a는 말초 혈액에서 분리한 간엽 줄기세포에 라파마이신을 처리하여 세포 내에서 발현되는 IL-10, IDO 및 TGF-β의 발현 정도를 분석한 결과이고, 도 1b는 라파마이신을 처리하여 제조한 인간 지방조직 유래 간엽 줄기세포에서 발현되고 있는 IDO 및 IL-10의 양을 형광현미경을 통해 관찰한 사진이다.
도 2는 중간엽 줄기세포의 병인 Th17 세포증식억제 효과를 분석한 결과를 나타낸 것이다.
도 3은 라파마이신을 처리한 간엽 줄기세포의 HMGB-1, IL-6, IL-1β의 발현 변화를 분석한 결과를 나타낸 것이다.
도 4는 라파마이신을 처리한 간엽 줄기세포 및 라파마이신이 처리되지 않은 간엽 줄기세포의 표현형을 분석한 결과를 나타낸 것이다.
도 5는 라파마이신을 처리하여 제조한 인간 지방조직 유래 간엽 줄기세포에서 형성되는 자가포식 소낭의 형성정도를 현미경을 통해 관찰한 사진이다.
도 6a 내지 도 6c는 각각 라파마이신을 처리하여 제조한 인간 지방조직 유래 간엽 줄기세포에서 자가포식 작용에 관여하는 인자인 ATG5, LC3A 및 LC3B의 mRNA 발현 정도를 RT-PCR를 수행하여 분석한 결과(도 6a)와, 자가포식 작용에 관여하는 인자들의 발현 정도를 웨스턴 블럿을 통해 분석한 사진(도 6c)과, 각 인자의 발현양을 수치화한 결과(도 6b)를 나타낸 것이다.
도 7은 라파마이신을 처리하여 제조한 인간 지방조직 유래 간엽 줄기세포의 세포 표면에서 발현되고 있는 세포 이동에 관여하는 인자들의 발현정도를 비교한 결과를 나타낸 것이다.
도 8은 라파마이신을 처리하여 제조한 인간 지방조직 유래 간엽 줄기세포의 세포 이동 정도를 세포 이동 분석키트를 사용하여 분석한 결과를 나타낸 것으로서, 도 8의 A는 이동된 세포들이 염색된 정도를 현미경으로 관찰한 것을 나타낸 것이고, 도 8의 B는 이동된 세포수를 카운팅하여 그래프로 나타낸 것이다.
도 9는 골관절염이 유도된 마우스 모델을 대상으로 라파마이신을 처리하여 제조한 인간 지방조직 유래 간엽 줄기세포를 주입한 군(Rapa-MSC), 간엽 줄기세포만을 주입한 군(MSC), 아무것도 처리하지 않은 군(MIA) 및 정상 마우스(Normal)군에서의 통증 분석 결과를 나타낸 것이고(A), 연골의 파괴정도를 인디아 잉크 염색법으로 염색하여 관찰한 사진이다(B).
도 10은 골관절염 유발 동물의 관절염증과 연골의 파괴정도를 분석하기 위해 H&E, Toluidin blue염색, saffranin O 염색을 한 사진이다.
도 11은 염증성 장질환 마우스 모델에서 라파마이신이 처리된 중간엽 줄기세포의 질환 치료 효과를 확인한 결과를 나타낸 것이다.
도 12는 염증성 장질환 마우스 모델에서 라파마이신이 처리된 중간엽 줄기세포에 의한 질병 제어 효과를 조직에서 H&E 및 IHC 염색을 통해 확인한 결과를 나타낸 것이다.
도 13은 관절염 마우스 모델에서 라파마이신이 처리된 중간엽 줄기세포에 의한 질환 치료 효과로서 serum 내 IgG, IgG1, IgG2a의 농도를 관찰한 결과를 나타낸 것이다.
도 14는 본 발명의 한 구현예에서, 골관절염이 유발된 동물모델에 중간엽 줄기세포를 단독 처리한 경우(MSC) 및 라파마이신을 처리한 중간엽 줄기세포의 경우(Rapa-MSC) 각각에 대한 관절염지수의 변화를 그래프로 나타낸 것이다.
도 15a 내지 도 15c는 라파마이신이 처리된 중간엽 줄기세포를 이식거부질환 동물 모델에 주입하여 치료 효과를 확인한 결과를 나타낸 것이다.
도 16은 라파마이신이 처리된 지방유래 간엽 줄기세포에 의한 루푸스 동물 모델 세포에 미치는 면역조절 능력을 확인한 결과를 나타낸 것이다.
도 17은 본 발명의 한 구현예에 따라서 본 발명의 라파마이신과 중간엽 줄기세포에 의한 Th17 및 Treg 세포 조절 효과를 유세포 분석기(FACS)로 확인한 결과를 나타낸 것이다.
본 발명은 우수한 면역질환 치료 효과를 갖는, 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서; CCR1(C-C chemokine receptor type 1), CCR2(C-C chemokine receptor type 2), CCR3(C-C chemokine receptor type 3), CCR4(C-C chemokine receptor type 4), CCR7(C-C chemokine receptor type 7), CCR9(C-C chemokine receptor type 9) 및 CXCR4(C-X-C chemokine receptor type 4)로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포를 제공함에 그 특징이 있다.
본 발명은 하기 화학식 1의 라파마이신을 간엽 줄기세포에 처리하는 것을 특징으로 하며, 라파마이신은 IUPAC 명명법으로 (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-9,27-dihydroxy-3-[(1R)-2-[(1S,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,27-epoxy-3H-pyrido[2,1-c][1,4]-oxaazacyclohentriacontine-1,5,11,28,29 (4H,6H,31H)-pentone 이고, 분자식은 C51H79NO13 이며, 분자량은 914.172이다.
<화학식 1>
Figure PCTKR2014007583-appb-I000001
본 발명자들은 면역질환을 치료할 수 있는 세포치료제를 개발하기 위 해 연구하던 중, 라파마이신을 처리하여 제조한 간엽 줄기세포가 라파마이신을 처리하지 않은 간엽 줄기세포에 비해 면역질환의 치료 효과가 현저하게 우수함을 실험을 통해 확인하였다.
따라서, 본 발명은 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포를 제공할 수 있으며, 상기 면역조절능을 갖는 간엽 줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료를 위한 세포치료제 조성물을 제공할 수 있다.
상기 간엽 줄기세포(Mesenchymal Stem Cell; MSC)는 골수(bone marrow), 혈액, 진피 및 골막 등에서 분리되는 줄기세포로서, 다양한 세포 예컨대 지방세포, 연골세포 및 뼈세포 등으로 분화할 수 있는 전능성(pluripotent) 또는 다능성(multipotent) 세포를 의미한다.
특히 본 발명에서 사용되는 상기 간엽줄기세 포는, 동물의 간엽 줄기세포일 수 있으며, 바람직하게는 포유동물, 보다 바람직하게는 인간의 간엽 줄기세포일 수 있다. 또한 본 발명의 간엽 줄기세포는 골수, 지방조직, 말초혈액, 간, 폐, 양수, 태반의 융모막 또는 제대혈로부터 유래된 것일 수 있으며, 바람직하게는 지방조직 또는 말초혈액에서 유래한 것을 사용할 수 있다.
참고로, 간엽 줄기세포는 상기와 같이 다양한 소스로부터 수득할 수 있는데, 간엽 줄기세포를 얻는 과정을 구체적으로 설명하면 다음과 같다: (1) 인간 또는 마우스를 포함하는 포유동물, 바람직하게는, 인간의 간엽 줄기세포 소스, 예컨대, 혈액 또는 골수 또는 지방조직으로부터 간엽 줄기세포를 분리하는 단계; (2) 분리된 세포를 적합한 배지에서 배양하는 단계; 및 (3) 배양과정에서 부유 세포를 제거하고 배양 플레이트에 부 착된 세포들을 계대 배양하여, 최종적으로 구축된 간엽 줄기세포를 수득하는 단계를 통하여 얻을 수 있다.
상기 과정에서 이용되는 배지로는, 줄기세포의 배양에 이용되는 일반적인 어떠한 배지도 이용할 수 있다. 바람직하게는, 혈청(예컨대, 우태아 혈청, 말 혈청 및 인간 혈청)이 함유된 배지이다. 본 발명에서 이용될 수 있는 배지는, 예를 들어, RPMI 시리즈, Eagles's MEM, α-MEM, Iscove's MEM, 199 배지, CMRL 1066, RPMI 1640, F12, F10, DMEM(Dulbecco's modification of Eagle's medium), DMEM과 F12의 혼합물, Way-mouth's MB752/1, McCoy's 5A 및 MCDB 시리즈를 포함하나, 이에 한정되는 것은 아니다. 상기 배지에는, 다른 성분 , 예를 들어, 항생제 또는 항진균제(예컨대, 페니실린, 스트렙토마이신) 및 글루타민 등이 포함될 수 있다.
또한, 분리하여 배양한 간엽 줄기세포의 확인은 유세포 분석을 통하여 할 수 있다. 이러한 유세포 분석은, 간엽 줄기세포의 특이한 표면 마커를 이용하여 실시된다. 예컨대, 간엽 줄기세포는 CD44, CD29 및/또는 MHC 클래스 I에 대하여 양성 반응을 나타내므로, 이를 통해 간엽 줄기세포를 검증할 수 있다.
한편, 본 발명에서 는 다양한 소스로부터 유래한 간엽 줄기세포를 면역질환의 치료 용도로 사용하고자 라파마이신을 처리하여 면역조절능을 갖는 새로운 간엽 줄기세포를 제조하였다.
상기 라파마이신은 항균제로 잘 알려져 있는 화합물로서 미생물 Streptomyces에서 발견되었고 거대한 석상으로 유명한 ester island에서 발견되었다. 이러한 라파마이신은 곰팡이의 세포 분열을 억제하는 활성을 갖는다는 사실이 알려져 있으며, 이후에는 면역억제 효과 작용을 갖는다는 사실도 알려져 있다. 또한, 최근에는 항암 작용이 있는 것으로도 밝혀지고 있다.
이에 본 발명자들은 이러한 라파마이신과 간엽 줄기세포를 이용한 새로운 면역질환 치료제를 개발하기 위해, 라파마이신에 간엽 줄기세포를 처리한 결과, 라파마이신을 처리하여 배양 및 수득한 간엽 줄기세포는 세포 내에서 면역조절능과 관련된 TGF-β, IDO 및 IL-10 유전자의 발현이 현저하게 증가하는 것으로 확인되었다(도 1a 및 도 1b 참조).
면역조절능과 관련성이 있는 상기 TGF-β, IDO 및 IL-10에 대해 보다 구체적으로 설명하면, TGF-β(Transforming growth factor beta)는 세포의 성장을 촉진하거나 억제할 수 있으며, 면역조절능이 있다고 알려져 있다. 본 발명의 실험에서는 라파마이신이 처리된 지방조직 유래 간엽 줄기세포 의 경우, 라파마이신을 처리하지 않은 경우에 비해 TGF-β의 발현정도가 거의 30배 증가하는 것으로 확인되었다.
또한, IDO(indoleamine 2,3-dioxygenase)는 면역계의 기능 및 활성을 측정하는 인자로 알려져 있으며, 최근 IL-10과 함께 염증을 억제하는 활성이 있는 것으로 밝혀졌다.
뿐만 아니라, 라파마이신을 처리하여 제조한 본 발명의 간엽 줄기세포는 자가포식 작용에 관여하는 유전자들의 발현 역시 증가되어 있는 것으로 확인되었고, 이 세포 내에서는 mTOR의 신호전달 작용이 억제되어 있는 것으로 확인되었다(도 6a 내지 도 6c 참조).
자가포식 작용(autophagy)은 세균이 자신의 소기관이나 세포성분을 분해하는 과정으로서, 세포 외에서 고분자를 음작용이나 식작용 등의 세포내 섭취에 의해 받아들이는 헤테로파지와는 구분되는 작용이다. 세포가 영양소 결핍에 반응하여 자신의 단백질을 분해하거나, 세포의 재구축 등의 과정에서 불필요한 세포 성분을 제거하기 위해 작용하며, 세포 성분은 소포체에 유래하는 막에 둘러싸여 자식식포를 형성하고, 또한 리소솜과 융합하여 자식파고리소솜을 형성하여 분해하게 한다.
또한, 이러한 자가포식 작용은 면역과 염증의 유익하거나 해로운 효과를 조절할 수 있고 감염성 질환, 자가면역과 염증질환을 방지할 수 있는 효과가 있기 때문에, 본 발명에서 라파마이신이 처리된 상기 간엽 줄기세포는 자가포식작용을 갖고 있어 면역 및 염증질환의 치료에 보다 유용할 수 있다.
나아가 본 발명에서는 라파마이신이 처리된 간엽 줄기세포의 면역질환 치료 효과가 mTOR 신호전달의 억제와 관련성이 있는지 확인하기 위해, 활성형의 mTOR 인산화 정도를 분석한 결과 라파마이신 처리시 mTOR 인산화 정도가 감소되어 있는 것으로 나타났고, Rictor 및 Ractor의 발현도 감소되어 있는 것으로 나타났다.
한편, mTOR 신호전달 경로는 단백질 합성을 조절하는데 있어서 매우 중요하며, 다양한 암 세포에서 활성화되어 있는 것으로 알려져 있다. Hsieh 등은 전립선암세포와 생쥐 전립선암에서 암세포의 침윤에 관여하는 몇몇 유전자들이 mTOR에 의해 조절된다는 사실을 밝혀진 바 있다. 또한, mTOR의 신호억제는 종양세포에 대한 효과 뿐만 아니라 면역세포들에 대한 광범위한 조절 효과도 가지고 있는 것으로 보고되고 있으며, 특히 mTOR의 억제는 면역억제 효과와도 직결되는 것으로 알려져 있다.
따라서 본 발명에서 라파마이신의 처리에 의해 간엽 줄기세포 내에서는 mTOR의 신호 전달이 억제되어 있는 것으로 볼 수 있다.
또한, 본 발명자들은 라파마이신을 처리하여 제조한 간엽 줄기세포가 세포 이동성을 갖고 있는지 조사하였는데, 그 결과, 라파마이신을 처리한 간엽 줄기세포의 경우, 세포 내에서 세포 이동성과 관련된 케모카인들의 발현이 증가되어 있는 것으로 확인되었다(도 7 및 도 8 참조).
이로써 본 발명자들은 본 발명에 따른 간엽 줄기세포를 세포 치료제로 사용할 경우, 타겟이 되는 병변부위로 세포가 효율 적으로 이동하여 목표지점에서 치료 효과를 도출할 수 있을 것으로 예상할 수 있었다.
본 발명에서 제조한 면역조절능을 갖는 상기 간엽 줄기세포는 투여개체의 체중 ㎏ 당 간엽 줄기세포 1×106 내지 5×107 세포수를 기준으로 10-100nM의 농도의 라파마이신을 처리하여 제조할 수 있으며, 보다 바람직하게는 말초혈액 또는 지방조직으로부터 분리된 간엽 줄기세포 5×105 세포수에 라파마이신을 100nM의 농도로 처리하고, 18-27 시간 동안 28-42℃의 온도 조건으로 배양하는 단계를 통해 제조될 수 있다.
또한, 본 발명은 상기 면역조절능을 갖는 간엽 줄기세포를 유효성분으로 포함하는 면역 질환의 예방 또는 치료용 세포치료제 조성물을 제공할 수 있다.
본 발명에서 상기 세포치료제란 세포와 조직의 기능을 복원시키기 위하여 살아있는 자가(autologous), 동종(allogenic), 이종(xenogenic) 세포를 체외에서 증식선별하거나 여타한 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 치료, 진단 및 예방의 목적으로 사용되는 의약품을 말한다. 미국은 1993년부터, 우리나라는 2002년부터 세포 치료제를 의약품으로 관리하고 있다. 이러한 세포치료제는 크게 두 분야로 분류할 수 있으며 그 첫 번째는 조직재생 혹은 장기기능 회복을 위한 줄기세포 치료제이며, 두 번째는 생체 내 면역반응의 억제 혹은 면역반응의 항진 등 면역반응 조절을 위한 면역세포 치료제로 분류할 수 있다.
본 발명의 세포치료제 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 비경구 투여, 예를 들어, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여될 수 있으나, 이에 제한되지는 않는다.
상기 조성물은 세포 치료에 일반적으로 사용되는 약제학적 담체와 함께 적합한 형태로 제형화 될 수 있다. '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 약학적으로 허용되는 담체로는 예를 들면, 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
또한 상기 조성물은 세포치료제가 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수도 있다.
본 발명의 세포치료제 조성물은 질환의 치료를 위하여 치료학적으로 유효한 양의 세포치료제를 포함할 수 있다. 용어 치료학적으로 유효한 양(therapeutically effective amount)은 연구자, 수의사, 의사 또는 기타 임상에 의해 생각되는 조직계, 동물 또는 인간에서 생물학적 또는 의학적 반응 을 유도하는 유효 성분 또는 약학적 조성물의 양을 의미하는 것으로, 이는 치료되는 질환 또는 장애의 증상의 완화를 유도하는 양을 포함한다. 본 발명의 조성물에 포함되는 세포치료제는 원하는 효과에 따라 변화될 것임은 당업자에게 자명하다. 그러므로 최적의 세포치료제 함량은 당업자에 의해 쉽게 결정될 수 있으며, 질환의 종류, 질환의 중증도, 조성물에 함유된 다른 성분의 함량, 제형의 종류, 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 포함하는 것이 중요하다. 예컨대, 본 발명의 조성물에는 면역조절능을 갖는 간엽줄기 세포를 체중 ㎏ 당 1×106 내지 5×107 세포수의 세포치료제가 포함될 수 있다.
또한 본 발명은 포유동물에게 치료학적으로 유효한 양의 본 발명의 상기 세포치료제 조성물을 투여하는 것을 포함하는 면역질환의 예방 또는 치료방법을 제공한다. 여기에서 사용된 용어 포유동물은 치료, 관찰 또는 실험의 대상인 포유동물을 말하며, 바람직하게는 인간을 말한다.
본 발명의 치료방법에 있어서, 성인의 경우, 본 발명의 세포치료제 조성물을 1일 1회 내지 수회 투여시, 조성물에 포함되는 세포치료 제는 체중 ㎏ 당 1×104 내지 1×108 세포수를 포함하는 것이 바람직하다.
본 발명의 치료방법에서 본 발명의 세포치료제를 유효성분으로 포함하는 조성물은 직장, 정맥내(intravenou s therapy, i.v), 동맥내, 복강내, 근육내, 흉골내, 경피, 국소, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다.
또한, 본 발명에서 라파마이신 처리에 의해 제조된 간엽 줄기세포 및 상기 세포 를 포함하는 면역질환 치료용 세포 치료제 조성물이 치료하고자 하는 상기 면역질환은 이에 제한되지는 않으나, 골관절염, 류마티스 관절염, 천식, 피부염, 건선, 낭섬유증, 고형장기 이식 후기 및 만성 거부증, 이식편대숙주질환, 이식거부질환, 다발성 경화증, 전신성 홍반성 루푸스, 쇼그렌 증후군, 하시모토 갑상선, 다발성근염, 경피증, 아디슨병, 백반증, 악성빈혈, 사구체신염 및 폐섬유증, 염증성장질환, 크론 병, 자가 면역성 당뇨, 당뇨 망막증, 비염, 허혈-재관류 손상, 혈관성형술후 재협착, 만성 폐색성 심장 질환, 그레이브병, 위장관 알러지, 결막염, 죽상경화증, 관상동맥질환, 협심증, 암 전이, 소동맥 질환 및 미토콘드리아 질환을 포함할 수 있다.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 이하, 본 발명을 실시예에 의해 상세히 설명하기로 한다. 그러나 이들 실시예들은 본 발명을 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
<실시예 1> 라파마이신이 처리된 간엽 줄기세포에서 면역조절능과 관련된 유전자의 발현변화 분석
<1-1> 말초혈액으로 간엽 줄기세포 분리 및 배양
Ficoll-paque를 이용하여 말초 혈액에서 단핵구세포를 분리한 뒤 20% 우태아혈청(FBS)이 포함된 DMEM(Dulbecco's modified Eagle's medium) 배지에서 6일간 배양한 다음, 위로 뜬 세포를 제거하여 세포 배양 플레이트에 부착된 세포만을 갖고 계대배양을 진행하였으며, 계대배양 조건은 5% CO2 및 37℃의 온도 조건에서 배양하였다. 이후 배양액은 3일 간격으로 교체하면서 배양하여 말초혈액으로부터 간엽 줄기세포를 분리 및 배양하였다.
<1-2> 지방조직으로부터 간엽 줄기세포 분리 및 배양
지방 흡입수술로 얻어진 지방 조직이나, 외과적 수술 후에 얻어진 지방 조직을 10% 페니실린-스트렙토마이신을 포함한 PBS로 10회 이상 세척하여 혈액과 이물질을 제거한 후, 조직을 0.2-0.3 g이 되도록 잘게 절단하였다. 0.2% 콜라게나아제(Roche, Sandhofer Strasse, Mannheim, Germany) 용액에 넣어서 37℃의 수욕, 100rpm에서 1시간 동안 반응시켰다. 100㎛ 메쉬를 이용하여 콜라게나아제에 의해서 분해된 용액층과 분해되지 않은 조각을 분리한 후, 분리된 콜라게나아제 용액에 동량의 PBS를 첨가하였다. 이어, 4℃, 1200rpm에서 5분간 원심분리하여 상층액인 지질과 지방층을 제거하고, 콜라게나아제 상층액을 제거하였다. 가라앉은 MSC로부터 남은 콜라게나아제 용액을 제거하기 위해서 MSCGM [mesenchymal stem cell growth media: MSC 기본 배지(Cambrex, Walkersville, MD, 미국), 간엽세포 성장 보조물(Cambrex, Walkersville, MD, 미국), 4mM L-글루타민 및 페니실린(0.025unit/500㎖)/스트렙토마이신(0.025㎎/500㎖)]를 넣어 다시 4℃, 1200rpm에서 5분간 원심분리하였다. MSCGM은 우태아혈청을 포함하는 DMEM에 기초한 배지이다. 이어, 상층액을 제거하고, 얻어진 MSC는 배양접시에 접종하여 MSCGM로 37℃, 5% CO2 항온기에서 배양하였다. 이틀에 한번 씩 배양액을 교체하면서 배양하였다.
<1-3> 면역조절능과 관련된 유전자의 발현 정도 분석
상기 <실시예 1>에서 분리 및 배양한 간엽 줄기세포를 대상으로 라파마이신을 각각 처리한 다음, 면역조절능과 관련된 유전자인 IDO, IL-10 및 TGF-β의 발현 변화를 분석하였다. 먼저 60㎜ dish 조건 하에서 지방조직 유래 간엽 줄기세포에는 5×105 세포수에 대해 100nM 농도의 라파마이신을 처리하여 37℃ 하에서 배양한 간엽 줄기세포를 사용하였다. 이때, 대조군으로는 라파마이신이 처리되지 않은 간엽 줄기세포를 사용하였으며, 라파마이신이 처리된 간엽 줄기세포에서 면역조절능 유전자의 발현 정도는 real time PCR 방법을 사용하여 분석하였다.
분석 결과, 도 1a 및 도 1b에 나타낸 바와 같이 간엽 줄기세포에 라파마이신을 처리한 경우, 라파마이신을 처리하지 않은 군에 비해 IL-10, IDO, TGF-β의 발현 정도는 각각 5배 정도 증가한 것으로 나타났다(도 1a). 또한, 현광현미경 분석 결과 IL-10 사이토카인 역시 라파마이신의 처리에 의해 그 발현이 의미있게 증가하는 것으로 나타났다(도 1b).
따라서 이러한 결과를 토대로 본 발명자들은 라파마이신이 처리된 간엽 줄기세포의 경우, 라파마이신을 처리하지 않은 세포에 비해, IDO, IL-10 및 TGF-β의 발현이 현저하게 증가하는 것으로 확인되었다.
<실시예 2> 라파마이신이 처리된 간엽 줄기세포에서 병인 Th17 세포증식억제 효과 분석
본 발명자들은 라파마이신이 처리된 간엽 줄기세포에 의한 T 세포 증식 억제능을 조사하기 위하여 싸이미딘을 처리하여 T 세포 증식반응을 조사하였다. 먼저, 마우스 CD4+ T 세포(1×105)와 간엽 줄기세포(1×104)를 1:10 비율로 넣어 3일간 96-웰 플레이트에서 37℃ 하에서 공조 배양하였다. 3일 후 싸이미딘을 처리하여 T 세포 증식반응을 조사하여 T 세포 증식 억제능을 분석하였다.
분석 결과, 간엽 줄기세포에 의한 T 세포 증식억제능이 라파마이신이 처리된 간엽 줄기세포에 의해 더욱 감소되는 것을 확인할 수 있었다(도 2).
<실시예 3> 라파마이신이 처리된 간엽 줄기세포에서 염증인자 및 종양인자 억제 효과 분석
상기 <실시예 1>에서 분리 및 배양한 간엽줄기 세포를 대상으로 라파마이신을 각각 처리한 다음, 염증인자 및 종양인자와 관련된 유전자인 HMGB-1(High-mo bility group protein B1), IL-6, IL-1β의 발현 변화를 분석하였다. 먼저 60㎜ dish 조건 하에서 지방조직 유래 간엽 줄기세포에는 5×105 세포수에 대해 100nM 농도의 라파마이신을 처리하여 37℃ 하에서 배양한 간엽 줄기세포를 사용하였다. 이때, 대조군으로는 라파마이신이 처리되지 않은 간엽 줄기세포를 사용하였으며, 라파마이신이 처리된 간엽 줄기세포에서 면역조절능 유전자의 발현 정도는 real time PCR 방법을 사용하여 분석하였다.
분석 결과, 도 3에 나타낸 바와 같이 간엽 줄기세포에 라파마이신을 처리한 경우, 라파마이신을 처리하지 않은 군에 비해 HMGB-1, IL-6, IL-1β의 발현 정도가 현저하게 감소됨을 확인하였다.
<실시예 4> 라파마이신이 처리된 간엽 줄기세포의 세포 표현형 CD마커 분석
상기 <실시예 1>에서 분리 및 배양한 간엽 줄기세포를 대상으로 라파마이신을 각각 처리한 다음, 간엽 줄기세포의 표현형을 분석하였다. 이때, 대조군으로는 라파마이신이 처리되지 않은 간엽 줄기세포를 사용하였으며, 라파마이신이 처리된 간엽 줄기세포에서 세포 표지자 발현 정도는 유세포 분석법을 사용하여 분석하였다.
분석 결과, 도 4에 나타낸 바와 같이 간엽 줄기세포에 라파마이신을 처리한 군은 라파마이신을 처리하지 않은 군과 같이 양성표지자인 CD105, CD29, CD44가 유사하게 발현되었고, 음성표지자인 CD45, HLA-DR의 발현은 모두 음성으로 관찰되었다.
<실시예 5> 라파마이신이 처리된 간엽 줄기세포의 자가포식 소낭(autophagic vacuoles) 형성 여부 분석
본 발명자들은 하기 실시예 6의 결과를 통해 라파마이신이 처리된 간엽 줄기세포에서 자가포식과 관련된 단백질들의 발현이 증가됨을 확인할 수 있었다. 특히 Beclin-1과 LC3은 자가포식시 발현이 증가되는 단백질로서 Beclin-1은 sutophagosome을 형성하는데 중요한 역할을 하는 것으로 알려져 있고, LC3은 autophagy가 일어나면 LC3의 두 가지 형태 중에서 LC3Ⅰ형태가 LC3Ⅱ 형태로 전환되면서 autophagosome의 막에 결합하기 때문에 autophagosome의 직접적인 지표가 되고 있다.
한편, 자가포식작용은 면역과 염증의 유익하거나 해로운 효과를 조절할 수 있고 감염성 질환, 자가면역과 염증질환을 방지할 수 있는 효과가 있기 때문에, 본 발명에서 라파마이신이 처리된 상기 간엽 줄기세포는 자가포식작용을 갖고 있어 면역 및 염증질환의 치료에 보다 유용할 수 있다. 이에 본 발명자들은 간엽 줄기세포에 라파마이신을 50μM의 농도로 처리한 후, 1시간 경과한 다음, 전자현미경으로 자가포식 소낭 생성 정도를 관찰하였다.
분석 결과, 도 5에 나타낸 바와 같이 자가포식 소낭(autophagic vacuoles) 의 숫자가 증가하는 것으로 나타났으며, 도면에서 빨간 화살표가 자가포식 소낭을 나타낸 것이다.
따라서 이러한 결과로부터 라파마이신이 처리된 간엽 줄기세포의 미토콘드리아 질환의 치료에 유용한 효과를 확인하였다.
<실시예 6> 라파마이신이 처리된 간엽 줄기세포에서 자가소화작용(autophagy)과 관련된 유전자들의 발현 변화 분석
<6-1> RT-PCR에 의한 분석
상기 실시예 1에서 분리 및 배양한 지방조직 유래의 간엽 줄기세포에 10ng/㎖의 라파마이신을 처리하고 12시간 경과 후, 세포들을 수집하고 총 RNA를 수득하였다. 이후 상기 RNA를 기반으로 cDNA 합성키트(Roche, Transcriptor First Strand cDNA Synthesis Kit)를 제조하였다. 이후 상기 합성된 cDNA를 갖고 자가소화작용 인자 마커인 ATG5, LC3A, LC3B 유전자의 발현 정도를 실시간 PCR을 수행하여 분석하였다. 그리고 이때 PCR을 위해 수행한 각 프라이머 서열은 하기에 기재된 바와 같다.
표 1
프라이머명 프라이머 서열(5'-3') 서열번호
ATG5 F-primer TTTTCACTGTGGTCCCTGGC 1
ATG5 R-primer ATCCCCAAAATGAACCGACG 2
LC3 F-primer AGACCTTCAAGCAGCGCCG 3
LC3 R-primer ACACTGACAATTTCATCCCG 4
GAPDH F-primer ACCACAGTCCATGCCATCAC 5
GAPDH R-primer TCCACCACCCTGTTGCTGTA 6
분석 결과, 도 6a에 나타낸 바와 같이, 라파마이신을 처리하지 않은 군에 비해 처리한 군의 경우, ATG5, LC3A, LC3B 유전자의 발현 정도가 유효하게 증가한 것으로 나타났다.
<6-2> 웨스턴 블럿 분석
이어 본 발명자들은 <6-1>의 결과에 이어 라파마이신이 처리된 간엽 줄기세포의 경우, 라파마이신에 의해 mTOR 신호 경로가 조절될 수 있는지 웨스턴 블럿을 수행하였다. 이를 위해 인간 지방조직 유래 간엽 줄기세포를 대상으로 10ng/㎖의 라파마이신을 처리한 후, 1시간이 경과한 후 세포들을 용해시켜 단백질을 추출하였다. 이후 추출된 단백질을 SDS-PAGE 전기영동 한 후, 니트로셀룰로오스 막(nitorcellulose membrane)으로 단백질들을 전기적 이동시킨 다음, 5% 스킴 밀크로 1시간 동안 블록킹 반응시키고, Beclin1, ATG5, ATG7, LC3I,II, Phospho-mTOR, mTOR, Rictor, Ractor에 대한 1차 항체를 붙여 반응시킨 후, 이에 대한 2차 항체를 붙여 다시 반응시킨 다음, Enhanced Chemilunimoecence(ECL) 용액을 사용하여 Kodak X-ray에 감광시켜 이들 유전자의 단백질 발현정도를 분석하였다(도 6c).
분석 결과, 도 6b에 나타낸 바와 같이, 라파마이신 처리 시 간엽 줄기세포 내에서 mTOR의 활성화(인산화)가 억제되는 것으로 나타났고, 반면, Beclin1, ATG5, ATG7, LC3I,II의 발현은 증가하는 것으로 나타났으며, 특히 ATG7은 발현 증가 정도가 매우 월등한 것으로 나타났다.
따라서 본 발명자들은 이러한 결과를 통해 라파마이신이 처리된 간엽 줄기세포는 mTOR의 활성화 및 mTOR 신호전달 인자의 발현이 억제되어 있다는 것을 알 수 있었고, 반면, 자가소화작용과 관련된 유전자들의 발현은 증가되어 있다는 것을 알 수 있었다.
<실시예 7> 라파마이신이 처리된 간엽 줄기세포에서 세포이동에 관여하는 유전자 발현분석
<7-1> 세포이동 표지자의 발현 분석
본 발명자는 라파마이신(50nM로 처리)이 처리된 지방유래 간엽 줄기세포가 세포 이동 능력을 갖고 있어 병소부위로 이동이 가능한지 확인하기 위해, 간엽 줄기세포의 이동과 관련된 인자인 CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4의 발현 정도를 실시간 PCR을 수행하여 분석하였다.
분석 결과, 도 7에 나타낸 바와 같이, 라파마이신을 처리하지 않은 군에 비해 라파마이신을 처리한 간엽 줄기세포에서는 CCR1(약 115배), CCR2(약 25배), CCR3(약 70배), CCR4(약 32배), CCR7(약 200배), CCR9(약 150배) 및 CXCR4(약 60배)의 발현이 확연히 증가되어 있는 것으로 나타났다.
<7-2> 세포이동 정도 분석
라파마이신(10ng/㎖로 처리)이 처리된 간엽 줄기세포의 세포 이동을 확인하기 위해, 세포이동키트(Chemicon, Temecula, CA)를 사용하여 분석하였다. 즉, 아래 챔버에는 CD4+T 세포단독군, CD4+T 세포와 Rapamycin(10ng/㎖)이 처리된 군, SDF-1와 CD4+T 세포처리 군을 각각 넣어두었고, 간엽 줄기세포를 위의 챔버에 넣어주었다. 이후 위에 넣어준 지방조직 유래 간엽 줄기세포가 아래 챔버로 이동하기 위해 polycarbonate membrane을 통과한 세포를 염색하였고, 그 수를 카운팅하여 관찰하였다.
그 결과, CD4+T 세포와 Rapamycin(10ng/㎖)으로 처리한 군이 아무것도 처리되지 않은 간엽 줄기세포에 비해 통계적으로 더 많이 이동되어 있는 것으로 나타났다. 그러나 autophagy 저해제인 bafilomycin을 처리한 후 라파마이신이 처리된 간엽 줄기세포의 세포이동능력이 감소됨을 확인하였다(도 8 참조).
<실시예 8> 라파마이신이 처리된 간엽 줄기세포의 골관절염 치료효과
상기 본 발명에 따라 제조된 라파마이신이 처리된 간엽 줄기세포가 실제적으로 면역질환의 치료 효과에 유용한지 확인하기 위해 먼저 골관절염 유발 동물모델을 대상으로 치료 효과를 조사하였다. 먼저, 골관절염 동물모델은 제작하기 위해 200-250g인 5주령 수컷 Wistar rat(중앙실험동물)을 21-22℃의 온도에서 명암주기(light-dark cycle)를 12시간 간격으로 사육하였고 살균한 물과 사료를 공급하여 키웠다. 이후 골관절염 유도를 위해 3㎎의 monosodium iodoacdtate(Sigma, ST. Louis, MO)를 오른쪽 무릎의 관절내에(intra-articular) 26.5G 주사기를 사용하여 50㎕씩 주입하여 골관절염이 유도된 마우스 동물을 제작하였다. 이후, 골관절염이 유도된 마우스에 2×106 세포수의 간엽 줄기세포 및 100nM 농도로 라파마이신이 처리된 간엽 줄기세포를 1주일에 한번씩, 총 2회 i.v.로 주입하였다. 이후, 7일 경과한 다음, 골관절염 유발 동물의 행동력에 미치는 영향을 평가하는 지표인 통증정도를 측정하였고, india ink 염색법으로 연골의 파괴정도를 분석하였다.
분석 결과, 도 9에 나타낸 바와 같이, 간엽 줄기세포를 주입한 마우스 군에 비해 라파마이신이 처리된 간엽 줄기세포를 주입한 마우스 군의 경우, 통증반응정도가 정상 마우스에 거의 근접한 것으로 나타났고, 연골 파괴 정도도 라파마이신이 처리된 간엽 줄기세포를 처리한 군이 정상과 유사하게 회복되어 있는 것으로 나타났다. 한편, 도 9의 B에 나타낸 사진은 연골 손상부위를 표시한 것으로서, 왼쪽으로부터, 첫 번째 사진은 골관절염 유도 마우스 군, 두 번째 사진은 골관절염 유도 후 MSC를 처리한 군, 세 번째 사진은 골관절염 유도 후 라파마이신이 처리된 MSC를 처리한 군을 나타낸 것으로서, 세 번째 사진의 경우, 연골손상이 다른 군에 비해 가장 적게 나타나 있는 것으로 확인되었다.
<실시예 9> 라파마이신이 처리된 간엽 줄기세포의 골관절염 통증 및 염증 치료효과
상기 <실시예 8>에서 사용한 골관절염이 유도된 마우스의 골관절염 통증 및 염증 치료효과를 분석하기 위해 H&E, Toluidin blue 염색, saffranin O 염색을 하였다.
분석 결과, 도 10에 나타낸 바와 같이, 간엽 줄기세포를 주입한 마우스 군에 비해 라파마이신이 처리된 간엽 줄기세포를 주입한 마우스 군의 경우, 염증세포의 침윤이나 연골 파괴의 정도가 현저하게 감소되어 있는 것으로 나타났다(도 10).
<실시예 10> 라파마이신이 처리된 간엽 줄기세포의 염증성 장질환 치료효과
염증성 장질환의 마우스 모델을 제조하기 위해, 시험동물은 C57BL/6(H-2kb) 마우스를 사용하였으며, 상기 마우스에 3.5% 덱스트란 설페이트 나트륨(dextran sulfate sodium, DSS) 물을 1주일간 음용하게 하여 염증성 장 질환 유도 동물 모델을 제작하였다. 이후 상기 염증성 장질환 마우스 동물에 지방조직 유래 간엽 줄기세포 및 라파마이신이 처리된 지방조직유래 간엽 줄기세포를 2×106의 세포수로 i.v.로 일주일에 한 번씩 총 2회 주입하였고, 증상(몸무게, 대장의 길이, DAI(disease activity index))을 확인하였다.
분석 결과, 도 11에 나타낸 바와 같이, 지방조직 유래 간엽 줄기세포를 단독처리한 군에 비해 라파마이신을 처리한 간엽 줄기세포의 경우, 염증성 장질환으로 감소된 마우스의 몸무게가 더 효과적으로 회복되는 것으로 나타났고(도 11의 A), IBD 질병 활성도 현저하게 감소되는 것으로 나타났으며(도 11의 B), 대장의 두께와 길이도 회복되어 진 것으로 나타났고, 장길이의 단축 현상이 정상과 유사하게 회복되는 것으로 확인되었다(도 11의 C).
<실시예 11> 라파마이신이 처리된 간엽 줄기세포의 염증성 장질환 치료효과
본 발명자들은 상기 <실시예 10>에서 사용한 염증성 장질환 마우스 모델에서 라파마이신이 처리된 간엽 줄기세포에 의한 질병 제어 효과를 조직에서 H&E 염색을 통해 확인하였다.
분석 결과, 라파마이신이 처리된 간엽 줄기세포를 주입한 모델에서 장내 염증세포의 침윤 등이 감소되어 있는 것을 관찰하였다(도 12의 A). 또한, 장에서 염증성 사이토카인인 TNF-a를 IHC 염색한 결과, 질환 유도군과 비교했을 때 라파마이신이 처리된 간엽 줄기세포를 주입한 모델에서 TNF-a의 양이 현저하게 감소되는 것을 확인하였다(도 12의 B).
<실시예 12> 라파마이신이 처리된 간엽 줄기세포의 관절염 치료효과
본 발명자들은 라파마이신이 처리된 간엽 줄기세포가 관절염에도 치료 효과가 있는지 확인하기 위해 다음과 같은 실험을 수행하였다. 먼저 자가면역 관절염 마우스 모델을 제조하기 위해, Y. Iwakura팀이 발표한 방법에 따라 IL-1 수용체 유전자를 결손시킨 마우스(IL-1Ra knockout mouse)를 제작하였는데, 이는 인터루킨1 수용체억제인자(IL-1 receptor antagonist, IL-1Ra)가 IL-1수용체에 직접 작용하여, IL-1α, IL-1β가 수용체에 작용하지 못하도록 함으로써 자연적으로 자가면역관절염 질환이 유발되도록 하는 방법이다. 관절염이 유발된 마우스를 대상으로 본 발명에서 제조한 라파마이신이 처리된 간엽 줄기세포를 상기 질환 마우스에 주입하였는데, 라파마이신이 처리된 간엽 줄기세포를 2×106의 세포수로 상기 마우스에 i.v.로 일주일에 한 번씩 총 3회 주입하였고, 1주일 후 이들 마우스로부터 혈청을 분리하여 혈청 내 존재하는 IgG, IgG1 및 IgG2a의 양을 분석하였다. 이때 대조군으로는 관절염이 유발된 마우스의 혈청 및 지방조직 유래 간엽 줄기세포만이 주입된 관절염 마우스의 혈청을 대상으로 상기 면역글로빈의 양을 측정한 것을 사용하였다.
분석 결과, 간엽 줄기세포만을 처리한 군에 비해 라파마이신이 처리된 간엽 줄기세포를 투여한 마우스 군의 경우, 관절염 증상이 개선되는 것으로 나타났고, 면역반응에 작용하는 Th2 타입의 IgG1과 Th1 타입의 IgG2a의 생성이 모두 유의하게 감소하는 것으로 나타났다(도 13).
따라서 이러한 결과를 통해 본 발명자들은 라파마이신이 처리된 간엽 줄기세포의 경우, 면역반응을 조절할 수 있는 활성이 있어 면역질환, 특히 자가면역질환의 치료제로 유용하게 사용할 수 있음을 알 수 있었다.
<실시예 13> 라파마이신이 처리된 간엽 줄기세포의 관절염 치료효과
본 발명자들은 라파마이신을 처리한 간엽 줄기세포와 일반 간엽 줄기세포의 치료효과를 확인하기 위해 자가항원활성유도를 통한 류마티스 관절염 동물모델에 투여한 후 치료효과를 확인하였다. 관절염 동물을 제작하기 위해, DBA/1J마우스에 type II collagen(CII)과 CFA(adjuvant) 1:1 로 혼합하여, 마우스당 100㎍의 CII를 tail base에 50㎕ 용량으로 주사하고, 2주후 CII와 IFA 1:1로 혼합액을 100㎍/50㎕로 2차로 주입하였다. 마우스에 관절염을 유도시키고 1주일 후, 1주일에 1회 총3회 정맥을 통해 아무것도 처리되지 않은 간엽 줄기세포 또는 라파마이신이 처리된 간엽 줄기세포 1×106-5×107(체중 ㎏ 당)를 투여한 후 관절염 평가를 진행하였다. 관절염 유도마우스 1주일 후 1주일에 1회 총3회 정맥내 1×106의 복강 내 아무것도 처리되지 않은 간엽 줄기세포 또는 라파마이신이 처리된 간엽 줄기세포를 투여한 후 관절염 평가를 진행하였다. 관절염 지수의 측정을 위해 실험의 내용을 알고 있지 않은 관찰자 세 명이 일주일에 세 번씩 관절 염증의 위증도를 평가하여 29일까지 관찰하였다. 이때 관절염의 평가는 Rossoliniec 등에 의한 평균 관절염 지수에 기준하여 마리당 2차 접종 때 CII/CFA를 투여한 다리를 제외한 나머지 세 다리에서 아래의 척도에 따라 매긴 점수를 합하여 3으로 나눈 평균치를 얻고, 다시 각 동물 모델에서 3명의 관찰자가 얻은 수치를 합산하여 나눈 평균치를 사용하였다. 관절염 평가에 따른 점수와 기준은 다음과 같다.
0점 : 부족이나 종창이 없음.
1점 : 발 또는 발목관절에 국한된 경한 부종과 발적이 있음.
2점 : 발목관절에서 족근골(metatarsal)에 걸친 경한 부종과 발적이 있음.
3점 : 발목관절에서 족근골에 걸친 중등도의 부종과 발적이 있음.
4점 : 발목에서 다리 전체에 걸쳐 부종과 발적이 있음.
이때 마리당 최고의 관절염 지수는 4점이므로 쥐 1마리당 최고의 질병지수는 16이다.
분석 결과, 도 14에 나타난 바와 같이, 간엽 줄기세포를 주입한 마우스 군에 비해 라파마이신이 처리된 간엽 줄기세포를 주입한 마우스 군의 경우, 관절염이 더욱 현저하게 억제되는 것으로 나타났다.
<실시예 14> 라파마이신이 처리된 간엽 줄기세포의 이식거부질환 치료효과
본 발명자들은 라파마이신이 처리된 간엽 줄기세포가 이식거부질환에도 치료 효과가 있는지 확인하기 위해 다음과 같은 실험을 수행하였다.
<14-1> 이식거부질환의 치료 효과 분석
먼저, 이식거부질환 동물 모델을 제조하기 위해, 수여 마우스 Balb/c(H-2k/d)를 전신방사선조사(TBI) 800cGy를 하고 공여마우스 C57BL/6(H-2k/b)의 대퇴골과 경골에서 조혈모세포와 비장세포를 분리하여 조혈모세포 5×106과 비장세포 1×106 을 수여 마우스 Balb/c(H-2k/d)에 이식하였다.
이식 후, 다음날 아무것도 처리되지 않은 간엽 줄기세포 또는 라파마이신이 처리된 간엽 줄기세포를 복강내 1×106의 세포수로 투여한 후 이들에 의한 효력 평가를 진행하였다.
분석 결과, 마우스의 무게, 질병도 측정 및 생존도를 관찰한 결과, 간엽 줄기세포를 주입한 마우스 군에 비하여 라파마이신이 처리된 간엽 줄기세포를 주입한 마우스 군의 경우, 이식거부질환 마우스의 질병도를 개선시키고 마우스의 생존도 또한 30일 간 유지되는 것을 확인하였다(도 15a).
<14-2> 라파마이신이 처리된 간엽 줄기세포를 주입한 마우스 모델의 염증세포 침윤 분석
먼저, 이식거부질환 모델 마우스를 대상으로 본 발명에서 제조한 라파마이신이 처리된 간엽 줄기세포를 상기 질환 마우스에 주입하였다. 이식 후 일주일 후, 마우스의 피부 및 장기(간)를 채취하여, 10% 중성 완충 포르말린에 고정하고 파라핀에 포매한 후 조직 절편을 만들어 슬라이드에 부착하였다. 기본 염색을 진행하기 전에 자일렌(xylen)을 이용하여 탈 파라핀 과정을 통과 후, 에탄올을 고농도에서 저농도까지 함수시켰다. 염색 과정은 헤마톡실린과 에오진 염색을 진행하였다.
분석 결과, 간엽 줄기세포만을 처리한 군에 비해 라파마이신이 처리된 간엽 줄기세포를 투여한 마우스 군의 경우, 염증세포의 침윤이 현저하게 감소된 것을 확인하였다(도 15b).
<14-3> 라파마이신이 처리된 간엽 줄기세포를 주입한 마우스 모델의 사이토카인 및 비장세포 내 T 세포 분석
먼저, 이식거부질환 모델 마우스에서 비장을 채취하였다. 채취한 비장으로부터 면역화학염색법을 이용하여 사이토카인(IFN-γ, IL-17, IL-4, Foxp)를 염색하여 광학현미경으로 분석하고, 각 마우스의 비장 세포내 T 세포 subset을 분석하였다.
분석 결과, 간엽 줄기세포만을 처리한 군에 비해 라파마이신이 처리된 간엽 줄기세포를 투여한 마우스 군의 경우, 병인세포인 Th1(IFN-γ), Th17(IL-17) 세포는 현저하게 감소한 반면, Th2(IL-4), Treg(Foxp3+) 세포는 현저하게 증가된 것을 확인하였다(도 15c).
따라서 이러한 결과를 통해 본 발명자들은 라파마이신이 처리된 간엽 줄기세포의 경우, 면역반응을 조절할 수 있는 활성이 있어 면역질환, 특히 자가면역질환의 치료제로 유용하게 사용할 수 있음을 알 수 있었다.
<실시예 15> 라파마이신이 처리된 간엽 줄기세포의 루푸스 동물모델의 병인 T 림프구와 공조 배양시에 면역조절 T 림프구(Treg) 활성의 유도분석
본 발명자들은 라파마이신이 처리된 지방유래 간엽 줄기세포에 의한 루푸스 동물모델 세포에 미치는 면역조절능력을 조사하였다. Roquin 유전자 mutation 마우스는 ICOS(inducible costimulator) 과발현으로 인한 Th세포의 활성 유도와 Germinal center response가 증가되어 자가 항체가 과분비되어 루푸스와 유사한 자가면역질환 마우스 모델이며, 루푸스 동물모델인 Roquin 마우스로부터 세포를 분리하여 간엽 줄기세포와 1:10의 비율로 3일간 공조배양한 뒤 면역조절 T 세포(Foxp3+Treg)의 활성을 유세포 분석법을 통해 분석하였다.
분석 결과, 도 16에 나타낸 바와 같이 라파마이신을 처리하지 않은 군에 비해 처리한 군의 경우, 배양액 내의 IL-17의 양이 현저하게 감소되어 있었으며, 면역조절 T 세포의 활성은 더욱 증가되는 것으로 나타났다.
따라서 이러한 결과를 토대로 본 발명자들은 라파마이신을 간엽 줄기세포에 처리하여 면역질환 치료를 위한 세포치료제로 활용할 수 있다는 것을 알 수 있었다.
<실시예 16> 라파마이신이 처리된 간엽 줄기세포의 류마티스 관절염 환자의 병인 T 림프구와 공조 배양시에 면역조절 T 림프구(Treg) 활성의 유도분석
본 발명자들은 라파마이신이 처리된 류마티스관절염 환자 유래 간엽 줄기세포의 면역 조절능력을 조사하였다. 마우스 CD4+T 세포(1×105 세포수)와 류마티스 관절염 환자 유래 간엽 줄기세포(1×104 세포수)를 1:10의 비율로 3일간 96-웰 플레이트에서 37℃로 공조배양한 뒤 면역조절 T 세포(Foxp3+Treg)의 활성을 유세포 분석법을 통해 분석하였다.
분석 결과, 도 17에 나타낸바와 같이 라파마이신을 처리하지 않은 군에 비해 처리한 군의 경우, 배양액 내의 IL-17의 양이 감소되어 있었으며, 면역조절 T 세포의 활성은 더욱 증가되는 것으로 나타났다.
따라서 이러한 결과를 토대로 본 발명자들은 라파마이신을 간엽 줄기세포에 처리하여 면역질환 치료를 위한 세포치료제로 활용할 수 있다는 것을 알 수 있었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
본 발명은 하기 국가연구개발사업 프로그램의 지원에 의해 수행되었다.
1. 과제고유번호: 2012M3A9C6049783
2. 연구사업명: 바이오의료기술개발사업_세포재생기술개발사업
3. 연구과제명: Inflammasome 제어인자 특화된 중간엽줄기세포를 이용한 자가면역질환군 치료기술 개발
4. 주관기관명: 가톨릭대학교 산학협력단
5. 부처명: 교육과학기술부
6. 연구관리전문기관: 한국연구재단(NRF)
7. 연구기간: 2012-10-01∼2013-09-30

Claims (10)

  1. 라파마이신이 처리된 면역조절능을 갖는 간엽 줄기세포에 있어서;
    CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 및 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포 표면인자가 발현되는 간엽 줄기세포.
  2. 청구항 1에 있어서,
    상기 간엽 줄기세포는 말초혈액 또는 지방조직 으로부터 분리된 것을 특징으로 하는 면역조절능을 갖는 간엽 줄기세포.
  3. 청구항 1에 있어서,
    상기 라파마이신은 간엽줄기 세포 2.5×105-7.5×105 세포수를 기준으로 10-100nM의 농도로 처리하는 것을 특징으로 하는 면역조절능을 갖는 간엽 줄기세포.
  4. 청구항 1에 있어서,
    상기 간엽 줄기세포는 라파마이신 처리에 의해 IDO(indole 2,3-dioxy genase), TGF-β(Transforming growth factor beta) 및 IL-10으로 이루어진 군으로부터 선택되는 어느 하나 이상의 인자의 발현이 증가된 것을 특징으로 하는 면역조절능을 갖는 간엽 줄기세포.
  5. 청구항 1에 있어서,
    상기 간엽 줄기세포는 라파마이신 처리에 의해 mTOR의 신호전달 인자인 Phospho-mTOR, Rictor 및 Ractor의 발현이 상기 세포 내에서 감소되어 있는 것을 특징으로 하는 면역조절능을 갖는 간엽 줄기세포.
  6. 청구항 1에 있어서,
    상기 간엽 줄기세포는 라파마이신 처리에 의해 Beclin1, ATG5, ATG7, LC3I 및 LCII로 이루어진 군으로부터 선택되는 어느 하나 이상의 자가포식 유도인자의 발현이 상기 간엽 줄기세포 내에서 증가되어 있는 것을 특징으로 하는 면역조절능을 갖는 간엽 줄기세포.
  7. 청구항 1의 면역조절능을 갖는 간엽 줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  8. 청구항 7에 있어서,
    상기 조성물은 면역조절능을 갖는 간엽 줄기세포를 투여개체의 체중 ㎏ 당 1×10 6 내지 5×107 세포수로 투여하는 것을 특징으로 하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  9. 청구항 7에 있어서,
    상기 면역질환은 골관절염, 류마티스 관절염(Rheumatoid Arthritis), 천식(Asthma), 피부염(Dermititis), 건선(Psoriasis), 낭섬유증(Cystic Fibrosis), 고형장기 이식 후기 및 만성 거부증(Post transplantation lat e and chronic solid organ rejection), 이식편대숙주질환(graft-versus-host disease), 이식거부질환, 다발성 경화증(Multiple Sclerosis), 전신성 홍반성 루푸스(systemic lupus erythematosus), 쇼그렌 증후군(Sjo gren syndrome), 하시모토 갑상선(Hashimoto thyroiditis), 다발성근염(polymyositis), 경피증(scleroderma), 아디슨병(Addison disease), 백반증(vitiligo), 악성빈혈(pernicious anemia), 사구체신염(glomerulonep hritis) 및 폐섬유증(pulmonary fibrosis), 염증성장질환(Inflammatory Bowel Diesese), 크론 병(Crohns disease), 자가면역성 당뇨(Autoimmune Diabetes), 당뇨 망막증(Diabetic retinopathy), 비염(Rhinitis), 허혈-재관류 손상(Ischemia-reperfusion injury), 혈관성형술후 재협착(Post-angioplasty restenosis), 만성 폐색성 심장 질환(Chronic obstructive pulmonary disease; COPD), 그레이브병(Graves disease), 위장관 알러지(Gastrointestinal allergy), 결막염(Conjunctivitis), 죽상경화증(Atherosclerosis), 관상동맥질환(Coro nary artery disease), 협심증(Angina), 암 전이, 소동맥 질환 및 미토콘드리아 질환(mitochondrial disea se)으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  10. 말초혈액 또는 지방조직으로부터 분리된 2.5×105-7.5×105 세포수의 간엽 줄기세포에 라파마이신을 10-100nM 의 농도로 처리하고, 18-27 시간 동안 28-42℃의 조건으로 배양하는 단계를 포함하는, CCR1, CCR2, CCR3, CCR4, CCR7, CCR9 또는 CXCR4로 이루어진 군으로부터 선택되는 어느 하나 이상의 세포표면 인자가 발현되는 간엽 줄기세포의 제조방법.
PCT/KR2014/007583 2013-08-16 2014-08-14 mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물 WO2015023147A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/912,391 US10851346B2 (en) 2013-08-16 2014-08-14 MTOR/STAT3 signal inhibitor-treated mesenchymal stem cell having immunomodulatory activity, and cell therapy composition comprising same, for preventing or treating immune disorders

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20130097218 2013-08-16
KR10-2013-0097218 2013-08-16
KR10-2014-0104575 2014-08-12
KR1020140104575A KR101723265B1 (ko) 2013-08-16 2014-08-12 mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물

Publications (1)

Publication Number Publication Date
WO2015023147A1 true WO2015023147A1 (ko) 2015-02-19

Family

ID=52468478

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/007583 WO2015023147A1 (ko) 2013-08-16 2014-08-14 mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물

Country Status (1)

Country Link
WO (1) WO2015023147A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017210749A1 (en) * 2016-06-10 2017-12-14 Adelaide Research & Innovation Pty Ltd Methods and products for treating autoimmune diseases
CN110088623A (zh) * 2016-10-17 2019-08-02 社会福祉法人三星生命公益财团 选择用于治疗免疫病症的高效干细胞的方法
CN110946877A (zh) * 2019-12-30 2020-04-03 深圳爱生再生医学科技有限公司 一种治疗肝硬化的干细胞生物制品及其制备方法与应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999051275A2 (en) * 1998-04-03 1999-10-14 Osiris Therapeutics, Inc. Mesenchymal stem cells as immunosuppressants
US20020085996A1 (en) * 1998-03-18 2002-07-04 Mcintosh Kevin R. Mesenchymal stem cells for prevention and treatment of immune responses in transplantation
US20100322894A1 (en) * 2007-09-30 2010-12-23 Mark A Atkinson Combination Therapies for Treating Type 1 Diabetes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020085996A1 (en) * 1998-03-18 2002-07-04 Mcintosh Kevin R. Mesenchymal stem cells for prevention and treatment of immune responses in transplantation
WO1999051275A2 (en) * 1998-04-03 1999-10-14 Osiris Therapeutics, Inc. Mesenchymal stem cells as immunosuppressants
US20100322894A1 (en) * 2007-09-30 2010-12-23 Mark A Atkinson Combination Therapies for Treating Type 1 Diabetes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BURON, F. ET AL.: "Human mesenchymal stem cells and immunosuppressive drug interactions in allogeneic responses: an in vitro study using human cells", TRANSPLANTATION PROCEEDINGS, vol. 41, no. 8, October 2009 (2009-10-01), pages 3347 - 3352 *
GE, W. ET AL.: "Infusion of mesenchymal stem cells and rapamycin synergize to attenuate alloimmune responses and promote cardiac allograft tolerance", AM. J. TRANSPLANT., vol. 9, no. 8, 26 June 2009 (2009-06-26), pages 1760 - 1772 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017210749A1 (en) * 2016-06-10 2017-12-14 Adelaide Research & Innovation Pty Ltd Methods and products for treating autoimmune diseases
CN110088623A (zh) * 2016-10-17 2019-08-02 社会福祉法人三星生命公益财团 选择用于治疗免疫病症的高效干细胞的方法
CN110088623B (zh) * 2016-10-17 2022-08-09 细胞生命有限公司 选择用于治疗免疫病症的高效干细胞的方法
CN110946877A (zh) * 2019-12-30 2020-04-03 深圳爱生再生医学科技有限公司 一种治疗肝硬化的干细胞生物制品及其制备方法与应用

Similar Documents

Publication Publication Date Title
KR101723265B1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
WO2018097540A9 (ko) 무혈청면역세포배양용 배지첨가키트, 상기 키트를 이용한 면역세포배양방법, 상기 키트 또는 배양방법에 의해 얻어진 무혈청면역세포배양액 및 상기 배양액을 포함하는 화장료조성물
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2012026712A4 (ko) Ｎｏｄ２의 아고니스트를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
KR101705412B1 (ko) Stat3 억제제가 처리된 간엽줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2012111997A2 (en) Cell therapy composition for preventing or treating immune disease comprising mesenchymal stem cells and immunoregulatory t-cells as active ingredient
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
KR20130096661A (ko) 줄기세포를 유효 성분으로 함유하는 면역 질환 또는 염증 질환의 예방 또는 치료용 조성물
WO2015023147A1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2015167243A1 (ko) 면역질환 치료효과를 갖는 신규한 화합물 및 이의 용도
WO2017146468A1 (ko) 줄기세포의 효능 개선을 위한 조성물 및 방법
KR101636139B1 (ko) 면역조절능이 우수한 sRAGE 과발현 간엽줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2017146538A1 (ko) 조절 t 세포 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2022119060A1 (ko) 불멸화 개 줄기세포 또는 이의 용도
WO2013165120A1 (ko) 신경능선줄기세포의 배양방법 및 그 용도
WO2015023165A1 (ko) 염증조절복합체 및 ｓｔａｔ３ 신호분자 차단을 통한 면역조절능 최적화된 안정화 중간엽줄기세포
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2022245138A1 (ko) 기능강화 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 조성물
KR101659158B1 (ko) 메트포민이 처리된 면역조절능을 갖는 간엽줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2016027990A1 (ko) Ｄｕｓｐ５를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물
WO2019027214A9 (ko) 동종-중간엽 줄기세포 및 이의 용도
WO2022131742A1 (ko) 소포체 스트레스 유발 물질로 처리된 세포 유래 엑소좀 및 이의 용도
WO2015194710A1 (ko) Stat3 억제제가 처리된 간엽줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2015199416A1 (ko) 피부 또는 혈관 조직 손상 치료용 약학 조성물 및 이의 이용

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14836763

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14912391

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 14836763

Country of ref document: EP

Kind code of ref document: A1