WO2022186592A1 - 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도 - Google Patents

당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도 Download PDF

Info

Publication number
WO2022186592A1
WO2022186592A1 PCT/KR2022/002924 KR2022002924W WO2022186592A1 WO 2022186592 A1 WO2022186592 A1 WO 2022186592A1 KR 2022002924 W KR2022002924 W KR 2022002924W WO 2022186592 A1 WO2022186592 A1 WO 2022186592A1
Authority
WO
WIPO (PCT)
Prior art keywords
microrna
expression level
diabetes
group
measuring
Prior art date
Application number
PCT/KR2022/002924
Other languages
English (en)
French (fr)
Inventor
조호찬
배윤위
박재형
Original Assignee
계명대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 계명대학교 산학협력단 filed Critical 계명대학교 산학협력단
Publication of WO2022186592A1 publication Critical patent/WO2022186592A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a biomarker for diagnosing prediabetes or predicting the onset of diabetic complications, and a use thereof, and more particularly, to a prediabetic diagnosis or diabetes comprising an agent for measuring the expression level of any one or more selected from seven microRNAs A composition and kit for predicting the onset of complications, and a method for diagnosing pre-diabetes or predicting the onset of diabetic complications using the marker.
  • Diabetes mellitus is a type of metabolic disease such as insufficient insulin secretion or failure to function normally. It is characterized by hyperglycemia in which the concentration of glucose in the blood rises. .
  • diabetes In Korea, one out of five people over the age of 65 is diagnosed with diabetes, and when the fasting blood sugar disorder called prediabetes is included, half (47.4%) of the elderly population is diabetic or is on the verge of diabetes.
  • prediabetes fasting blood sugar disorder
  • 2 out of 10 adults in their 30s in Korea (20%) are pre-diabetic patients, and it is estimated that there is a potential group close to twice that of diabetic patients (12.4%), so the number of diabetic patients is expected to increase even more.
  • Diabetes is a trigger for almost all cardiovascular diseases, such as heart disease and stroke, and is the biggest cause of chronic kidney failure that requires dialysis or retinal disease that causes blindness, so its seriousness is emerging.
  • pre-diabetes is a stage in which the blood sugar level is between a normal person and a diabetic patient. 125 mg/dL is classified as pre-diabetes. Although prediabetes cannot be clearly diagnosed as diabetes, it is known that the probability of developing diabetes is 5 to 17 times higher than that of normal people.
  • pre-diabetic markers HbA1C, fructosamin, glycated albumin, etc. used for the diagnosis of diabetes are used (Metab Syndr Relat Disord. 2014 Jun 1; 12(5): 258-268.), which are specific markers for pre-diabetes. Therefore, specificity or sensitivity is low, and prediabetes diagnosis is sometimes impossible under certain clinical conditions (acute and intermittent hyperglycemia).
  • diabetes can be diagnosed through the results of glycated hemoglobin, glucose tolerance test, fasting and random blood glucose test, but a method for predicting the risk of transition from normal and pre-diabetes to diabetes in advance has not been studied. Diagnosis and the establishment of predictive biomarkers can predict the risk of diabetes, and biomarkers for preventing diabetes or its complications by analyzing changes according to the diabetes progression stage of known miRNAs as well as small RNAs through bioinformatics methods development is needed.
  • the present inventors collected blood from subjects corresponding to the normal group, pre-diabetic patient group, and diabetic patient group, and separated exosome RNA therefrom, and then exo through NGS analysis.
  • a biomarker for early diagnosis of diabetes that is used as a risk index for diabetes in the pre-diabetic patient group or is easy to predict the onset of diabetic complications was found. Based on this, the present invention was completed.
  • an object of the present invention is to provide a marker composition for prediabetes diagnosis, including microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the present invention provides a composition for diagnosis of pre-diabetes, comprising an agent for measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286), and a kit for diagnosis of pre-diabetes comprising the composition to do it for a different purpose.
  • the present invention provides an information providing method for prediabetes diagnosis, comprising measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject to serve another purpose.
  • Another object of the present invention is to provide a marker composition for predicting the onset of diabetic complications, including microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the present invention provides a composition for predicting the onset of diabetic complications, including an agent for measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286), and predicting the onset of diabetic complications comprising the composition It is another purpose to provide a kit.
  • the present invention provides information for predicting the onset of diabetic complications, including measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject
  • Another object is to provide a method.
  • the present invention provides a method for diagnosing pre-diabetes comprising the step of measuring or detecting the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject. for other purposes.
  • the present invention provides a method for predicting the onset of diabetic complications comprising measuring or detecting the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject. It serves another purpose to provide.
  • the present invention provides a marker composition for prediabetes diagnosis, comprising microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the composition comprises microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), It may further include one or more selected from the group consisting of microRNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p).
  • the present invention provides a composition for prediabetes diagnosis, comprising an agent for measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the composition comprises microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), An agent for measuring the expression level of one or more selected from the group consisting of microRNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p) may be further included.
  • the agent for measuring the expression level of the microRNA may be a sense and antisense primer, or a probe that specifically binds to the microRNA.
  • the present invention also provides a kit for diagnosing pre-diabetes, comprising the composition for diagnosing pre-diabetes.
  • the present invention provides an information providing method for prediabetes diagnosis, comprising measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject do.
  • the method comprises microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), The method may further include measuring the expression level of one or more selected from the group consisting of microRNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p).
  • the biological sample may be a blood or plasma-derived exosome.
  • the expression level of the microRNA is determined by next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase It may be measured through one or more methods selected from the group consisting of a chain reaction (Real-time PCR), an RNase protection assay (RPA), a microarray, and northern blotting.
  • NGS next generation sequencing
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • RPA RNase protection assay
  • the present invention provides a marker composition for predicting the onset of diabetic complications, including microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the present invention provides a composition for predicting the onset of diabetic complications, comprising an agent for measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the present invention provides a kit for predicting the onset of diabetic complications, including the composition for predicting the onset of diabetic complications.
  • the present invention provides information for predicting the onset of diabetic complications, including measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject provide a way
  • the present invention provides a method for diagnosing pre-diabetes comprising measuring or detecting the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject.
  • the present invention provides a method for predicting the onset of diabetic complications comprising measuring or detecting the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject. to provide.
  • the method may further include obtaining a biological sample from a subject or a human patient.
  • the present inventors As a result of analyzing microRNAs contained in exosomes isolated from the blood of the normal group, the pre-diabetic group, and the diabetic group, the present inventors identified 7 specific microRNAs in the pre-diabetic group. Therefore, it is possible to diagnose pre-diabetes at an early stage using the identified microRNAs, which is expected to be useful as a biomarker for predicting the onset of diabetes or diabetic complications.
  • FIG. 1 is a result of comparative analysis of the expression levels of microRNAs in exosomes isolated from plasma of normal group (HV) and pre-diabetic (Pre-DM) subjects, FIG. 1a is significantly 2 in pre-diabetes compared to normal group It is a heat map result of performing hierarchical clustering according to the expression level of microRNAs with reduced or increased expression more than twice (p ⁇ 0.05), and FIG. 1B is a scatter plot result according to the expression level of the microRNAs detected above.
  • Figure 2 is a result of comparative analysis of the expression level of microRNAs in exosomes isolated from plasma of pre-diabetic (Pre-DM) and diabetic group (DM) subjects. It is a heat map result of performing hierarchical clustering according to the expression level of microRNAs with reduced or increased expression by more than 2 times (p ⁇ 0.05), and FIG. 2B is a scatter plot result according to the expression level of the microRNAs detected above. .
  • FIG. 3 is a result of comparative analysis of the expression level of microRNAs in exosomes isolated from plasma of normal group (HV) and diabetic group (DM) subjects
  • FIG. 3a is significantly more than doubled in diabetic group compared to normal group (p ⁇ 0.05) is a heat map result obtained by performing hierarchical clustering according to the expression level of the microRNAs with decreased or increased expression
  • FIG. 3B is a scatter plot result according to the expression level of the microRNAs detected above.
  • MDS multidimensional scale
  • RNAs microRNAs
  • HV normal group
  • Pre-DM pre-diabetes
  • DM diabetic group
  • the present inventors completed the present invention by finding a biomarker showing a specific expression change in the pre-diabetic stage as a result of intensive research to discover a biomarker for prediabetes diagnosis or predicting the onset of diabetic complications.
  • the present invention provides a marker composition for diagnosing prediabetes or predicting the onset of diabetic complications, including microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286).
  • the marker composition is microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), microRNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p) may further include one or more selected from the group consisting of.
  • the present invention provides a composition for diagnosing prediabetes or predicting the onset of diabetic complications, and a kit comprising the composition, comprising an agent for measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) provides
  • the composition for diagnosing prediabetes or predicting the onset of diabetic complications is microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA) -19b-3p), microRNA 326 (microRNA-326), and microRNA 382-5p (microRNA-382-5p) may further include an agent for measuring the expression level of one or more selected from the group consisting of.
  • Diagnosis in a broad sense means judging the actual condition of a patient's disease in all aspects. The content of the judgment is the disease name, etiology, disease type, severity, detailed mode of the disease, and the presence or absence of complications. Diagnosis in the present invention may be to determine the progress level of the pre-diabetes stage, etc.
  • prediction development refers to determining whether a specific individual is likely to develop diabetic complications, a relatively high probability of developing diabetes complications, or whether diabetic complications have already occurred.
  • the prediction in the present invention can be used to predict the risk of developing diabetic complications based on the expression of pre-diabetic markers.
  • pre-diabetes is a stage in which the blood sugar level is between a normal person and a diabetic patient.
  • the pre-diabetes stage refers to the interval in between, that is, a stage showing a fasting blood sugar of 100 to 125 mg/dL.
  • diabetes complications is a variety of conditions caused by diabetes, such as diabetic retinopathy, diabetic cataract, diabetic nephropathy, diabetic neuropathy or diabetic vascular complications.
  • the present invention is not limited thereto.
  • microRNA 1290 microRNA-1290
  • microRNA 4286 microRNA-4286
  • microRNA 1307-3p microRNA-1307-3p
  • microRNA 19a-3p biomarkers for prediabetes diagnosis through Examples.
  • microRNA-19a-3p microRNA 19b-3p
  • microRNA 326 microRNA-326
  • microRNA 382-5p microRNA-382-5p
  • subjects corresponding to the normal group, pre-diabetic group, and diabetic group were recruited, and exosomes were isolated from their blood, and the expression level of miRNA in the exosomes was comparatively analyzed (Example) see 1).
  • microRNAs were analyzed in (1) normal group and pre-diabetic group, (2) pre-diabetic group and diabetic group, (3) normal group and diabetic group, respectively, and microRNAs expression level results
  • it gradually increases from normal to prediabetes and diabetes (miR-1290) or gradually decreases from normal to prediabetes and diabetes (miR-1307-3p, miR-19a-3p, miR-19b-3p, miR-326).
  • miR-382-5p, miR-4286) were finally selected. It was confirmed that the selected miRNAs actually exhibit a significant difference in expression between the normal group and the pre-diabetic group (see Examples 2-1 to 2-4).
  • microRNA 1290 (microRNA-1290), microRNA 4286 (microRNA-4286), microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-) discovered in the present invention from the above results.
  • 3p microRNA 19b-3p (microRNA-19b-3p), microRNA 326 (microRNA-326), and microRNA 382-5p (microRNA-382-5p) are used to diagnose prediabetes or predict the onset of diabetic complications. It can be usefully used as a biomarker.
  • MicroRNA 1290 (microRNA-1290), microRNA 4286 (microRNA-4286), microRNA 1307-3p (microRNA-1307-3p) and micro RNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), microRNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p) are shown in the table below. 1] may be composed of the nucleotide sequence shown.
  • miRNA order hsa-miR-1290 uggauuuuuuggaucaggga SEQ ID NO: 1) hsa-miR-1307-3p acucggcguggcgucggucgug (SEQ ID NO: 2) hsa-miR-19a-3p ugugcaaaucuaugcaaaacuga (SEQ ID NO: 3) hsa-miR-19b-3p ugugcaaauccaugcaaaacuga (SEQ ID NO: 4) hsa-miR-326 ccucugggcccuuccuccag (SEQ ID NO: 5) hsa-miR-382-5p gaaguuguucgugguggauucg (SEQ ID NO: 6) hsa-miR-4286 accccacuccugguacc (SEQ ID NO: 7)
  • microRNA 1290 (microRNA-1290), microRNA 4286 (microRNA-4286), microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p),
  • the agent for measuring the expression level of microRNA 19b-3p (microRNA-19b-3p), microRNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p) specifically binds to the microRNA It may be a sense and antisense primer, or a probe, but is not limited thereto.
  • primer refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc. as a short gene sequence serving as a starting point of DNA synthesis.
  • the primers can be synthesized and used with a length of typically 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, etc. by a known method.
  • probe refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, and capable of specifically hybridizing to a target nucleotide sequence, exist or are artificially synthesized.
  • the diagnostic kit of the present invention consists of one or more other component compositions, solutions or devices suitable for the assay method.
  • the kit of the present invention comprises genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of a DNA polymerase, a dNTP mixture, a PCR buffer, and water to perform PCR. It may be a kit comprising
  • the PCR buffer may contain KCl, Tris-HCl and MgCl 2 .
  • components necessary for performing electrophoresis that can confirm whether the PCR product is amplified may be additionally included in the kit of the present invention.
  • the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR.
  • the RT-PCR kit includes a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included.
  • dNTPs deoxynucleotides
  • enzymes such as Taq-polymerase and reverse transcriptase
  • DNase DNase
  • RNase inhibitors DEPC -Water
  • sterile water etc.
  • a primer pair specific for a gene used as a quantitative control may be included.
  • the present invention includes measuring the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject, prediabetes diagnosis or diabetes It provides an information provision method for predicting the onset of complications.
  • the information providing method is microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), microRNA
  • the method may further include measuring the expression level of one or more selected from the group consisting of RNA 326 (microRNA-326) and microRNA 382-5p (microRNA-382-5p).
  • the biological sample derived from the subject may include tissue, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid, or urine, and more preferably, exosomes derived from blood or plasma, but is not limited thereto.
  • microRNA 1290 when the expression level of microRNA 1290 (microRNA-1290) in the exosomes isolated from the subject-derived sample according to the above method is higher than normal, it can be determined as pre-diabetes, and microRNA 4286 (microRNA-4286). ), microRNA 1307-3p (microRNA-1307-3p), microRNA 19a-3p (microRNA-19a-3p), microRNA 19b-3p (microRNA-19b-3p), microRNA 326 (microRNA-326) or If the expression level of microRNA 382-5p (microRNA-382-5p) is lower than that of normal people, it can be determined as pre-diabetes.
  • the expression level of the microRNAs is polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RNase) by a conventional method known in the art. It may be measured by one or more methods selected from the group consisting of protection assay; RPA), microarray, or northern blotting, but is not limited thereto.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • Real-time PCR real-time polymerase chain reaction
  • RNase protection assay RNase
  • the present invention provides a method for diagnosing pre-diabetes comprising measuring or detecting the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject.
  • the present invention provides a method for predicting the onset of diabetic complications comprising measuring or detecting the expression level of microRNA 1290 (microRNA-1290) and microRNA 4286 (microRNA-4286) in a biological sample derived from a subject. to provide.
  • the method may further include obtaining a biological sample from a subject or a human patient.
  • each of the normal group (HV, fasting blood sugar 95 or less, HbA1c 5.5 or less) 20 people, the pre-diabetes group (Pre- DM, fasting blood glucose 100-125, HbA1c 5.8-6.3 or less) and 20 subjects from the diabetic group (DM, HbA1c 6.5 or more) were recruited.
  • the criteria for dividing each group refer to the criteria of the American Diabetes Association, and to find a more accurate marker by clarifying the division between patient groups, a new standard excluding the boundary part was applied (American Diabetes Association standards; normal (fasting blood sugar less than 100, HbA1c less than 5.7) pre-diabetes (fasting blood sugar 100-125, HbA1c 5.8-6.4) diabetes (fasting blood sugar 126 or more, HbA1c 6.5 or more)).
  • Plasma samples were collected from the normal group, the pre-diabetic group, and the diabetic group to find biomarkers indicating differences between groups. For this purpose, plasma was provided from subjects in each of the above groups.
  • Exosomes were isolated using Exoquick (SBI, USA) for plasma samples collected from subjects in each group in Example 1-1, and total RNA from the separated exosomes using Qiagen miRNeasy kit was extracted, and the quality of the extracted total RNA was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions.
  • a library was prepared using the Takara SMARTer smRNA for illumina kit from Macrogen using the isolated RNA, and then the microRNA was detected by performing next-generation sequencing (NGS) with Hiseq 2500.
  • NGS next-generation sequencing
  • microRNAs having different expression levels in the blood-derived exosomes of 20 normal group and 20 pre-diabetic patients, according to the methods of Examples 1-1 and 1-2, the present inventors Exosomes were isolated from plasma collected from the fields, and NGS analysis was performed on the extracted total RNA. As a result of the analysis, 486 miRNAs were detected, and the expression levels of the detected miRNAs were compared.
  • the present inventors performed NGS analysis of total RNA in exosomes obtained in the same manner as above in order to identify miRNAs with different expression levels in the blood-derived exosomes of 20 pre-diabetic patients and 20 diabetic groups. carried out. As a result of the analysis, 486 miRNAs were detected, and the expression levels of the detected miRNAs were compared.
  • FIG. 2a As a result, as shown in FIG. 2a , among 486 miRNAs, 28 miRNAs with reduced expression and 47 miRNAs with increased expression were found in the diabetic group more than twice (p ⁇ 0.05) compared to the pre-diabetic group. In addition, a scatter plot result according to the expression level of the miRNAs showing the significant expression change is shown in FIG. 2B.
  • the present inventors performed NGS analysis on the total RNA in the exosomes obtained by the same method as above in order to identify miRNAs having different expression levels in the blood-derived exosomes of 20 normal group and 20 diabetic group. As a result of the analysis, 486 miRNAs were detected, and the expression levels of the detected miRNAs were compared.
  • the amount of change for each sample was derived through the multidimensional scale method (MDS), and this was visualized and analyzed.
  • MDS multidimensional scale method
  • miRNAs showing changes in expression levels were classified, and specifically, as shown in [Table 2] below, normal pre-diabetes and diabetes (miR-1290) or progressively decreases from normal to prediabetes and diabetes (miR-1307-3p, miR-19a-3p, miR-19b-3p, miR-326, miR-382-5p, miR) -4286) miRNAs were finally selected.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

본 발명은 당뇨 전단계 진단 또는 당뇨 합병증의 발병 예측을 위한 바이오마커 및 이의 용도에 관한 것으로, 보다 구체적으로 7개의 마이크로RNAs 중 선택되는 어느 하나 이상의 발현수준을 측정하는 제제를 포함하는 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 조성물 및 키트, 상기 마커를 이용하여 당뇨 전단계를 진단하거나 당뇨 합병증의 발병을 예측하는 방법에 관한 것이다. 본 발명자들은 정상군, 당뇨 전단계 환자군, 당뇨 환자군의 혈액에서 분리한 엑소좀(exosome) 내에 포함된 microRNA를 분석한 결과, 당뇨 전단계 환자군에서 특이적인 7개의 마이크로RNAs를 동정하였다. 이에, 상기 동정된 마이크로RNAs를 이용하여 당뇨 전단계를 조기에 진단할 수 있어 조기 당뇨의 진단이 가능하고, 이후 당뇨 또는 당뇨 합병증의 발병을 예측하기 위한 바이오마커로 유용하게 이용할 수 있을 것으로 기대된다.

Description

당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도
본 발명은 당뇨 전단계 진단 또는 당뇨 합병증의 발병 예측을 위한 바이오마커 및 이의 용도에 관한 것으로, 보다 구체적으로 7개의 마이크로RNAs 중 선택되는 어느 하나 이상의 발현수준을 측정하는 제제를 포함하는 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 조성물 및 키트, 상기 마커를 이용하여 당뇨 전단계를 진단하거나 당뇨 합병증의 발병을 예측하는 방법에 관한 것이다.
당뇨병은 인슐린의 분비량이 부족하거나 정상적인 기능이 이루어지지 않는 등의 대사질환의 일종으로, 혈중 포도당의 농도가 높아지는 고혈당을 특징으로 하며, 고혈당으로 인하여 여러 증상 및 징후를 일으키고 소변에서 포도당을 배출하게 된다. 국내 기준 65세 이상 인구 다섯 명 중 한 명이 당뇨로 조사되었으며, 당뇨 전단계로 불리는 공복 혈당 장애까지 합치면 노년 인구의 절반(47.4%)이 당뇨이거나 당뇨병 임박으로 집계되었다. 또한 국내 30대 이상 성인 10명 중 2명(20%)이 당뇨 전단계 환자로 당뇨병 환자(12.4%)의 2배에 가까운 잠재 집단이 있는 것으로 집계되어 당뇨 환자는 더욱더 늘어날 것으로 예측된다. 당뇨병은 심장병 뇌졸중 등 거의 모든 심혈관 질환 발생의 방아쇠 역할을 하며, 투석 생활을 해야하는 만성 신부전증이나 실명을 유발하는 망막 질환의 최대원인이므로 이에따른 심각성이 대두되고 있다.
한편, 당뇨 전단계(Pre-diabetes)는 혈당 수준이 정상인과 당뇨 환자 사이에 있는 단계로, 공복혈당 기준으로 정상은 99㎎/dL 이하, 당뇨병은 126㎎/dL 이상이며 그 사이 구간, 즉 100~125㎎/dL를 당뇨 전단계로 구분하고 있다. 당뇨 전단계는 당뇨라고 명확히 진단할 수는 없지만 당뇨로 발전할 수 있는 확률은 정상인보다 5배에서 최대 17배 정도나 높은 것으로 알려져 있다.
기존에 알려져 있는 당뇨 전단계 마커로는 당뇨진단에 쓰이는 HbA1C, fructosamin, glycated albumin 등이 사용되고 있는데(Metab Syndr Relat Disord. 2014 Jun 1; 12(5): 258-268.), 이는 당뇨 전단계 특이적인 마커가 아니므로 특이성이나 민감도가 떨어지고 특정 임상적인 조건(acute and intermittent hyperglycemia)에서는 당뇨 전단계 진단이 불가한 경우도 있어 당뇨 전단계 특이적인 마커에 대한 연구가 미미하다.
현재 당화혈색소, 당부하검사, 공복 및 임의혈당 검사 결과를 통해 당뇨병을 진단할 수는 있으나, 정상 및 당뇨 전단계가 당뇨병으로 이행될 위험도를 미리 예측할 수 있는 방법은 아직까지 연구되지 않았으며, 새로운 당뇨병 진단, 예측 바이오마커의 수립으로 당뇨병 발생 위험도를 예측할 수 있으며, 기존에 알려진 miRNA 뿐만 아니라 small RNA들의 당뇨 진행단계에 따른 변화를 생물정보학 방법을 통해 분석함으로써 당뇨병 또는 이로인한 합병증을 예방하기 위한 바이오마커의 개발이 필요한 실정이다.
상기와 같은 종래의 문제점을 해결하기 위하여, 본 발명자들은 정상군, 당뇨 전단계 환자군, 당뇨 환자군에 해당하는 대상자들로부터 혈액을 채취하고 이로부터 엑소좀(exosome) RNA를 분리한 후 NGS 분석을 통해 엑소좀 microRNA의 발현수준을 비교분석한 결과, 당뇨 전단계 환자군에서 당뇨 발생 위험 지표로 사용되거나 당뇨 합병증 발병 예측에 용이한 당뇨 조기진단 바이오마커를 발견하였는바, 이에 기초하여 본 발명을 완성하였다.
이에, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는, 당뇨 전단계 진단용 마커 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 전단계 진단용 조성물 및 상기 조성물을 포함하는, 당뇨 전단계 진단용 키트를 제공하는 것을 다른 목적으로 한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 전단계 진단을 위한 정보제공방법을 제공하는 것을 또 다른 목적으로 한다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는, 당뇨 합병증 발병 예측용 마커 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 합병증 발병 예측용 조성물 및 상기 조성물을 포함하는 당뇨 합병증 발병 예측용 키트를 제공하는 것을 다른 목적으로 한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 합병증의 발병을 예측하기 위한 정보제공방법을 제공하는 것을 또 다른 목적으로 한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하거나 검출하는 단계를 포함하는 당뇨 전단계 진단 방법을 제공하는 것을 또 다른 목적으로 한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하거나 검출하는 단계를 포함하는 당뇨 합병증의 발병을 예측하는 방법을 제공하는 것을 또 다른 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는, 당뇨 전단계 진단용 마커 조성물을 제공한다.
본 발명의 일구현예로, 상기 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상을 더 포함할 수 있다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 전단계 진단용 조성물을 제공한다.
본 발명의 일구현예로, 상기 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 제제를 더 포함할 수 있다.
본 발명의 다른 구현예로, 상기 마이크로RNA의 발현수준을 측정하는 제제는 상기 마이크로RNA에 특이적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있다.
또한, 본 발명은 상기 당뇨 전단계 진단용 조성물을 포함하는, 당뇨 전단계 진단용 키트를 제공한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 전단계 진단을 위한 정보제공방법을 제공한다.
본 발명의 일구현예로, 상기 방법은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 단계를 더 포함할 수 있다.
본 발명의 다른 구현예로, 상기 생물학적 시료는 혈액 또는 혈장 유래 엑소좀(exosome)일 수 있다.
본 발명의 또 다른 구현예로, 상기 마이크로RNA의 발현수준은 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 하나 이상의 방법을 통해 측정될 수 있다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는, 당뇨 합병증 발병 예측용 마커 조성물을 제공한다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 합병증 발병 예측용 조성물을 제공한다.
또한, 본 발명은 상기 당뇨 합병증 발병 예측용 조성물을 포함하는, 당뇨 합병증 발병 예측용 키트를 제공한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 합병증의 발병을 예측하기 위한 정보제공방법을 제공한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하거나 검출하는 단계를 포함하는 당뇨 전단계 진단 방법을 제공한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하거나 검출하는 단계를 포함하는 당뇨 합병증의 발병을 예측하는 방법을 제공한다.
본 발명의 일구현예로, 상기 방법은 피검체 또는 인간 환자로부터 생물학적 시료를 얻는 단계를 더 포함할 수 있다.
본 발명자들은 정상군, 당뇨 전단계 환자군, 당뇨 환자군의 혈액에서 분리한 엑소좀(exosome) 내에 포함된 microRNA를 분석한 결과, 당뇨 전단계 환자군에서 특이적인 7개의 마이크로RNAs를 동정하였다. 이에, 상기 동정된 마이크로RNAs를 이용하여 당뇨 전단계를 조기에 진단할 수 있어 조기 당뇨의 진단이 가능하고, 이후 당뇨 또는 당뇨 합병증의 발병을 예측하기 위한 바이오마커로 유용하게 이용할 수 있을 것으로 기대된다.
도 1은 정상군(HV) 및 당뇨 전단계(Pre-DM) 대상자들의 혈장에서 분리한 엑소좀 내 microRNAs의 발현수준을 비교분석한 결과로서, 도 1a는 정상군에 비해 당뇨 전단계에서 유의적으로 2배 이상(p < 0.05) 발현이 감소 또는 증가한 microRNAs의 발현수준에 따른 계층적 클러스터링을 수행한 히트맵 결과이고, 도 1b는 상기에서 검출된 microRNAs의 발현수준에 따른 산점도(scatter plot) 결과이다.
도 2는 당뇨 전단계(Pre-DM) 및 당뇨군(DM) 대상자들의 혈장에서 분리한 엑소좀 내 microRNAs의 발현수준을 비교분석한 결과로서, 도 2a는 당뇨 전단계군에 비해 당뇨군에서 유의적으로 2배 이상(p < 0.05) 발현이 감소 또는 증가한 microRNAs의 발현수준에 따른 계층적 클러스터링을 수행한 히트맵 결과이고, 도 2b는 상기에서 검출된 microRNAs의 발현수준에 따른 산점도(scatter plot) 결과이다.
도 3은 정상군(HV) 및 당뇨군(DM) 대상자들의 혈장에서 분리한 엑소좀 내 microRNAs의 발현수준을 비교분석한 결과로서, 도 3a는 정상군에 비해 당뇨군에서 유의적으로 2배 이상(p < 0.05) 발현이 감소 또는 증가한 microRNAs의 발현수준에 따른 계층적 클러스터링을 수행한 히트맵 결과이고, 도 3b는 상기에서 검출된 microRNAs의 발현수준에 따른 산점도(scatter plot) 결과이다.
도 4는 상기 도 1 내지 도 3의 결과를 바탕으로 정상군(HV), 당뇨 전단계(Pre-DM) 및 당뇨군(DM)에 대하여 다차원척도법(MDS) 분석을 실시한 결과이다.
도 5는 정상군(HV), 당뇨 전단계(Pre-DM) 및 당뇨군(DM) 간의 마이크로RNAs(miRNAs)의 발현수준을 측정하여 비교한 결과이다.
본 발명자들은 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측을 위한 바이오마커를 발굴하기 위해 예의 연구한 결과, 당뇨 전단계에서 특이적인 발현 변화를 나타내는 바이오마커를 발견함으로써 본 발명을 완성하였다.
이에, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 마커 조성물을 제공한다.
본 발명에 있어서, 상기 마커 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상을 더 포함할 수 있다.
또한, 본 발명은 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 조성물 및 상기 조성물을 포함하는 키트를 제공한다.
본 발명에 있어서, 상기 당뇨 전단계 진단용 또는 당뇨 합병증 발병 예측용 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 제제를 더 포함할 수 있다.
본 발명에서 사용되는 용어, “진단(diagnosis)”이란 넓은 의미로는 환자의 병의 실태를 모든 면에 걸쳐서 판단하는 것을 의미한다. 판단의 내용은 병명, 병인, 병형, 경중, 병상의 상세한 양태, 및 합병증의 유무 등이다. 본 발명에서 진단은 당뇨 전단계의 진행 수준 등을 판단하는 것일 수 있다.
본 발명에서 사용되는 용어,“발병 예측(predict development)”이란 특정 개인에 대하여 당뇨 합병증이 발병할 가능성이 있는지, 발병할 가능성이 상대적으로 높은지, 또는 당뇨 합병증이 이미 발병하였는지 여부를 판별하는 것을 말한다. 본 발명에서의 예측은 당뇨 전단계 마커의 발현 여부를 기반으로 당뇨 합병증의 발병 위험도를 예측하는데 사용할 수 있다.
본 발명에서 사용되는 용어, “당뇨 전단계(Pre-diabetes)”는 혈당 수준이 정상인과 당뇨 환자 사이에 있는 단계로, 공복혈당 기준으로 정상은 99㎎/dL 이하, 당뇨병은 126㎎/dL 이상이며 당뇨 전단계는 그 사이 구간, 즉 100~125㎎/dL의 공복혈당을 나타내는 단계를 의미한다.
본 발명에서 사용되는 용어, “당뇨 합병증(diabetic complications)”은 당뇨로 인해 발생되는 다양한 병증으로, 당뇨성 망막증, 당뇨성 백내장, 당뇨성 신증, 당뇨성 신경병증 또는 당뇨성 혈관 합병증일 수 있으나, 이에 제한되는 것은 아니다.
본 발명자들은 실시예를 통해 당뇨 전단계 진단용 바이오마커로써 상기 마이크로RNA 1290(microRNA-1290), 마이크로RNA 4286(microRNA-4286), 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)를 발굴하였다.
보다 구체적으로, 본 발명의 일실시예에서는 정상군, 당뇨 전단계군, 당뇨군에 해당하는 대상자들을 모집하고 이들의 혈액에서 엑소좀을 분리하여 엑소좀 내 miRNA의 발현수준을 비교분석하였다(실시예 1 참조).
본 발명의 다른 실시예에서는, 각각 (1) 정상군 및 당뇨 전단계군, (2) 당뇨 전단계군 및 당뇨군, (3) 정상군 및 당뇨군에서 차이가 있는 microRNAs를 분석하였으며, microRNAs 발현수준 결과를 이용하여 다차원척도법으로 분석한 결과 2차원 상에서 정상군, 당뇨 전단계군, 당뇨군이 순차적인 패턴을 보이는 것을 확인하였다. 또한, 정상에서 당뇨 전단계 및 당뇨로 갈수록 점점 증가(miR-1290)하거나 정상에서 당뇨 전단계 및 당뇨로 갈수록 점점 감소(miR-1307-3p, miR-19a-3p, miR-19b-3p, miR-326, miR-382-5p, miR-4286)하는 miRNAs를 최종적으로 선별하였다. 선별된 miRNAs는 실제로 정상군과 당뇨 전단계군 간에 유의한 발현 차이를 나타내는 것을 확인하였다(실시예 2-1 내지 2-4 참조).
상기 결과로부터, 본 발명에서 발굴한 마이크로RNA 1290(microRNA-1290), 마이크로RNA 4286(microRNA-4286), 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)는 당뇨 전단계 진단 또는 당뇨 합병증의 발병을 예측하기 위한 바이오마커로 유용하게 이용될 수 있다.
본 발명에서 발굴한 당뇨 전단계 진단 또는 당뇨 합병증의 발병 예측용 바이오마커인 마이크로RNA 1290(microRNA-1290), 마이크로RNA 4286(microRNA-4286), 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)는 하기 [표 1]에 도시된 염기서열로 이루어진 것일 수 있다.
miRNA 서열
hsa-miR-1290 uggauuuuuggaucaggga (서열번호 1)
hsa-miR-1307-3p acucggcguggcgucggucgug (서열번호 2)
hsa-miR-19a-3p ugugcaaaucuaugcaaaacuga (서열번호 3)
hsa-miR-19b-3p ugugcaaauccaugcaaaacuga (서열번호 4)
hsa-miR-326 ccucugggcccuuccuccag (서열번호 5)
hsa-miR-382-5p gaaguuguucgugguggauucg (서열번호 6)
hsa-miR-4286 accccacuccugguacc (서열번호 7)
본 발명에 있어서, 상기 마이크로RNA 1290(microRNA-1290), 마이크로RNA 4286(microRNA-4286), 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)의 발현 수준을 측정하는 제제는 상기 마이크로RNA에 특이적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있으나, 이에 제한되는 것은 아니다.
발명에서 사용되는 용어, “프라이머”란 DNA 합성의 기시점이 되는 짧은 유전자 서열로써, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화 등으로 변형시킬 수 있다.
본 발명에서 사용되는 용어, "프로브"는 자연의 또는 변형된 모노머 또는 연쇄(linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오타이드 및 리보뉴클레오타이드를 포함하고 타깃 뉴클레오타이드 서열에 특이적으로 혼성화할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다.
본 발명의 진단용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치로 구성된다.
예컨대, 본 발명의 키트는 PCR을 수행하기 위해, 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 함유할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.
또한, 본 발명의 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
본 발명의 다른 양태로서, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 전단계 진단 또는 당뇨 합병증의 발병을 예측하기 위한 정보제공방법을 제공한다.
본 발명에 있어서, 상기 정보제공방법은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 단계를 더 포함할 수 있다.
상기 피검체 유래의 생물학적 시료는 조직, 세포, 전혈, 혈액, 타액, 객담, 뇌척수액 또는 뇨 등을 포함할 수 있고, 보다 바람직하게는 혈액 또는 혈장 유래 엑소좀일 수 있으나 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 방법에 따라 피검자 유래 시료에서 분리한 엑소좀 내에서 마이크로RNA 1290(microRNA-1290)의 발현수준이 정상인 보다 높을 경우 당뇨 전단계로 판정할 수 있고, 마이크로RNA 4286(microRNA-4286), 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 또는 마이크로RNA 382-5p(microRNA-382-5p)의 발현수준이 정상인 보다 낮을 경우 당뇨 전단계로 판정할 수 있다.
상기 microRNAs의 발현수준은 당업계에 알려진 통상적인 방법으로 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 또는 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 하나 이상의 방법을 통해 측정될 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하거나 검출하는 단계를 포함하는 당뇨 전단계 진단 방법을 제공한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하거나 검출하는 단계를 포함하는 당뇨 합병증의 발병을 예측하는 방법을 제공한다.
본 발명의 일구현예로, 상기 방법은 피검체 또는 인간 환자로부터 생물학적 시료를 얻는 단계를 더 포함할 수 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
[실시예]
실시예 1. 실험준비 및 실험방법
1-1. 분석 대상 모집
본 발명자들은 당뇨 전단계의 조기 진단 또는 당뇨병 관련 합병증의 발병을 예방하기 위한 바이오마커를 발굴하기 위해, 각각 정상군(HV, 공복혈당 95이하, HbA1c 5.5 이하) 20명, 당뇨-전단계군(Pre-DM, 공복혈당 100-125, HbA1c 5.8-6.3 이하) 20명 및 당뇨군(DM, HbA1c 6.5 이상) 20명의 대상자들을 모집하였다. 이때 각 군을 나누는 기준은 미국 당뇨병 학회 기준을 참고하였으며, 환자군간 구분을 명확히 하여 좀 더 정확한 마커를 찾기 위해 경계부분을 제외한 새로운 기준을 적용하였다 (미국 당뇨병 학회 기준; 정상 (공복혈당 100미만, HbA1c 5.7미만) 당뇨 전단계 (공복혈당 100-125, HbA1c 5.8-6.4) 당뇨 (공복혈당 126이상, HbA1c 6.5 이상)). 상기 정상군, 당뇨-전단계군, 당뇨군으로부터 혈장 샘플을 채취하여 그룹 간 차이를 나타내는 생체지표를 찾고자 하였다. 이를 위해, 상기 각 군의 대상자들로부터 혈장을 제공받았다.
1-2. 혈장으로부터 RNA 분리 및 서열분석 수행
상기 실시예 1-1에서 각 군의 대상자들로부터 채취한 혈장 샘플에 대하여 Exoquick(SBI, USA)을 사용해 엑소좀(exosome)을 분리하였고, 상기 분리된 엑소좀으로부터 Qiagen miRNeasy kit을 이용하여 총 RNA를 추출하였으며, 추출된 총 RNA의 질은 Agilent RNA Bioanalyzer를 이용해 제조사의 지시에 따라 측정하였다.
이후 상기 분리된 RNA를 이용하여 마크로젠사에서 Takara SMARTer smRNA for illumina kit를 사용하여 라이브러리를 제작한 후 Hiseq 2500으로 차세대 염기서열 분석(NGS)을 실시하여 microRNA를 검출하였다.
실시예 2. 당뇨 전단계 진단용 microRNA 발굴
2-1. 정상군 vs. 당뇨 전단계의 발현수준에 차이가 있는 microRNA 분석
먼저, 본 발명자들은 상기 정상군 20명과 당뇨 전단계 20명의 혈액 유래 엑소좀에서 발현수준의 차이가 나는 microRNA(miRNA)를 동정하기 위하여, 상기 실시예 1-1 및 1-2의 방법에 따라 각 대상자들에서 채취한 혈장으로부터 엑소좀을 분리하고 추출된 총 RNA에 대한 NGS 분석을 실시하였다. 분석 결과 486개의 miRNAs가 검출되었으며, 나아가 상기 검출된 miRNAs의 발현수준을 비교하였다.
그 결과, 도 1a에 나타낸 바와 같이 486개의 miRNAs 중에 정상군(HV)에 비해 당뇨 전단계 (Pre-DM)에서 2배 이상(p < 0.05) 발현이 감소하는 miRNA가 82개, 발현이 증가하는 miRNA가 39개로 나타났다. 또한, 상기 유의한 발현 변화를 보이는 miRNAs의 발현수준에 따른 산점도(scatter plot) 결과를 도 1b에 나타내었다.
2-2. 당뇨 전단계 vs. 당뇨군의 발현수준에 차이가 있는 microRNA 분석
상기 결과에 더하여, 본 발명자들은 상기 당뇨 전단계 20명과 당뇨군 20명의 혈액 유래 엑소좀에서 발현수준의 차이가 나는 miRNA를 동정하기 위하여, 상기와 동일한 방법으로 얻은 엑소좀 내 총 RNA에 대한 NGS 분석을 실시하였다. 분석 결과 486개의 miRNA가 검출되었으며, 나아가 상기 검출된 miRNAs의 발현수준을 비교하였다.
그 결과, 도 2a에 나타낸 바와 같이 486개의 miRNAs 중에 당뇨 전단계에 비해 당뇨군에서 2배 이상(p < 0.05) 발현이 감소하는 miRNA가 28개, 발현이 증가하는 miRNA가 47개로 나타났다. 또한, 상기 유의한 발현 변화를 보이는 miRNAs의 발현수준에 따른 산점도(scatter plot) 결과를 도 2b에 나타내었다.
2-3. 정상군 vs. 당뇨군의 발현수준에 차이가 있는 miRNA 분석
또한, 본 발명자들은 정상군 20명과 당뇨군 20명의 혈액 유래 엑소좀에서 발현수준의 차이가 나는 miRNA를 동정하기 위하여, 상기와 동일한 방법으로 얻은 엑소좀 내 총 RNA에 대한 NGS 분석을 실시하였다. 분석 결과 486개의 miRNAs가 검출되었으며, 나아가 상기 검출된 miRNAs의 발현수준을 비교하였다.
그 결과, 도 3a에 나타낸 바와 같이 486개의 miRNAs 중에 정상군(HV)에 비해 당뇨군(DM)에서 2배 이상(p < 0.05) 발현이 감소하는 miRNA가 139개, 발현이 증가하는 miRNA가 103개로 나타났다. 또한, 상기 유의한 발현 변화를 보이는 miRNAs의 발현수준에 따른 산점도(scatter plot) 결과를 도 3b에 나타내었다.
2-4. 정상군 vs. 당뇨 전단계 vs. 당뇨군의 발현수준에 차이가 있는 miRNA 분석
나아가 정상군, 당뇨 전단계 및 당뇨군에 대하여 다차원척도법(MDS)을 통해 개별 샘플에 대한 변화량을 도출하여 이를 시각화하여 분석하였다. 그 결과, 도 4에 나타낸 바와 같이 정상군과 당뇨군에서 각각 나타나는 2차원 상의 공간적 위치가 두개의 그룹으로 확연하게 구분되어 나타났으며, 대체적으로 정상군, 당뇨 전단계 및 당뇨군이 순차적인 패턴을 보이는 것을 확인하였다. 또한, 상기 실시예 2-1 내지 2-3의 결과를 통해 얻은 분석 결과로서, 발현수준의 변화가 나타나는 miRNAs를 분류하였으며, 구체적으로 하기 [표 2]에 나타낸 바와 같이, 정상에서 당뇨 전단계 및 당뇨로 갈수록 점점 증가(miR-1290)하거나 정상에서 당뇨 전단계 및 당뇨로 갈수록 점점 감소(miR-1307-3p, miR-19a-3p, miR-19b-3p, miR-326, miR-382-5p, miR-4286)하는 miRNAs를 최종적으로 선별하였다.
Fold change
MaturemiRNA Pre-DM/HV DM/Pre-DM DM/HV ANOVA
hsa-miR-326 -5.09 -2.38 -12.13 ***
hsa-miR-4286 -3.50 -2.84 -9.94 ***
hsa-miR-19b-3p -2.68 -2.39 -6.39 ***
hsa-miR-1307-3p -2.62 -2.35 -6.15 ***
hsa-miR-382-5p -2.34 -2.53 -5.94 ***
hsa-miR-19a-3p -2.28 -2.94 -6.68 ***
hsa-miR-1290 2.46 4.92 12.08 ***
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (20)

  1. 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는, 당뇨 전단계 진단용 마커 조성물.
  2. 제1항에 있어서,
    상기 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상을 더 포함하는 것을 특징으로 하는, 마커 조성물.
  3. 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 전단계 진단용 조성물.
  4. 제3항에 있어서,
    상기 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 제제를 더 포함하는 것을 특징으로 하는, 조성물.
  5. 제3항에 있어서,
    상기 마이크로RNA의 발현수준을 측정하는 제제는 상기 마이크로RNA에 특이적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브인 것을 특징으로 하는, 조성물.
  6. 제3항 내지 제5항 중 어느 한 항의 조성물을 포함하는, 당뇨 전단계 진단용 키트.
  7. 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 전단계 진단을 위한 정보제공방법.
  8. 제7항에 있어서,
    상기 방법은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 단계를 더 포함하는 것을 특징으로 하는, 정보제공방법.
  9. 제7항에 있어서,
    상기 생물학적 시료는 혈액 또는 혈장 유래 엑소좀(exosome)인 것을 특징으로 하는, 정보제공방법.
  10. 제7항에 있어서,
    상기 마이크로RNA의 발현수준은 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 하나 이상의 방법을 통해 측정되는 것을 특징으로 하는, 정보제공방법.
  11. 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)을 포함하는, 당뇨 합병증 발병 예측용 마커 조성물.
  12. 제11항에 있어서,
    상기 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상을 더 포함하는 것을 특징으로 하는, 마커 조성물.
  13. 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 제제를 포함하는, 당뇨 합병증 발병 예측용 조성물.
  14. 제13항에 있어서,
    상기 조성물은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 제제를 더 포함하는 것을 특징으로 하는, 조성물.
  15. 제13항에 있어서,
    상기 마이크로RNA의 발현수준을 측정하는 제제는 상기 마이크로RNA에 특이적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브인 것을 특징으로 하는, 조성물.
  16. 제13항 내지 제15항 중 어느 한 항의 조성물을 포함하는, 당뇨 합병증 발병 예측용 키트.
  17. 피검체 유래의 생물학적 시료에서 마이크로RNA 1290(microRNA-1290) 및 마이크로RNA 4286(microRNA-4286)의 발현수준을 측정하는 단계를 포함하는, 당뇨 합병증의 발병을 예측하기 위한 정보제공방법.
  18. 제17항에 있어서,
    상기 방법은 마이크로RNA 1307-3p(microRNA-1307-3p), 마이크로RNA 19a-3p(microRNA-19a-3p), 마이크로RNA 19b-3p(microRNA-19b-3p), 마이크로RNA 326(microRNA-326) 및 마이크로RNA 382-5p(microRNA-382-5p)로 이루어진 군에서 선택되는 하나 이상의 발현수준을 측정하는 단계를 더 포함하는 것을 특징으로 하는, 정보제공방법.
  19. 제17항에 있어서,
    상기 생물학적 시료는 혈액 또는 혈장 유래 엑소좀(exosome)인 것을 특징으로 하는, 정보제공방법.
  20. 제17항에 있어서,
    상기 마이크로RNA의 발현수준은 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 하나 이상의 방법을 통해 측정되는 것을 특징으로 하는, 정보제공방법.
PCT/KR2022/002924 2021-03-04 2022-03-02 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도 WO2022186592A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0028691 2021-03-04
KR1020210028691A KR102525144B1 (ko) 2021-03-04 2021-03-04 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022186592A1 true WO2022186592A1 (ko) 2022-09-09

Family

ID=83155464

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/002924 WO2022186592A1 (ko) 2021-03-04 2022-03-02 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도

Country Status (2)

Country Link
KR (1) KR102525144B1 (ko)
WO (1) WO2022186592A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240067606A (ko) 2022-11-09 2024-05-17 중앙대학교 산학협력단 동맥경화반의 심혈관질환 예측 마커 및 이를 이용한 심혈관질환 발생 예측 방법

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2839005B1 (en) * 2012-04-20 2021-01-06 Aptamir Therapeutics, Inc. Mirna modulators of thermogenesis

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021150011A1 (ko) * 2020-01-22 2021-07-29 계명대학교 산학협력단 당뇨 조기진단 또는 당뇨병성 합병증 진단을 위한 바이오마커 및 이의 용도

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2839005B1 (en) * 2012-04-20 2021-01-06 Aptamir Therapeutics, Inc. Mirna modulators of thermogenesis

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BARUTTA F., BELLINI S., MASTROCOLA R., BRUNO G., GRUDEN G.: "MicroRNA and Microvascular Complications of Diabetes", INTERNATIONAL JOURNAL OF ENDOCRINOLOGY, HINDAWI PUBLISHING CORPORATION, US, vol. 2018, 1 January 2018 (2018-01-01), US , pages 1 - 20, XP055963960, ISSN: 1687-8337, DOI: 10.1155/2018/6890501 *
COPIER CAMILA URIBE, LEÓN LUIS, FERNÁNDEZ MAURICIO, CONTADOR DAVID, CALLIGARIS SEBASTIÁN D.: "Circulating miR-19b and miR-181b are potential biomarkers for diabetic cardiomyopathy", SCIENTIFIC REPORTS, vol. 7, no. 1, 1 December 2017 (2017-12-01), XP055963956, DOI: 10.1038/s41598-017-13875-2 *
GUARINO ELISA, DELLI POGGI CHIARA, GRIECO GIUSEPPINA EMANUELA, CENCI VALERIA, CECCARELLI ELENA, CRISCI ISABELLA, SEBASTIANI GUIDO,: "Circulating MicroRNAs as Biomarkers of Gestational Diabetes Mellitus: Updates and Perspectives", INTERNATIONAL JOURNAL OF ENDOCRINOLOGY, HINDAWI PUBLISHING CORPORATION, US, vol. 2018, 1 January 2018 (2018-01-01), US , pages 1 - 11, XP055963953, ISSN: 1687-8337, DOI: 10.1155/2018/6380463 *
KIM HYOSHIK, BAE YUN-UI, LEE HAEKYUNG, KIM HYOUNGNAE, JEON JIN SEOK, NOH HYUNJIN, HAN DONG CHEOL, BYUN DONG WON, KIM SANG HYUN, PA: "Effect of diabetes on exosomal miRNA profile in patients with obesity", BMJ OPEN DIABETES RESEARCH & CARE, vol. 8, no. 1, 1 September 2020 (2020-09-01), pages e001403, XP055963961, DOI: 10.1136/bmjdrc-2020-001403 *
SIDORKIEWICZ IWONA, NIEMIRA MAGDALENA, MALISZEWSKA KATARZYNA, EROL ANNA, BIELSKA AGNIESZKA, SZALKOWSKA ANNA, ADAMSKA-PATRUNO EDYTA: "Circulating miRNAs as a Predictive Biomarker of the Progression from Prediabetes to Diabetes: Outcomes of a 5-Year Prospective Observational Study", JOURNAL OF CLINICAL MEDICINE, vol. 9, no. 7, 10 July 2020 (2020-07-10), pages 2184, XP055963957, DOI: 10.3390/jcm9072184 *

Also Published As

Publication number Publication date
KR20220124941A (ko) 2022-09-14
KR102525144B1 (ko) 2023-04-21

Similar Documents

Publication Publication Date Title
Ipson et al. Identifying exosome-derived MicroRNAs as candidate biomarkers of frailty
US11767565B2 (en) Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
KR102110039B1 (ko) 비만 진단을 위한 마이크로RNA-26b 또는 마이크로RNA-4449 바이오마커 및 이의 용도
KR102178922B1 (ko) 당뇨병성 신증 진단을 위한 마이크로RNA let-7 또는 마이크로RNA-150 바이오마커 및 이의 용도
WO2014163445A1 (ko) 위암에 대한 예후 예측 모형의 제조방법
WO2022186592A1 (ko) 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도
WO2020242080A1 (ko) 편평상피세포암의 진단 또는 예후 예측용 마커 및 이의 용도
KR102492149B1 (ko) 난소암 진단 또는 감별진단을 위한 마이크로rna-1246 및 이의 용도
KR102178919B1 (ko) 당뇨병성 신증 진단을 위한 마이크로rna 바이오마커 및 이의 용도
Pollet et al. Host miRNAs as biomarkers of SARS-CoV-2 infection: a critical review
CN111321219A (zh) Acta2甲基化作为哮喘诊断标志物的用途
KR102165841B1 (ko) 당뇨병 진단을 위한 마이크로RNA let-7b 또는 마이크로RNA-664a 바이오마커 및 이의 용도
WO2023177132A1 (ko) 당뇨 전단계 및 당뇨병 진단용 바이오마커 및 이의 용도
WO2022025387A1 (ko) Microrna조합을 이용한 비알코올 지방간염 진단용 바이오마커
WO2021112612A1 (ko) 자궁경부암 환자의 항암방사선 치료 반응성 예측용 바이오마커 조성물
EP4112745A1 (en) Biomarkers for predicting a patient&#39;s response to bcg therapy, methods and uses based thereon
WO2021080335A1 (ko) 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물
KR102110050B1 (ko) 당뇨병 진단을 위한 마이크로rna-423 또는 마이크로rna-424 바이오마커 및 이의 용도
WO2024035082A1 (ko) 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물
WO2024049247A1 (ko) 신규 파킨슨병 바이오마커 및 이의 용도
WO2024128688A1 (ko) 간질성방광염 진단 또는 예후 예측용 신규 바이오마커 및 이의 용도
KR102480430B1 (ko) 주사증 진단을 위한 마이크로RNA-31-5p 및 이의 용도
WO2022080882A1 (ko) 만성신장질환의 악화 예측 마커로서의 snp 및 이의 이용
CN116694642B (zh) 一种不稳定型心绞痛生物标记物及其检测方法、应用和试剂盒
WO2022103027A1 (ko) 자궁경부암의 급성 종양 반응 진단용 바이오 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22763574

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22763574

Country of ref document: EP

Kind code of ref document: A1