WO2024035082A1 - 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물 - Google Patents

엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물 Download PDF

Info

Publication number
WO2024035082A1
WO2024035082A1 PCT/KR2023/011690 KR2023011690W WO2024035082A1 WO 2024035082 A1 WO2024035082 A1 WO 2024035082A1 KR 2023011690 W KR2023011690 W KR 2023011690W WO 2024035082 A1 WO2024035082 A1 WO 2024035082A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
lung cancer
small cell
cell lung
mirna
Prior art date
Application number
PCT/KR2023/011690
Other languages
English (en)
French (fr)
Inventor
노진경
이재철
최창민
김동하
지원준
Original Assignee
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 재단법인 아산사회복지재단
Publication of WO2024035082A1 publication Critical patent/WO2024035082A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a biomarker composition for diagnosing small cell lung cancer containing exosome-derived miRNA as an active ingredient.
  • Lung cancer is a disease with a high incidence and mortality rate worldwide, and among cancers, lung cancer has a high incidence and mortality rate.
  • Lung cancer can be divided into non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) depending on the size of the cells, of which small cell lung cancer accounts for approximately 10 to 20% of all lung cancers.
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • LD limited disease
  • ED extensive disease
  • LD is when the cancer is limited to only one side of the lung, including the mediastinum
  • ED is when the cancer is limited to the opposite lung or other organs.
  • Small cell lung cancer has a very rapid tumor formation and metastasis rate, making it difficult to predict the prognosis.
  • Most small cell lung cancer patients are already diagnosed as terminally ill (ED) at the time of diagnosis, and the 5-year survival rate is reported to be less than 10%.
  • ED terminally ill
  • EP chemotherapy initial combination chemotherapy
  • the purpose of the present invention is to provide a biomarker composition for diagnosing small cell lung cancer containing exosome-derived miRNA as an active ingredient.
  • Another object of the present invention is to provide a composition for diagnosing small cell lung cancer containing as an active ingredient an agent capable of measuring the expression level of exosome-derived miRNA.
  • Another object of the present invention is to provide a kit for diagnosing small cell lung cancer comprising the composition for diagnosing small cell lung cancer as an active ingredient.
  • Another object of the present invention is to provide a biomarker composition for predicting the prognosis of small cell lung cancer containing exosome-derived miRNA as an active ingredient.
  • Another object of the present invention is to provide a method of providing information for diagnosing or predicting prognosis of small cell lung cancer.
  • the present invention provides a biomarker composition for diagnosing small cell lung cancer, which includes miRNA consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p as an active ingredient.
  • the present invention provides a composition for diagnosing small cell lung cancer comprising, as an active ingredient, an agent capable of measuring the expression level of miRNAs consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p.
  • the present invention provides a kit for diagnosing small cell lung cancer, comprising the composition for diagnosing small cell lung cancer as an active ingredient.
  • the present invention provides a biomarker composition for predicting the prognosis of small cell lung cancer, which contains miRNA consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p as an active ingredient.
  • the present invention includes the steps of isolating a biological sample from an individual; And providing a method of providing information for diagnosing or predicting prognosis of small cell lung cancer, including measuring the expression level of miRNA consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p in the separated biological sample. do.
  • the accuracy of small cell lung cancer diagnosis and prognosis prediction is achieved by individually or in combination the seven miRNAs whose expression is specifically increased or decreased in the small cell lung cancer patient group, which was identified through the analysis of miRNAs in exosomes isolated from the normal group and the small cell lung cancer patient group.
  • the combination of miRNAs consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p showed excellent small cell lung cancer diagnosis and prognosis prediction effects, making it a biomarker for small cell lung cancer diagnosis or prognosis prediction. It can be usefully used as a composition.
  • Figure 1a shows the results of observing the morphological characteristics of exosomes isolated from the normal group and the early stage small cell lung cancer patient group using an electron microscope.
  • Figures 1b to 1e show the results of analyzing the size distribution of the exosomes using a nanoparticle tracking analysis method.
  • Figure 1f shows the results of analyzing the exosome markers (TSG1, HSP90, CD63, and CD81) through Western blot.
  • Figure 2 shows the results of analyzing the internal components of exosomes isolated from the normal group and small cell lung cancer patient group using a Bioanalyzer.
  • Figure 3a is a schematic result of data analyzed by microarray method for miRNA in exosomes isolated from normal group and small cell lung cancer patient group through principal component analysis (PCA plot).
  • Figure 3b shows the results of analyzing the number of miRNAs in exosomes and the number of common miRNAs according to the normal group and small cell lung cancer patient group.
  • Figure 3c shows the results of comparing and analyzing the total and average number of miRNAs in exosomes according to the normal group and small cell lung cancer patient group.
  • Figure 3D is the group average of the individual patient outcomes in Figure 3C.
  • Figures 3e and 3f show 31 miRNAs showing statistical significance (p-vaule ⁇ 0.05) differences between the normal group and the small cell lung cancer patient group, respectively, as a result of microarray analysis; This is the result of analyzing the top or bottom 10 miRNAs showing the greatest change in expression rate.
  • Figures 4a and 4b show the results of selecting 25 miRNAs based on verification through polymerase chain reaction (Real-Time PCR; RT-PCR) of a total of 51 miRNAs identified in Figures 3e and 3f. .
  • Figures 5a to 5g compare the expression changes of specific 7 miRNAs among the 25 miRNAs selected in Figure 4 according to the normal group and small cell lung cancer patient group (limited stage; LD + extended stage; ED) through RT-PCR. This is the result of analysis.
  • Figure 6 shows the results of analyzing whether the seven specific miRNAs identified in Figure 5 can distinguish and detect the normal group and the small cell lung cancer patient group using an receiver operating characteristic (AUC-ROC) classification model.
  • Figure 6a shows the results of applying each or all possible combinations of the seven miRNAs to a classification model.
  • Figures 6b to 6j are graphs showing the results of applying Figure 6a.
  • Figures 7a and 7b show the results of dividing the small cell lung cancer patient group into low risk and high risk, and comparing and analyzing the survival rates of the two groups through hazard ratio (HR) analysis.
  • Figure 7c shows the results of analyzing the predicted targets of three miRNAs using bioinformatics technology.
  • Figures 7d and 7e show the results of analyzing the possibility of functional changes in cells through exosomes through KEGG pathway and Gene Ontology analysis, respectively, for the predicted target genes identified in Figure 7c.
  • Figure 8 shows the three secured miRNAs (miR-200b-3P, miR-3124-5p, and miR-92b-5p) individually or in a mixture (miR3124 mimic, miR200b mimic, and miR92b inhibitor) in a normal lung cell line (BEAS2B cell). This is the result of confirming the pattern of genes changing compared to the control after transduction through mRNA-sequencing.
  • Figure 8a shows the results of principal component analysis (PCA) of samples transduced into BEAS2B cells.
  • Figure 8b is a volcano plot comparing the change pattern of mRNAs through transduced miRNAs in BEAS2B cells with the control group.
  • PCA principal component analysis
  • Figure 8c shows the application of individual and comparative combinations of mRNA changes between groups to a classification model.
  • Figures 8d and 8e illustrate and list the results of gene ontology (GO) analysis of mRNA that showed significant changes in each group.
  • Figure 8f shows the results of disease ontology (GO) using mRNA with significance for each group.
  • Figure 8g shows the results of gene set enrichment analysis (GSEA), which analyzed the expression level of lung cancer-related genes derived through disease analysis by group.
  • GSEA gene set enrichment analysis
  • Figure 9 shows changes in the expression of three specific miRNAs according to the normal group and the non-small cell lung cancer (NSCLC) patient group.
  • Figure 9a shows the results of comparing and analyzing the changes in miRNA expression of miR-200b-3P
  • Figure 9b is miR-3124-5p
  • Figure 9c is miR-92b-5p through RT-PCR.
  • the present invention provides a biomarker composition for diagnosing small cell lung cancer, which contains miRNA consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p as an active ingredient.
  • the miRNA may be derived from exosomes isolated from one or more biological samples selected from the group consisting of tissues, cells, whole blood, blood, serum, saliva, sputum, cerebrospinal fluid, and urine, but is not limited thereto.
  • the miRNA has the following sequence.
  • miR-200b-3P (MIMAT0000318, SEQ ID NO: 1): UAAUACUGCCUGGUAAUGAUGA
  • miR-92b-5p (MIMAT0004792, SEQ ID NO: 3): AGGGACGGGACGCGGUGCAGUG
  • diagnosis of the present invention refers to confirming the presence or characteristics of a pathological condition, and for the purpose of the present invention means confirming the occurrence or possibility of developing small cell lung cancer, or at least one symptom thereof. Includes determining the subject's susceptibility to, therametrics (e.g., monitoring the subject's condition to provide information about treatment efficacy), etc. It also includes primary diagnosis of a clinical condition or diagnosis of recurrent disease.
  • biomarker of the present invention is an indicator that can detect changes in the body, and is a substance that can confirm the normal or pathological state of a living organism and whether there is a change in it, and includes polypeptides, nucleic acids, lipids, glycolipids, It may include organic biomolecules such as glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.).
  • the present invention provides a composition for diagnosing small cell lung cancer comprising, as an active ingredient, an agent capable of measuring the expression level of miRNAs consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p.
  • An agent capable of measuring the expression level of the miRNA may be a primer or probe that specifically binds to the miRNA, but is not limited thereto.
  • primer refers to a nucleic acid sequence with a short free 3' hydroxyl group, which can form base pairs with a complementary template and functions as a starting point for copying the template strand. refers to a short nucleic acid sequence that Primers can initiate DNA synthesis in the presence of four different nucleotide triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.
  • probe of the present invention refers to a fragment of several to hundreds of base sequences that can specifically bind to a miRNA, and is labeled so that the presence or absence and expression level of the miRNA can be confirmed. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.
  • the present invention provides a kit for diagnosing small cell lung cancer, comprising the composition for diagnosing small cell lung cancer as an active ingredient.
  • the kit can be used to diagnose the development of small cell lung cancer by measuring the expression level of the miRNA in a sample isolated from an individual suspected of having small cell lung cancer.
  • the kit may include not only an agent for measuring the expression level of the miRNA, but also one or more other component compositions, solutions, or devices suitable for the analysis method.
  • the kit according to the present invention includes genomic DNA derived from a sample to be analyzed to perform PCR, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer solution, and May contain water.
  • the PCR buffer solution may include KCl, Tris-HCl, and MgCl 2 .
  • components necessary for performing electrophoresis that can confirm the amplification of the PCR product may be additionally included in the kit of the present invention.
  • the kit according to the present invention may be a kit containing essential elements required to perform RT-PCR.
  • the RT-PCR kit contains test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, and DEPC.
  • dNTPs deoxynucleotides
  • -Can include DEPC-water, sterilized water, etc. Additionally, it may include a pair of primers specific to the gene used as a quantitative control.
  • the present invention provides a biomarker composition for predicting the prognosis of small cell lung cancer, which contains miRNA consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p as an active ingredient.
  • prognosis prediction in the present invention is used with the same meaning as “prognosis” and refers to the act of predicting the course and outcome of a disease in advance. More specifically, prognosis prediction refers to the fact that the course of a disease after treatment may vary depending on the patient's physiological or environmental condition, and is interpreted to mean all activities that predict the course of the disease after treatment by comprehensively considering the patient's condition. It can be.
  • the present invention includes the steps of isolating a biological sample from an individual; And providing a method of providing information for diagnosing or predicting prognosis of small cell lung cancer, including measuring the expression level of miRNA consisting of miR-200b-3P, miR-3124-5p, and miR-92b-5p in the separated biological sample. do.
  • the biological sample may be derived from exosomes isolated from one or more selected from the group consisting of tissues, cells, whole blood, blood, serum, saliva, sputum, cerebrospinal fluid, and urine, but is not limited thereto.
  • the expression level of the miRNA was determined by next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), and RNase. It may be measured by one or more methods selected from the group consisting of RNase protection assay (RPA), microarray, and northern blotting, but is not limited thereto.
  • NGS next generation sequencing
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • Real-time PCR real-time polymerase chain reaction
  • RNase RNase protection assay
  • microarray microarray
  • northern blotting but is not limited thereto.
  • the exosome pellet was fixed in 4% paraformaldehyde for 1 hour and then washed. Afterwards, it was fixed in 1% osmium tetroxide (OsO 4 ), dehydrated, treated with 1% uranyl-acetate, and then dyed and fixed. For ultrathin sections, a Hitachi 7100 electron microscope was used.
  • RIPA buffer was added to exosomes, protein was extracted, and quantified. The extracted proteins were separated using SDS-PAGE, electrotransferred to an immobilon membrane, and exosome markers were identified.
  • RNA within the exosome was extracted and RNA integrity within the exosome was confirmed using an agilent 2100 bioanalyzer.
  • a total of 51 (31 showing a statistically significant difference in probability + 10 each at the top/bottom of the largest change in expression rate) identified in Example 3 were subjected to real-time polymerase chain reaction (Real-Time PCR; hereinafter referred to as RT-PCR). ) was verified through the method.
  • RT-PCR real-time polymerase chain reaction
  • an extension product consisting of 1) cDNA reverse transcribed from the miRNA, 2) an oligonucleotide capable of specifically hybridizing, and 3) an adapter oligonucleotide is used.
  • the miRNA was amplified using primers, and the degree of amplification was analyzed using Cybergreen. Based on this, 25 miRNAs were selected, and the selected 25 miRNAs are as shown in Figure 4.
  • the receiver operating characteristic (AUC-ROC) classification model reflecting sensitivity and specificity was used individually or in all possible combinations of the above seven exosomal miRNAs. was applied and analyzed, and the accuracy (hereinafter referred to as ACC) values were diagrammed.
  • the three miRNAs have the sequences shown in Table 1.
  • the patient survival rate according to the expression of the miRNAs was analyzed.
  • MiRNA expression was divided into patients with high expression rate and patient group with low expression rate based on the level detected through PCR, and Kaplan-Meier survival curve was used to analyze the survival rate between these groups.
  • the GraphPad Prism version 8.0 program was used to verify significance.
  • the hazard ratio (hazard ratio: HR) analysis was performed. 76 small cell lung cancer patients were divided into low risk and high risk groups, and survival rates between the two experimental groups were compared and analyzed.
  • the predicted targets of the three miRNAs were identified using bioinformatics technology. After confirmation, KEGG pathway and Gene Ontology analysis were performed on the predicted target genes.
  • NSCLC non-small cell lung cancer

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물에 관한 것으로, 정상군 및 소세포폐암 환자군에서 분리한 엑소좀 내 miRNA 분석을 통해 확인한 소세포폐암 환자군에서 특이적으로 발현이 증가 또는 감소하는 7개의 miRNA를 개별 또는 조합하여 소세포폐암 진단 및 예후예측 정확도를 분석한 결과, miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA 조합이 우수한 소세포폐암 진단 및 예후예측 효과를 나타내는 것을 확인함으로써, 소세포폐암 진단 또는 예후예측용 바이오마커 조성물로서 유용하게 활용될 수 있다.

Description

엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물
본 발명은 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물에 관한 것이다.
암은 전세계적으로 높은 발병률과 사망률을 나타내는 질환이고, 그 중 폐암은 암 중에서도 높은 발병률과 사망률을 보인다. 폐암은 세포의 크기에 따라 비소세포폐암(non-small cell lung cancer; NSCLC)과 소세포폐암 (small cell lung cancer; SCLC)로 구분할 수 있는데, 그 중 소세포폐암은 폐암의 전체 약 10~20% 비율을 차지하고, 신경내분비(neuroendocrine) 유래의 암세포로서, 빠른 종양 형성 및 전이; 및 높은 재발률이 특징이다. 소세포폐암 진단 시 제한 병기(limited disease; LD) 및 확장 병기(extensive disease; ED)로 구분할 수 있는데, LD는 암이 종격동을 포함해서 폐의 한쪽에만 국한된 경우이고, ED는 암이 반대편 폐나 다른 장기로 전이된 경우이다. 소세포폐암은 종양 형성 및 전이 속도가 매우 빨라서 예후예측이 쉽지 않아, 소세포폐암 환자 대부분이 진단 시 이미 말기 환자(ED)로 판명받고, 5년 생존율이 10% 이내라고 보고되고 있다. 진단 후 최초 복합화학 요법(EP chemotherapy) 치료를 진행하지만 대부분의 환자에서 내성이 발생되고 ED 환자의 생존율이 LD 환자에 비해 현저하게 낮다고 보고되고 있다.
이처럼 소세포폐암을 진단 후 치료를 진행한다 할지라도, 이미 말기 환자로 판명받는 경우가 많아 치료 효과를 기대하기 어렵고, 내성, 부작용 등의 문제도 존재하여 소세포폐암은 특히 조기 진단이 무엇보다 중요하다. 따라서, 소세포폐암을 진단 및 예후예측을 위한 바이오마커 개발이 필요한 실정이다.
본 발명의 목적은 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물을 제공하는 것이다.
본 발명의 다른 목적은 엑소좀 유래 miRNA의 발현수준을 측정할 수 있는 제제를 유효성분으로 포함하는 소세포폐암 진단용 조성물을 제공하는 것이다.
본 발명의 또다른 목적은 상기 소세포폐암 진단용 조성물을 유효성분으로 포함하는 소세포폐암 진단용 키트를 제공하는 것이다.
본 발명의 또다른 목적은 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 예후예측용 바이오마커 조성물을 제공하는 것이다.
본 발명의 또다른 목적은 소세포폐암 진단 또는 예후예측을 위한 정보 제공 방법을 제공하는 것이다.
상기 목적을 달성하기 위해, 본 발명은 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물을 제공한다.
또한, 본 발명은 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA의 발현수준을 측정할 수 있는 제제를 유효성분으로 포함하는 소세포폐암 진단용 조성물을 제공한다.
또한, 본 발명은 상기 소세포폐암 진단용 조성물을 유효성분으로 포함하는 소세포폐암 진단용 키트를 제공한다.
또한, 본 발명은 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA를 유효성분으로 포함하는 소세포폐암 예후예측용 바이오마커 조성물을 제공한다.
또한, 본 발명은 개체로부터 생물학적 시료를 분리하는 단계; 및 상기 분리된 생물학적 시료에서 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA의 발현수준을 측정하는 단계를 포함하는 소세포폐암 진단 또는 예후예측을 위한 정보 제공 방법을 제공한다.
본 발명에 따르면, 정상군 및 소세포폐암 환자군에서 분리한 엑소좀 내 miRNA 분석을 통해 확인한 소세포폐암 환자군에서 특이적으로 발현이 증가 또는 감소하는 7개의 miRNA를 개별 또는 조합하여 소세포폐암 진단 및 예후예측 정확도를 분석한 결과, miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA 조합이 우수한 소세포폐암 진단 및 예후예측 효과를 나타내는 것을 확인함으로써, 소세포폐암 진단 또는 예후예측용 바이오마커 조성물로서 유용하게 활용될 수 있다.
도 1a는 정상군 및 소세포폐암 초기 환자군에서 분리한 엑소좀의 형태학적 특성을 전자현미경으로 관찰한 결과이다. 도 1b 내지 1e는 상기 엑소좀의 사이즈별 분포도를 나노입자 추적 분석 방법을 통해 분석한 결과이다. 도 1f는 상기 엑소좀의 마커(TSG1, HSP90, CD63 및 CD81)를 웨스턴블롯(wetern blot)을 통해 분석한 결과이다.
도 2는 정상군 및 소세포폐암 환자군에서 분리한 엑소좀 내부 구성요소를 Bioanalyzer를 통해 분석한 결과이다.
도 3a은 정상군 및 소세포폐암 환자군에서 분리한 엑소좀 내 miRNA를 마이크로어레이(microarray) 방법으로 분석한 데이터를 주성분분석(PCA plot)을 통해 도식화한 결과이다. 도 3b은 정상군 및 소세포폐암 환자군에 따른 엑소좀 내 miRNA의 수 및 공통으로 가지는 miRNA 수를 분석한 결과이다. 도 3c는 정상군 및 소세포폐암 환자군에 따른 엑소좀 내 총합 및 평균 miRNA 수를 비교 및 분석한 결과이다. 도 3d는 도 3c의 개별 환자의 결과물의 그룹별 평균치이다. 도 3e 및 3f는 각각 마이크로어레이 분석 결과, 정상군 및 소세포폐암 환자군 사이 통계적 유의확률(p-vaule<0.05) 차이를 보이는 31개의 miRNA; 및 가장 큰 발현율 변화를 나타내는 상위 또는 하위 10개의 miRNA를 분석한 결과이다.
도 4a 및 도 4b는 상기 도 3e 및 3f에서 확인한 총 51개의 miRNA를 실시한 중합효소연쇄반응(Real-Time PCR; RT-PCR)을 통해 검증한 후, 이를 바탕으로 25개의 miRNA를 선별한 결과이다.
도 5a 내지 도 5g는 정상군 및 소세포폐암 환자군(제한병기; LD + 확장병기; ED)에 따른 상기 도 4에서 선별한 25개의 miRNA 중 특정 7개의 miRNA의 발현 변화를 RT-PCR을 통해 비교 및 분석한 결과이다.
도 6은 수신자 조작 특성(AUC-ROC) 분류 모델을 이용하여 상기 도 5에서 확인한 특정 7개의 miRNA가 정상군 및 소세포폐암 환자군을 구분 및 환자군을 검출할 수 있는지 분석한 결과이다. 도 6a은 상기 7개의 miRNA의 개별 또는 가능한 모든 조합을 분류모델에 적용한 결과이다. 도 6b 내지 6j는 상기 도 6a의 적용 결과를 나타낸 그래프이다.
도 7a 및 7b는 소세포폐암 환자군을 저위험군(Low risk) 및 고위험군(High risk)으로 구분하고, 위험비(hazard ratio: HR) 분석을 통해 두 그룹별 생존률을 비교 및 분석한 결과이다. 도 7c는 3개의 miRNA의 예상 타겟(target)을 생물정보학 기술을 통해 분석한 결과이다. 도 7d 및 7e는 상기 도 7c에서 확인한 예상 타겟 유전자를 대상으로 각각 KEGG pathway 및 Gene Ontology 분석을 통해 엑소좀을 통한 세포의 기능적변화 가능성을 분석한 결과이다.
도 8은 상기 확보한 3개의 miRNAs(miR-200b-3P, miR-3124-5p 및 miR-92b-5p) 개별 또는 혼합물 (miR3124 mimic, miR200b mimic, miR92b inhibitor)을 정상 폐세포주 (BEAS2B cell)에 형질도입후 control 대비 변화하는 유전자의 양상을 mRNA-sequencing을 통해 확인한 결과이다. 도 8a은 BEAS2B 세포에 형질도입된 샘플들의 주성분 분석 (Principal Component Analysis, PCA) 결과이다. 도 8b는 BEAS2B 세포내 형질도입된 miRNAs를 통한 mRNAs의 변화양상을 control 그룹과 비교한 volcano plot이다. 도 8c는 그룹간 변화된 mRNA 개별 및 비교조합을 분류 모델에 적용한 것을 나타낸다. 도 8d 및 도 8e는 그룹별 유의미한 변화를 보인 mRNA의 유전자 기능분석 (Gene Ontology, GO) 결과를 도식하고 나열한 결과이다. 도 8f는 그룹별 유의미성을 가지는 mRNA를 이용한 질병분석 (Disease ontology, GO) 결과이다. 도 8g는 질병분석을 통해 도출한 Lung cancer 관련 유전자들의 발현정도를 그룹별로 분석한 유전자 세트 농축분석 (Gene set enrichment analysis, GSEA) 결과이다.
도 9는 정상군 및 비소세포폐암(NSCLC) 환자군에 따른 특정 3개의 miRNAs 발현 변화를 나타낸 것이다. 도 9a은 miR-200b-3P, 도 9b는 miR-3124-5p, 도 9c는 miR-92b-5p의 miRNA 발현 변화를 RT-PCR을 통해 비교 및 분석한 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명은 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물을 제공한다.
상기 miRNA는 조직, 세포, 전혈, 혈액, 혈청, 타액, 객담, 뇌척수액 및 뇨로 이루어진 군에서 선택된 하나 이상의 생물학적 시료에서 분리된 엑소좀(exosome)에서 유래된 것일 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 miRNA는 하기와 같은 서열을 가진다.
1) miR-200b-3P (MIMAT0000318, 서열번호 1) : UAAUACUGCCUGGUAAUGAUGA
2) miR-3124-5p (MIMAT0014986, 서열번호 2) : UUCGCGGGCGAAGGCAAAGUC
3) miR-92b-5p (MIMAT0004792, 서열번호 3) : AGGGACGGGACGCGGUGCAGUG
본 발명의 용어 “진단(diagnosis)”은 병리 상태의 존재 또는 특징을 확인하는 것으로, 본 발명의 목적상 소세포폐암의 발병 여부 또는 발병 가능성을 확인하는 것을 의미하며, 소세포폐암 또는 이의 적어도 하나 이상의 증상에 대한 대상의 감수성을 판정하는 것, 테라메트릭스(therametrics)(예를 들어, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링하는 것) 등을 포함한다. 또한, 임상 상태의 일차 진단 또는 재발한 질병의 진단을 포함한다.
본 발명의 용어 “바이오마커(biomarker)”는 몸 안의 변화를 알아낼 수 있는 지표로서, 생명체의 정상 또는 병리적인 상태, 이의 변화 여부 등을 확인할 수 있는 물질로, 폴리펩타이드, 핵산, 지질, 당지질, 당단백질, 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자 등을 포함할 수 있다.
또한, 본 발명은 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA의 발현수준을 측정할 수 있는 제제를 유효성분으로 포함하는 소세포폐암 진단용 조성물을 제공한다.
상기 miRNA의 발현수준을 측정할 수 있는 제제는 상기 miRNA에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 용어 “프라이머(primer)”는 짧은 자유 3말단 수산화기(free 3' hydroxl group)를 가지는 핵산 서열로, 상보적인 주형과 염기쌍을 형성할 수 있고, 주형 가닥 복사를 위한 시작 시점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA polymerase 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트(nucleotide triphosphate)의 존재 하에서 DNA 합성을 개시할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
본 발명의 용어 “프로브(probe)”는 miRNA와 특이적으로 결합을 이룰 수 있는 수 개 내지 수백 개의 염기서열의 단편을 의미하며, 라벨링 되어있어서 상기 miRNA의 존재 유무 및 발현량을 확인할 수 있다. 적절한 프로브 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
또한, 본 발명은 상기 소세포폐암 진단용 조성물을 유효성분으로 포함하는 소세포폐암 진단용 키트를 제공한다.
상기 키트는 소세포폐암이 의심되는 개체로부터 분리된 시료에서 상기 miRNA의 발현수준을 측정하여 소세포폐암 발병 여부를 진단하는 데 사용될 수 있다.
상기 키트는 상기 miRNA 발현수준을 측정하는 제제뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 포함할 수 있다. 예를 들어, 본 발명에 따른 키트는 PCR을 수행하기 위해 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함할 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 포함할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.
또한, 본 발명에 따른 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한, 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
또한, 본 발명은 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA를 유효성분으로 포함하는 소세포폐암 예후예측용 바이오마커 조성물을 제공한다.
본 발명의 용어 “예후예측”은 “예후”와 동일한 의미로 사용되고, 질환의 경과 및 결과를 미리 예측하는 행위를 의미한다. 보다 구체적으로, 예후예측이란 질환의 치료 후 경과는 환자의 생리적 또는 환경적 상태에 따라 달라질 수 있고, 이러한 환자의 상태를 종합적으로 고려하여 치료 후 병의 경과를 예측하는 모든 행위를 의미하는 것으로 해석될 수 있다.
또한, 본 발명은 개체로부터 생물학적 시료를 분리하는 단계; 및 상기 분리된 생물학적 시료에서 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA의 발현수준을 측정하는 단계를 포함하는 소세포폐암 진단 또는 예후예측을 위한 정보 제공 방법을 제공한다.
상기 생물학적 시료는 조직, 세포, 전혈, 혈액, 혈청, 타액, 객담, 뇌척수액 및 뇨로 이루어진 군에서 선택된 하나 이상에서 분리된 엑소좀(exosome)에서 유래된 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 miRNA의 발현수준은 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray) 및 노던 블롯팅(northern blotting)으로 이루어진 군에서 선택된 하나 이상의 방법으로 측정할 수 있으나, 이에 한정되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
[실시예 1] 엑소좀(exosome) 분리
폐의 결절이 확인된 정상군과 소세포폐암 초기(limited stage) 환자군 각 5명의 혈청 1ml을 수집하고, 초고속 원심분리기를 사용하여 엑소좀을 분리하였다. 수집된 혈청을 10,000 x g 속도에서 30분간 원심분리 하여 혈청 내 세포 및 잔해 물질을 제거한 후, 상등액을 100,000 x g 속도에서 70분간 원심분리 하여 엑소좀을 수집하였다. 수집된 엑소좀은 PBS로 세척과정을 거친 후 100,000 x g 속도에서 70분간 엑소좀 분리 동일조건으로 원심분리하여 수집 후 분석 과정을 거쳤다.
[실시예 2] 엑소좀 특성 분석
상기 실시예 1에서 분리한 엑소좀의 특성을 확인하기 위해, 하기와 같은 분석방법을 사용하였다.
2-1. 전자현미경 분석
엑소좀의 형태학적 특성을 확인하기 위해, 엑소좀 펠렛을 4% 파라포름알데하이드(paraformaldehyde)에 1시간 동안 고정한 후 세척과정을 거쳤다. 이후 1% 사산화오스뮴(OsO4)에서 고정하고 탈수 과정을 거친 후, 1% 아세트산 우라닐(uranyl-acetate)을 처리하고 염색 및 고정 과정을 거쳤다. 초박절편(ultrathin sections)은 Hitachi 7100 전자현미경을 사용하였다.
2-2. 나노입자 추적 분석
엑소좀의 사이즈별 분포도를 확인하기 위해, NanoSight NS300 장비를 이용하여 엑소좀의 사이즈 및 조밀도를 분석하였다. NTA 2.1 analytical software를 사용하여 데이터를 해석하고, 엑소좀의 사이즈 분포도를 도식화하였다.
2-3. 웨스턴블롯(western blot)
엑소좀의 특이적인 마커를 확인하기 위해, 엑소좀에 RIPA buffer를 넣고 단백질 추출 후 정량하였다. 추출된 단백질은 SDS-PAGE를 이용하여 분리하고, 이모빌론 막(immobilon membrane)으로 electrotransfer한 후 엑소좀 마커를 확인하였다.
2-4. Bioanalyzer 분석
엑소좀 내부의 구성요소를 확인하기 위해, 엑소좀 내 RNA를 추출하고 agilent 2100 bioanalyzer를 사용하여 엑소좀 내 RNA integrity를 확인하였다.
그 결과, 도 1에 나타난 바와 같이, 엑소좀의 존재 여부와 두 실험군 간 엑소좀의 형태, 크기 및 양적인 차이가 없는 것을 확인하였고, 도 2에 나타난 바와 같이, 엑소좀 구성요소 중 miRNA가 주요 인자인 것을 확인하였다.
[실시예 3] 마이크로어레이(microarray) 분석
정상군과 소세포폐암 환자군 사이의 엑소좀 miRNA 발현 차이를 확인하기 위해, 마이크로어레이를 통한 miRNA 프로파일링 분석을 수행하였다. 상기 분석을 통해 확인한 miRNA들을 온라인 데이터베이스인 VESICLEPEDIA(2929개, http://www.microvesicles.org/) 및 EXCARTA(2766개, http://www.exocarta.org/)에 등록된 miRNA들과 비교하였고, 상기 분석한 마이크로어레이 데이터를 주성분분석(PCA plot)을 통하여 도식화하여 정상군 및 소세포폐암 환자군을 비교하였다.
그 결과, 정상군과 소세포폐암 환자군에서 총 1635개의 엑소좀 miRNA의 존재를 확인하였고, 상기 온라인 데이터베이스에 등록된 miRNA들과 비교한 결과, 상기 1635개의 miRNA 중 온라인 데이터베이스 상에 등록되지 않은 135개의 새로운 엑소좀 miRNA가 존재하는 것을 확인하였다.
또한, 상기 분석한 마이크로어레이 데이터를 주성분분석(PCA plot)을 통하여 도식화한 결과, 도 3에 나타난 바와 같이, 정상군의 경우 응집된 분포를 나타낸 반면, 소세포폐암 환자군의 경우 산발적인 분포를 나타내는 것을 확인하였다. 이는 정상군과 구별되는 특징으로, 암세포의 이질성이 엑소좀에도 반영되는 것을 의미한다.
또한, 도 3에 나타난 바와 같이, 마이크로어레이 분석 결과, 두 실험군에서 통계적 유의확률 (p-value<0.05) 차이를 보이는 31개의 miRNA와 가장 큰 발현율 변화가 관찰된 상위 또는 하위 각각 10개의 miRNA를 확인하였다.
[실시예 4] 실시간 중합효소연쇄반응(Real-Time PCR) 분석
상기 실시예 3에서 확인한 총 51개(통계적 유의확률 차이를 보이는 31개 + 가장 큰 발현율 변화의 상위/하위 각각 10개) miRNA들을 실시간 중합효소연쇄반응(Real-Time PCR; 이하 RT-PCR이라 함) 방법을 통해 검증하였다. poly A　꼬리 연결 miRNA와 혼성화할 수 있는 어댑터를 올리고 뉴클레오티드를 사용하여 miRNA를 역전사시킨 후, 1) miRNA로부터 역전사된 cDNA, 2) 특이적으로 혼성화 가능한 올리고뉴클레오티드 및 3) 어댑터 올리고뉴클레오티드로 구성된 연장용 프라이머를 사용하여 miRNA를 증폭시키고 증폭 정도를 Cybergreen을 사용하여 분석하였다. 이를 바탕으로 25개의 miRNA들을 선별하였고, 상기 선별한 25개의 miRNA는 도 4에 나타난 바와 같다.
또한, 상기 선별한 25개의 miRNA를 대규모 집단에서 재검증하기 위해, 50명의 정상군과 76명의 소세포폐암 환자군(제한병기_LD: 28명, 확장병기_ED: 48명)의 혈액을 수집하여 혈청 내 엑소좀을 분리하고, 상기 25개의 miRNA를 RT-PCR 방법을 통해 분석하였다.
그 결과, 도 5에 나타난 바와 같이, 25개 중 7개(miR-3565, miR3124-5p, miR-200b-3p, miR-6515, miR-3126-3p, miR-9-5p 및 miR-92b-5p)가 유의성이 있음을 확인하였고, 구체적으로, 상기 7개의 miRNA 중 6개(miR-3565, miR3124-5p, miR-200b-3p, miR-6515, miR-3126-3p 및 miR-9-5p)는 소세포폐암 환자군에서 특이적인 증가를, 나머지 1개(miR-92b-5p)는 소세포폐암 환자군에서 특이적인 감소를 나타내는 것을 확인하였다.
또한, 정상군 및 소세포폐암 환자군의 구분 및 환자군 검출 가능성 여부를 확인하기 위해, 민감도 및 특이도를 반영하는 수신자 조작 특성(AUC-ROC) 분류 모델에 상기 7개의 엑소좀 miRNA의 개별 또는 가능한 모든 조합을 적용하여 분석하였고, 정확도(accuracy; 이하 ACC라 함) 수치를 도식화하였다.
그 결과, 도 6에 나타난 바와 같이, miR-200b-3P, miR3124-5p 및 miR-92b-5p의 miRNA 조합이 AUC=0.93 및 P<0.0001의 수치를 나타내어, 소세포폐암을 구분하고 진단할 수 있는 가장 이상적인 분류 모델인 것을 확인하였다. 상기 3개의 miRNA는 표 1과 같은 서열을 가진다.
유전자 염기서열 서열번호
miR-200b-3P UAAUACUGCCUGGUAAUGAUGA 1
miR3124-5p UUCGCGGGCGAAGGCAAAGUC 2
miR-92b-5p AGGGACGGGACGCGGUGCAGUG 3
[실시예 5] 소세포폐암 예후예측인자로서의 활용 가능성 분석
엑소좀 miRNA를 이용한 소세포폐암 환자의 예후예측 가능성 여부를 확인하기 위해, 하기와 같은 실험을 수행하였다.
5-1. miRNA 발현에 따른 환자 생존률 분석
상기 실시예 3에서 확인한 7개의 miRNA에 따른 소세포폐암 환자의 예후예측 가능성을 확인하기 위해, 상기 miRNA 발현에 따른 환자 생존률을 분석하였다. miRNA 발현은 PCR을 통하여 검출된 수치를 기준으로 발현률 상위환자군과 하위환자군으로 구분하고, 이들 간 생존률 분석에는 Kaplan-Meier 생존곡선을 이용하였다. 유의성 검증에는 GraphPad Prism version 8.0 프로그램을 사용하였다.
그 결과, 상기 7개의 개별 miRNA 모두에서 생존률의 유의성을 확인할 수 없었다.
5-2. 위험비(hazard ratio) 분석
상기 실시예 3에서 확인한 3개의 miRNA(miR-200b-3P, miR-3124-5p 및 miR-92b-5p) 조합에 따른 환자 예후예측 가능성을 확인하기 위해, 상기 miRNA 조합의 위험비(hazard ratio: HR) 분석을 수행하였다. 76명의 소세포폐암 환자를 저위험군(Low risk) 및 고위험군(High risk)으로 구분하였고, 두 실험군 사이 생존률을 비교 및 분석하였다.
그 결과, 도 7에 나타난 바와 같이, 저위험군에 비해 고위험군의 생존율이 유의미하게 감소하는 것을 확인하였다(p-value=0.0029). 이는 상기 miRNA 조합을 통한 소세포폐암의 예후예측이 가능함을 의미한다.
5-3. 엑소좀을 통한 세포의 기능적변화 가능성 분석
엑소좀을 통한 세포의 기능적변화 가능성을 확인하기 위해, 생물정보학 기술을 사용하여 상기 3개의 miRNA(miR-200b-3P, miR-3124-5p 및 miR-92b-5p)의 예상 타겟(target)을 확인하고, 상기 예상 타겟 유전자를 대상으로 KEGG pathway 및 Gene Ontology 분석을 수행하였다.
그 결과, 도 7에 나타난 바와 같이, miR-200b-3P, miR-3124-5p 및 miR-92b-5p의 조합이 소세포폐암의 진단 및 예후예측인자로서 활용 가능하다는 것을 확인하였다.
[실시예 6] miRNAs의 개별 또는 조합에 따른 효과 분석
3개의 miRNAs(miR-200b-3P, miR-3124-5p 및 miR-92b-5p)의 개별 또는 조합에 따른 소세포폐암의 진단 및 예후예측인자로서 효과를 비교하기 위해, 하기와 같은 실험을 수행하였다.
정상 폐암세포주 (BEAS2B cell)에 상기 확보한 3개의 miRNAs(miR-200b-3P, miR-3124-5p 및 miR-92b-5p) 개별 또는 혼합물 (miR3124 mimic, miR200b mimic, miR92b inhibitor)을 세포내 형질도입후 이들의 기능적인 부분을 확인해본 결과, 도 8에 나타난 결과와 같이 ERBB, EGF, JACK-stat 경로의 활성과 더불어 폐 관련, 특히 폐암 관련 유전자의 변화 양상이 혼합물이 처리된 세포 그룹에서 가장 크게 증가하는 것을 확인하였다.
이러한 결과를 통하여 miR-200b-3P, miR-3124-5p 및 miR-92b-5p의 조합이 소세포폐암의 진단 및 예후예측인자로서 활용 가능하다는 것을 확인하였다.
[실시예 7] miRNAs에 의한 비소세포폐암(NSCLC)에서의 발현 양상 분석
3개의 miRNAs(miR-200b-3P, miR-3124-5p 및 miR-92b-5p)이 소세포폐암(SCLC) 특이적으로 발현하는지를 확인하기 위해, 하기와 같은 실험을 수행하였다.
도 9를 통해 확인한 비소세포폐암(NSCLC) 환자 그룹에서 3개의 miRNAs(miR-200b-3P, miR-3124-5p 및 miR-92b-5p)의 발현양상은 정상비교군과 비교하여 유의미한 증감양상이 관찰되지 않았다. 이러한 결과를 바탕으로 3개의 miRNA는 소세포폐암 특이적인 바이오마커로 활용 가능하다는 것을 확인하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.

Claims (9)

  1. miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물.
  2. 청구항 1에 있어서, 상기 miRNA는 조직, 세포, 전혈, 혈액, 혈청, 타액, 객담, 뇌척수액 및 뇨로 이루어진 군에서 선택된 하나 이상의 생물학적 시료에서 분리된 엑소좀(exosome)에서 유래된 것을 특징으로 하는 소세포폐암 진단용 바이오마커 조성물.
  3. miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA의 발현수준을 측정할 수 있는 제제를 유효성분으로 포함하는 소세포폐암 진단용 조성물.
  4. 청구항 3에 있어서, 상기 miRNA의 발현수준을 측정할 수 있는 제제는 상기 miRNA에 특이적으로 결합하는 프라이머 또는 프로브인 것을 특징으로 하는 소세포폐암 진단용 조성물.
  5. 청구항 3 또는 청구항 4의 조성물을 유효성분으로 포함하는 소세포폐암 진단용 키트.
  6. miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA를 유효성분으로 포함하는 소세포폐암 예후예측용 바이오마커 조성물.
  7. 개체로부터 생물학적 시료를 분리하는 단계; 및
    상기 분리된 생물학적 시료에서 miR-200b-3P, miR-3124-5p 및 miR-92b-5p로 이루어진 miRNA의 발현수준을 측정하는 단계를 포함하는 소세포폐암 진단 또는 예후예측을 위한 정보 제공 방법.
  8. 청구항 7에 있어서, 상기 생물학적 시료는 조직, 세포, 전혈, 혈액, 혈청, 타액, 객담, 뇌척수액 및 뇨로 이루어진 군에서 선택된 하나 이상에서 분리된 엑소좀(exosome)에서 유래된 것을 특징으로 하는 소세포폐암 진단 또는 예후예측을 위한 정보 제공 방법.
  9. 청구항 7에 있어서, 상기 miRNA의 발현수준은 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray) 및 노던 블롯팅(northern blotting)으로 이루어진 군에서 선택된 하나 이상의 방법으로 측정하는 것을 특징으로 소세포폐암 진단 또는 예후예측을 위한 정보 제공 방법.
PCT/KR2023/011690 2022-08-12 2023-08-08 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물 WO2024035082A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220101447 2022-08-12
KR10-2022-0101447 2022-08-12

Publications (1)

Publication Number Publication Date
WO2024035082A1 true WO2024035082A1 (ko) 2024-02-15

Family

ID=89852026

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/011690 WO2024035082A1 (ko) 2022-08-12 2023-08-08 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물

Country Status (2)

Country Link
KR (1) KR20240023370A (ko)
WO (1) WO2024035082A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102899390A (zh) * 2011-07-26 2013-01-30 中国科学院上海生命科学研究院 小细胞肺癌标志物及其检测
KR20200019849A (ko) * 2017-06-29 2020-02-25 도레이 카부시키가이샤 폐암의 검출을 위한 키트, 디바이스 및 방법
US20200255906A1 (en) * 2018-12-12 2020-08-13 National University Corporation Nagoya University Extract from a body fluid comprising a micro rna

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106471132B (zh) 2014-06-18 2020-09-22 东丽株式会社 肺癌的检测试剂盒或装置以及检测方法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102899390A (zh) * 2011-07-26 2013-01-30 中国科学院上海生命科学研究院 小细胞肺癌标志物及其检测
KR20200019849A (ko) * 2017-06-29 2020-02-25 도레이 카부시키가이샤 폐암의 검출을 위한 키트, 디바이스 및 방법
US20200255906A1 (en) * 2018-12-12 2020-08-13 National University Corporation Nagoya University Extract from a body fluid comprising a micro rna

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI MING, SHAN WULIN, HONG BO, ZOU JINGLU, LI HONG, HAN DANDAN, ZHANG YANG, LI LAILING, LI DAN, LIN WENCHU: "Circulating miR-92b and miR-375 for monitoring the chemoresistance and prognosis of small cell lung cancer", SCIENTIFIC REPORTS, NATURE PUBLISHING GROUP, US, vol. 10, no. 1, 29 July 2020 (2020-07-29), US , pages 12705, XP093138223, ISSN: 2045-2322, DOI: 10.1038/s41598-020-69615-6 *
박효정. 소세포폐암 유래 exosomal miRNAs을 활용한 진단 및 예후 예측. 울산대학교 석사학위 학위논문. pp. 1-31, February 2022 (PARK, Hyo-Jung. Clinical application of exosomal miRNAs in small cell lung cancer. Master's thesis, University of Ulsan.) *

Also Published As

Publication number Publication date
KR20240023370A (ko) 2024-02-21

Similar Documents

Publication Publication Date Title
WO2016115354A1 (en) Methods for cancer diagnosis and prognosis
EP3430162B1 (en) Methylation markers for pancreatic cancer
WO2009094318A2 (en) Molecular staging of stage ii and iii colon cancer and prognosis
TWI804857B (zh) 大腸直腸癌的早期檢測、預測治療反應和預後之方法
KR20200002241A (ko) 비만 진단을 위한 마이크로RNA-26b 또는 마이크로RNA-4449 바이오마커 및 이의 용도
WO2020242080A1 (ko) 편평상피세포암의 진단 또는 예후 예측용 마커 및 이의 용도
CN109161593B (zh) 环状RNA和microRNA在结直肠癌筛查诊断的应用
CN107630093B (zh) 用于诊断肝癌的试剂、试剂盒、检测方法及用途
KR20220052461A (ko) 난소암 진단 또는 감별진단을 위한 마이크로rna-1246 및 이의 용도
WO2024035082A1 (ko) 엑소좀 유래 miRNA를 유효성분으로 포함하는 소세포폐암 진단용 바이오마커 조성물
KR20190113094A (ko) 대장암 진단 또는 재발 예측을 위한 마이크로RNA-4732-5p 및 이의 용도
CN111321219A (zh) Acta2甲基化作为哮喘诊断标志物的用途
CN111996249A (zh) 癌症诊断和病程监控方法
WO2010085124A2 (ko) 간암진단과 재발 및 생존 예측용 마커, 이를 포함한 키트 및 상기 마커를 이용한 간암환자 예후 예측
EP4112745A1 (en) Biomarkers for predicting a patient&#39;s response to bcg therapy, methods and uses based thereon
WO2021080335A1 (ko) 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물
WO2021091277A1 (ko) 혈액 기반 대장암 진단용 dna 메틸화 바이오마커 패널
WO2020071784A1 (ko) 대식세포 특이적 바이오마커 패널 및 이의 용도
WO2018074865A2 (ko) 유방암 예후 예측용 조성물 및 방법
WO2022186592A1 (ko) 당뇨 전단계 진단 또는 당뇨 합병증 발병 예측용 바이오마커 및 이의 용도
WO2024049247A1 (ko) 신규 파킨슨병 바이오마커 및 이의 용도
WO2023177132A1 (ko) 당뇨 전단계 및 당뇨병 진단용 바이오마커 및 이의 용도
WO2022014804A1 (ko) 간 섬유화 위험도 예측용 마커 및 그를 이용하는 정보제공방법
WO2022124564A1 (ko) 마이크로rna를 이용한 당뇨병성 신경병증의 예측 및 진단 방법 및 이를 위한 키트
EP3790984B1 (en) Methods for early prediction, treatment response, recurrence and prognosis monitoring of breast cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23852953

Country of ref document: EP

Kind code of ref document: A1