WO2021080335A1 - 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물 - Google Patents

비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물 Download PDF

Info

Publication number
WO2021080335A1
WO2021080335A1 PCT/KR2020/014450 KR2020014450W WO2021080335A1 WO 2021080335 A1 WO2021080335 A1 WO 2021080335A1 KR 2020014450 W KR2020014450 W KR 2020014450W WO 2021080335 A1 WO2021080335 A1 WO 2021080335A1
Authority
WO
WIPO (PCT)
Prior art keywords
mycobacterium
mir
hsa
tuberculosis
infection
Prior art date
Application number
PCT/KR2020/014450
Other languages
English (en)
French (fr)
Inventor
신성재
고원중
한선애
전병우
김수영
Original Assignee
연세대학교 산학협력단
사회복지법인 삼성생명공익재단
성균관대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단, 사회복지법인 삼성생명공익재단, 성균관대학교산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2021080335A1 publication Critical patent/WO2021080335A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a composition for diagnosing an infection or an infectious disease caused by a non-tuberculosis mycobacterium.
  • Mycobacterium In the genus Mycobacterium, not only species that cause serious diseases in humans and animals, such as tuberculosis, right tuberculosis, and leprosy, are also called opportunistic bacteria. There are about 72 species, such as species and saprophytic species found in the natural environment, and 25 species are known to be related to human diseases. Such Mycobacterium genus is not easily dyed with a commonly used dyeing solution, but once dyed, it is also called anti-acid bacteria because it is not easily discolored even when treated with alcohol or hydrochloric acid.
  • Nontuberculous mycobacteria refers to antioxidants excluding Mycobacterium tuberculosis complex and Mycobacterium leprae.
  • NTM Nontuberculous mycobacteria
  • MAC mainly includes M. avium and M. intracellulare
  • Mycobacterium abscessus MAB is mainly a subspecies of M. apsesus, Absesusu. Abscessus (M. abscessus subspecies abscessus) and M. abscessus subspecies massiliense (M.
  • An object of the present invention is to provide a biomarker composition for diagnosing an infection or infectious disease of non-tuberculosis mycobacterium.
  • Another object of the present invention is to provide a composition for diagnosing infections or infectious diseases of non-tuberculosis mycobacteria.
  • Another object of the present invention is to provide a kit for diagnosing infections or infectious diseases of non-tuberculosis mycobacteria.
  • Another object of the present invention is to provide a method of providing information for diagnosing an infection or an infectious disease of a non-tuberculosis mycobacterium.
  • hsa-miR-484 comprising at least one selected from the group consisting of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p and hsa-miR-4732-5p
  • hsa-miR-484 comprising at least one selected from the group consisting of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p and hsa-miR-4732-5p
  • diagnosis refers to determining the susceptibility of an object, that is, a test subject to a specific disease or disease, determining whether an object currently has a specific disease or disease, or It includes determining the prognosis or therametrics (eg, monitoring the condition of an object to provide information on treatment efficacy) of a disease or diseased subject.
  • the diagnostic biomarker according to the present invention is a material capable of diagnosing a person infected with a non-tuberculosis mycobacterium or a person with a disease after infection separately from a healthy normal control group. It includes nucleic acids showing an increasing or decreasing pattern in a sample, particularly miRNA, or cRNA or cDNA.
  • miRNA As used herein, the terms “miR”, “miRNA” or “micro RNA” or “microRNA” regulate gene expression after transcription by promoting degradation of target RNA or inhibiting their translation.
  • miRNA database http://www.mirbase.org.
  • miRBase the mature sequence of miRNA used herein can be obtained from the miRNA database (http://www.mirbase.org).
  • miRBase the miRNA database (21 edition, miRBase)
  • 35,828 mature miRNAs from 223 species have been registered.
  • microRNA is transcribed into a precursor of about 70-80 nt (nucleotide) length having a hairpin structure called pre-miRNA, and then cut by the RNAse III enzyme Dicer, and produced in a mature form.
  • Micro RNA forms a ribonucleo complex called miRNP, which cleaves the target gene through complementary binding to the target site or inhibits translation. More than 30% of human miRNAs exist as clusters, and after being transcribed as a precursor, a final mature miRNA is formed through a cleavage process.
  • the hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p miRNAs are derived from humans, respectively, as shown in Table 1 below. It has a mature sequence, and includes a precursor sequence thereof, or includes a cRNA or cDNA of these sequences.
  • the non-tuberculosis mycobacterium is Mycobacterium avium, Mycobacterium abscessus, Mycobacterium flavescence, and Mycobacterium.
  • M. kansasii szulgai
  • Mycobacterium terrae M. terrae
  • Mycobacterium scrofulaceum M. scrofulaceum
  • Mycobacterium ulcerans M. ulcerans
  • Mycobacterium simie M. simiae
  • Mycobacterium xenopi M. xenopi
  • the non-tuberculosis mycobacterial infection includes all clinical symptoms manifested by the infection of the non-tuberculosis mycobacteria, and the infectious diseases include lung disease, lymphadenitis, skin, soft tissue, osteoinfection, or disseminated disease, etc. It may include.
  • the infectious lung disease caused by the non-tuberculosis mycobacterium may be a fibrocavitary form, a nodular bronchiectatic form, or a combination thereof.
  • the infectious lung disease may be accompanied by cough, sputum, blood sputum, fever, dyspnea, chest pain, or a combination thereof.
  • the infectious lung disease caused by the non-tuberculosis mycobacterium is a bacterium that causes infectious lung disease, for example, Mycobacterium avium complex, Mycobacterium kansasii (M. kansasii). ), Mycobacterium abscessus (M. abscessus), Mycobacterium xenopi (M. xenopi), Mycobacterium malmoense (M. malmoense), Mycobacterium fortuitum (M. fortuitum) , Mycobacterium marinum (M. marinum), Mycobacterium cellone (M. chelonae), Mycobacterium gordonae (M.
  • Mycobacterium avium complex Mycobacterium kansasii (M. kansasii). )
  • Mycobacterium abscessus M. abscessus
  • Mycobacterium xenopi M. xenopi
  • Mycobacterium malmoense
  • Mycobacterium szulgai M. szulgai
  • Mycobacterium szulgai Infectiousness caused by Cobacterium celatum, Mycobacterium scrofulaceum, M. terrae or M. simiae It may be a lung disease, but is not limited thereto.
  • measuring the expression level of one or more selected from the group consisting of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p and hsa-miR-4732-5p It relates to a composition for diagnosis of an infection or infectious disease of non-tuberculosis mycobacterium, comprising an agent.
  • the agent for measuring the expression level of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p or hsa-miR-4732-5p is a primer that specifically binds to the miRNA , Probes and antisense nucleotides.
  • the "primer” is a fragment that recognizes a target gene sequence, and includes a forward and reverse primer pair, preferably, a primer pair that provides an analysis result having specificity and sensitivity. Since the nucleic acid sequence of the primer is a sequence inconsistent with the non-target sequence present in the sample, a primer that amplifies only the target gene sequence containing the complementary primer binding site and does not induce non-specific amplification can give high specificity. .
  • the "probe” refers to a substance capable of specifically binding to a target substance to be detected in a sample, and refers to a substance capable of specifically confirming the presence of a target substance in a sample through the binding.
  • the type of probe is not limited as a material commonly used in the art, but preferably may be a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a peptide, a polypeptide, a protein, RNA or DNA, and most preferably Hagi is PNA.
  • the probe is a biomaterial that includes an organism-derived or similar thing or a thing produced in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, neurons, DNA, and It may be RNA, DNA includes cDNA, genomic DNA, oligonucleotide, RNA includes genomic RNA, mRNA, oligonucleotide, and examples of proteins include antibodies, antigens, enzymes, peptides, and the like.
  • LNA Locked Nucleic Acids
  • LNA nucleosides contain common nucleic acid bases of DNA and RNA, and can form base pairs according to the Watson-Crick base pairing rules. However, due to the'locking' of the molecule due to the methylene bridge, the LNA cannot form an ideal shape in the Watson-Crick bond.
  • LNA When LNA is included in a DNA or RNA oligonucleotide, the LNA can more quickly pair with a complementary nucleotide chain to increase the stability of the double helix.
  • the "antisense” refers to a sequence of nucleotide bases in which the antisense oligomer is hybridized with the target sequence in RNA by Watson-Crick base pairing, and typically allows the formation of mRNA and RNA: oligomer heterodimer within the target sequence. And an oligomer having a backbone between subunits. Oligomers may have exact sequence complementarity or approximate complementarity to the target sequence.
  • hsa-miR-484 Information of the hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p and hsa-miR-4732-5p according to the present invention is known, so those skilled in the art can encode the protein based on this Primers, probes or antisense nucleotides that specifically bind to a gene may be easily designed.
  • the non-tuberculosis mycobacterium is Mycobacterium avium, Mycobacterium abscessus, Mycobacterium flavescence, and Mycobacterium.
  • M. kansasii szulgai
  • Mycobacterium terrae M. terrae
  • Mycobacterium scrofulaceum M. scrofulaceum
  • Mycobacterium ulcerans M. ulcerans
  • Mycobacterium simie M. simiae
  • Mycobacterium xenopi M. xenopi
  • the non-tuberculosis mycobacterial infection includes all clinical symptoms manifested by the infection of the non-tuberculosis mycobacteria, and the infectious diseases include lung disease, lymphadenitis, skin, soft tissue, osteoinfection, or disseminated disease, etc. It may include.
  • the infectious lung disease caused by the non-tuberculosis mycobacterium may be a fibrocavitary form, a nodular bronchiectatic form, or a combination thereof.
  • the infectious lung disease may be accompanied by cough, sputum, blood sputum, fever, dyspnea, chest pain, or a combination thereof.
  • the infectious lung disease caused by the non-tuberculosis mycobacterium is a bacterium that causes infectious lung disease, for example, Mycobacterium avium complex, Mycobacterium kansasii (M. kansasii). ), Mycobacterium abscessus (M. abscessus), Mycobacterium xenopi (M. xenopi), Mycobacterium malmoense (M. malmoense), Mycobacterium fortuitum (M. fortuitum) , Mycobacterium marinum (M. marinum), Mycobacterium cellone (M. chelonae), Mycobacterium gordonae (M.
  • Mycobacterium avium complex Mycobacterium kansasii (M. kansasii). )
  • Mycobacterium abscessus M. abscessus
  • Mycobacterium xenopi M. xenopi
  • Mycobacterium malmoense
  • Mycobacterium szulgai M. szulgai
  • Mycobacterium szulgai Infectiousness caused by Cobacterium celatum, Mycobacterium scrofulaceum, M. terrae or M. simiae It may be a lung disease, but is not limited thereto.
  • kits for diagnosing non-tuberculosis mycobacterial infection or infectious disease comprising the composition for diagnosing infection or infectious disease of non-tuberculosis mycobacterium according to the present invention.
  • the diagnostic kit by using the diagnostic kit, it is possible to predict whether or not the non-tuberculosis mycobacterium is infected, the possibility of infection, or the onset or possibility of an infectious disease, and furthermore, the course, prognosis, or The therapeutic effect can also be diagnosed.
  • diagnostic composition of the present invention and the infection or infectious disease of non-tuberculosis mycobacterium are duplicated as described in the diagnostic composition of the present invention, and description thereof will be omitted below in order to avoid excessive congestion in the specification.
  • the kit may be a kit including essential elements necessary for performing RT-PCR.
  • the diagnostic kit of the present invention may further include a composition, solution, or device of one or more other components suitable for an analysis method.
  • the diagnostic kit of the present invention may further include essential elements necessary to perform a reverse transcription polymerase reaction.
  • the reverse transcription polymerase reaction kit contains a pair of primers specific for the gene encoding the marker protein.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of the gene, and may have a length of about 7 bp to 50 bp, more preferably about 10 bp to 30 bp.
  • a primer specific to the nucleic acid sequence of the control gene may be included.
  • reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (various pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor DEPC. - May include DEPC-water, sterilized water, etc.
  • hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p in a biological sample isolated from the object of interest. It relates to a method for providing information for diagnosing an infectious disease of non-tuberculosis mycobacterial bacteria comprising measuring the expression level of one or more selected from the group.
  • the "object of interest” refers to an individual whose infection by non-tuberculosis mycobacterium is uncertain, and has a high probability of infection.
  • the "biological sample” means any substance, biological body fluid, tissue or cell obtained from or derived from an individual, whole blood, leukocytes, peripheral blood mononuclear cells (peripheral blood) mononuclear cells), leukocyte soft coat, plasma, serum, sputum, tears, mucus, nasal washes, nasal aspirate , Breath, urine, semen, saliva, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joints It may be one or more selected from the group consisting of joint aspirate, organ secretions, cells, cell extracts, cerebrospinal fluid, and the like, preferably serum. , Is not limited thereto.
  • the step of measuring the expression level is the miRNA, hsa-miR-484, hsa-miR-584-5p, in the object of interest in order to diagnose the onset of infection or infectious disease caused by non-tuberculosis mycobacterium
  • the amount of miRNA may be measured.
  • the miRNA may be directly isolated or measured using at least one selected from the group consisting of primers, probes, and antisense nucleotides for the miRNA.
  • RT-PCR is a method of analyzing RNA. It is a method of amplifying and analyzing cDNA obtained by reverse transcription of miRNA by PCR. In the amplification step of the RT-PCR, a primer pair specifically prepared for the gene is used, and by checking the band pattern and the thickness of the band by electrophoresis after RT-PCR, it is possible to check whether the gene is expressed or not. And by comparing this with the normal control, the presence or absence of a stroke or the degree of onset of the individual can be easily determined.
  • Such methods include, but are not limited to, nucleic acid hybridization, polymerization, amplification methods and hybridization-based ligation, for example.
  • the nucleic acid hybridization may be performed in a form in which the nucleic acid is bound to a solid support, such as beads, nanoparticles, or a biochip array (microarray), or by using in situ hybridization.
  • a solid support such as beads, nanoparticles, or a biochip array (microarray)
  • the miRNA microarray technology enables the analysis of multiple miRNAs at the same time.
  • the nucleotides complementary to the miRNA according to the present invention may be spotted on the coated solid support or may be spotted on the solid support by an in situ synthesis method.
  • miRNA isolated from a biological sample can be detected by incorporation of a complementary sequence on the solid support, for example, a label detected by an enzymatic reaction after hybridization with a probe (for example, biotin, a fluorescent dye). .
  • the miRNA isolated from the biological sample is labeled with a fluorescent substance, and binds to the corresponding sequence, and the resulting fluorescence signal is indicative of the presence of the specific miRNA.
  • a substance or reagent for detection may be provided in a form bound to a solid support.
  • the detection reagent may be directly or indirectly labeled in the form of a sandwich for detection, and reference may be made to the description below.
  • a nucleic acid polymerization or amplification method may also be used for the detection of the miRNA, and is particularly suitable for detecting miRNAs present in trace amounts.
  • Various known nucleic acid amplification or synthesis methods can be used, for example, reverse transcription reaction, reverse transcription polymerase chain reaction (RT-PCR), real-time RT-PCR, PCR, real-time PCR, quantitative RT-PCR, quantitative PCR, NASBA ( Nucleic Acid Sequence-Base Amplification), LCR (Ligase Chain Reaction), Multiple ligatable probe amplification, Invader technology (Third Wave), SDA (Strand Displacement Amplification), TMA (Transcription Mediated Amplification) or Eberwine RNA amplification It may include, but is not limited to this.
  • a typical PCR method consists of three steps consisting of a step of denaturation of a template, annealing in which forward and reverse primers bind to the target sequence, and extension by a thermostable polymerase, for amplification of a specific target sequence, in several cycles, for example. More than 20 times are performed. Alternatively, annealing and stretching may be performed in the same step. Since mature miRNAs are single-stranded, a reverse transcription reaction can be performed first before PCR. The reverse transcription reaction requires the use of a primer and a reverse transcriptase.
  • a set of forward and reverse primers or a probe together with the primers may be used.
  • the length of the probe and primer depends on various factors such as the hybridization temperature, the composition of the target sequence, and the complexity of the target sequence.
  • the probe is at least 7 nucleotides and the length of the primer is about 10 to 35 nucleotides, such as 15, 20, 25, 30 or 35 nucleotides.
  • the forward primer includes at least one sequence capable of specifically binding to the biomarker miRNA, and may further include a non-complementary sequence on the 5'side.
  • the sequence of the reverse primer may be independent of the sequence of the biomarker, and a plurality of miRNA biomarkers may be amplified with one kind of reverse primer, or may include one or more sequences specific for the biomarker.
  • the amplification product can be analyzed during or after amplification by various methods known in the art. Such methods are known in the art and include gel electrophoresis, real-time PCR analysis, single strand conformational polymorphism (SSCP), restriction fragment length polymorphism (RFLP), capillary zone electrophoresis (CZE), and HPLC-based nucleic acid (WAVE). analyzing technology), including, but not limited to, microchips.
  • SSCP single strand conformational polymorphism
  • RFLP restriction fragment length polymorphism
  • CZE capillary zone electrophoresis
  • WAVE HPLC-based nucleic acid
  • a real-time quantitative PCR method i.e., RT-PCR
  • a primer for example, a stem-loop primer capable of forming a stem-loop is used.
  • synthesizing cDNA using it as a template, in real time using a dye that binds to a nucleic acid such as SYBR or as an end-point using a forward and reverse primer, or a combination of a forward and reverse primer and a probe.
  • a stem-loop RT-based nucleic acid amplification method using a fluorescent substance-labeled TaqMan probe is used.
  • hybridization-based ligation techniques can be used for quantitative analysis of miRNAs.
  • Such a method includes, but is not limited to, a method of separating a detectable probe bound to a target nucleic acid sequence from a probe that does not bind, such as a method using a HARP-like probe.
  • Another technique using ligation is MLPA (Multiplex Ligation-dependent Probe Amplification). The above technique binds in such a way that ligation occurs only when a pair of probes are bound to the target sequence side by side, and the ligated probe includes a primer binding site so that it can be amplified by PCR.
  • a hybridized or amplified miRNA product may be detected through staining or labeling of a target, staining or labeling of a primer or probe.
  • Techniques known in the art may be used for detection, and those skilled in the art will be able to select an appropriate method in consideration of the sensitivity of detection and/or the amount of target. Depending on the sensitivity of the detection method and/or the amount of target, amplification may not be necessary prior to detection.
  • miRNA can be detected by direct or indirect methods.
  • the miRNA is labeled with a detectable label bound thereto, and then bound to a probe connected to a solid support such as a bead, and then detected by screening the labeled miRNA.
  • a labeled probe can be used for direct detection, and is detected through screening of the labeled probe after specific binding with miRNA.
  • the amplified miRNA is detected using a probe conjugated with a probe capable of capturing a desired nucleic acid.
  • the probe may be labeled with a fluorescent material.
  • an indirect detection method can also be used.
  • a biotinylated probe can be used to detect a bound nucleic acid using a streptavidin conjugated dye.
  • the streptavidin molecule binds to the biotin label of the amplified miRNA, and the bound miRNA is detected by a dye conjugated to streptavidin.
  • streptavidin-conjugated dyes are known in the art, and for example, Phycolink(R) Streptavidin R-Phycoerythrin (PROzyme) can be used.
  • the label for detection is not limited thereto, but may include a compound capable of generating or eliminating detectable fluorescence, chemiluminescence, or bioluminescence signals such as light emission, light scattering, and light absorbing substances.
  • Fluorescent substances are, for example, but not limited to, fluorescein, rhodamine, benzophenoxazine, energy transfer fluorescent dyes including donors and acceptors, and cyanine, lysamine, phycoerythrin, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham), Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPYR6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514,
  • the fluorescent dye is 6-carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; And 2',4',5',7',1,4-hexachlorofluorescein.
  • SYBR-Green, 6-carboxyfluorescein (“FAM”), TET, ROX, VICTM, or JOE is used as a fluorescent label.
  • FAM 6-carboxyfluorescein
  • TET 6-carboxyfluorescein
  • ROX ROX
  • VICTM VICTM
  • JOE JOE
  • a probe labeled with two fluorescent materials, a reporter fluorescent material and an erasing fluorescent material, is used, and in this case, a fluorescent material having a distinguishable wavelength emitting a spectrum is used.
  • the marker is a compound capable of enhancing, stabilizing, or affecting the binding of nucleic acids, for example, intercalators, minor groove conjugates, and crosslinkable functional groups including ethyl bromide and SYBR-Green. It may be used, but is not limited thereto.
  • the miRNA quantification may refer to, for example, miRNA, SYBR-based miRNA RT-qPCR assays, BeadArray, Invader Assays, and Padlock probe-based assays.
  • the step of predicting that the infection is infected by the non-tuberculosis mycobacterium or has a high probability of infection, or that an infectious disease has developed or is highly likely to develop may be further included.
  • the definition of an infectious disease of non-tuberculosis mycobacterium is duplicated as described in the diagnostic composition of the present invention, and thus description thereof will be omitted to avoid excessive congestion in the specification.
  • hsa-miR-484 by measuring the expression level of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p or hsa-miR-4732-5p with respect to the biological sample of the object of interest It is possible to predict whether or not the onset of infection or infectious disease caused by or the likelihood of onset can be predicted simply, easily and accurately.
  • FIG. 1 shows an experimental design for identifying miRNA in serum that can be used as a marker for lung disease caused by non-tuberculosis mycobacteria in an embodiment of the present invention.
  • FIG. 2 is a graph showing the results of analyzing the distribution frequency of each RNA length in a serum sample of a healthy control group in an embodiment of the present invention.
  • FIG. 3 is a graph showing the results of analyzing the distribution frequency of each RNA length in a serum sample of a patient with M. avium infectious lung disease in an embodiment of the present invention.
  • FIG. 4 is a graph showing the results of analyzing the distribution frequency of each RNA length in a serum sample of a patient with Mycobacterium intracellulare infectious lung disease in an embodiment of the present invention.
  • FIG. 5 is a graph showing the results of analyzing the distribution frequency of each RNA length in a serum sample of a patient with M. abscessus subspecies abscessus infectious lung disease in an embodiment of the present invention. .
  • FIG. 6 is a graph showing the results of analyzing the distribution frequency of each RNA length in a serum sample of a patient with M. abscessus subspecies massiliense infectious lung disease in an embodiment of the present invention. .
  • FIG. 7 shows the distribution of miRNAs that are differently expressed in patients with M. avium infectious lung disease compared to a healthy control group in an embodiment of the present invention.
  • FIG. 8 shows the distribution of miRNAs differently expressed in patients with M. intracellulare infectious lung disease compared to a healthy control group in an embodiment of the present invention.
  • FIG. 10 shows the distribution of miRNAs differently expressed in patients with M. abscessus subspecies massiliense infectious lung disease compared to a healthy control group in an embodiment of the present invention.
  • 11 shows the number of miRNAs expressed differently in each patient with non-tuberculous mycobacterial infectious lung disease compared to a healthy control group in an embodiment of the present invention.
  • FIG. 12 shows the expression folds of miRNAs that are differently expressed in patients with non-tuberculosis mycobacterial infectious lung disease compared to a healthy control group in an embodiment of the present invention.
  • FIG. 13 is a graph showing the results of comparing the expression level of hsa-miR-423-5p in the serum of a healthy control group and a patient with non-tuberculous mycobacterial infectious lung disease in an embodiment of the present invention.
  • FIG. 14 is a graph showing the results of comparing the expression level of hsa-miR-484 in the serum of a healthy control group and a patient with non-tuberculosis mycobacterial infectious lung disease in an embodiment of the present invention.
  • 15 is a graph showing the results of comparing the expression level of hsa-miR-584-5p in the serum of a healthy control group and a patient with non-tuberculous mycobacterial infectious lung disease in an embodiment of the present invention.
  • 16 is a graph showing the results of comparing the expression level of hsa-miR-625-3p in the serum of a healthy control group and a patient with non-tuberculous mycobacterial infectious lung disease in an embodiment of the present invention.
  • 17 is a graph showing the results of comparing the expression level of hsa-miR-4732-5p in the serum of a healthy control group and a patient with non-tuberculous mycobacterial infectious lung disease in an embodiment of the present invention.
  • FIG. 18 shows an analysis of the ROC curve for the hsa-miR-484 biomarker in the diagnosis of non-tuberculosis mycobacterial infectious lung disease in an embodiment of the present invention.
  • FIG. 19 shows ROC curve analysis for hsa-miR-584-5p biomarker in the diagnosis of non-tuberculosis mycobacterial infectious lung disease in an embodiment of the present invention.
  • Figure 20 shows the ROC curve analysis for the hsa-miR-625-3p biomarker in the diagnosis of non-tuberculosis mycobacterial infectious lung disease in an embodiment of the present invention.
  • Figure 21 shows the ROC curve analysis for the hsa-miR-4732-5p biomarker in the diagnosis of non-tuberculosis mycobacterial infectious lung disease in an embodiment of the present invention.
  • Figure 22 shows the miRNA-gene network of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p in an embodiment of the present invention.
  • hsa-miR-484 shows hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732- using a gene ontology (GO) in an embodiment of the present invention. It shows the results of analyzing the molecular function of 5p-related genes.
  • hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p and hsa-miR-4732-5p containing at least one selected from the group consisting of, non-tuberculosis It provides a biomarker composition for an infection or an infectious disease of an antioxidant.
  • a formulation measuring the expression level of one or more selected from the group consisting of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p and hsa-miR-4732-5p It provides a composition for diagnosis of infection or infectious disease of non-tuberculosis mycobacterium, comprising a.
  • kits for diagnosing non-tuberculosis mycobacterial infections or infectious diseases comprising the diagnostic composition according to the present invention.
  • hsa-miR-484 in the group consisting of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p in the biological sample isolated from the object of interest. It provides a method of providing information for diagnosing an infection or infectious disease of non-tuberculosis mycobacterial bacteria comprising the step of measuring the expression level of one or more selected types.
  • Serum of patients newly diagnosed with lung disease caused by non-tuberculosis mycobacterium was screened at Samsung Medical Center (ClinicalTrials.gov identifier: NCT00970801).
  • Samsung Medical Center ClinicalTrials.gov identifier: NCT00970801.
  • Mycobacterium avium M. avium
  • Mycobacterium intracellulare M. intracellulare
  • Mycobacterium abscessus subspecies Abscessus M. abscessus subspecies abscessus
  • Mycobacterium Thirteen patients infected with each of M.
  • abscessus subspecies massiliense were selected, and a total of 52 patients who met the criteria for pulmonary disease due to non-tuberculosis mycobacterium were selected.
  • 43 hospital workers without comorbidity were selected.
  • Serum obtained from each population was centrifuged and stored at -80 °C.
  • the experiment was performed in four steps to identify miRNAs in serum that can be used as markers of lung disease caused by non-tuberculosis mycobacteria.
  • screening was performed using Illumina small RNA sequencing to select miRNAs expressed in different patterns in patients with onset of non-tuberculosis mycobacterial lung disease and healthy controls.
  • a total of 15 serum samples were tested by combining 3 samples of infected patients and 3 samples of healthy control groups for each strain to obtain a miRNA profile. Subsequent qRT-PCR was performed using a panel of miRNAs showing different expressions in patients with non-tuberculosis mycobacterial lung disease and miRNAs commonly expressed in lung diseases caused by four strains.
  • RNA sequencing library was designed using the NEXTFlex Small RNA Library Prep Kit (Illumina, San Diego, CA, USA). Briefly, the RNA sequencing library was prepared by cDNA amplification, end-repair, adenylation of 3'ends, adapter ligation and amplification. Ready. The library was sequenced using a HiSeq 2500 system (Illumina) with 50-base pair single reads.
  • Read data was evaluated using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc) and pre-work was performed, and a low quality base was excised from the 3'end. The adapter sequence was cut out, and reads smaller than 17 nucleic acids were removed. Reads cut using Bowtie were mapped to the reference genome (GRCH38/hg19). The distribution of the mapped reads was analyzed with miRBase (http://www.mirbase.org/), Ensembl annotations and Rfam database (http://rfam.xfam.org/).
  • Known miRNAs were identified using the miRDeep2 program (https://www.mdc-berlin.de/content/mirdeep2-documentation) to predict novel miRNAs in all samples and summarize read counts of each miRNA. When the threshold fold was more than 2 times and the p-value was less than 0.05, it was judged that miRNAs were expressed differently. However, the p-value was calculated using the DESeq algorithm in the R package.
  • the reverse transcription reaction was performed using Taq-Man miRNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) and miRNA-specific stem-loop primers.
  • Each reaction mixture for qRT-PCR contained 2.5 ⁇ L of 2 ⁇ TaqMan Universal PCR Master Mix without AmpErase UNG, 0.25 ⁇ L of miRNA-specific primer/probe mixture, and 2.25 ⁇ L of diluted RT product.
  • the reaction was carried out at 95° C. for 10 minutes, 95° C. for 15 seconds, 40 cycles, and 60° C. for 1 minute, and then maintained at 4° C.
  • Raw data were analyzed using SDS Relative Quantification software version 2.2.3 (Applied Biosystems).
  • the expression level of each target miRNA was normalized to miR-16 (internal control).
  • TargetScan http://genes.mit.edu/targetscan/index.ht ml was used to predict genes targeted by the obtained miRNA.
  • Targets associated with non-tuberculosis mycobacterial pulmonary disease using NCBI database (http://www.ncbi.nlm.nih.gov/pubmed/) and Cytoscape (Cytoscape Software, Version 2.8.2, Seattle, WA, USA) The genes were screened.
  • the miRNA gene network was designed using Cytoscape and the correlation between miRNA-miRNA was analyzed.
  • the molecular function of the target gene was predicted using Gene Ontology (http://www.geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (http://www.genome.jp/kegg/).
  • Data are expressed as a number (%) for categorical variables, and a median value (interquartile range) for continuous variables.
  • Data were statistically analyzed using SPSS software, version 17.0 (SPSS, Inc., Chicago, IL, USA) or a program built therein. Two-tailed unpaired t-tests were performed for comparison between groups, and one-way analysis of variance was performed for comparison between groups.
  • ROC Receiveiver operating characteristic curve analysis was performed to evaluate the distinguishing factor of miRNA. To determine specificity and sensitivity using statistical tests in Prism Graph software, version 5.01 (GraphPad, Inc., La Jolla, CA, USA), with 95% confidence interval (CI), areas under the curves (AUC) were calculated. Calculated. Binary logistic regression analyses were performed using SPSS software. If p ⁇ 0.05, it was considered statistically significant.
  • NTM-PD Characteristic NTM-PD
  • NTM-PD means patients with non-tuberculous mycobacterial lung disease, and INA means no information.
  • RNAs ranging from 18 to 30 nucleic acids from serum samples from patients with non-tuberculosis mycobacterial lung disease and healthy controls were obtained, respectively, with an average of 11,217,363 and 18,556,427 reads.
  • the length distribution of clean sequences in the reference genome was determined. According to the analysis of the length distribution of serum samples from patients with non-tuberculosis mycobacterial infectious lung disease and healthy controls, most reads showed a length of 18 to 24 nucleic acids corresponding to the length of a normal miRNA. Serum samples of patients with non-tuberculosis mycobacterial infectious lung disease and healthy controls contained small RNAs of various lengths (FIGS. 2 to 6 ). Accordingly, bioinformatics analysis was performed to confirm the types of small RNAs and sequencing frequencies.
  • RNA samples of patients with non-tuberculosis mycobacterial infectious lung disease and healthy controls included miRNA, long intergenic noncoding RNA (RNA), ribosomal RNA, small nucleolar RNA (small nucleolar RNA), and small nuclear RNA. nuclear RNA) and various small RNA types were identified (Table 3).
  • miRNAs of the total small RNAs were calculated as 39.7% and 44.5%, respectively, and no significant differences were found between the two groups. Accordingly, all reads were analyzed using mirDeep software to confirm the presence of known or novel miRNAs.
  • RNAs showed a significant difference in expression levels in patients with M. avium infectious lung disease compared to the healthy control group, and 56 miRNAs were Mycobacterium intracellulare (M. There was a significant difference in expression levels in patients with intracellulare) infectious lung disease, and 46 miRNAs were significantly different in expression levels in patients with M. abscessus subspecies abscessus infectious lung disease. And 32 miRNAs showed significant differences in expression levels in patients with M. abscessus subspecies massiliense infectious lung disease (FIGS. 7 to 10 ). However, only 14 miRNAs showed a significant difference in expression level compared to the healthy control group in common in the 4 strains of infectious lung disease patients (FIGS. 11 and 12).
  • NTM-PD Healthy control Total reads 11,217,363 18,556,427 Precursor miRNA reads 3,445 8,444 Mature miRNA reads 7,250,677 5,265,841 Number of known miRNAs 467 407 Number of new miRNAs 262 193 Distribution of genome-mapped sequence reads miRNA 3,517,419 (39.7) 3,083,932 (44.5) lincRNA 2,397,431 (27.0) 1,655,179 (23.9) rRNA 10,857 (0.1) 6,326 (0.1) snoRNA 8,987 (0.1) 5,626 (0.1) snRNA 25,265 (0.3) 20,821 (0.3) Etc 2,924,390 (32.8) 2,164,554 (31.2) Data are expressed as a number (%), and NTM-PD refers to patients with non-tuberculosis mycobacterium-infected lung disease, miRNA is microRNA, lincRNA is long intergenic noncoding RNA, rRNA is ribosomal RNA,
  • miRNAs showing different expression patterns in four strains of infectious lung disease patients compared to the healthy control group were considered as potential biomarkers, and their expression levels were confirmed by qRT-PCR.
  • the expression levels of 14 miRNAs were confirmed from serum samples of 12 infected lung disease patients and 3 healthy control groups for each of the 4 strains.
  • miRNAs with an average expression level of more than 2 times and p-values less than 0.05 were selected.
  • ROC curve analysis was performed using validation data obtained from 40 patients with non-tuberculosis mycobacterial pulmonary disease and 40 healthy controls.
  • hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p will be used as biomarkers to distinguish patients with non-TB mycobacterial infection lung disease compared to healthy controls. I could see that I could.
  • FIG. 23 shows the miRNA-gene networks of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p, and these four miRNAs are in the TargetScan database. It was associated with 4231, 2268, 2475, and 2242 target mRNAs, respectively.
  • hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, and hsa-miR-4732-5p all NFAT5 (nuclear factor of activated T cells 5) and TLR4 (Toll- like receptor 4) was targeted, and hsa-miR-484, hsa-miR-584-5p, and hsa-miR-4732-5p targeted interleukin 6 (IL-6), and hsa-miR -484 and hsa-miR-625-3p targeted interleukin 17 (IL-17).
  • IL-6 interleukin 6
  • 125 genes were analyzed using Gene Ontology (GO), and the database based on molecular function (Fig. 23), the Kyoto Encyclopedia of Genes and Genomes (KEGG), and the regulatory pathway database (Fig. 24) control most of the transcription. Proteins encoded by autophagy and protein binding function were found to be associated with cell growth, migration proliferation, Hippo signal, Wnt signal, p53 signal, and TGF- ⁇ (transforming growth factor ⁇ ) signal.
  • GO Gene Ontology
  • Fig. 23 the database based on molecular function
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • Fig. 24 regulatory pathway database
  • hsa-miR-484 by measuring the expression level of hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p or hsa-miR-4732-5p with respect to the biological sample of the object of interest It is possible to predict whether or not the onset of infection or infectious disease caused by or the likelihood of onset can be predicted simply, easily and accurately.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 비결핵 항산균에 의한 감염 또는 감염 질환을 진단하기 위한 조성물에 관한 것이다.

Description

비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물
본 발명은 비결핵 항산균에 의한 감염 또는 감염 질환을 진단하기 위한 조성물에 관한 것이다.
마이코박테리움 (Mycobacterium) 속(屬)에는 결핵, 우형결핵 (牛形結核), 나병 (癩病)과 같이 사람과 동물에 심각한 질병을 일으키는 균 종 (species)뿐 아니라, 기회 감염균으로 일컬어지는 균 종, 그리고 자연환경에서 볼 수 있는 사물 (死物) 기생의 균 종 (saprophytic species) 등 현재까지 약 72 종(species)이 알려져 있으며, 그 중 인체 질환과 관련된 것이 25종에 이르는 것으로 알려져 있다. 이러한 마이코박테리움 속은 일반적으로 사용되는 염색액으로는 용이하게 염색되지 않지만 일단 염색되면 알코올이나 염산 등으로 처리시에도 용이하게 탈색되지 않기 때문에 항산균이라고도 불린다.
비결핵 항산균(Nontuberculous mycobacteria; NTM)은 결핵균(Mycobacterium tuberculosis complex) 및 나균(Mycobacterium leprae)을 제외한 항산균을 의미한다. 한편, 마이코박테리움 아비움 복합체(Mycobacterium avium complex; MAC)에 속하는 비결핵 항산균주 중 흔히 인간에게서 폐 질환을 일으키는 균주로는 공식적으로 대략 180 종 이상이 규명되었다. MAC는 주로 M. 아비움(M. avium)과 M. 인트라셀룰라(M. intracellulare)를 포함하고, 마이코박테리움 압세수스(Mycobacterium abscessus; MAB)는 주로 M. 압세수스 아종인 압세수스(M. abscessus subspecies abscessus)와 M. 압세수스 아종인 마실리엔스(M. abscessus subspecies massiliense)를 포함한다. 최근 전세계적으로 비결핵 항산균에 기인한 폐 감염 보고가 증가하고 있지만, 건강한 개체군으로부터 비결핵 항산균 폐 감염 질환자를 구별하기 위한 바이오마커나, 질환에 대한 병태 생리의 연구가 부족한 실정이다.
본 발명의 일 목적은 비결핵 항산균의 감염 또는 감염 질환을 진단하기 위한 바이오마커 조성물을 제공하고자 한다.
본 발명의 다른 목적은 일 목적은 비결핵 항산균의 감염 또는 감염 질환을 진단하기 위한 조성물을 제공하고자 한다.
본 발명의 또 다른 목적은 비결핵 항산균의 감염 또는 감염 질환을 진단하기 위한 키트를 제공하고자 한다.
본 발명의 또 다른 목적은 비결핵 항산균의 감염 또는 감염 질환을 진단하기 위한 정보 제공 방법을 제공하고자 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명의 일 구현 예에 따르면, hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상을 포함하는, 비결핵 항산균의 감염 또는 감염 질환의 진단용 바이오마커 조성물에 관한 것이다.
본 발명의 명세서에서 용어 "진단"은 특정 질병 또는 질환에 대한 한 객체 즉 검사 대상자의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는 지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)를 판정하는 것 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다.
본 발명에 따른 진단용 바이오마커는 비결핵 항산균의 감염자 또는 감염 후 질환이 발병한 자를 건강한 정상 대조군과 구분하여 진단할 수 있는 물질로, 정상 대조군에 비하여 비결핵 항산균에 의해 감염된 대상체 유래의 생물학적 시료에서 증가 또는 감소 양상을 보이는 핵산, 특히 miRNA, 또는 cRNA 또는 cDNA를 포함한다.
본원에 사용된 용어 "miR", "miRNA" 또는 "마이크로 RNA" 또는 "마이크로알엔에이"는 표적 RNA의 분해(degradation)를 촉진시키거나 또는 그들의 번역을 억제시킴으로써 유전자 발현을 전사 후에 조절하는 21 내지 23개의 비코딩 RNA를 말한다. 본원에 사용된 miRNA의 성숙 서열은 miRNA 데이터베이스 (http://www.mirbase.org)에서 얻을 수 있다. 2016년 10월 현재 miRNA 데이터베이스(21판, miRBase)에 의하면 223개 종에서 유래한 35,828개의 성숙 miRNA가 등록되어 있다. 일반적으로 마이크로 RNA는 pre-miRNA라 불리는 헤어핀 구조를 갖는 약 70-80 nt (nucleotide) 길이의 전구체로 전사된 후, RNAse III 효소인 Dicer에 의해 잘려 성숙된 형태로 생성된다. 마이크로 RNA는 miRNP라 불리는 리보뉴클레오복합체를 형성하여 표적 부위에 상보적 결합을 통해 표적 유전자를 절단하거나, 번역을 억제한다. 30% 이상의 인간 miRNA는 클러스터로 존재하며, 하나의 전구체로 전사된 후, 절단과정을 거쳐 최종 성숙 miRNA가 형성된다.
본 발명에서 상기 본 발명에서 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p miRNA는 인간 유래로 각각 하기 표 1에 나타낸 바와 같은 성숙 서열을 가지며, 이의 전구 서열 역시 포함하는 것이며, 또는 이들 서열의 cRNA 또는 cDNA를 포함한다.
miRNA 서열 정보
hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU(서열번호 1)
hsa-miR-584-5p UUAUGGUUUGCCUGGGACUGAG(서열번호 2)
hsa-miR-625-3p AGGGGGAAAGUUCUAUAGUCC(서열번호 3)
hsa-miR-4732-5p UGUAGAGCAGGGAGCAGGAAGCU(서열번호 4)
본 발명에서 상기 비결핵 항산균은 마이코박테리움 아비움(M. avium), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 플라베센스(M. flavescence), 마이코박테리움 아프리카눔(M. africanum), 마이코박테리움 보비스(M. bovis), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 가스트리(M. gastri), 마이코박테리움 헤모필룸(M. haemophilum), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 테레(M. terrae), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 울서란스(M. ulcerans), 마이코박테리움 시미애(M. simiae) 및 마이코박테리움 제노피(M. xenopi)로 구성된 군으로부터 선택된 것이 바람직하나, 이에 제한되는 것은 아니다.
본 발명에서 상기 비결핵 항산균 감염 질환은 상기 비결핵 항산균의 감염에 의해 나타나는 모든 임상적 증상을 포함하는 것으로, 상기 감염 질환은 폐 질환, 림프절염, 피부·연조직·골감염증 또는 파종성 질환 등을 포함할 수 있다.
본 발명에서 상기 비결핵 항산균에 의한 감염성 폐 질환은 섬유공동형 (fibrocavitary form), 기관지 확장증형 (nodular bronchiectatic form), 또는 이들의 조합인 것일 수 있다. 또한, 상기 감염성 폐 질환은 기침, 객담, 혈담, 발열, 호흡곤란, 흉통 또는 이들의 조합을 동반하는 것일 수 있다.
본 발명에서 상기 비결핵 항산균에 의한 감염성 폐 질환은 감염성 폐 질환을 일으키는 균으로, 예를 들면, 마이코박테리움 아비움 복합체(M. avium complex), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 제노피(M. xenopi), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 테레(M. terrae) 또는 마이코박테리움 시미애(M. simiae)에 의한 감염성 폐 질환인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현 예에 따르면, hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준을 측정하는 제제를 포함하는, 비결핵 항산균의 감염 또는 감염 질환의 진단용 조성물에 관한 것이다.
본 발명에서 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 또는 hsa-miR-4732-5p의 발현 수준을 측정하는 제제는 상기 miRNA에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상을 포함할 수 있다.
본 발명에서 상기 "프라이머"는 표적 유전자 서열을 인지하는 단편으로서, 정방향 및 역방향의 프라이머 쌍을 포함하나, 바람직하게는, 특이성 및 민감성을 가지는 분석 결과를 제공하는 프라이머 쌍이다. 프라이머의 핵산 서열이 시료 내 존재하는 비-표적 서열과 불일치하는 서열이어서, 상보적인 프라이머 결합 부위를 함유하는 표적 유전자 서열만 증폭하고 비특이적 증폭을 유발하지 않는 프라이머일 때, 높은 특이성이 부여될 수 있다.
본 발명에서 상기 "프로브"란 시료 내의 검출하고자 하는 표적 물질과 특이적으로 결합할 수 있는 물질을 의미하며, 상기 결합을 통하여 특이적으로 시료 내의 표적 물질의 존재를 확인할 수 있는 물질을 의미한다. 프로브의 종류는 당업계에서 통상적으로 사용되는 물질로서 제한은 없으나, 바람직하게는 PNA(peptide nucleic acid), LNA(locked nucleic acid), 펩타이드, 폴리펩타이드, 단백질, RNA 또는 DNA일 수 있으며, 가장 바람직하게는 PNA이다. 보다 구체적으로, 상기 프로브는 바이오 물질로서 생물에서 유래되거나 이와 유사한 것 또는 생체 외에서 제조된 것을 포함하는 것으로, 예를 들어, 효소, 단백질, 항체, 미생물, 동식물 세포 및 기관, 신경세포, DNA, 및 RNA일 수 있으며, DNA는 cDNA, 게놈 DNA, 올리고뉴클레오타이드를 포함하며, RNA는 게놈 RNA, mRNA, 올리고뉴클레오타이드를 포함하며, 단백질의 예로는 항체, 항원, 효소, 펩타이드 등을 포함할 수 있다.
본 발명에서 상기 "LNA(Locked nucleic acids)"란, 2'-O, 4'-C 메틸렌 브릿지를 포함하는 핵산 아날로그를 의미한다. LNA 뉴클레오사이드는 DNA와 RNA의 일반적 핵산 염기를 포함하며, Watson-Crick 염기 쌍 규칙에 따라 염기 쌍을 형성할 수 있다. 하지만, 메틸렌 브릿지로 인한 분자의 'locking'으로 인해, LNA는 Watson-Crick 결합에서 이상적 형상을 형성하지 못하게 된다. LNA가 DNA 또는 RNA 올리고뉴클레오티드에 포함되면, LNA는 보다 빠르게 상보적 뉴클레오티드 사슬과 쌍을 이루어 이중 나선의 안정성을 높일 수 있다.
본 발명에서 상기 "안티센스"는 안티센스 올리고머가 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열과 혼성화되어, 표적서열 내에서 전형적으로 mRNA와 RNA:올리고머 헤테로이중체의 형성을 허용하는, 뉴클레오티드 염기의 서열 및 서브유닛간 백본을 갖는 올리고머를 의미한다. 올리고머는 표적 서열에 대한 정확한 서열 상보성 또는 근사 상보성을 가질 수 있다.
본 발명에 따른 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p의 정보는 알려져 있으므로, 당업자라면 이를 바탕으로 상기 단백질을 암호화하는 유전자에 특이적으로 결합하는 프라이머, 프로브 또는 안티센스 뉴클레오티드를 용이하게 디자인할 수 있을 것이다.
본 발명에서 상기 비결핵 항산균은 마이코박테리움 아비움(M. avium), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 플라베센스(M. flavescence), 마이코박테리움 아프리카눔(M. africanum), 마이코박테리움 보비스(M. bovis), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 가스트리(M. gastri), 마이코박테리움 헤모필룸(M. haemophilum), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 테레(M. terrae), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 울서란스(M. ulcerans), 마이코박테리움 시미애(M. simiae) 및 마이코박테리움 제노피(M. xenopi)로 구성된 군으로부터 선택된 것이 바람직하나, 이에 제한되는 것은 아니다.
본 발명에서 상기 비결핵 항산균 감염 질환은 상기 비결핵 항산균의 감염에 의해 나타나는 모든 임상적 증상을 포함하는 것으로, 상기 감염 질환은 폐 질환, 림프절염, 피부·연조직·골감염증 또는 파종성 질환 등을 포함할 수 있다.
본 발명에서 상기 비결핵 항산균에 의한 감염성 폐 질환은 섬유공동형 (fibrocavitary form), 기관지 확장증형 (nodular bronchiectatic form), 또는 이들의 조합인 것일 수 있다. 또한, 상기 감염성 폐 질환은 기침, 객담, 혈담, 발열, 호흡곤란, 흉통 또는 이들의 조합을 동반하는 것일 수 있다.
본 발명에서 상기 비결핵 항산균에 의한 감염성 폐 질환은 감염성 폐 질환을 일으키는 균으로, 예를 들면, 마이코박테리움 아비움 복합체(M. avium complex), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 제노피(M. xenopi), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 테레(M. terrae) 또는 마이코박테리움 시미애(M. simiae)에 의한 감염성 폐 질환인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현 예에 따르면, 본 발명에 따른 비결핵 항산균의 감염 또는 감염 질환의 진단용 조성물을 포함하는 비결핵 항산균의 감염 또는 감염 질환의 진단용 키트에 관한 것이다.
본 발명에서는 상기 진단용 키트를 이용하여 비결핵 항산균의 감염 여부 또는 감염 가능성이나, 감염 질환의 발병 여부 또는 발병 가능성을 예측할 수 있고, 더 나아가서는 상기 비결핵 항산균의 감염 질환의 경과, 예후 또는 치료 효과에 대하여도 진단할 수 있다.
본 발명의 진단용 조성물과, 비결핵 항산균의 감염 또는 감염 질환에 관한 정의는 상기 본 발명의 진단용 조성물에 기재된 바와 중복되어 명세서의 과도한 혼잡을 피하기 위해 이하 그 기재를 생략한다.
본 발명에서 상기 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다.
본 발명의 진단용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 더 포함할 수 있다.
예를 들면, 본 발명의 진단용 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 더 포함할 수 있다. 역전사 중합효소반응 키트는 마커 단백질을 코딩하는 유전자에 대해 특이적인 프라이머 쌍을 포함한다. 프라이머는 상기 유전자의 핵산서열에 특이적인 서열을 가지는 뉴클레오티드로서, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp의 길이를 가질 수 있다. 또한 대조군 유전자의 핵산 서열에 특이적인 프라이머를 포함할 수 있다. 그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 용기, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNase 억제제 DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.
본 발명의 또 다른 구현 예에 따르면, 목적하는 개체로부터 분리된 생물학적 시료에서 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준을 측정하는 단계를 포함하는 비결핵 항산균의 감염 질환을 진단하기 위한 정보 제공 방법에 관한 것이다.
본 발명에서 상기 "목적하는 개체"란 비결핵 항산균에 의한 감염 여부가 불확실한 개체로, 감염 가능성이 높은 개체를 의미한다.
본 발명에서 상기 "생물학적 시료"는 개체로부터 얻어지거나 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 전혈(whole blood), 백혈구(leukocytes), 말초혈액 단핵 세포(peripheral blood mononuclear cells), 백혈구 연층(buffy coat), 혈장(plasma), 혈청(serum), 객담(sputum), 눈물(tears), 점액(mucus), 세비액(nasal washes), 비강 흡인물(nasal aspirate), 호흡(breath), 소변(urine), 정액(semen), 침(saliva), 복강 세척액(peritoneal washings), 복수(ascites), 낭종액(cystic fluid), 뇌척수막 액(meningeal fluid), 양수(amniotic fluid), 선액(glandular fluid), 췌장액(pancreatic fluid), 림프액(lymph fluid), 흉수(pleural fluid), 유두 흡인물(nipple aspirate), 기관지 흡인물(bronchial aspirate), 활액(synovial fluid), 관절 흡인물(joint aspirate), 기관 분비물(organ secretions), 세포(cell), 세포 추출물(cell extract) 및 뇌척수액(cerebrospinal fluid) 등으로 이루어진 군에서 선택된 1종 이상일 수 있으며, 바람직하게는 혈청일 수 있으나, 이에 제한되지 않는다.
본 발명에서 상기 발현 수준을 측정하는 단계는 비결핵 항산균에 의한 감염 또는 감염 질환의 발병 여부를 진단하기 위하여 목적하는 개체에서 상기 miRNA로, hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 존재 여부와 수준을 확인하는 과정으로써 miRNA 양의 측정일 수 있다. 이를 위하여, 본 발명에서는 상기 miRNA를 직접 분리하거나, 상기 miRNA에 대한 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상을 이용하여 측정할 수 있다.
또한, 본 발명에서 상기 발현 수준을 측정하는 단계 시 miRNA 양의 분석 방법은 RT-PCR, 경쟁적 RT-PCR (competitive RT-PCR), 실시간 RT-PCR (Real-time RT-PCR), RNase 보호 분석법 (RPA: RNase protection assay), 노던 블랏팅 (Northern blotting), DNA를 포함한 핵산 마이크로어레이 또는 그 조합을 이용하는 것을 포함할 수 있다. RT-PCR은 RNA를 분석하는 방법으로, miRNA를 역전사하여 얻어진 cDNA를 PCR로 증폭하여 분석하는 방법이다. 상기 RT-PCR 중 증폭 단계에서 상기 유전자에 특이적으로 제조된 프라이머 쌍을 사용하며, RT-PCR 후 전기영동하여 밴드 패턴과 밴드의 두께를 확인함으로써 상기 유전자의 miRNA 발현 여부와 발현 수준을 확인할 수 있고 이를 정상 대조군과 비교함으로써, 개체의 뇌졸중의 유무 또는 그 발병 정도를 간편하게 판단할 수 있다.
이러한 방법은 예를 들면 핵산 교잡, 중합, 증폭 방법 및 교잡기반 라이게이션 등을 포함하나 이로 제한하는 것은 아니다.
본 발명에서 상기 핵산 교잡은 핵산이 고상의 지지체, 예를 들면 비드, 나노입자 또는 바이오칩 어레이(마이크로에레이)에 결합된 형태로 또는 인시츄 교잡을 이용하여 수행될 수 있다. miRNA 마이크로어레이 기술은 동시에 다수의 miRNA의 분석을 가능하게 한다. 본 발명에 따른 miRNA에 상보적인 뉴클레오타이드는 코팅된 고상 지지체에 스폿팅되거나 또는 인시츄 합성 방법으로 고상지지체에 스폿팅 될 수 있다. 실시예에서 생물학적 시료로부터 분리된 miRNA는 상기 고상지지체 상의 상보적인 서열, 예를 들면 프로브와의 교잡 후에 효소반응에 의해 검출되는 표지(예를 들면 바이오틴, 형광염료)의 혼입에 의해 검출될 수 있다. 다른 실시예에서, 생물학적 시료에서 분리된 miRNA는 형광물질로 표지되어, 상응하는 서열과 결합하고, 그 결과 방출된 형광 신호는 특정 miRNA의 존재를 나타낸다. 마이크로어레이 제조 기술에서 검출용 물질 또는 시약은 고상의 지지체에 결합된 형태로 제공될 수 있다. 검출시약은 검출을 위해 직접적 또는 샌드위치 형태로 간접적으로 표지될 수 있으며, 후술하는 바를 참조할 수 있다.
본 발명에서 상기 miRNA의 검출에는 핵산 중합 또는 증폭 방법이 또한 사용될 수 있으며, 특히 미량으로 존재하는 miRNA 검출에 적합하다. 공지된 다양한 핵산 증폭 또는 합성 방법이 사용될 수 있으며, 예를 들면 역전사 반응, 역전사 중합효소연쇄반응(RT-PCR), 실시간 RT-PCR, PCR, 실시간 PCR, 정량 RT-PCR, 정량 PCR, NASBA(Nucleic Acid Sequence-Base Amplification), LCR(Ligase Chain Reaction), 다중 연결 프로브 증폭(Multiple ligatable probe amplification), Invader 기술(Third Wave), SDA(Strand Displacement Amplification), TMA(Transcription Mediated Amplification) 또는 Eberwine RNA 증폭 등을 포함할 수 있으나 이로 제한하는 것은 아니다.
전형적인 PCR 방법은 특정 표적 서열의 증폭을 위해, 주형의 변성, 포워드 및 리버스 프라이머가 표적 서열에 결합하는 어닐링 및 열안정 중합효소에 의한 신장의 단계로 구성되는 3 단계가 여러 주기, 예를 들면 통상 20회 이상이 수행된다. 대안적으로 어닐링 및 신장은 동일한 단계에서 수행되기도 한다. 성숙한 miRNA는 단일가닥이기 때문에, PCR 전에 역전사 반응이 먼저 수행될 수 있다. 역전사 반응에는 프라이머와 역전사 효소의 사용을 필요로 한다.
PCR 및 정량 PCR에서는 포워드 및 리버스의 한 세트의 프라이머 또는 상기 프라이머와 함께 프로브가 사용될 수 있다. 프로브 및 프라이머의 길이는 교잡온도, 표적 서열의 구성, 표적 서열의 복잡성 등과 같은 다양한 요소에 따라 결정된다. 예를 들면 프로브는 7 뉴클레오타이드 이상, 프라이머의 길이는 약 10 내지 35 뉴클레오타이드, 예를 들면 15, 20, 25, 30 또는 35 뉴클레오타이드이다. 포워드 프라이머는 바이오마커 miRNA에 특이적으로 결합할 수 있는 적어도 하나의 서열을 포함하며, 5'쪽에 비상보적 서열을 추가로 포함할 수 있다. 리버스 프라이머의 서열은 바이오마커의 서열과는 독립적일 수 있으며, 다수의 miRNA 바이오마커가 한 종류의 리버스 프라이머로 증폭될 수 있거나, 또는 바이오마커에 특이적인 하나 이상의 서열을 포함할 수 있다.
증폭 산물은 증폭 과정에서 또는 증폭 후에 당업계에 공지된 다양한 방법으로 분석될 수 있다. 이러한 방법은 당업계에 공지된 것으로서 예를 들면 젤 전기영동, 실시간 PCR 분석, SSCP(single strand conformational polymorphism), RFLP(restriction fragment length polymorphism), CZE(capillary zone electrophoresis), WAVE(HPLC-based nucleic acid analyzing technology), 마이크로칩을 포함하나, 이로 제한하는 것은 아니다.
본 발명에서는 역전사 반응 후에 실시간 정량 PCR 방법, 즉 RT-PCR이 사용되며, 이는 검체의 RNA를 분리한 후, 이로부터 프라이머, 예를 들면 stem-loop를 형성할 수 있는 stem-loop 프라이머를 이용하여 cDNA를 합성한 후, 이를 주형으로 하여, 여기에, 포워드 및 리버스 프라이머, 또는 포워드 및 리버스 프라이머와 프로브의 조합을 사용하여 end-point로 또는 SYBR과 같은 핵산에 결합하는 염료를 사용하여 실시간으로, 또는 형광물질로 표지된 TaqMan 방식의 프로브를 사용한 stem-loop RT 기반의 핵산증폭방법이 사용된다.
또한 교잡에 기반한 라이게이션 기술이 miRNA의 정량 분석에 사용될 수 있다.
이러한 방법은 HARP-유사 프로브를 사용한 방법과 같은 표적 핵산 서열에 결합한 검출가능한 프로브를 결합하지 않은 프로브로부터 분리해 내는 방법 등을 포함하나, 이에 제한되는 것은 아니다. 라이게이션을 이용한 다른 기술은 MLPA(Multiplex Ligation-dependent Probe Amplification)을 들 수 있다. 상기 기술은 한 쌍의 프로브가 표적서열에 나란히 결합한 경우에만 라이게이션이 일어나는 방식으로 결합하며, 라이게이션된 프로브는 PCR에 의해 증폭될 수 있도록 프라이머 결합부위를 포함한다.
상술한 바와 같은 교잡, 증폭 및/또는 교잡 기반 라이게이션 반응에서 표적의 염색 또는 표지, 프라이머 또는 프로브의 염색 또는 표지를 통해 교잡 또는 증폭된 miRNA 산물을 검출할 수 있다. 검출에는 당업계의 공지의 기술이 사용될 수 있으며, 당업자라면 검출의 민감도 및/또는 표적의 양을 고려하여 적절한 방법을 선택할 수 있을 것이다. 검출 방법의 민감도 및/또는 표적의 양에 따라 검출 전에 증폭이 필요하지 않을 수도 있다.
또한 miRNA는 직접적 또는 간접적 방법에 의해 검출될 수 있다. 직접적 방법에서 miRNA는 이에 결합된 검출 가능한 표지로 표지되고 이어 비드와 같은 고상지지체에 연결된 프로브에 결합된 후 표지된 miRNA를 스크리닝하여 검출된다. 대안적으로 직접 검출에 표지된 프로브가 사용될 수 있으며, miRNA와 특이적 결합 후 표지된 프로브의 스크리닝을 통해 검출된다. 실시예에서는 증폭된 miRNA는 목적하는 핵산을 캡쳐할 수 있는 프로브와 컨쥬게이션된 비드를 이용하여 검출된다. 다른 실시예에서 프로브는 형광물질로 표지될 수 있다.
본 발명에서는 간접적 검출 방법이 또한 사용될 수 있다. 예를 들면 바이오티닐화 프로브를 스트렙타비딘 컨쥬게이트된 염료를 사용하여 결합된 핵산을 검출할 수 있다. 스트렙타비딘 분자는 증폭된 miRNA의 바이오틴 표지에 결합하며, 결합된 miRNA는 스트렙타비딘에 컨쥬게이트된 염료에 의해 검출된다. 이러한 스트렙타비딘에 컨쥬게이트된 염료는 당업계에 공지되어 있으며 예를 들면 Phycolink(R) Streptavidin R-Phycoerythrin (PROzyme)이 사용될 수 있다.
본 발명에서 검출을 위한 표지자(label)는 이로 제한하는 것은 아니나, 광방출, 광산란, 광흡수 물질과 같은 검출가능한 형광, 화학발광 또는 생발광 신호를 생성 또는 소거할 수 있는 화합물을 포함할 수 있다. 형광 물질은 예를 들면 이로 제한하는 것은 아니나, 플루오레신, 로다민, 벤조페녹사진, 공여체와 수용체를 포함하는 에너지 전이 형광 염료 및 사이아나인, 리사민, 파이코에리쓰린, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham), Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPYR6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, Tetramethylrhodamine, 및/또는 Texas Red는 물론 기타 검출가능한 신호를 생성할 수 있는 임의의 형광 모이어티를 포함한다. 형광염료는 6-carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; 및 2',4',5',7',1,4-hexachlorofluorescein를 포함하나 이로 제한하는 것은 아니다. 실시예에서는 형광 표지로 SYBR-Green, 6-carboxyfluorescein (“FAM”), TET, ROX, VICTM, 또는 JOE가 사용된다. 실시예에서는 리포터 형광물질과 소거형광물질의 두 개의 형광물질로 표지된 프로브가 사용되며, 이 경우 형광물질은 구분이 가능한 파장이 스펙트럼을 방출하는 형광물질이 사용된다.
또한 본 발명에서 표지자는 핵산의 결합을 향상, 안정화 또는 핵산의 결합에 영향을 미칠 수 있는 화합물 예를 들면 에씨디움 브로마이드 및 SYBR-Green을 포함하는 인터칼레이터, 마이너그루브 결합체 및 가교가능한 작용기가 사용될 수 있으나, 이로 제한되는 것은 아니다.
본 발명에서 상기 miRNA 정량은, 예를 들면 miRNA, SYBR-based miRNA RT-qPCR assays, BeadArray, Invader Assays, 및 Padlock probe-based assays를 참조할 수 있다.
본 발명에서 목적하는 개체의 생물학적 시료에 대하여 측정된 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준이 정상 대조군에 비하여 증가된 경우, 비결핵 항산균에 의해 감염되었거나 감염 가능성이 높거나, 또는 감염 질환이 발병하였거나 발병 가능성이 높은 것으로 예측하는 단계를 더 포함할 수 있다.
본 발명의 정보 제공 방법에서 비결핵 항산균의 감염 질환에 관한 정의는 상기 본 발명의 진단용 조성물에 기재된 바와 중복되어 명세서의 과도한 혼잡을 피하기 위해 이하 그 기재를 생략한다.
본 발명에서는 목적하는 개체의 생물학적 시료에 대하여 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 또는 hsa-miR-4732-5p의 발현 수준을 측정함으로써 비결핵 항산균에 의한 감염 또는 감염 질환의 발병 유무 또는 발병 가능성을 간단하고 용이하면서도 정확하게 예측할 수 있다.
도 1은 본 발명의 일 실시예에서 비결핵 항산균에 의한 폐 질환의 마커로 사용될 수 있는 혈청 내 miRNA를 규명하기 위한 실험 설계도를 나타낸 것이다.
도 2는 본 발명의 일 실시예에서 건강한 대조군의 혈청 샘플 내 RNA 길이 별 분포 빈도를 분석한 결과를 그래프로 나타낸 것이다.
도 3은 본 발명의 일 실시예에서 마이코박테리움 아비움(M. avium) 감염성 폐 질환 환자의 혈청 샘플 내 RNA 길이 별 분포 빈도를 분석한 결과를 그래프로 나타낸 것이다.
도 4는 본 발명의 일 실시예에서 마이코박테리움 인트라셀루라레(M. intracellulare) 감염성 폐 질환 환자의 혈청 샘플 내 RNA 길이 별 분포 빈도를 분석한 결과를 그래프로 나타낸 것이다.
도 5는 본 발명의 일 실시예에서 마이코박테리움 압세수스 아종 압세수스(M. abscessus subspecies abscessus) 감염성 폐 질환 환자의 혈청 샘플 내 RNA 길이 별 분포 빈도를 분석한 결과를 그래프로 나타낸 것이다.
도 6은 본 발명의 일 실시예에서 마이코박테리움 압세수스 아종 마실리엔스(M. abscessus subspecies massiliense) 감염성 폐 질환 환자의 혈청 샘플 내 RNA 길이 별 분포 빈도를 분석한 결과를 그래프로 나타낸 것이다.
도 7은 본 발명의 일 실시예에서 건강한 대조군 대비 마이코박테리움 아비움(M. avium) 감염성 폐 질환 환자에서 다르게 발현되는 miRNA 분포를 나타낸 것이다.
도 8은 본 발명의 일 실시예에서 건강한 대조군 대비 마이코박테리움 인트라셀루라레(M. intracellulare) 감염성 폐 질환 환자에서 다르게 발현되는 miRNA 분포를 나타낸 것이다.
도 9는 본 발명의 일 실시예에서 건강한 대조군 대비 마이코박테리움 압세수스 아종 압세수스(M. abscessus subspecies abscessus) 감염성 폐 질환 환자에서 다르게 발현되는 miRNA 분포를 나타낸 것이다.
도 10은 본 발명의 일 실시예에서 건강한 대조군 대비 마이코박테리움 압세수스 아종 마실리엔스(M. abscessus subspecies massiliense) 감염성 폐 질환 환자에서 다르게 발현되는 miRNA 분포를 나타낸 것이다.
도 11은 본 발명의 일 실시예에서 건강한 대조군 대비 각 비결핵 항산균 감염성 폐 질환 환자에게서 다르게 발현되는 miRNA의 수를 나타낸 것이다.
도 12는 본 발명의 일 실시예에서 건강한 대조군 대비 비결핵 항산균 감염성 폐 질환 환자에게서 다르게 발현되는 miRNA의 발현 배수를 나타낸 것이다.
도 13은 본 발명의 일 실시예에서 건강한 대조군과 비결핵 항산균 감염성 폐 질환 환자의 혈청에서 hsa-miR-423-5p의 발현 수준을 비교한 결과를 그래프로 나타낸 것이다.
도 14는 본 발명의 일 실시예에서 건강한 대조군과 비결핵 항산균 감염성 폐 질환 환자의 혈청에서 hsa-miR-484의 발현 수준을 비교한 결과를 그래프로 나타낸 것이다.
도 15는 본 발명의 일 실시예에서 건강한 대조군과 비결핵 항산균 감염성 폐 질환 환자의 혈청에서 hsa-miR-584-5p의 발현 수준을 비교한 결과를 그래프로 나타낸 것이다.
도 16은 본 발명의 일 실시예에서 건강한 대조군과 비결핵 항산균 감염성 폐 질환 환자의 혈청에서 hsa-miR-625-3p의 발현 수준을 비교한 결과를 그래프로 나타낸 것이다.
도 17은 본 발명의 일 실시예에서 건강한 대조군과 비결핵 항산균 감염성 폐 질환 환자의 혈청에서 hsa-miR-4732-5p의 발현 수준을 비교한 결과를 그래프로 나타낸 것이다.
도 18은 본 발명의 일 실시예에서 비결핵 항산균 감염성 폐 질환의 진단에 있어서 hsa-miR-484 바이오마커에 대한 ROC 곡선 분석을 나타낸 것이다.
도 19는 본 발명의 일 실시예에서 비결핵 항산균 감염성 폐 질환의 진단에 있어서 hsa-miR-584-5p 바이오마커에 대한 ROC 곡선 분석을 나타낸 것이다.
도 20은 본 발명의 일 실시예에서 비결핵 항산균 감염성 폐 질환의 진단에 있어서 hsa-miR-625-3p 바이오마커에 대한 ROC 곡선 분석을 나타낸 것이다.
도 21은 본 발명의 일 실시예에서 비결핵 항산균 감염성 폐 질환의 진단에 있어서 hsa-miR-4732-5p 바이오마커에 대한 ROC 곡선 분석을 나타낸 것이다.
도 22는 본 발명의 일 실시예에서 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, 및 hsa-miR-4732-5p의 miRNA-유전자 네트워크를 나타낸 것이다.
도 23은 본 발명의 일 실시예에서 유전자 온톨로지(Gene Ontology; GO)를 사용하여 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, 및 hsa-miR-4732-5p 관련 유전자의 분자 기능을 분석한 결과를 나타낸 것이다.
도 24는 본 발명의 일 실시예에서 KEGG를 사용하여 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, 및 hsa-miR-4732-5p 관련 조절 경로를 분석한 결과를 나타낸 것이다.
본 발명의 일 실시예에서는 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상을 포함하는, 비결핵 항산균의 감염 또는 감염 질환의 바이오마커 조성물을 제공한다.
본 발명의 다른 실시예에서는 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준을 측정하는 제제를 포함하는, 비결핵 항산균의 감염 또는 감염 질환의 진단용 조성물을 제공한다.
본 발명의 또 다른 실시예에서는 본 발명에 따른 진단용 조성물을 포함하는 비결핵 항산균의 감염 또는 감염 질환의 진단용 키트를 제공한다.
본 발명의 또 다른 실시예에서는 목적하는 개체로부터 분리된 생물학적 시료에서 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준을 측정하는 단계를 포함하는 비결핵 항산균의 감염 또는 감염 질환을 진단하기 위한 정보 제공 방법을 제공한다.
이하, 본 발명을 하기의 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
실시예
조사 모집단(Study population)
삼성서울병원(ClinicalTrials.gov identifier: NCT00970801)에서 비결핵 항산균에 의한 폐 질환으로 새롭게 진단받은 환자의 혈청을 스크리닝하였다. 비결핵 항산균에 의한 폐 질환 특이적 miRNA를 규명하기 위하여, miRNA 발현에 영향을 미칠 수 있는 다른 질환으로 만성 내과 질환 또는 암이 발병한 환자는 본 실험에서 제외하였다. 이에 따라 마이코박테리움 아비움(M. avium), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 압세수스 아종 압세수스(M. abscessus subspecies abscessus) 및 마이코박테리움 압세수스 아종 마실리엔스(M. abscessus subspecies massiliense) 각각에 감염된 13명 환자씩, 비결핵 항산균에 의한 폐 질환 진단 기준에 부합하는 총 52명의 환자군을 선별하였다. 건강한 대조군으로는 동반 질병(comorbidity)이 없는 43명의 병원 근무자를 선별하였다. 각 개체군에서 수득한 혈청은 원심분리하여 -80 ℃에서 보관하였다. 본 실험에서는 비결핵 항산균에 의한 폐 질환의 마커로 사용될 수 있는 혈청 내 miRNA를 규명하기 위하여 도 1에 나타낸 바와 같이 4단계로 실험을 수행하였다. 가장 먼저, 발견 단계(discovery phase)에서는, 비결핵 항산균 폐 질환이 발병한 환자와 건강한 대조군에서 다른 양상으로 발현되는 miRNA를 선별하기 위하여 Illumina 소형 RNA 시퀀싱을 이용해 스크리닝을 수행하였다. 본 단계에서는 miRNA 프로파일을 얻기 위하여 각 균주 별 3명의 감염 환자 샘플과 건강한 대조군 3명 샘플을 합쳐서 총 15개의 혈청 시료를 테스트하였다. 비결핵 항산균 폐 질환이 발병한 환자에게서 다른 발현을 보이는 miRNA와 4가지 균주에 의해 유발되는 폐 질환에서 공통적으로 발현되는 miRNA의 패널을 이용하여 이후의 qRT-PCR을 수행하였다.
RNA 추출
miRNeasy Mini 키트(Qiagen, Hilden, Germany)를 사용하여 혈청 샘플로부터 총 RNA를 분리하고, 각 샘플은 RNase-free water로 녹여 분리하였다. NanoDropTM ND-2000 (Thermo Fisher Scientific, Waltham, MA, USA)를 이용하여 RNA 정량 및 순도를 측정하고, Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA)를 사용하여 RNA 완전도(integrity)를 측정하였다. RNA 샘플은 -80 ℃에서 보관하였다.
Illumina 고처리량 시퀀싱(Illumina high-throughput sequencing)
NEXTFlex Small RNA Library Prep Kit (Illumina, San Diego, CA, USA)를 사용하여 small RNA 라이브러리를 설계하였다. 간단히, RNA 시퀀싱 라이브러리는 cDNA 증폭(cDNA amplification), 말단-수선(end-repair), 3' 말단의 아데닐화(adenylylation of 3' ends), 어뎁터 라이게이션(adapter ligation) 및 증폭(amplification)에 의해 준비하였다. 50-염기 쌍 싱글 리드(50-base pair single reads)로 HiSeq 2500 system (Illumina)를 사용하여 라이브러리를 시퀀싱하였다.
소형 RNA 시퀀싱 데이터 분석
FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc)를 이용하여 리드 데이터를 평가하고 전-작업을 수행하였으며, 3' 말단으로부터 낮은 품질의 염기를 잘라내었다. 어뎁터 시퀀스를 잘라내었고, 17개의 핵산 보다 작은 리드는 제거하였다. Bowtie를 이용하여 잘라낸 리드는 레퍼런스 게놈(GRCH38/hg19)에 맵핑되었다. 맵핑된 리드의 분포를 miRBase (http://www.mirbase.org/), Ensembl 주석(annotations) 및 Rfam 데이터베이스 (http://rfam.xfam.org/)로 분석하였다. 모든 샘플에서 신규한 miRNA를 예측하고 각 miRNA의 리드 카운트를 요약하기 위하여 miRDeep2 프로그램 (https://www.mdc-berlin.de/content/mirdeep2-documentation)를 이용해 알려진 miRNA를 규명하였다. 역치 배수가 2배 이상이고, p-value가 0.05 미만인 경우 miRNA가 다르게 발현된다고 판단하였다. 단, p-value는 R 패키지(package)에서 DESeq 알고리즘(algorithm)을 사용하여 계산하였다.
qRT-PCR을 이용한 miRNA의 정량화
Taq-Man miRNA 역전사 키트(Applied Biosystems, Foster City, CA, USA) 및 miRNA-특이 스템-루프 프라이머(miRNA-specific stem-loop primers)를 이용하여 역전사 반응을 수행하였다. qRT-PCR을 위한 각 반응 혼합물은, AmpErase UNG가 없는 2Х TaqMan Universal PCR Master Mix 2.5 μL, miRNA-특이 프라이머/프로브 혼합물 0.25 μL, 및 희석된 RT 산물 2.25 μL을 포함하였다. 반응은 95 ℃에서 10분, 95 ℃에서 15 초 동안 40 사이클, 60 ℃에서 1분 동안 수행한 뒤, 4 ℃에서 유지하였다. SDS 상대적 정량 소프트웨어 버전 2.2.3 (Applied Biosystems)을 이용하여 로우 데이터를 분석하였다. 각 타겟 miRNA의 발현 수준은 miR-16 (internal control)로 표준화하였다.
miRNA-유전자 네트워크 설계
얻어진 miRNA에 의해 타겟 설정된 유전자를 예측하기 위하여 TargetScan (http://genes.mit.edu/targetscan/index.ht ml)을 사용하였다. NCBI 데이터베이스 (http://www.ncbi. nlm.nih.gov/pubmed/) 및 Cytoscape (Cytoscape Software, Version 2.8.2, Seattle, WA, USA)를 사용하여 비결핵 항산균 감염 폐 질환과 관련된 타겟 유전자를 스크리닝하였다. Cytoscape를 사용하여 miRNA 유전자 네트워크를 설계하고 miRNA-miRNA 사이 상관 관계를 분석하였다. 타겟 유전자의 분자적 기능은 Gene Ontology (http://www.geneontology.org/) 및 Kyoto Encyclopedia of Genes and Genomes (http://www.genome.jp/kegg/)을 이용하여 예측하였다.
통계적 분석
데이터는 범주 변수(categorical variables)에 대하여는 수(%)로 나타내었고, 연속 변수(continuous variables)에 대하여는 중앙값(사분 범위)로 나타내었다. 데이터는 SPSS 소프트웨어, 버전 17.0 (SPSS, Inc., Chicago, IL, USA) 또는 그 내부에 세워진 프로그램을 이용하여 통계적으로 분석하였다. 각 군 간의 비교를 위해서 양쪽 꼬리 비대응 t-검정(two-tailed unpaired t-tests)을 수행하였고, 다군 간의 비교를 위해서 일원 분산 분석(one-way analysis of variance)을 수행하였다. miRNA의 구별 요소를 평가하기 위하여 ROC(Receiver operating characteristic) 커브 분석을 수행하였다. Prism Graph 소프트웨어, 버전 5.01 (GraphPad, Inc., La Jolla, CA, USA) 내 통계적 테스트를 사용하여 특이도 및 민감도를 결정하기 위해 95% CI(confidence interval)로, AUC(areas under the curves)를 계산하였다. SPSS 소프트웨어를 이용하여 이원 논리주의적 회귀 분석(binary logistic regression analyses)을 수행하였다. p < 0.05인 경우 통계적 유의성이 있다고 보았다.
환자
본 실험을 위하여, 하기 표 2와 같이 비결핵 항산균 감염성 폐 질환 환자 52명과 건강한 정상 대조군 43명으로, 총 95명이 참가하였다. 환자의 중앙 나이는 56세이고, 45명(87%)가 여성이었다. 52명 환자군의 중앙 체질량 지수는 20.8 kg/m2이고, 46명의 환자군(89%)가 흡연한 경험이 없었다. 비결핵 항산균 폐 질환 환자 사이에서 가장 흔한 호흡기 질환은 기관지 확장증(n = 48, 92%)이고, 다음으로 과거 결핵 치료 경험(n = 17, 33%)이었다. 43명의 건강한 대조군에서 중앙 나이는 48세이고, 29명(67%)이 여성이었다.
특징 NTM-PD(n = 52) 건강한 대조군(n = 43)
나이 (years) 56 (50-62) 48 (40-56 )
여성 45 (87) 29 (67)
체질량 지수 (kg/m2) 20.8 (19.0-22.5) NA
흡연 경험 없음 46 (89) INA
병인체(Etiologic organism) INA
M. avium 13 (25) -
M. intracellulare 14 (27) -
M. abscessus 13 (25) -
M. massiliense 12 (23) -
수반 질환
기관지 확장증 48 (92) -
과거 결핵 치료 17 (33) -
과거 흉부 수술 1 (2) -
만성 심장 질환 1 (2) -
만성 간 질환 1 (2) -
데이터는 수(%) 또는 중앙값(사분범위)로 나타내었다. NTM-PD는 비결핵 항산균 폐 질환 환자를 의미하고, INA는 정보 없음을 의미한다.
Illumina-기반 혈청 miRNA의 소형 RNA 시퀀싱
마이코박테리움 아비움(M. avium), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 압세수스 아종 압세수스(M. abscessus subspecies abscessus) 및 마이코박테리움 압세수스 아종 마실리엔스(M. abscessus subspecies massiliense) 각각에 감염된 환자 3명씩 총 12명의 환자와 3명의 건강한 대조군으로부터 발견 단계(discovery phase)에서 Illumina 소형 RNA 시퀀싱을 이용하여 miRNA의 혈청 수준을 확인하였다. 비결핵 항산균 폐 질환 환자와 건강한 대조군의 혈청 샘플로부터 18개 내지 30개 핵산 범위의 RNA로, 각각 11,217,363 및 18,556,427 리드 평균을 얻었다. 레퍼런스 게놈에서 서열(clean sequences)의 길이 분포를 결정하였다. 비결핵 항산균 감염성 폐 질환 환자와 건강한 대조군의 혈청 샘플의 길이 분포 분석에 따라 대부분의 리드는, 보통의 miRNA 길이에 해당하는 18개 내지 24개의 핵산 길이를 나타내었다. 비결핵 항산균 감염성 폐 질환 환자와 건강한 대조군의 혈청 샘플은 다양한 길이의 소형 RNA를 포함하고 있었다(도 2 내지 6). 이에 따라 소형 RNA의 종류와 시퀀싱 빈도(sequencing frequencies)를 확인하기 위하여 생물정보학 분석(bioinformatics analysis)을 수행하였다.
그 결과, 비결핵 항산균 감염성 폐 질환 환자와 건강한 대조군의 혈청 샘플에는, miRNA, 긴 유전자간 넌코딩 RNA(long intergenic noncoding RNA), 리보솜 RNA, 소핵소체 RNA(small nucleolar RNA) 및 소핵 RNA(small nuclear RNA) 등 다양한 소형 RNA 종류가 확인되었다(표 3). 비결핵 항산균 감염성 폐 질환 환자와 건강한 대조군의 혈청 샘플에서 총 소형 RNA(시퀀싱 리드) 중 miRNAs는 각각 39.7% 및 44.5%로 계산되었고, 두 군 간의 유의적 차이점을 발견할 수 없었다. 이에 따라, mirDeep 소프트웨어를 이용하여 모든 리드를 분석하여 알려졌거나 신규한 miRNA가 존재하는 지 확인하였다. 비결핵 항산균 감염성 폐 질환 환자와 건강한 대조군으로부터 각각 467개 및 407개의 알려진 miRNA가 확인되었다(표 3). 신규한 miRNA 전구체의 경우 비결핵 항산균 폐 질환 환자에서 대략 262개, 건강한 대조군에서 193개 확인되었다(표 2).
148개의 miRNA 중 70개의 miRNA는 건강한 대조군 대비 마이코박테리움 아비움(M. avium) 감염성 폐 질환 환자에서 유의적 발현 수준의 차이를 보였고, 56개의 miRNA는 마이코박테리움 인트라셀루라레(M. intracellulare) 감염성 폐 질환 환자에서 유의적 발현 수준의 차이를 보였으며, 46개의 miRNA는 마이코박테리움 압세수스 아종 압세수스(M. abscessus subspecies abscessus) 감염성 폐 질환 환자에게서 유의적 발현 수준의 차이를 보였고, 32개의 miRNA는 마이코박테리움 압세수스 아종 마실리엔스(M. abscessus subspecies massiliense) 감염성 폐 질환 환자에게서 유의적 발현 수준의 차이를 보였다(도 7 내지 10). 하지만, 14개의 miRNA 만이 상기 4개 균주 감염성 폐 질환 환자에게서 공통적으로 건강한 대조군 대비 유의적 발현 수준의 차이를 보였다(도 11 및 12).
구분 NTM-PD 건강한 대조군
총 리드(total reads) 11,217,363 18,556,427
전구체 miRNA 리드(precursor miRNA reads) 3,445 8,444
성숙된 miRNA 리드(mature miRNA reads) 7,250,677 5,265,841
알려진 miRNA의 수 467 407
신규한 miRNA의 수 262 193
게놈-맵핑된 시퀀스 리드의 분포
miRNA 3,517,419 (39.7) 3,083,932 (44.5)
lincRNA 2,397,431 (27.0) 1,655,179 (23.9)
rRNA 10,857 (0.1) 6,326 (0.1)
snoRNA 8,987 (0.1) 5,626 (0.1)
snRNA 25,265 (0.3) 20,821 (0.3)
기타 2,924,390 (32.8) 2,164,554 (31.2)
데이터는 수(%)로 나타내었고, NTM-PD는 비결핵 항산균 감염 폐질환 환자를 의미하며, miRNA는 microRNA, lincRNA는 long intergenic noncoding RNA, rRNA는 ribosomal RNA, snoRNA는 small nucleolar RNA, snRNA는 small nuclear RNA를 의미한다.
qRT-PCR 분석을 통한 miRNA의 다른 발현 확인
건강한 대조군 대비 4개 균주 감염성 폐 질환 환자에게서 다른 발현 패턴을 보이는 14개의 miRNA를 잠재적 바이오마커로 간주하고, 그 발현 수준을 qRT-PCR로 확인하였다. 선별 단계(selection phase)에 있어, 4개 균주 별 감염된 폐 질환 환자 12명과 건강한 대조군 3명의 각 혈청 샘플로부터 14개의 miRNA의 발현 수준을 확인하였다. 건강한 대조군 대비 비결핵 항산균 감염성 폐 질환 환자의 샘플에서 평균 발현 수준이 2배 이상 증가하고, p-values가 0.05 미만인 miRNA를 선별하였다. 그 결과, 14개의 miRNA 후보군 중에서 hsa-miR-423-5p, hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p의 5개의 miRNA가 비결핵 항산균 감염성 폐 질환 환자와 건강한 대조군 사이 발현 수준에 유의적으로 차이가 있는 것을 확인할 수 있었다(도 13 내지 17). 이후, 비결핵 항산균 감염성 폐 질환 환자 40명(각 균주 별 10명씩)과 건강한 대조군 40명에 대하여 상기 5개의 miRNA의 발현 수준의 차이를 정량하기 위하여 qRT-PCR 기반 검증을 수행하였다. hsa-miR-423-5p (p = 0.116)를 제외하고, hsa-miR-484(p = 0.015), hsa-miR-584-5p(p = 0.001), hsa-miR-625-3p(p = 0.002), 및 hsa-miR-4732-5p(p = 0.014) 4개의 miRNA에 있어서 건강한 대조군 대비 비결핵 항산균 감염성 폐 질환 환자의 혈청에서 유의적으로 높은 발현 수준을 보였다(도 13 내지 17).
5개의 miRNA에 대한 ROC 커브 분석
비결핵 항산균 감염 폐 질환 환자 40명과 건강한 대조군 40명으로부터 얻은 검증 데이터를 사용하여 ROC 커브 분석을 수행하였다. ROC 커브는 두 군 간의 5개의 miRNA의 상대적 발현 수준을 비교할 수 있도록 설계하였고, AUC 값은 다음과 같이 확인되었다: hsa-miR-423-5p, 0.589 (p = 0.188, 95% CI = 0.457-0.720); hsa-miR-484, 0.741 (p = 0.0002, 95% CI = 0.628-0.855); hsa-miR-584-5p, 0.712 (p = 0.002, 95% CI = 0.593-0.830); hsa-miR-625-3p, 0.773 (p < 0.0001, 95% CI = 0.666-0.880); 및 hsa-miR-4732-5p, 0.892 (p < 0.0001, 95% CI = 0.812-0.973) (도 18 내지 21). 이를 통해 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p는 건강한 대조군 대비 비결핵 항산균 감염 폐 질환 환자를 구분하는 바이오마커로 사용될 수 있음을 알 수 있었다.
miRNA-유전자 네트워크의 설계
상기 miRNA의 추정적 기능을 조사하기 위하여, TargetScan 데이터베이스 (http://targetscan.org)를 사용하였다. 또한, Database for Annotation, Visualization, and Integrated Discovery (http://david.abcc.ncifcrf.gov/)를 사용하여 보존된 타겟과 관련된 생화학적 경로를 확인하였다. 도 23은 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, 및 hsa-miR-4732-5p의 miRNA-유전자 네트워크를 나타낸 것으로, 이들 4개의 miRNA는 TargetScan 데이터베이스에서 각각 4231, 2268, 2475, 및 2242 타겟 mRNA와 연관성이 있었다. 이러한 유전자 중에서, 결핵과 관련된 9개의 유전자를 포함하여 총 125개의 유전자가 4개의 miRNA에 의해 공통적으로 타겟이 되는 것을 알 수 있었다(도 22 내지 24). 예를 들어, hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p, 및 hsa-miR-4732-5p 모두 NFAT5(nuclear factor of activated T cells 5) 및 TLR4(Toll-like receptor 4)를 타겟으로 하였으며, hsa-miR-484, hsa-miR-584-5p, 및 hsa-miR-4732-5p는 인터루킨 6(interleukin 6; IL-6)를 타겟으로 하였고, hsa-miR-484 및 hsa-miR-625-3p는 인터루킨 17(interleukin 17; IL-17)을 타겟으로 하였다. 또한, hsa-miR-484는 CD40 및 CD40 리간드를 타겟으로 하였고, hsa-miR-625-3p는 T 세포 활성화를 중재하는 코리셉터(coreceptor)인 CD28을 타겟으로 하였다.
유전자 온톨로지(Gene Ontology; GO)를 사용하여 125개의 유전자를 분석하였고, 분자 기능에 기반한 데이터베이스(도 23), Kyoto Encyclopedia of Genes and Genomes (KEGG), 조절 경로 데이터베이스(도 24)는 대부분의 전사 조절자 활성과 단백질 결합 기능으로 코딩된 단백질은 세포 성장, 이동 증식, Hippo 신호, Wnt 신호, p53 신호 및 TGF-β(transforming growth factor β) 신호와 연관성이 있는 것을 볼 수 있었다.
본 발명에서는 목적하는 개체의 생물학적 시료에 대하여 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 또는 hsa-miR-4732-5p의 발현 수준을 측정함으로써 비결핵 항산균에 의한 감염 또는 감염 질환의 발병 유무 또는 발병 가능성을 간단하고 용이하면서도 정확하게 예측할 수 있다.
서열번호 1: hsa-miR-484
UCAGGCUCAGUCCCCUCCCGAU
서열번호 2: hsa-miR-584-5p
UUAUGGUUUGCCUGGGACUGAG
서열번호 3: hsa-miR-625-3p
AGGGGGAAAGUUCUAUAGUCC
서열번호 4: hsa-miR-4732-5p
UGUAGAGCAGGGAGCAGGAAGCU

Claims (15)

  1. hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상을 포함하는, 비결핵 항산균의 감염 또는 감염 질환의 바이오마커 조성물.
  2. 제1항에 있어서,
    상기 비결핵 항산균은 마이코박테리움 아비움(M. avium), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 플라베센스(M. flavescence), 마이코박테리움 아프리카눔(M. africanum), 마이코박테리움 보비스(M. bovis), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 가스트리(M. gastri), 마이코박테리움 헤모필룸(M. haemophilum), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 테레(M. terrae), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 울서란스(M. ulcerans), 마이코박테리움 시미애(M. simiae) 및 마이코박테리움 제노피(M. xenopi)로 구성된 군으로부터 선택되는, 바이오마커 조성물.
  3. 제1항에 있어서,
    상기 비결핵 항산균 감염 질환은 비결핵 항산균 감염에 의한 폐 질환, 림프절염, 피부·연조직·골감염증 또는 파종성 질환인, 바이오마커 조성물.
  4. hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준을 측정하는 제제를 포함하는, 비결핵 항산균의 감염 또는 감염 질환의 진단용 조성물.
  5. 제4항에 있어서,
    상기 발현 수준을 측정하는 제제는 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상인, 진단용 조성물.
  6. 제4항에 있어서,
    상기 비결핵 항산균은 마이코박테리움 아비움(M. avium), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 플라베센스(M. flavescence), 마이코박테리움 아프리카눔(M. africanum), 마이코박테리움 보비스(M. bovis), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 가스트리(M. gastri), 마이코박테리움 헤모필룸(M. haemophilum), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 테레(M. terrae), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 울서란스(M. ulcerans), 마이코박테리움 시미애(M. simiae) 및 마이코박테리움 제노피(M. xenopi)로 구성된 군으로부터 선택되는, 진단용 조성물.
  7. 제4항에 있어서,
    상기 비결핵 항산균 감염 질환은 비결핵 항산균 감염에 의한 폐 질환, 림프절염, 피부·연조직·골감염증 또는 파종성 질환인, 진단용 조성물.
  8. 제4항 내지 제7항 중 어느 한 항의 진단용 조성물을 포함하는 비결핵 항산균의 감염 또는 감염 질환의 진단용 키트.
  9. 목적하는 개체로부터 분리된 생물학적 시료에서 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준을 측정하는 단계를 포함하는 비결핵 항산균의 감염 또는 감염 질환을 진단하기 위한 정보 제공 방법.
  10. 제9항에 있어서,
    상기 생물학적 시료는 전혈(whole blood), 백혈구(leukocytes), 말초혈액 단핵 세포(peripheral blood mononuclear cells), 백혈구 연층(buffy coat), 혈장(plasma), 혈청(serum), 객담(sputum), 눈물(tears), 점액(mucus), 세비액(nasal washes), 비강 흡인물(nasal aspirate), 호흡(breath), 소변(urine), 정액(semen), 침(saliva), 복강 세척액(peritoneal washings), 복수(ascites), 낭종액(cystic fluid), 뇌척수막 액(meningeal fluid), 양수(amniotic fluid), 선액(glandular fluid), 췌장액(pancreatic fluid), 림프액(lymph fluid), 흉수(pleural fluid), 유두 흡인물(nipple aspirate), 기관지 흡인물(bronchial aspirate), 활액(synovial fluid), 관절 흡인물(joint aspirate), 기관 분비물(organ secretions), 세포(cell), 세포 추출물(cell extract) 및 뇌척수액(cerebrospinal fluid) 등으로 이루어진 군에서 선택된 1종 이상인, 정보 제공 방법.
  11. 제9항에 있어서,
    상기 발현 수준을 측정하는 단계는 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상을 사용하여 수행되는, 정보 제공 방법.
  12. 제9항에 있어서,
    상기 발현 수준을 측정하는 단계는 RT-PCR, 경쟁적 RT-PCR (competitive RT-PCR), 실시간 RT-PCR (Real-time RT-PCR), RNase 보호 분석법 (RPA: RNase protection assay), 노던 블랏팅 (Northern blotting), DNA를 포함한 핵산 마이크로어레이 또는 그 조합을 이용하여 수행되는, 정보 제공 방법.
  13. 제9항에 있어서,
    상기 목적하는 개체의 생물학적 시료에 대하여 측정된 상기 hsa-miR-484, hsa-miR-584-5p, hsa-miR-625-3p 및 hsa-miR-4732-5p로 이루어진 군에서 선택된 1종 이상의 발현 수준이 정상 대조군에 비하여 증가된 경우, 비결핵 항산균에 의해 감염되었거나 감염 가능성이 높거나, 또는 감염 질환이 발병하였거나 발병 가능성이 높은 것으로 예측하는 단계를 더 포함하는, 정보 제공 방법.
  14. 제9항에 있어서,
    상기 비결핵 항산균은 마이코박테리움 아비움(M. avium), 마이코박테리움 압세수스(M. abscessus), 마이코박테리움 플라베센스(M. flavescence), 마이코박테리움 아프리카눔(M. africanum), 마이코박테리움 보비스(M. bovis), 마이코박테리움 첼로네(M. chelonae), 마이코박테리움 셀라툼(M. celatum), 마이코박테리움 포르투이툼(M. fortuitum), 마이코박테리움 고르도네(M. gordonae), 마이코박테리움 가스트리(M. gastri), 마이코박테리움 헤모필룸(M. haemophilum), 마이코박테리움 인트라셀루라레(M. intracellulare), 마이코박테리움 칸사시이(M. kansasii), 마이코박테리움 말모엔스(M. malmoense), 마이코박테리움 마리눔(M. marinum), 마이코박테리움 스줄가이(M. szulgai), 마이코박테리움 테레(M. terrae), 마이코박테리움 스크로풀라세움(M. scrofulaceum), 마이코박테리움 울서란스(M. ulcerans), 마이코박테리움 시미애(M. simiae) 및 마이코박테리움 제노피(M. xenopi)로 구성된 군으로부터 선택되는, 정보 제공 방법.
  15. 제9항에 있어서,
    상기 비결핵 항산균 감염 질환은 비결핵 항산균 감염에 의한 폐 질환, 림프절염, 피부·연조직·골감염증 또는 파종성 질환인, 정보 제공 방법.
PCT/KR2020/014450 2019-10-24 2020-10-22 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물 WO2021080335A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0132918 2019-10-24
KR1020190132918A KR102276224B1 (ko) 2019-10-24 2019-10-24 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물

Publications (1)

Publication Number Publication Date
WO2021080335A1 true WO2021080335A1 (ko) 2021-04-29

Family

ID=75619330

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/014450 WO2021080335A1 (ko) 2019-10-24 2020-10-22 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물

Country Status (2)

Country Link
KR (1) KR102276224B1 (ko)
WO (1) WO2021080335A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102596057B1 (ko) 2021-11-05 2023-11-01 연세대학교 산학협력단 마이코박테리움 아비움 복합체 감염질환 진단용 지질대사체 마커

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017143810A (ja) * 2016-02-19 2017-08-24 学校法人慶應義塾 抗酸菌症又は抗酸菌感染のバイオマーカー
CN110205378A (zh) * 2019-07-02 2019-09-06 宁夏医科大学总医院 一组脊柱结核血浆miRNA联合诊断标记物及其应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3026121A1 (en) * 2014-11-27 2016-06-01 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Micro-RNA-based diagnosis of tuberculosis

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017143810A (ja) * 2016-02-19 2017-08-24 学校法人慶應義塾 抗酸菌症又は抗酸菌感染のバイオマーカー
CN110205378A (zh) * 2019-07-02 2019-09-06 宁夏医科大学总医院 一组脊柱结核血浆miRNA联合诊断标记物及其应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ALIPOOR SHAMILA D., MORTAZ ESMAEIL, TABARSI PAYAM, FARNIA PARISSA, MIRSAEIDI MEHDI, GARSSEN JOHAN, MOVASSAGHI MASOUD, ADCOCK IAN M: "Bovis Bacillus Calmette–Guerin (BCG) infection induces exosomal miRNA release by human macrophages", JOURNAL OF TRANSLATIONAL MEDICINE, vol. 15, no. 1, 1 December 2017 (2017-12-01), pages 1 - 9, XP055805404, DOI: 10.1186/s12967-017-1205-9 *
NISHIMURA TOMOYASU, TAMIZU EIKO, UNO SHUNSUKE, UWAMINO YOSHIFUMI, FUJIWARA HIROSHI, NISHIO KAZUMI, NAKANO YASUSHI, SHIONO HIROFUMI: "hsa-miR-346 is a potential serum biomarker of Mycobacterium avium complex pulmonary disease activity", JOURNAL OF INFECTION AND CHEMOTHERAPY, CHURCHILL LIVINGSTONE, TOKYO,, JP, vol. 23, no. 10, 1 October 2017 (2017-10-01), JP, pages 703 - 708, XP055805411, ISSN: 1341-321X, DOI: 10.1016/j.jiac.2017.07.015 *
SOARES CLEVERSON T., TROMBONE ANA P. F., FACHIN LUCIANA R. V., ROSA PATRICIA S., GHIDELLA CÁSSIO C., RAMALHO RODRIGO F., PINILLA M: "Differential Expression of MicroRNAs in Leprosy Skin Lesions", FRONTIERS IN IMMUNOLOGY, vol. 8, no. 1035, pages 1 - 10, XP055805416, DOI: 10.3389/fimmu.2017.01035 *

Also Published As

Publication number Publication date
KR20210048794A (ko) 2021-05-04
KR102276224B1 (ko) 2021-07-12

Similar Documents

Publication Publication Date Title
US11414705B2 (en) Salivary biomarkers of brain injury
US9951387B2 (en) Methods for detection of depressive disorders
US20210222256A1 (en) Pancreatic cancer
JP2011510650A (ja) 敗血症性ショックの間に死亡する危険が高い患者を迅速に決定する方法及びキット
TWI804857B (zh) 大腸直腸癌的早期檢測、預測治療反應和預後之方法
WO2014163445A1 (ko) 위암에 대한 예후 예측 모형의 제조방법
WO2021080335A1 (ko) 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물
KR102096498B1 (ko) 대장암 진단 또는 재발 예측을 위한 마이크로RNA-4732-5p 및 이의 용도
WO2023210997A1 (ko) 위암 발병의 위험도를 예측하기 위한 조성물 및 이를 이용한 방법
US10704089B1 (en) DNA methylation assays for body fluid identification
WO2017007275A1 (ko) 코 표현형 판단용 조성물
CN111100924B (zh) 一种用于检测fmr1基因cgg重复数的质控品及其应用和含有该质控品的试剂盒
KR102096499B1 (ko) 대장암 진단 또는 재발 예측을 위한 마이크로rna-3960 및 이의 용도
KR20110034297A (ko) 내인성 아토피 피부염 진단용 마커 및 그의 용도
WO2022103025A1 (ko) 자궁경부암의 조기 진행 진단용 바이오 마커 및 이의 용도
LU102676B1 (en) A Biomarker for Severe Asthma and Application Thereof
WO2020116838A1 (ko) 운동 민감도 예측용 조성물, 키트, 및 이를 이용한 방법
WO2022124564A1 (ko) 마이크로rna를 이용한 당뇨병성 신경병증의 예측 및 진단 방법 및 이를 위한 키트
WO2023063775A1 (ko) Mir-625-3p의 건선 중증도 진단용 바이오마커로서의 용도
WO2022103026A1 (ko) 자궁경부암의 전이 진단용 바이오 마커 및 이의 용도
WO2022103027A1 (ko) 자궁경부암의 급성 종양 반응 진단용 바이오 마커 및 이의 용도
KR20190113108A (ko) 대장암 진단 또는 재발 예측을 위한 마이크로rna-3656 및 이의 용도
KR20190113100A (ko) 대장암 진단 또는 재발 예측을 위한 마이크로RNA-320c 및 이의 용도
CN112813168B (zh) 一种与口腔鳞癌相关的生物标志物
KR20230037111A (ko) 대사증후군 특이적 후성유전 메틸화 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20880278

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20880278

Country of ref document: EP

Kind code of ref document: A1