WO2023063775A1 - Mir-625-3p의 건선 중증도 진단용 바이오마커로서의 용도 - Google Patents

Mir-625-3p의 건선 중증도 진단용 바이오마커로서의 용도 Download PDF

Info

Publication number
WO2023063775A1
WO2023063775A1 PCT/KR2022/015595 KR2022015595W WO2023063775A1 WO 2023063775 A1 WO2023063775 A1 WO 2023063775A1 KR 2022015595 W KR2022015595 W KR 2022015595W WO 2023063775 A1 WO2023063775 A1 WO 2023063775A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
psoriasis
expression level
biomarker
diagnosing
Prior art date
Application number
PCT/KR2022/015595
Other languages
English (en)
French (fr)
Inventor
이은소
박영준
김동찬
박지영
Original Assignee
아주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단 filed Critical 아주대학교산학협력단
Publication of WO2023063775A1 publication Critical patent/WO2023063775A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to the use of miR-625-3p as a biomarker for diagnosing severity of psoriasis, and more particularly, to a composition for diagnosing psoriasis severity or a kit for diagnosing severity of psoriasis, including a substance for detecting miR-625-3p biomarker, and the miR It relates to a method for diagnosing psoriasis severity-severe using -625-3p as a biomarker.
  • Psoriasis is a relatively common skin inflammatory disease, which occurs in 1-3% of the population, and is a disease that requires long-term treatment by repeating improvement and exacerbation after onset at a young age. It has been reported that arthritis is induced in about 10% of patients with psoriasis, and it has also been reported to be associated with cardiovascular disease and metabolic syndrome.
  • PASI psoriasis area severity index
  • BSA body surface area
  • Exosomes are the smallest (30-120 nm) extracellular vesicles and contain various biomolecules such as microRNA (miRNA), nucleic acids, and proteins that enable cell-to-cell communication.
  • miRNA microRNA
  • the stable lipid bilayer of exosomes prevents degradation of biomolecules.
  • damaged keratinocytes can secrete exosomes, and psoriatic keratinocytes secrete exosomes due to excessive inflammation and abnormal differentiation (ACS nano. 2020;14(10):12732-48; Cell death & disease 2022;13(1):1-13).
  • miRNA is a small-sized non-coding RNA (20-25 nucleotides) known to play a role in regulating gene expression. miRNA is involved in the proliferation and activation of T cells and is differentially expressed in psoriasis patients compared to healthy controls. (Biomedical reports. 2018;9(5):367-74). Circulating exosomal miRNAs have been used as potential biomarkers reflecting disease activity for diseases such as cancer, hepatitis, dermatomyositis, and neurodegenerative diseases, as they are known to correlate with disease with remarkable stability.
  • miRNAs there are more than 250 differentially expressed miRNAs in the skin or blood of psoriasis patients, but since miRNAs are small single-stranded non-coding RNA molecules that are vulnerable to external stimulation and degradation, miRNAs are used to diagnose psoriasis patients. had limitations.
  • miRNAs in circulating exosomes could be used for diagnosing psoriasis as a relatively stable biomarker. Efforts were made to invent markers, and as a result, miR-625-3p expression in circulating exosomes was not only expressed at a significantly high level in psoriasis, but also miR-625-3p expression level faithfully correlated with psoriasis disease severity. The present invention was completed by confirming the reflection.
  • An object of the present invention is to provide a novel biomarker capable of accurately diagnosing the severity of psoriasis.
  • composition for diagnosing psoriasis disease severity comprising the present miR-625-3p biomarker detecting substance.
  • the detection material may include at least one of a primer, a probe, and an antisense nucleotide specifically binding to the miR-625-3p biomarker.
  • the composition may be characterized in that it further comprises a substance for detecting the miR-4488 biomarker and/or a substance for detecting the miR-342-3p biomarker.
  • the detection substance may include at least one of a primer, a probe, and an antisense nucleotide that specifically binds to the miR-4488 biomarker and/or the miR-342-3p biomarker. there is.
  • the present invention also provides the use of the miR-625-3p biomarker for diagnosing the severity of psoriasis.
  • the present invention also provides the use of the miR-625-3p biomarker for the preparation of a reagent for diagnosing the severity of psoriasis.
  • the present invention also provides a method for diagnosing severity of psoriasis comprising measuring the expression level of the miR-625-3p biomarker in a subject in need of diagnosis of severity of psoriasis.
  • the present invention also provides a kit for diagnosing the severity of psoriasis, including the composition.
  • the present invention also includes (a) measuring the expression level of miR-625-3p in a sample isolated from a patient; and
  • the expression level of miR-625-3p is measured using reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip can be done with
  • the sample may be a tissue, cell, blood or serum sample.
  • the sample may be characterized in that it includes exosomes isolated from tissue, cell, blood or serum.
  • the information providing method is moderate-severe when the expression level of miR-625-3p is increased by about 3.46 times or more compared to the expression level of miR-625-3p in mild psoriasis samples. to severe) psoriasis.
  • step (a) further measures the expression level of miR-4488 and/or miR-342-3p in samples isolated from the patient,
  • the miR-4488 expression level is compared with the miR-4488 expression level of the mild psoriasis sample and/or the miR-342-3p expression level is compared with the miR-342-3p expression level of the mild psoriasis sample. It can be characterized by comparison.
  • the information providing method is performed when the miR-4488 expression level is increased by about 2.375 times or more compared to the miR-4488 expression level of the mild psoriasis sample and/or
  • the diagnosis of moderate-severe psoriasis may be characterized.
  • the expression level of miR-4488 and/or miR-342-3p is determined by reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip. It can be characterized by being measured using.
  • the biomarker for diagnosing psoriasis can objectively diagnose psoriasis at an early stage at the molecular level and accurately determine the severity of psoriasis disease, thereby increasing the treatment efficiency of diagnosing a chronic disease.
  • FIG. 1 shows that miRNA (differentially expressed miRNA) showing a significant difference is screened by next-generation sequencing (NGS) after extracting exosomes from blood and skin tissue of psoriasis patients, and miRNAs expressed up and down are This is the result of validating the expression pattern by performing quantitative real-time PCR on it. Significance of correlations was tested using Spearman's rank correlation test. *P ⁇ 0.05, **P ⁇ 0.01.
  • Figure 1a is a schematic diagram showing the experimental process of acquisition and analysis of exosome miRNA (blue arrow (dotted line) indicates the screening step, red arrow (solid line) indicates the validation step).
  • FIG 1b shows the differentially expressed genes (DEG) on the Volcano plot. Screened exosomal miRNAs are indicated in bold.
  • Figure 1c shows downregulated miRNAs in the plasma of psoriasis patients with PASI >10.
  • Figure 1d shows upregulated miRNAs in the plasma of psoriasis patients with PASI >10.
  • Figure 1e shows the qRT-PCR results of miRNAs upregulated in the skin of psoriasis patients.
  • 1F shows skin miR-625-3p levels plotted against PASI and BSA.
  • Figure 2 is a result of verifying the diagnostic accuracy of miRNAs that are elevated in screening.
  • 2a and 2b show the results of plotting plasma miR-625-3p, miR-4488, and miR-342-3p levels against psoriasis severity indices (a) PASI and (b) BSA, respectively. Significance of correlations was tested using Spearman's rank correlation test.
  • Figure 2c is the result of confirming the sensitivity and specificity through the ROC (receiver operating characteristic) curve and related AUC values of each upregulated exosome miRNA.
  • Figure 2d is a schematic diagram showing the experimental process for analyzing exosome miRNA levels before and after treatment according to the active and inactive states of Behcet's disease patients.
  • Figure 2e is the result of confirming the difference in miRNA expression by performing qRT-PCR after extracting exosomes from plasma according to the active and inactive states of Behcet's disease patients.
  • FIG. 2f is a result of extracting exosomes from the plasma of patients with Behcet's disease before and after treatment and performing qRT-PCR to confirm the difference in miRNA expression between a group showing an improvement in PASI of 50 or more after treatment and a group without. *P ⁇ 0.05.
  • Figure 3 is the result of confirming the origin of exosome miRNA through in situ hybridization (ISH) technique in paraffin tissue.
  • ISH in situ hybridization
  • 3a and 3b show the results of detecting miR-625-3p expression in the skin through ISH at (a) a low power field (x100) and (b) a high power field (x400), respectively.
  • 3c and 3d show that in order to confirm whether the miRNAs that were elevated were derived from keratinocytes or T cells, HaCaT cells and JurkaT cells were used to (c) collected cells and (d) supernatants of IL-12 (Th1), IL-12 (Th1) and IL-12 (Th1). 23 (Th17) and confirmed the expression levels of miR-625-3p and miR-4488 through qRT-PCR. *P ⁇ 0.05 and **P ⁇ 0.01.
  • Figure 4 is the result of confirming the possibility of association with the IGF-1 signaling system of miR-625-3p through the miRNA database. Data are presented as mean ⁇ SEM. Horizontal lines above the bars represent statistical differences and statistical comparisons between categories. *P ⁇ 0.05, **P ⁇ 0.01, and ****P ⁇ 0.0001.
  • Figure 4a shows the results of predicting the target and function of miR-625-3p using three miRNA databases (miRDB/TargetScan/miRTarBase).
  • Figure 4b is the result of confirming the expression level after transfection with miR-625-3p mimic.
  • Figure 4c is a qRT-PCR result of IGF-1 signaling genes after transfection with miR-625-3p mimic.
  • Figure 4d shows the result of western blotting analysis of Akt protein in HaCat cells cultured for 48 hours after transfection with the miR-625-3p mimic.
  • Figure 4e is a result confirming the increase in the expression level of the Ki67 gene, which increases during cell division after transfection with the miR-625-3p mimic.
  • Figure 4f shows the results of confirming the survival of HaCaT cells by CCK8 assay at different dopamine concentrations for 24, 48 and 72 hours after transfection with the miR-625-3p mimic.
  • miR-625-3p which can objectively diagnose psoriasis with miRNA in circulating exosomes, was identified as a novel biomarker for diagnosing psoriasis severity.
  • the expression level of miR-625-3p showed a significant correlation according to the severity, and it was confirmed that miR-625-3p is a biomarker that reflects the severity of psoriasis disease.
  • the present invention relates to a composition for diagnosing psoriasis disease severity, including a substance for detecting the miR-625-3p biomarker.
  • the detection material may include at least one of a primer, a probe, and an antisense nucleotide specifically binding to the miR-625-3p biomarker, but is not limited thereto.
  • the miR-625-3p biomarker may be characterized in that it is possible to determine psoriasis disease severity.
  • the composition may be characterized in that it further comprises a substance for detecting the miR-4488 biomarker and/or a substance for detecting the miR-342-3p biomarker.
  • the detection substance may include at least one of a primer, a probe, and an antisense nucleotide that specifically binds to the miR-4488 biomarker and/or the miR-342-3p biomarker.
  • a primer a probe
  • an antisense nucleotide that specifically binds to the miR-4488 biomarker and/or the miR-342-3p biomarker.
  • it is not limited thereto.
  • miRNA refers to a 21- to 21-to-2 gene expression that regulates gene expression post-transcriptionally by promoting degradation of target RNA or inhibiting their translation. 23 non-coding RNAs.
  • the mature sequences of the miRNAs used herein can be obtained from the miRNA database (http://www.mirbase.org).
  • microRNA is transcribed as a stem-loop (primary miRNA or pri-miRNA) precursor with a hairpin structure called pre-miRNA and about 70-80 nt (nucleotides) in length.
  • pri-miRNAs may include several miRNA precursors, and are processed into precursor miRNAs (pre-miRNAs) having a hairpin structure by the action of enzymes.
  • pre-miRNAs precursor miRNAs having a hairpin structure by the action of enzymes.
  • the pre-miRNA moves out of the nucleus and the hairpin structure is cleaved by RNase enzyme (Dicer) in the cytoplasm.
  • Dicer binds to the 3' end of the hairpin, cuts the loop connecting the 3' and 5' arms, and forms an unstable double-stranded miRNA, ultimately mature miR-3p and miR-5p. is formed
  • miR-625-3p is derived from the 3p end of pre-miRNA miR-625 having a hairpin structure. In the present study, it was found that miR-625-3p was particularly elevated in psoriasis patients.
  • the miR-625-3p biomarker according to the present disclosure includes mature miR-625-3p as well as a precursor pre-miR-625 capable of producing it.
  • human-derived pre-miR-625 including miR-625 can be represented by SEQ ID NO: 1: AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUGUAAUUA GAUCUCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCCCU, and miR-625-3p can be represented by SEQ ID NO: 2: GACUAUAGAACUUUCCCCCUCA,
  • SEQ ID NO: 1 AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUGUAAUUA GAUCUCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCCCU
  • miR-625-3p can be represented by SEQ ID NO: 2: GACUAUAGAACUUUCCCCCUCA
  • the underlined part in SEQ ID NO: 1 is a sequence forming a loop.
  • Pre-miR-625 includes both 5p and 3p sequences based on the loop, and when a probe and/or primer described later is used for detection, it is preferable to
  • the human-derived pre-miR-4488 sequence including miR-4488 may be represented by SEQ ID NO: 3: GGUAGGGGGCGGGCUCCGGCGCUGGGACCCCACUAGGGU GGCGCCUUGGCCCCGCCCCGCCC, and miR-4488 may be represented by SEQ ID NO: 4: AGGGGGCGGGCUCCGGCG.
  • human-derived pre-miR-342 including miR-342 may be represented by SEQ ID NO: 5: GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGA CAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA, and miR-342-3p may be represented by SEQ ID NO: 6: UCUCACACAGAAAUCG CACCCGU
  • the underlined portion is a sequence forming a loop.
  • Pre-miR-342 includes both 5p and 3p sequences based on the loop, and when a probe and/or primer described later is used for detection, it is preferable to design to specifically recognize 3p.
  • biomarker or diagnostic marker is a substance that can be diagnosed by distinguishing a sample from a patient with psoriasis from a control group, It includes non-coding nucleic acids that show an increased expression pattern in the sample.
  • diagnosis refers to determining the susceptibility of a test subject to a specific disease or disorder, determining whether or not currently having a specific disease or disorder, and determining whether a test subject has a specific disease or disorder This includes determining prognosis, recurrence of a disease after treatment, or therametrics (eg, monitoring a subject's condition to provide information about therapeutic efficacy).
  • the biomarker according to the present disclosure can be used for diagnosing psoriasis by detecting the presence or absence of miRNA and/or detecting its expression level itself, change in expression level, or difference in expression level through quantitative and/or qualitative analysis.
  • the detection substance according to the present application is a substance capable of detecting the presence or absence of miRNA or its cRNA or cDNA and/or detecting its expression level itself, change in expression level, or difference in expression level, and the composition is the substance for detection.
  • the detection material may further include a reagent suitable for detecting the biomarker.
  • the detection material includes a probe that specifically binds to the miRNA disclosed herein or its cRNA or cDNA.
  • the probe specifically and complementarily binds to single-stranded RNA or DNA as a template and has a free 3' hydroxyl group that allows reverse transcriptase or DNA polymerase to initiate replication of the template. It refers to a nucleic acid molecule, which enables qualitative and / or quantitative measurement of a target by specific binding to a template or target, and can be used in various methods as described below, and also for detection of amplified products As described below, it may be labeled with a color, luminescent, or fluorescent substance.
  • the detection substance according to the present application specifically and complementarily binds to the miRNA disclosed herein or its cRNA or cDNA, and has a free 3' end that allows reverse transcriptase or DNA polymerase to initiate replication of the template. It is a primer having a hydroxyl group (free 3' hydroxyl group). Primers are generally designed to bind to the vicinity of both ends of a site to be amplified in a target nucleic acid in a nucleic acid amplification reaction, and specifically bind to a template (or target) to perform qualitative and/or quantitative analysis of the template or target material. and can be used in a variety of ways as described below. In addition, for detection of the amplified product, it may be labeled with a color, luminescent, or fluorescent substance as described below.
  • the detection substance according to the present application includes a probe and a primer pair that specifically bind to the miRNA disclosed herein or its cRNA or cDNA, and in this case, the probe is located between the primer pair.
  • Probes and/or primers capable of detecting miR-625-3p, miR-4488 or miR-342-3p according to the present application may be used in various known methods, and various reagents are specifically provided herein according to the method used. It can also be included in the composition according to.
  • Such methods include, but are not limited to, for example, nucleic acid hybridization, polymerization, amplification methods and hybridization-based ligation, and the like.
  • Nucleic acid hybridization can be performed in the form of nucleic acids bound to a solid phase support, such as beads, nanoparticles or biochip arrays (microarrays), or using in situ hybridization.
  • miRNA microarray technology allows the analysis of multiple miRNAs simultaneously.
  • Nucleotides complementary to miRNAs according to the present disclosure may be spotted on a coated solid support or spotted on a solid support using an in situ synthesis method.
  • miRNA isolated from a biological sample can be detected by incorporation of a label (e.g., biotin, fluorescent dye) detected by hybridization with a complementary sequence on the solid support, for example, a probe. .
  • a label e.g., biotin, fluorescent dye
  • miRNA isolated from a biological sample is labeled with a fluorescent material and binds to a corresponding sequence, and the resulting fluorescence signal indicates the presence of a specific miRNA.
  • Microarray fabrication techniques are described, for example, in Schena et al., 1996, Proc Natl Acad Sci USA.93(20):10614-9; Schena et al., 1995, Science 270(5235):467-70; and U.S. Pat. Nos. 5,599,695, 5,556,752 or 5,631,734.
  • a substance or reagent for detection may be provided in a form bound to a solid support.
  • the detection reagent may be labeled directly or indirectly in a sandwich form for detection, and reference may be made to the bar described below.
  • a nucleic acid polymerization or amplification method may also be used to detect miRNA according to the present disclosure, and is particularly suitable for detecting miRNA present in a small amount.
  • Various known nucleic acid amplification or synthesis methods may be used, for example, reverse transcription reaction, reverse transcription polymerase chain reaction (RT-PCR), real-time RT-PCR, PCR, real-time PCR, quantitative RT-PCR, quantitative PCR, NASBA ( Nucleic Acid Sequence-Base Amplification (LCR), Ligase Chain Reaction (LCR), Multiple ligatable probe amplification (Multiple ligatable probe amplification), Invader technology (Third Wave), Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), and Eberwine RNA amplification, etc., but is not limited thereto.
  • LCR Nucleic Acid Sequence-Base Amplification
  • LCR Ligase Chain Reaction
  • Multiple ligatable probe amplification Multiple ligatable probe amplification
  • a typical PCR method consists of three steps, denaturation of the template, annealing in which forward and reverse primers bind to the target sequence, and elongation with a thermostable polymerase for amplification of a specific target sequence, usually in several cycles, for example, 20 More than once is done. Alternatively, annealing and stretching may be performed in the same step. Since mature miRNAs are single-stranded, a reverse transcription reaction can be performed first before PCR. The reverse transcription reaction requires the use of primers and reverse transcriptase.
  • a set of forward and reverse primers or probes together with the primers can be used.
  • the length of probes and primers is determined according to various factors such as hybridization temperature, composition of target sequence, and complexity of target sequence.
  • the probe is 7 nucleotides or more
  • the primer is about 10 to 35 nucleotides in length, such as 15, 20, 25, 30 or 35 nucleotides.
  • the forward primer includes at least one sequence capable of specifically binding to the biomarker miRNA, and may further include a non-complementary sequence at the 5' side.
  • the sequence of the reverse primer may be independent of the sequence of the biomarker, and multiple miRNA biomarkers may be amplified with one type of reverse primer, or may include one or more sequences specific to the biomarker.
  • a primer capable of amplifying miR-625-3p may be MystiCq®microRNA qPCR Assay Primer hsa-miR-625-3p, but is not limited thereto.
  • primers capable of amplifying miR-625-3p may be forward: 5'-GCGCAGGACTATAGAACTTTC-3' and reverse: 5'-GGTCCAGTTTTTTTTTTTTTGAG-3', but are not limited thereto.
  • Amplification products can be analyzed during or after amplification by various methods known in the art. These methods are known in the art and include, for example, gel electrophoresis, real-time PCR analysis, SSCP (single strand conformational polymorphism), RFLP (restriction fragment length polymorphism), CZE (capillary zone electrophoresis), WAVE (HPLC-based nucleic acid analyzing technology), microchip, but is not limited thereto.
  • a real-time quantitative PCR method that is, RT-PCR is used after reverse transcription reaction, which isolates RNA from a sample, and then primers, for example, a stem-loop capable of forming a stem-loop therefrom.
  • primers for example, a stem-loop capable of forming a stem-loop therefrom.
  • forward and reverse primers, or a combination of forward and reverse primers and probes are used here as end-points, or using dyes that bind to nucleic acids such as SYBR Therefore, a stem-loop RT-based nucleic acid amplification method using a TaqMan type probe labeled with a fluorescent material or in real time is used.
  • hybridization-based ligation techniques can be used for quantitative analysis of miRNAs. Such methods are known in the art and do not bind a detectable probe that binds to a target nucleic acid sequence, such as, for example, oligonucleotide ligation (OLA) and methods using HARP-like probes described, for example, in US Publication No. 2006-0078894. It includes, but is not limited to, a method of separating from an unidentified probe.
  • Another technique using ligation may include Multiplex Ligation-dependent Probe Amplification (MLPA) (Schouten et al., Nucleic Acids Research 30:e57 (2002)). In this technique, ligation occurs only when a pair of probes bind to the target sequence side by side, and the ligated probes include primer binding sites so that they can be amplified by PCR.
  • MLPA Multiplex Ligation-dependent Probe Amplification
  • hybridized or amplified miRNA products can be detected through staining or labeling of the target, staining or labeling of primers or probes.
  • a known technique in the art may be used for detection, and a person skilled in the art may select an appropriate method in consideration of detection sensitivity and/or target quantity. Depending on the amount of target and/or the sensitivity of the detection method, amplification may not be necessary prior to detection.
  • miRNAs can be detected by direct or indirect methods.
  • miRNA is labeled with a detectable label attached thereto, and then bound to a probe linked to a solid support such as a bead, and then the labeled miRNA is screened for detection.
  • a labeled probe may be used for direct detection, and detection is performed through screening of the labeled probe after specific binding to the miRNA.
  • the amplified miRNA is detected using beads conjugated with a probe capable of capturing a target nucleic acid.
  • the probe may be labeled with a fluorophore. Indirect detection methods may also be used.
  • biotinylated probes can be used to detect bound nucleic acids using streptavidin conjugated dyes.
  • streptavidin conjugated dyes The streptavidin molecule binds to the biotin label of the amplified miRNA, and the bound miRNA is detected by a dye conjugated to streptavidin.
  • Dyes conjugated to such streptavidin are known in the art and for example Phycolink(R) Streptavidin R-Phycoerythrin (PROzyme) can be used.
  • Labels for detection include, but are not limited to, compounds capable of generating or quenching detectable fluorescence, chemiluminescence, or bioluminescence signals such as light-emitting, light-scattering, and light-absorbing materials, such as Garman A., Non_Radioactive Labeling, Academic Press 1997.
  • Fluorescent materials include, but are not limited to, fluorescein (eg US Patent 6,020,481), rhodamine (eg US Patent 6,191,278), benzophenoxazine (eg US Patent 6,140,500), donor and acceptor.
  • Energy transfer fluorescent dyes including (eg US Patent Publication No.
  • Fluorescent dye is 6-carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; and 2', 4', 5', 7', 1,4-hexachlorofluorescein, but is not limited thereto.
  • SYBR-Green, 6-carboxyfluorescein (“FAM”), TET, ROX, VICTM, or JOE are used as fluorescent labels.
  • FAM 6-carboxyfluorescein
  • TET 6-carboxyfluorescein
  • ROX ROX
  • VICTM VICTM
  • JOE JOE
  • a probe labeled with two fluorescent substances, a reporter fluorescent substance and a scavenger fluorescent substance is used.
  • a fluorescent substance that emits a spectrum of distinguishable wavelengths is used as the fluorescent substance.
  • a compound capable of improving, stabilizing, or influencing nucleic acid binding may be used, for example, an intercalator including etcidium bromide and SYBR-Green, a minor groove conjugate, and a crosslinkable functional group. , but not limited to, Blackburn et al., eds. See “DNA and RNA Structure” in Nucleic Acids in Chemistry and Biology (1996).
  • miRNA quantification can also be performed with reference to the following literature, for example, miRNA microarrays (Calin, G.A. et al. (2004) Proc Natl Acad Sci USA 101,11755.60.), SYBR-based miRNA RT-qPCR assays ( Sharbati-Tehrani et al. (2008) miR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complexsample. BMC Mol Biol 9, 34.), BeadArray (Chen, J. (2008) Highly sensitive and specific microRNA expression profiling using BeadArray technology. Nucleic Acids Res 36, e87.), Invader Assays (Allawi, H.T. et al.
  • kits based on RT-PCR using primers and probes may be used, for example, Stem-loop RT based TaqMan MicroRNA Assays (ThermoFisher Scientific, USA) may be used.
  • composition according to the present disclosure may include reagents used in any one or more of the methods described above.
  • biomarker or composition containing the biomarker according to the present disclosure may be usefully used for diagnosis of psoriasis, prediction of recurrence and/or prognosis, and/or prediction of response after drug treatment.
  • the present invention relates to the use of the miR-625-3p biomarker for diagnosing the severity of psoriasis.
  • the present invention can be interpreted as a composition for diagnosing psoriasis disease severity, including a substance for detecting the miR-625-3p biomarker, for use in diagnosing psoriasis disease severity.
  • the present invention relates to the use of a miR-625-3p biomarker for the preparation of a reagent for diagnosing the severity of psoriasis.
  • the present invention can be interpreted as a composition for diagnosing psoriasis disease severity, including a substance for detecting the miR-625-3p biomarker, for the preparation of a reagent for diagnosing the severity of psoriasis.
  • the present invention provides a method for diagnosing severity of psoriasis comprising measuring the expression level of the miR-625-3p biomarker in a subject in need of diagnosis of severity of psoriasis.
  • the miR-625-3p biomarker can be used for diagnosing the severity of psoriasis by measuring its expression level using any one or more of primers, probes, and antisense nucleotides that specifically bind to the miR-625-3p biomarker.
  • the miR-625-3p biomarker can be used together with the miR-4488 biomarker and/or the miR-342-3p biomarker to diagnose the severity of psoriasis.
  • the present invention can provide the use of the miR-4488 biomarker and/or the miR-342-3p biomarker for diagnosing the severity of psoriasis together with the miR-625-3p biomarker.
  • the composition for diagnosing psoriasis disease severity which further includes a substance for detecting miR-4488 biomarker and/or miR-342-3p biomarker, can be interpreted as a composition for diagnosing psoriasis disease severity.
  • the present invention is interpreted as a composition for diagnosing psoriasis disease severity, including a substance for detecting miR-4488 biomarker and/or miR-342-3p biomarker, for the preparation of a reagent for diagnosing psoriasis disease severity. It can be.
  • the miR-4488 biomarker and/or the miR-342-3p biomarker are expressed by measuring the expression level using at least one of primers, probes, and antisense nucleotides that specifically bind to each marker. It can be used to diagnose the severity of psoriasis.
  • the present invention relates to a kit for diagnosing the severity of psoriasis, including the composition.
  • the kit is used for nucleic acid amplification, in particular for amplification using RT-PCR.
  • the kit may include primer sets and/or probes, buffers, reverse transcriptase, and Taq polymerase necessary for the RT-PCR reaction.
  • it may further include a nuclease capable of removing single-stranded nucleic acids.
  • buffers known in the art may be used, for example, Tris-HCl, pH 9.0 buffer may be used, but is not limited thereto.
  • Reverse transcriptase and Taq polymerase are commercially available.
  • AmpliTaq Gold (Applied Biosystems, USA) capable of hot start reaction as a polymerase can be used, and appropriate concentrations, for example, of 1.5 mM to 2.5 mM MgCl 2 may be included.
  • the kit according to the present application further comprises a positive control, a negative control and instructions for use.
  • the negative control group may include a sample that does not contain miRNA, and the positive control group may include one or more miRNAs to be detected.
  • the present invention may provide information necessary for a method for diagnosing moderate-to-severe psoriasis or for diagnosing or prognosing psoriasis.
  • the present invention provides (a) measuring the expression level of miR-625-3p in a sample isolated from a patient; and (b) comparing the expression level of miR-625-3p with the expression level of miR-625-3p in mild psoriasis samples; It relates to an information providing method for diagnosing moderate-to-severe psoriasis, including.
  • the expression level of miR-625-3p is measured using reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip , but is not limited thereto.
  • the sample may be a tissue, cell, blood or serum sample, but is not limited thereto.
  • the sample may include exosomes isolated from tissues, cells, blood or serum, but is not limited thereto.
  • the expression level of miR-625-3p when the expression level of miR-625-3p is increased by about 3.46 times or more compared to the expression level of miR-625-3p in mild samples, moderate-severe psoriasis can be diagnosed. It is not limited to this.
  • step (a) further measures the expression level of miR-4488 and/or miR-342-3p in samples isolated from the patient,
  • the miR-4488 expression level is compared with the miR-4488 expression level of the mild psoriasis sample and/or the miR-342-3p expression level is compared with the miR-342-3p expression level of the mild psoriasis sample. It can be characterized by comparison.
  • the miR-4488 expression level when the miR-4488 expression level is increased by about 2.375 times or more compared to the miR-4488 expression level of the mild psoriasis sample and/or
  • the diagnosis of moderate-severe psoriasis may be characterized.
  • the expression level of miR-4488 and/or miR-342-3p may be additionally verified along with the expression level of miR-625-3p to diagnose moderate to severe psoriasis, but is not limited thereto.
  • the expression level of miR-4488 and/or miR-342-3p is determined by reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip. It may be characterized in that it is measured using, but is not limited thereto.
  • the sample may be a biological sample
  • biological sample refers to a biologically derived organ, tissue, cell or body fluid.
  • biological samples include, but are not limited to, tissue sections, whole blood, plasma, serum, urine or blood derived leukocytes, red blood cells or platelets, or tissue or cell cultures.
  • one or more of the above samples may be mixed and used.
  • Such a biological sample may be directly obtained from a patient suspected of having psoriasis immediately before the test by a conventional sample obtaining method, or may be previously separated and stored.
  • skin tissue or blood samples are used.
  • skin tissue or blood obtained from a subject with or suspected or likely to have psoriasis may be used, but is not limited thereto.
  • a subject herein includes a mammal suspected of having a disease, a mammal suffering from a disease and then treated but suspected of recurrence, particularly a human.
  • the expression levels of miR-625-3p, miR-4488 and/or miR-342-3p in the subject are compared with miR-625-3p, miR-4488 and/or miR-4488 and/or miR-3488 and/or
  • the subject sample and the normal sample may be characterized by comparing the expression level of the above biomarker after normalizing to miR-103-3p.
  • miR-103-3p can be normalized to other miRNAs having uniform intracellular expression levels.
  • composition according to the present application detects the expression level of the one or more miRNAs in a biological sample, compares it with a control group or reference group, and predicts the risk of diagnosis or recurrence or occurrence of psoriasis according to the degree of decrease or change in the expression level.
  • control group is a sample showing differential expression from moderate to severe psoriasis disease, and a sample derived from a subject of the same species having mild psoriasis disease is used.
  • the miR-625-3p expression level when the miR-625-3p expression level is compared with the miR-625-3p expression level of a mild psoriasis sample, the miR-625-3p expression level is increased, for example, by about 10%, An increase of more than about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% is considered moderate to severe psoriasis or the risk of developing It can be judged as increased or high.
  • the expression level of miR-4488 and/or miR-342-3p is increased in the miR-4488 and/or miR-342-
  • the expression level of miR-4488 and/or miR-342-3p is increased compared to the expression level of 3p, for example, about 10%, about 20%, about 30%, about 40%, about 50%, about 60 %, about 70%, about 80%, about 90%, or about 100% or more, it can be judged as moderate-to-severe psoriasis or the risk of occurrence is further increased or higher.
  • biomarkers according to the present disclosure may be used together with existing markers and/or diagnostic methods. For example, it can be used with PASI and BSA results.
  • the miRNA expression level of mild psoriasis samples may be published in literature or previously measured, and may be measured in advance in individuals with mild psoriasis.
  • Example 1 Confirmation of exosome-derived miRNA expression patterns according to psoriasis-specific and disease activity differences in psoriasis patients
  • Diagnosis of psoriasis was made based on clinical and histological features in skin biopsy. PASI and BSA were assessed on the day of sampling.
  • Plasma samples from psoriasis patients were collected in serum separator tubes and EDTA treated tubes and immediately centrifuged at 3,000 rpm for 10 minutes at 4°C.
  • NGS Next generation sequencing
  • exosomes were extracted from plasma using the miRCURY TM Exosome isolation kit (Qiagen, Hilden, Germany) and exosomes were isolated using an RNA isolation kit (miRNeasy Serum/Plasma Kit; Qiagen, Hilden, Germany) according to the manufacturer's instructions. Total miRNAs were extracted from some.
  • paired-end (150 bp) sequencing was performed using the Illumina NovaSeq6000 S4 platform for sequencing (Illumina, CA, USA).
  • miRNA expression levels were determined using the gene annotation database of species with hairpin and mature miRNA sequence information extractable from miRBase (Nucleic acids research. 2014;42(D1):D68-D73), mirdeep2 (Nucleic acids research. 2012; 40(1):37-52).
  • miRNA level count data were generated using mirdeep2.
  • DEmiRNA was developed using the TCC R package for a robust normalization strategy to compare tag count data (BMC bioinformatics. 2013;14(1):1-14). was identified using Normalization factors were calculated using the iterative DEGES/edgeR method. Q-values were calculated based on p-values using the p.adjust function of the R package with default parameter settings.
  • DEmiRNAs were identified based on a q-value threshold of less than 0.05 to correct errors due to multiple testing (Journal of the Royal statistical society: series B (Methodological). 1995;57(1):289-300).
  • Fig. 1b 19 significant DE miRNAs were identified among the total of 805 detected miRNAs, that is, 9 up-regulated and 10 down-regulated miRNAs (Fig. 1b). Based on fold change and p-value, miR-625-3p, miR-4488 and miR-342-3p of upregulated miRNAs and miR-5698, miR-1255b-5p and miR323a-5p of downregulated miRNAs, respectively miRNAs were selected.
  • RNA extraction from plasma samples from psoriasis patients proceeded with the same procedure as described above, skin tissue samples from psoriasis patients were obtained from psoriasis lesions using a 3 mm disposable biopsy punch, and quick-frozen tissue samples from patients were collected until the time of analysis. It was stored in -80 °C nitrogen tank in Ajou University Hospital Human Biobank (AUHHB). Skin tissue samples were homogenized in QIAzol Lysis Reagent and total RNA was extracted by pulverizing lesion tissue using TissueLyser II (Qiagen, Hilden, Germany).
  • cDNA was synthesized from total RNA extracted using miRCURY LNA miRNA PCR Assays (Qiagen) with the miRCURY LNA RT Kit (Qiagen) according to the manufacturer's instructions, and the quantity and quality of total RNA was measured spectrophotometrically (NanodropTM ND-1000, ThermoFisherScientific , Copenhagen, Denmark).
  • qRT-PCR was performed using the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). miRNA expression values obtained by qRT-PCR were normalized to miR-103-3p (International journal of molecular sciences. 2019;20(18):4353). Afterwards, the results were quantitatively analyzed using the relative standard curve method (2- ⁇ ).
  • the selected down-regulated miRNAs did not show a significant difference in expression between the groups (Fig. 1c), but all of the selected up-regulated miRNAs showed a significant difference in expression between the PASI ⁇ 5 group and the PASI ⁇ 10 group.
  • both miR-4488 and miR-625-3p showed significant expression differences between the PASI ⁇ 5 group and the 5 ⁇ PASI ⁇ 10 group (FIG. 1d).
  • miR-625-3p showed a significant difference between the PASI ⁇ 5 group and the 5 ⁇ PASI ⁇ 10 group, and the PASI ⁇ 5 group and the PASI ⁇ 10 group ( Fig. 1e).
  • the three selected miRNAs showed a significant correlation (p ⁇ 0.0001) between the expression level and PASI, but miR-625-3p showed an exceptionally high level of correlation (FIG. 2a). Similar results were observed in the correlation with BSA, and miR-625-3p showed the highest correlation coefficient value compared to other miRNAs (Fig. 2b).
  • the ROC curve was analyzed to what extent the elevated miRNAs could predict the two patient groups with PASI ⁇ 10 and PASI ⁇ 10.
  • miR-4488 was also found to have significant results in the AUC value in the ROC curve, but in particular, miR-625-3p had the highest AUC value with an exceptional value of 0.9515, indicating mild psoriasis (PASI ⁇ 10) and severe psoriasis. (PASI ⁇ 10), and the diagnostic value as a biomarker for determining the severity of psoriasis disease was confirmed.
  • circulating exosome miRNAs from Behcet's disease (BD) patients were additionally analyzed (Fig. 2d, blue arrow (dotted line)).
  • miR-625-3p is a biomarker that can most accurately indicate psoriasis activity.
  • ISH In situ hybridization
  • ISH ISH paraffin-embedded sections fixed in formalin were cut to a thickness of 6 ⁇ m, mounted on slides, and experiments were performed using miRCURY LNA miRNA Detection Probe (Qiagen) according to the manufacturer's instructions. Briefly, sections of patient lesion specimens were deparaffinized and treated with proteinase K for 10 minutes at 37°C. Hybridization mix was prepared by adding LNA detection probes (Qiagen, 5'-DIG- and 3'-DIG-labeled) for hsa-miR-625-3p and hsa-miR-4488 to miRNA ISH buffer (Qiagen) .
  • LNA detection probes Qiagen, 5'-DIG- and 3'-DIG-labeled
  • the hybridization mix was applied to the incubated slide and placed in a hybridizer at a temperature ranging from 55°C to 60°C.
  • the slides were then washed with 5X SSC, 1X SSC and 0.2X SSC buffer and incubated with 0.2X SSC buffer at 60°C for 1 hour. After washing thoroughly, the probe was detected by incubating the sections with alkaline phosphatase (AP)-conjugated anti-DIG Ab for 1 hour at RT.
  • AP alkaline phosphatase
  • miR-625-3p was identified in basal keratinocytes, not in infiltrating immune cells (FIG. 3a).
  • miR-625-3p was observed in the cytoplasm and extracellular matrix of basal keratinocytes, but not in the nucleus (stained with U6) under high-power fields (Fig. 3b).
  • miR-625-3p is derived from psoriasis basal keratinocytes, and IL-12 (Recombinant Human IL-12 (Cat No. 573002) BioLegend) and IL-23 (Recombinant Human IL-23) are used to mimic similar conditions.
  • 23 (Cat No. 1290-IL) Bio-Techne) (each 50ng/ml) after stimulating HaCaT cells or JurkaT cells, the expression levels of miR-625-3p and miR-4488 were confirmed by qRT-PCR. .
  • HaCaT human keratinocytes
  • T Jurkat cells
  • the cell line tested negative for mycoplasma was cultured in RPMI medium 1640 with L-glutamine supplemented with 10% heat-inactivated FBS.
  • HaCaT cells and Jurkat cells were cultured in a 12-well plate at a concentration of 4 x 10 4 cells and 5 x 10 5 cells, respectively, and interleukin (IL)-12 and/or IL-23 were treated in each well plate.
  • IL interleukin
  • RNA in HaCaT and Jurkat cells was isolated with the miRNeasy Micro Kit (Qiagen) according to the manufacturer's instructions, or from the culture supernatant of HaCaT and Jurkat cells using the QIAGEN exoRNeasy Midi Kit (Cat. No. 77144), qRT-PCR was performed in the same manner as described in Example 1 after exosome extraction.
  • miRDB Nucleic Acids Research. 48(D1):D127-D131 (2020)
  • TargetScan Gene Biol. 11:R90. (2010)
  • miRTarBase Nucleic Acid Res. 8;48(D1):D148-D154 (2020)
  • 294, 2906, and 33 targets were predicted as targets of miR-625-3p in miRDB, TargetScan, and mirRTarBase, respectively.
  • Select the top 100 overlapping genes (6 genes with all 3 overlaps, 94 genes with random 2 overlaps), enter the HGNC names using the Enrichr tool (BMC Bioinformatics 14, 128 (2013)) and enter the KEGG pathway and enrichment scores (P-values) for GO terms.
  • the top 4 (lowest P values) for each category were scored.
  • miR-625-3p was confirmed to be correlated with insulin-like growth factor (IGF) (FIG. 4a).
  • IGF insulin-like growth factor
  • mir Vana TM miRNA Mimic (Negative control, Thermo Fisher Scientific (#4464058)) (or mir Vana TM miRNA Mimic (has-miR-625-3p, Thermo Fisher Scientific, (#4464066)) was purchased and used at a concentration of 50 pmol.
  • miRNA Mimic was transfected using Lipofectamine ® RNAiMAX reagent according to the manufacturer's instructions (Fig. 4b), the following primers were used in the same manner as in Example 1 to confirm the expression level of various IGF-1 signaling genes and subjected to qRT-PCR analysis.
  • Ki67-Forward 5'-GAGAGCTCCCAGCCTAAGGT, Reverse: 5'-CCTGCT TCTCCTTTCCCTTT
  • Cell counting kit analysis was performed by CCK8 assay using D-PlusTMCCK cell viability assay kit (Dougin; #CCK-3000).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 miR-625-3p의 건선 중증도 진단용 바이오마커로서의 용도에 관한 것으로, 더 상세하게는 miR-625-3p 바이오마커 검출용 물질을 포함하는 건선 중증도 진단용 조성물 또는 건선 중증도 진단용 키트, 및 상기 miR-625-3p를 바이오마커로 하는 건선 중증도-중증 진단방법에 관한 것이다. 본 발명에 따른 건선 진단용 바이오마커는 건선을 분자수준에서 조기에 객관적으로 진단이 가능하고, 건선 질환의 중증도(severity)를 정확히 판별할 수 있어, 만성질환인 진단의 치료 효율을 증대시킬 수 있는 장점이 있다.

Description

MIR-625-3P의 건선 중증도 진단용 바이오마커로서의 용도
본 발명은 miR-625-3p의 건선 중증도 진단용 바이오마커로서의 용도에 관한 것으로, 더 상세하게는 miR-625-3p 바이오마커 검출용 물질을 포함하는 건선 중증도 진단용 조성물 또는 건선 중증도 진단용 키트, 및 상기 miR-625-3p를 바이오마커로 하는 건선 중증도-중증 진단방법에 관한 것이다.
건선은 비교적 흔한 피부 염증성 질환으로, 전 인구의 1-3%에서 발생하며, 젊은 나이에 발병한 후 호전과 악화를 반복하여 장기적인 치료가 요구되는 질환이다. 건선 환자 중 약 10%에서는 관절염이 유발되는 것으로 보고되었으며, 심혈관 질환 및 대사 증후군과도 연관되어 있음이 보고된바 있다.
건선의 질병 활성도를 평가하는 바이오마커로는 psoriasis area severity index(PASI)와 body surface area(BSA)가 있으나, 이는 임상의가 피부의 상태를 보고 판단하는 것이기 때문에 판단에 임상의의 주관이 개입될 수 있어, 객관적으로 건선을 진단할 수 있는 바이오마커가 필요하다 (Advances in Clinical and Experimental Medicine. 2017;26(5):851-6).
엑소좀은 가장 작은(30-120 nm) 세포외 소포체로 microRNA(miRNA), 핵산, 세포 간 통신을 가능하게 하는 단백질과 같은 다양한 생체 분자를 포함한다. 엑소좀의 안정적인 지질 이중층은 생체 분자가 분해되는 것을 방지한다. 또한, 손상된 각질세포는 엑소좀을 분비할 수 있는데, 건선의 각질세포에서는 과도한 염증과 비정상적인 분화로 인해 엑소좀을 분비한다 (ACS nano. 2020;14(10):12732-48; Cell death & disease. 2022;13(1):1-13).
miRNA는 유전자 발현을 조절하는 역할을 하는 것으로 알려진 작은 크기의 non-coding RNA(20-25 nucleotides)로, miRNA는 T 세포의 증식 및 활성화에 관여하며 건강한 대조군과 비교하여 건선 환자에서 차등적으로 발현되는 것으로 보고되었다 (Biomedical reports. 2018;9(5):367-74). 순환하는 엑소좀 miRNA는 현저한 안정성과 함께 질병과 상관관계가 있는 것으로 알려지면서, 암, 간염, 피부근염 및 신경퇴행성 질환과 같은 질병에 대한 질병 활성을 반영하는 잠재적 바이오마커로 사용되어 왔다.
이와 관련하여, 건선 환자의 피부 또는 혈액에는 250개 이상의 차등적으로 발현되는 miRNA가 있으나, miRNA는 외부 자극 및 분해에 취약한 작은 단일 가닥 비암호화 RNA 분자이기 때문에, miRNA를 이용하여 건선 환자를 진단하는데는 한계가 있었다.
그러나, 본 발명자들은 순환하는 엑소좀에서 miRNA는 비교적 안정적인 바이오마커로 건선을 진단하는데 활용이 가능할 것이라는 점에서 착안하여, 순환하는 엑소좀 내 miRNA로 객관적으로 건선을 진단할 수 있는 정확도 높은 신규한 바이오마커를 발명하고자 예의 노력하였고, 그 결과, 순환하는 엑소좀에서 miR-625-3p 발현이 건선에서 유의하게 높은 수준으로 발현될 뿐만 아니라 miR-625-3p 발현량이 건선 질병 중증도(severity)도 충실하게 반영하는 것을 확인함으로써 본 발명을 완성하였다.
본 발명은 건선의 중증도(severity)를 정확하게 진단할 수 있는 신규한 바이오마커를 제공하는 것을 목적으로 한다.
상기 목적을 달성하기 위하여, 본 miR-625-3p 바이오마커 검출용 물질을 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물을 제공한다.
본 발명에 있어서, 상기 검출용 물질은 상기 miR-625-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 조성물은 miR-4488 바이오마커 검출용 물질 및/또는 miR-342-3p 바이오마커 검출용 물질을 추가로 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 검출용 물질은 상기 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 포함하는 것을 특징으로 할 수 있다.
본 발명은 또한, 건선 중증도 진단을 위한 miR-625-3p 바이오마커의 용도를 제공한다.
본 발명은 또한, 건선 중증도 진단을 위한 시약의 제조를 위한 miR-625-3p 바이오마커의 용도를 제공한다.
본 발명은 또한, 건선 중증도 진단이 필요한 대상체에서 miR-625-3p 바이오마커의 발현 수준을 측정하는 단계를 포함하는 건선 중증도 진단 방법을 제공한다.
본 발명은 또한, 상기 조성물을 포함하는, 건선 중증도 진단용 키트를 제공한다.
본 발명은 또한, (a) 환자로부터 분리된 시료 중 miR-625-3p의 발현 수준을 측정하는 단계; 및
(b) 상기 miR-625-3p의 발현 수준을 경증 건선 시료의 miR-625-3p 발현 수준과 비교하는 단계;를 포함하는, 중증도-중증 건선을 진단하기 위한 정보제공방법을 제공한다.
본 발명에 있어서, 상기 miR-625-3p의 발현 수준은, 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 또는 유전자칩을 이용하여 측정되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 시료는 조직, 세포, 혈액 또는 혈청 시료인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 시료는 조직, 세포, 혈액 또는 혈청으로부터 분리된 엑소좀을 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 정보제공방법은 상기 miR-625-3p의 발현 수준이 경증(mild) 건선 시료의 miR-625-3p 발현 수준과 비교하여 약 3.46배 이상 증가하는 경우, 중등도-중증(moderate to severe) 건선으로 진단하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 (a) 단계는 환자로부터 분리된 시료 중 miR-4488 및/또는 miR-342-3p의 발현 수준을 추가로 측정하고,
상기 (b) 단계는 상기 miR-4488의 발현 수준을 경증 건선 시료의 miR-4488 발현 수준과 비교 및/또는 상기 miR-342-3p의 발현 수준을 경증 건선 시료의 miR-342-3p 발현 수준과 비교하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 정보제공방법은 상기 miR-4488의 발현 수준이 경증 건선 시료의 miR-4488발현 수준과 비교하여 약 2.375배 이상 증가하는 경우 및/또는
상기 miR-342-3p의 발현 수준이 경증 건선 시료의 miR-342-3p 발현 수준과 비교하여 약 1.657배 이상 증가하는 경우, 중등도-중증 건선으로 진단하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 miR-4488 및/또는 miR-342-3p의 발현 수준은, 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 또는 유전자칩을 이용하여 측정되는 것을 특징으로 할 수 있다.
본 발명에 따른 건선 진단용 바이오마커는 건선을 분자수준에서 조기에 객관적으로 진단이 가능하고, 건선 질환의 중증도(severity)를 정확히 판별할 수 있어, 만성질환인 진단의 치료 효율을 증대시킬 수 있는 장점이 있다.
도 1은 건선 환자의 혈액 및 피부 조직을 채취하여 엑소좀을 추출한 후 miRNA를 next-generation sequencing (NGS) 기법으로 유의미한 차이를 보이는 miRNA (differentially expressed miRNA)를 스크리닝하고, 상승 및 하강 발현된 miRNA를 선택하여 이에 대하여 quantitative real-time PCR을 실행하여 발현 양상을 검증(validation)한 결과이다. 상관의 유의성은 Spearman's rank correlation test를 사용하여 테스트되었다. *P<0.05, **P<0.01.
도 1a는 엑소좀 miRNA의 획득 및 분석의 실험과정을 보여주는 모식도이다 (파란색 화살표(점선)는 스크리닝 단계를, 빨간색 화살표(실선)는 검증 단계를 나타낸다).
도 1b는 볼케이노 플랏 상의 차등적으로 발현된 유전자(Differentially Expressed Gene, DEG)를 나타낸다. 스크리닝된 엑소좀 miRNA는 볼드체로 표시하였다.
도 1c는 PASI >10인 건선 환자의 혈장에서 하향 조절된 miRNA를 나타낸다.
도 1d는 PASI >10인 건선 환자의 혈장에서 상향 조절된 miRNA를 나타낸다.
도 1e는 건선 환자의 피부에서 상향 조절된 miRNA의 qRT-PCR 결과를 나타낸다.
도 1f는 PASI 및 BSA에 대해 플롯팅된 피부 miR-625-3p 수준을 나타낸다.
도 2는 스크리닝에서 유의미한 차이를 보이는 상승 발현된 miRNA의 진단 정확도를 검증한 결과이다.
도 2a와 도 2b는 혈장 miR-625-3p, miR-4488 및 miR-342-3p 수준을 각각 건선 중증도 지수인 (a) PASI 및 (b) BSA에 대해 플롯팅한 결과이다. 상관의 유의성은 Spearman's rank correlation test를 사용하여 테스트되었다.
도 2c는 각 상향조절된 엑소좀 miRNA의 ROC(수신기 작동 특성) 곡선 및 관련 AUC 값을 통해 민감도와 특이도를 확인한 결과이다.
도 2d는 베체트병 환자의 활성, 불활성 상태에 따라 치료 전/후의 엑소좀 miRNA 수준 분석을 위한 실험 과정을 보여주는 모식도이다.
도 2e는 베체트병 환자의 활성, 불활성 상태에서 따라 혈장에서 엑소좀을 추출하여 qRT-PCR을 실행하여 miRNA 발현 차이를 확인한 결과이다.
도 2f는 베체트병 환자의 치료 전/후의 혈장에서 엑소좀을 추출하여 qRT-PCR을 실행하여 치료 후 PASI 50 이상 호전을 보인 그룹과 아닌 그룹간의 miRNA 발현 차이를 확인한 결과이다. *P < 0.05.
도 3은 파라핀 조직에서 in situ hybridization (ISH) 기법을 통해 엑소좀 miRNA의 기원을 확인한 결과이다.
도 3a와 3b는 각각 (a) 저전력장(x100) 및 (b) 고전력장(x400)에서 ISH를 통해 피부의 miR-625-3p 발현을 검출한 결과이다.
도 3c와 3d는 상승발현된 miRNA가 각질세포 기원인지 T 세포 기원인지 확인하고자, HaCaT 세포와 JurkaT 세포를 이용하여 (c) 수집된 세포 및 (d) 상등액에 IL-12 (Th1), IL-23 (Th17)을 처리하고 qRT-PCR을 통해 miR-625-3p와 miR-4488의 발현량을 확인한 결과이다. *P < 0.05 및 **P < 0.01.
도 4는 miRNA데이터베이스를 통해 miR-625-3p의 IGF-1 신호 전달 체계와의 연관 가능성 확인한 결과이다. 데이터는 평균 ± SEM으로 표시하였다. 막대 위의 수평선은 범주 간의 통계적 차이와 통계적 비교를 나타낸다. *P < 0.05, **P < 0.01, 및 ****P < 0.0001.
도 4a는 3개의 miRNA 데이터베이스(miRDB/TargetScan/miRTarBase)를 사용하여 miR-625-3p의 표적 및 기능을 예측한 결과이다.
도 4b는 miR-625-3p mimic을 트랜스펙션 한 후 발현양을 확인한 결과이다.
도 4c는 miR-625-3p mimic을 트랜스펙션 한 후 IGF-1 신호전달 유전자들의 qRT-PCR 결과이다.
도 4d는 miR-625-3p mimic을 트랜스펙션 한 후 48시간 동안 배양된 HaCat 세포에서 Akt 단백질의 웨스턴 블로팅 분석 결과이다.
도 4e는 miR-625-3p mimic을 트랜스펙션 한 후 세포 분열시 증가하는 Ki67 유전자의 발현량 증가를 확인한 결과이다.
도 4f는 miR-625-3p mimic을 트랜스펙션 한 후 24, 48 및 72시간 동안 상이한 도파민 농도에서 HaCaT 세포 생존을 CCK8 분석으로 확인한 결과이다.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 명세서 및 특허청구범위에서 사용된 특징부의 크기, 양 및 물리적 특성을 표현하는 모든 수는 모든 경우 용어 "약"에 의해 수식되는 것으로 이해되어야 한다. 따라서, 반대로 나타내지 않는 한, 명세서 및 특허청구범위에 개시된 수치 파라미터는 본 명세서에 개시된 교시 내용을 이용하여 당업자가 얻고자 하는 원하는 특성에 따라 달라질 수 있는 근사치이다.
본 발명에서는 순환하는 엑소좀 내 miRNA로 객관적으로 건선을 진단할 수 있는 miR-625-3p를 신규한 건선 중증도 진단용 바이오마커로 확인하였다. 건선 진단에서 miR-625-3p 발현량은 중증도에 따라 현저히 유의한 상관관계를 나타내 miR-625-3p는 건선 질환 중증도도 반영하는 바이오마커인 것을 확인하였다.
따라서, 본 발명은 일 관점에서 miR-625-3p 바이오마커 검출용 물질을 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물에 관한 것이다.
본 발명에 있어서, 상기 검출용 물질은 상기 miR-625-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 miR-625-3p 바이오마커는 건선 중증도 (psoriasis disease severity) 판별이 가능한 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 조성물은 miR-4488 바이오마커 검출용 물질 및/또는 miR-342-3p 바이오마커 검출용 물질을 추가로 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 검출용 물질은 상기 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본원에 사용된 용어 "miR" "miRNA" 또는 "마이크로 RNA" 또는 “마이크로알엔에이”는 표적 RNA의 분해(degradation)를 촉진시키거나 또는 그들의 번역을 억제시킴으로써 유전자 발현을 전사 후에 조절하는 21 내지 23개의 비코딩 RNA를 말한다. 본원에 사용된 miRNA의 성숙 서열은 miRNA 데이터베이스(http://www.mirbase.org)에서 얻을 수 있다.
일반적으로 마이크로 RNA는 pre-miRNA라 불리는 헤어핀 구조를 갖는 약 70-80 nt(nucleotide) 길이의 stem-loop(일차(primary) miRNA 또는 pri-miRNA) 전구체로 전사된다. 이러한 pri-miRNA는 수 개의 miRNA 전구체 (precursor)를 포함할 수 있으며, 효소의 작용에 의해 헤어핀 구조를 갖는 전구체 miRNA(pre-miRNAs)로 처리된다. 이어 pre-miRNA는 핵밖으로 이동하여 세포질에서 RNase 효소(Dicer)에 의해 헤어핀 구조가 잘린다. 이 과정에서 Dicer는 헤어핀의 3' 말단에 결합을 하여 3'과 5' 암(arm)을 연결하는 루프를 자르고 불안정한 형태의 이중가닥 miRNA가 형성되고, 궁극적으로 성숙한 miR-3p 및 miR-5p가 형성된다.
본원에 따른 miR-625-3p는 상술한 바와 같이 헤어핀 구조를 갖는 pre-miRNA miR-625의 3p 말단으로부터 유래한다. 본원에서는 특히 miR-625-3p가 건선 환자에서 상승발현하는 것을 발견하였다. 본원에 따른 miR-625-3p 바이오마커는 성숙한 miR-625-3p는 물론 이를 생산할 수 있는 전구체 pre-miR-625를 포함한다.
본 발명의 일 양태에서, miR-625를 포함하는 인간유래 pre-miR-625은 서열번호 1: AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUGUAAUUA GAUCUCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCCCU 으로 표시될 수 있고, miR-625-3p는 서열번호 2: GACUAUAGAACUUUCCCCCUCA 로 표시될 수 있으며, 서열번호 1에서 밑줄친 부분은 루프를 이루는 서열이다. pre-miR-625는 루프를 기준으로 5p 및 3p를 서열을 모두 포함하며, 검출을 위해서, 후술하는 프로브 및/또는 프라이머가 사용되는 경우에는 3p를 특이적으로 인식하도록 디자인되는 것이 바람직하다.
본 발명의 다른 양태에서, miR-4488을 포함하는 인간유래 pre-miR-4488 서열은 서열번호 3: GGUAGGGGGCGGGCUCCGGCGCUGGGACCCCACUAGGGU GGCGCCUUGGCCCCGCCCCGCCC으로 표시될 수 있고, miR-4488는 서열번호 4: AGGGGGCGGGCUCCGGCG 로 표시될 수 있다.
본 발명의 또 다른 양태에서, miR-342를 포함하는 인간유래 pre-miR-342은 서열번호 5: GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGA CAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA 으로 표시될 수 있고, miR-342-3p는 서열번호 6: UCUCACACAGAAAUCG CACCCGU으로 표시될 수 있으며, 서열번호 5에서 밑줄친 부분은 루프를 이루는 서열이다. pre-miR-342는 루프를 기준으로 5p 및 3p를 서열을 모두 포함하며, 검출을 위해서, 후술하는 프로브 및/또는 프라이머가 사용되는 경우에는 3p를 특이적으로 인식하도록 디자인되는 것이 바람직하다.
본원에서 용어 “바이오마커” 또는 진단 마커(diagnosis marker)란 건선이 발생한 환자 유래의 시료를 대조군과 구분하여 진단할 수 있는 물질로, 대조군에 비하여 질환이 발생한 환자 또는 질환의 심각도가 높은 환자 유래의 시료에서 증가된 발현 양상을 보이는 비코딩 핵산을 포함한다.
본원에서 용어 “진단”은 특정 질병 또는 질환에 대하여 검사 대상자의 질환에 대한 감수성(susceptibility)을 판정하는 것, 특정 질병 또는 질환을 현재 가지고 있는지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 대상자의 예후(prognosis)를 판정하는 것, 질환의 치료 후 재발 여부 또는 테라메트릭스(therametrics)(예컨대, 치료효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다.
본원에 따른 바이오마커는 정량적 및/또는 정성적 분석을 통해 miRNA의 존재 여부의 검출 및/또는 이의 발현량 자체, 발현량의 변화, 발현량 차이의 수준에서 검출되어 건선의 진단에 사용될 수 있다.
본원에 따른 상기 검출용 물질은 miRNA 또는 이의 cRNA 또는 cDNA의 존재 여부의 검출 및/또는 이의 발현량 자체, 발현량의 변화, 발현량 차이를 검출할 수 있는 물질로, 상기 조성물은 상기 검출용 물질과 함께 상기 검출용 물질이 상기 바이오마커를 검출하기에 적합한 시약을 추가로 포함할 수 있다.
일 양태로서 상기 검출용 물질은 본원에 개시된 miRNA 또는 이의 cRNA 또는 cDNA에 특이적으로 결합하는 프로브를 포함한다. 프로브는 주형으로서 단일가닥의 RNA 또는 DNA에 특이적으로 상보적으로 결합하며, 역전사효소 또는 DNA 중합효소가 주형의 복제를 개시할 수 있도록 하는 자유 3'말단 수산화기(free 3' hydroxyl group)를 가지는 핵산분자를 일컫는 것으로, 이는 주형 또는 표적에의 특이적 결합에 의해, 표적의 정성 및/또는 정량적 측정을 가능하게 하며, 후술하는 바와 같이 다양한 방법에 사용될 수 있으며, 또한 증폭된 산물의 검출을 위해 후술하는 바와 같이 발색, 발광 또는 형광물질과 같은 것으로 표지될 수 있다.
당업자라면, 본원 및 miRBase에 개시된 miR-625-3p, miR-4488 또는 miR-342-3p의 서열을 참조하여, 본원에 따른 적절한 프로브 서열을 선택할 수 있을 것이다.
또 다른 양태로서 본원에 따른 검출용 물질은 본원에 개시된 miRNA 또는 이의 cRNA 또는 cDNA에 특이적으로 상보적으로 결합하며, 역전사효소 또는 DNA 중합효소가 주형의 복제를 개시할 수 있도록 하는 자유 3'말단 수산화기(free 3' hydroxyl group)를 가지는 프라이머이다. 프라이머는 일반적으로 핵산 증폭 반응에서 표적 핵산의 증폭 대상의 부위의 양 말단 부근에 결합하도록 고안되며, 이는 주형(또는 표적)에 특이적으로 결합하여, 주형 또는 표적 물질의 정성 및/또는 정량적 분석을 가능하게 하며, 후술하는 바와 같이 다양한 방법에 사용될 수 있다. 또한 증폭된 산물의 검출을 위해 후술하는 바와 같이 발색, 발광 또는 형광물질과 같은 것으로 표지될 수 있다.
당업자라면, 본원 및 miRBase에 개시된 miR-625-3p, miR-4488 또는 miR-342-3p의 서열을 참조하여, 본원에 따른 적절한 프로브 서열을 선택할 수 있을 것이다.
또 다른 구현예에서 본원에 따른 검출용 물질은 본원에 개시된 miRNA 또는 이의 cRNA 또는 cDNA에 특이적으로 결합하는 프로브 및 프라이머 쌍을 포함하며, 이 경우 상기 프로브는 상기 프라이머 쌍의 사이에 위치한다.
본원에 따른 miR-625-3p, miR-4488 또는 miR-342-3p을 검출할 수 있는 프로브 및/또는 프라이머는 공지된 다양한 방법에 사용될 수 있으며, 구체적으로 사용되는 방법에 맞추어 다양한 시약이 본원에 따른 조성물에 또한 포함될 수 있다.
이러한 방법은 예를 들면 핵산 혼성화, 중합, 증폭 방법 및 혼성화 기반 라이게이션 등을 포함하나 이로 제한하는 것은 아니다.
핵산 혼성화은 핵산이 고상의 지지체, 예를 들면 비드, 나노입자 또는 바이오칩 어레이(마이크로에레이)에 결합된 형태로 또는 인시츄 혼성화을 이용하여 수행될 수 있다. miRNA 마이크로어레이 기술은 동시에 다수의 miRNA의 분석을 가능하게 한다. 본원에 따른 miRNA에 상보적인 뉴클레오타이드는 코팅된 고상지지체에 스폿팅되거나 또는 인시츄 합성 방법으로 고상지지체에 스폿팅될 수 있다. 실시예에서 생물학적 시료로부터 분리된 miRNA는 상기 고상지지체 상의 상보적인 서열, 예를 들면 프로브와의 혼성화혼성화 효소반응에 의해 검출되는 표지(예를 들면 바이오틴, 형광염료)의 혼입에 의해 검출될 수 있다. 다른 실시예에서, 생물학적 시료에서 분리된 miRNA는 형광물질로 표지되어, 상응하는 서열과 결합하고, 그 결과 방출된 형광신호는 특정 miRNA의 존재를 나타낸다. 마이크로어레이 제조 기술은 예를 들면 Schena et al., 1996, Proc Natl Acad Sci USA.93(20):10614-9; Schena et al., 1995, Science 270(5235):467-70; 및 U.S. Pat. Nos. 5,599,695, 5,556,752 또는 5,631,734를 참조할 수 있다. 이런 경우, 검출용 물질 또는 시약은 고상의 지지체에 결합된 형태로 제공될 수 있다. 검출시약은 검출을 위해 직접적 또는 샌드위치 형태로 간접적으로 표지될 수 있으며, 후술하는 바를 참조할 수 있다.
본원에 따른 miRNA의 검출에는 핵산 중합 또는 증폭 방법이 또한 사용될 수 있으며, 특히 미량으로 존재하는 miRNA 검출에 적합하다. 공지된 다양한 핵산 증폭 또는 합성 방법이 사용될 수 있으며, 예를 들면 역전사 반응, 역전사 중합효소연쇄반응(RT-PCR), 실시간 RT-PCR, PCR, 실시간 PCR, 정량 RT-PCR, 정량 PCR, NASBA(Nucleic Acid Sequence-Base Amplification), LCR(Ligase Chain Reaction), 다중 연결 프로브 증폭(Multiple ligatable probe amplification), Invader 기술(Third Wave), SDA(Strand Displacement Amplification), TMA(Transcription Mediated Amplification), 및 Eberwine RNA 증폭 등을 포함할 수 있으나 이로 제한하는 것은 아니다.
전형적인 PCR 방법은 특정 표적 서열의 증폭을 위해, 주형의 변성, 포워드 및 리버스 프라이머가 표적 서열에 결합하는 어닐링 및 열안정 중합효소에 의한 신장의 단계로 구성되는 3 단계가 여러 주기 예를 들면 통상 20회 이상이 수행된다. 대안적으로 어닐링 및 신장은 동일한 단계에서 수행되기도 한다. 성숙한 miRNA는 단일가닥이기 때문에, PCR 전에 역전사 반응이 먼저 수행될 수 있다. 역전사 반응에는 프라이머와 역전사 효소의 사용을 필요로 한다.
PCR 및 정량 PCR에서는 포워드 및 리버스의 한 세트의 프라이머 또는 상기 프라이머와 함께 프로브가 사용될 수 있다. 프로브 및 프라이머의 길이는 혼성화온도, 표적 서열의 구성, 표적 서열의 복잡성 등과 같은 다양한 요소에 따라 결정된다. 예를 들면 프로브는 7 뉴클레오타이드 이상, 프라이머의 길이는 약 10 내지 35 뉴클레오타이드, 예를 들면 15, 20, 25, 30 또는 35 뉴클레오타이드이다. 포워드 프라이머는 바이오마커 miRNA에 특이적으로 결합할 수 있는 적어도 하나의 서열을 포함하며, 5'쪽에 비상보적 서열을 추가로 포함할 수 있다. 리버스 프라이머의 서열은 바이오마커의 서열과는 독립적일 수 있으며, 다수의 miRNA 바이오마커가 한 종류의 리버스 프라이머로 증폭될 수 있거나, 또는 바이오마커에 특이적인 하나 이상의 서열을 포함할 수 있다.
예컨대, miR-625-3p를 증폭시킬 수 있는 프라이머는 MystiCq®microRNA qPCR Assay Primer hsa-miR-625-3p일 수 있으나, 이에 한정되지는 않는다. 다른 양태로서, miR-625-3p를 증폭시킬 수 있는 프라이머는forward: 5'-GCGCAGGACTATAGAACTTTC-3' 및 reverse: 5'-GGTCCAGTTTTTTTTTTTTTTTGAG-3'일 수 있으나, 이에 한정되지는 않는다.
증폭 산물은 증폭 과정에서 또는 증폭 후에 당업계에 공지된 다양한 방법으로 분석될 수 있다. 이러한 방법은 당업계에 공지된 것으로서 예를 들면 젤 전기영동, 실시간 PCR 분석, SSCP(single strand conformational polymorphism), RFLP(restriction fragment length polymorphism), CZE(capillary zone electrophoresis), WAVE(HPLC-based nucleic acid analyzing technology), 마이크로칩을 포함하나, 이로 제한하는 것은 아니다.
본원에 따른 일 구현예에서는 역전사 반응 후에 실시간 정량 PCR 방법, 즉 RT-PCR이 사용되며, 이는 시료에서 RNA를 분리한 후, 이로부터 프라이머, 예를 들면 stem-loop를 형성할 수 있는 stem-loop 프라이머를 이용하여 cDNA를 합성한 후, 이를 주형으로 하여, 여기에, 포워드 및 리버스 프라이머, 또는 포워드 및 리버스 프라이머와 프로브의 조합을 사용하여 end-point로 또는 SYBR과 같은 핵산에 결합하는 염료를 사용하여 실시간으로, 또는 형광물질로 표지된 TaqMan 방식의 프로브를 사용한 stem-loop RT 기반의 핵산증폭방법이 사용된다. 이러한 방법은 예를 들면 Schmittgen, T.D. et al(2008) Real-time PCR quantification of precursor and mature microRNA. Methods 44, 31.8.; 및 Chen et al., Nucleic Acids Research, 33(20):e179, 2005 등을 참조할 수 있다.
또한 혼성화에 기반한 라이게이션 기술이 miRNA의 정량 분석에 사용될 수 있다. 이러한 방법은 당업계에 공지되어 있으며, 예를 들면 OLA(oligonucleotide ligation) 및 예를 들면 미국공개공보 2006-0078894에 기재된 HARP-유사 프로브를 사용한 방법과 같은 표적 핵산 서열에 결합한 검출가능한 프로브를 결합하지 않은 프로브로부터 분리해내는 방법 등을 포함하나 이로 제한하는 것은 아니다. 라이게이션을 이용한 다른 기술은 MLPA(Multiplex Ligation-dependent Probe Amplification)(Schouten et al., Nucleic Acids Research 30:e57 (2002))을 들 수 있다. 상기 기술은 한 쌍의 프로브가 표적서열에 나란히 결합한 경우에만 라이게이션이 일어나는 방식으로 결합하며, 라이게이션된 프로브는 PCR에 의해 증폭될 수 있도록 프라이머 결합부위를 포함한다.
상술한 바와 같은 혼성화, 증폭 및/또는 혼성화 기반 라이게이션 반응에서 표적의 염색 또는 표지, 프라이머 또는 프로브의 염색 또는 표지를 통해 혼성화 또는 증폭된 miRNA 산물을 검출할 수 있다. 검출에는 당업계의 공지의 기술이 사용될 있으며, 당업자라면 검출의 민감도 및/또는 표적의 양을 고려하여 적절한 방법을 선택할 수 있을 것이다. 검출 방법의 민감도 및/또는 표적의 양에 따라 검출 전에 증폭이 필요하지 않을 수도 있다.
또한 miRNA는 직접적 또는 간접적 방법에 의해 검출될 수 있다. 직접적 방법에서 miRNA는 이에 결합된 검출가능한 표지로 표지되고 이어 비드와 같은 고상지지체에 연결된 프로브에 결합된 후 표지된 miRNA를 스크리닝하여 검출된다. 대안적으로 직접 검출에 표지된 프로브가 사용될 수 있으며, miRNA와 특이적 결합 후 표지된 프로브의 스크리닝을 통해 검출된다. 실시예에서는 증폭된 miRNA는 목적하는 핵산을 캡쳐할 수 있는 프로브와 컨쥬게이션된 비드를 이용하여 검출된다. 다른 실시예에서 프로브는 형광물질로 표지될 수 있다. 간접적 검출방법이 또한 사용될 수 있다. 예를 들면 바이오티닐화 프로브를 스트렙타비딘 컨쥬게이트된 염료를 사용하여 결합된 핵산을 검출할 수 있다. 스트렙타비딘 분자는 증폭된 miRNA의 바이오틴 표지에 결합하며, 결합된 miRNA는 스트렙타비딘에 컨쥬게이트된 염료에 의해 검출된다. 이러한 스트렙타비딘에 컨쥬게이트된 염료는 당업계에 공지되어 있으며 예를 들면 Phycolink(R) Streptavidin R-Phycoerythrin (PROzyme)이 사용될 수 있다.
검출을 위한 표지자(label)는 이로 제한하는 것은 아니나, 광방출, 광산란, 광흡수 물질과 같은 검출가능한 형광, 화학발광 또는 생발광 신호를 생성 또는 소거할 수 있는 화합물을 포함하며, 예를 들면 Garman A., Non_Radioactive Labeling, Academic Press 1997을 참조할 수 있다. 형광 물질은 예를 들면 이로 제한하는 것은 아니다 플루오레신(예를 들면 미국특허 6,020,481), 로다민(예를 들면 미국 특허 6,191,278), 벤조페녹사진(예를 들면 미국특허 6,140,500), 공여체와 수용체를 포함하는 에너지 전이 형광 염료(예를 들면 미국특허 공개특허 10-2016-0022017 5,945,526) 및 사이아나인(예를 들면 WO1997-45539), 리사민, 파이코에리쓰린, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham), Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPYR6G,BODIPY-TMR, BODIPY-TRX, Cascade Blue, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, Tetramethylrhodamine, 및/또는 Texas Red는 물론 기타 검출가능한 신호를 생성할 수 있는 임의의 형광 모이어티를 포함한다. 형광염료는 6-carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; 및 2',4',5',7',1,4-hexachlorofluorescein를 포함하나 이로 제한하는 것은 아니다. 실시예에서는 형광 표지로 SYBR-Green, 6-carboxyfluorescein ("FAM"), TET, ROX, VICTM, 또는 JOE가 사용된다. 실시예에서는 리포터 형광물질과 소거형광물질의 두 개의 형광물질로 표지된 프로브가 사용되며, 이 경우 형광물질은 구분이 가능한 파장이 스펙트럼을 방출하는 형광물질이 사용된다.
또한 표지자는 핵산의 결합을 향상, 안정화 또는 핵산의 결합에 영향을 미칠 수 있는 화합물 예를 들면 에씨디움 브로마이드 및 SYBR-Green을 포함하는 인터칼레이터, 마이너그루브 결합체 및 가교가능한 작용기가 사용될 수 있으나, 이로 제한하는 것은 아니며, Blackburn et al., eds. "DNA and RNA Structure" in Nucleic Acids in Chemistry and Biology (1996)을 참조할 수 있다.
miRNA 정량은 또한 다음의 문헌을 참조하여 수행될 수 있으며, 예를 들면 miRNA microarrays (Calin, G.A. et al.(2004) Proc Natl Acad Sci USA 101,11755.60.), SYBR-based miRNA RT-qPCR assays (Sharbati-Tehrani et al.(2008) miR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complexsample. BMC Mol Biol 9, 34.), BeadArray (Chen, J. et al. (2008) Highly sensitive and specific microRNA expression profiling using BeadArray technology. Nucleic Acids Res 36, e87.), Invader Assays (Allawi, H.T. et al.(2004) Quantitationof microRNAs using a modified Invader assay. RNA 10, 1153.61.), 및 Padlock probe-based assays (Jonstrup, S.P. et al.(2006) AmicroRNA detection system based on padlockprobes and rolling circle amplification. RNA 12, 1747.52.)를 참조할 수 있다.
또한 프라이머와 프로브를 사용한 RT-PCR 기반의 상용화된 키트를 사용할 수 있으며, 예를 들면 Stem-loop RT based TaqMan®MicroRNA Assays (ThermoFisher Scientific, USA)가 사용될 수 있다.
따라서 본원에 따른 조성물은 상술한 방법 중 어느 하나 이상의 방법에 사용되는 시약을 포함할 수 있다.
본원에 따른 바이오마커 또는 이를 포함하는 조성물은 건선의 진단, 재발 예측 및/또는 예후 측정 및/또는 약물 치료 후 반응성 예측에 유용하게 사용될 수 있다.
본 발명은 다른 관점에서, 건선 중증도 진단을 위한 miR-625-3p 바이오마커의 용도에 관한 것이다. 이 경우, 본 발명은 miR-625-3p 바이오마커 검출용 물질을 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물의 건선 중증도 진단 용도로 해석될 수 있다.
본 발명은 또 다른 관점에서, 건선 중증도 진단을 위한 시약의 제조를 위한 miR-625-3p 바이오마커의 용도에 관한 것이다. 이 경우, 본 발명은 miR-625-3p 바이오마커 검출용 물질을 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물의 건선 중증도 진단을 위한 시약의 제조를 위한 용도로 해석될 수 있다.
본 발명은 또 다른 관점에서, 건선 중증도 진단이 필요한 대상체에서 miR-625-3p 바이오마커의 발현 수준을 측정하는 단계를 포함하는 건선 중증도 진단 방법을 제공한다.
상기 용도 또는 진단 방법에 있어서, 본 기술분야의 통상의 기술자에게 모순되게 해석되지 않는 한, 상기 진단용 조성물에 대한 상세한 설명은 본 발명에 따른 용도 및 진단방법에도 적용될 수 있을 것이다. 예컨대, 상기 miR-625-3p 바이오마커는 상기 miR-625-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 이용하여 그 발현 수준을 측정함으로써 건선 중증도 진단에 활용될 수 있다.
또 다른 양태로서, 상기 miR-625-3p 바이오마커는 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커와 함께 건선 중증도 진단에 활용할 수 있다.
따라서, 본 발명은 miR-625-3p 바이오마커와 더불어 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커의 건선 중증도 진단 용도를 함께 제공할 수 있다. 이 경우, miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커 검출용 물질을 추가로 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물의 건선 중증도 진단 용도로 해석될 수 있다. 또는, 본 발명은 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커 검출용 물질을 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물의 건선 중증도 진단을 위한 시약의 제조를 위한 용도로 해석될 수 있다.
본 발명에 있어서, 상기 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커는 상기 각 마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 이용하여 그 발현 수준을 측정함으로써 건선 중증도 진단에 활용될 수 있다.
본 발명은 다른 관점에서, 상기 조성물을 포함하는, 건선 중증도 진단용 키트에 관한 것이다.
상기 키트에 포함될 수 있는 시약 및 이를 이용한 검출은 앞서 언급한 바를 참조할 수 있다. 본원에 따른 일 양태에서, 키트는 핵산 증폭에 사용되며, 특히 RT-PCR을 이용한 증폭에 사용된다. 이 경우 키트는 RT-PCR의 반응에 필요한 프라이머 세트 및/또는 프로브, 완충액, 역전사 효소, Taq 폴리머라제를 포함할 수 있다. 다른 양태에서는 단일가닥 핵산을 제거할 수 있는 뉴클리아제를 추가로 포함할 수 있다. 당업계에 공지된 다양한 완충액이 사용될 수 있으며, 예를 들면 Tris-HCl, pH 9.0 완충액이 사용될 수 있으나 이로 제한하는 것은 아니다. 역전사 효소 및 Taq 폴리머라제는 시중에서 구입할 수 있으며, 예를 들면 폴리머라제로 hot start 반응이 가능한 AmpliTaq Gold (Applied Biosystems, USA)와 같은 것을 사용할 수 있으며, 적절한 농도 예를 들면 1.5mM 내지 2.5mM의 MgCl2가 포함될 수 있다.
본원에 따른 키트는 양성대조군, 음성대조군 및 사용설명서를 추가로 포함한다. 음성대조군으로는 miRNA를 포함하지 않는 시료, 양성대조군은 검출대상 miRNA 중 하나 이상을 포함할 수 있다.
본 발명은 또 다른 관점에서, 건선 중증도-중증 건선 진단방법이나 건선 진단 또는 예후에 필요한 정보를 제공할 수 있다.
따라서, 본 발명은 (a) 환자로부터 분리된 시료 중 miR-625-3p의 발현 수준을 측정하는 단계; 및 (b) 상기 miR-625-3p의 발현 수준을 경증 건선 시료의 miR-625-3p 발현 수준과 비교하는 단계; 를 포함하는, 중증도-중증 건선을 진단하기 위한 정보제공방법에 관한 것이다.
본 발명에 있어서, 상기 miR-625-3p의 발현 수준은, 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 또는 유전자칩을 이용하여 측정되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 시료는 조직, 세포, 혈액 또는 혈청 시료인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 시료는 조직, 세포, 혈액 또는 혈청으로부터 분리된 엑소좀을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 miR-625-3p의 발현 수준이 경증 시료의 miR-625-3p 발현 수준과 비교하여 약 3.46배 이상 증가하는 경우, 중증도-중증 건선으로 진단하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 (a) 단계는 환자로부터 분리된 시료 중 miR-4488 및/또는 miR-342-3p의 발현 수준을 추가로 측정하고,
상기 (b) 단계는 상기 miR-4488의 발현 수준을 경증 건선 시료의 miR-4488 발현 수준과 비교 및/또는 상기 miR-342-3p의 발현 수준을 경증 건선 시료의 miR-342-3p 발현 수준과 비교하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 miR-4488의 발현 수준이 경증 건선 시료의 miR-4488발현 수준과 비교하여 약 2.375배 이상 증가하는 경우 및/또는
상기 miR-342-3p의 발현 수준이 경증 건선 시료의 miR-342-3p 발현 수준과 비교하여 약 1.657배 이상 증가하는 경우, 중등도-중증 건선으로 진단하는 것을 특징으로 할 수 있다.
즉, 본 발명에서는 miR-625-3p의 발현 수준과 함께 miR-4488 및/또는 miR-342-3p의 발현 수준을 추가로 검증하여 중등도-중증 건선으로 진단할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 miR-4488 및/또는 miR-342-3p의 발현 수준은, 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 또는 유전자칩을 이용하여 측정되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본원에 따른 방법이 구현되는 구체적 수단(방법) 및 검출용 시약 등은 앞서 기술한 바를 참조할 수 있다.
본원에서 상기 시료는 생물학적 시료일 수 있으며, "생물학적 시료"란 생물유래의 장기, 조직, 세포 또는 체액을 일컫는 것이다. 생물학적 시료의 예로는 조직 절편, 전혈, 혈장, 혈청, 소변 또는 혈액 유래의 백혈구, 적혈구 또는 혈소판, 또는 조직 또는 세포 배양물을 포함하나 이로 제한하는 것은 아니다. 또한 하나 이상의 상기 시료가 혼합되어 사용될 수 있다. 이러한 생물학적 시료는 검사 직전에 건선이 의심되는 환자로부터 통상의 시료 수득방법에 의해 대상체로부터 직접 수득한 것이거나 또는 종전에 분리되어 보관된 것일 수 있다. 본원에 따른 실시예에서는 피부 조직 또는 혈액 시료가 사용된다. 본 발명은 건선이 발병한 또는 발병이 의심되는 또는 발병 가능성이 있는 대상체에서 수득한 피부 조직 또는 혈액이 사용될 수 있으나, 이로 제한하는 것은 아니다.
본원에서 대상체는 질환에 걸린 것으로 의심되는 포유류, 질환에 걸린 후 치료가 되었으나 재발이 의심되는 포유류, 특히 인간을 포함한다.
본원에서, 상기 대상체 (예컨대, 중증 환자)의 miR-625-3p, miR-4488 및/또는 miR-342-3p의 발현 수준을 각각 경증 환자 시료의 miR-625-3p, miR-4488 및/또는 miR-342-3p 발현 수준과 비교하는 경우, 진단의 정확도를 위하여, 상기 대상체 시료 및 정상 시료는 miR-103-3p로 정규화 한 후 상기한 바이오마커의 발현 수준을 비교하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않으며, miR-103-3p은 세포 내 발현량이 균일한 다른 miRNA로 정규화 할 수 있음을 본 기술분야에서 자명하다.
본원에 따른 조성물은 생물학적 시료에서 상기 하나 이상의 miRNA의 발현량을 검출하고, 이를 대조군 또는 참조군과 비교하여, 그 발현량의 감소, 변화 정도에 따라 건선 진단 또는 재발 또는 발생위험도를 예측할 수 있다.
본원에 따른 방법에서 대조군은 중증도-중증 건선 질환과 차별적 발현을 나타내는 시료로서, 경증 건선 질환을 가지는 동종의 대상체로부터 유래한 시료가 사용된다.
본원에 따른 일 양태에서, 상기 miR-625-3p의 발현 수준을 경증 건선 시료의 miR-625-3p 발현 수준과 비교하여 상기 miR-625-3p의 발현 수준이 증가한 경우, 예컨대, 약 10%, 약 20%, 약 30%, 약 40%, 약 50%, 약 60%, 약 70%, 약 80%, 약 90%, 또는 약 100% 이상 증가한 경우, 중증도-중증 건선으로 판정 또는 발생위험도가 증가 또는 높은 것으로 판단할 수 있다.
본원에 따른 또 다른 양태에서, 상기 miR-625-3p의 발현 수준의 증가와 함께 miR-4488 및/또는 miR-342-3p의 발현 수준을 경증 건선 시료의 miR-4488 및/또는 miR-342-3p의 발현 수준과 비교하여 상기 miR-4488 및/또는 miR-342-3p의 발현 수준이 증가한 경우, 예컨대, 약 10%, 약 20%, 약 30%, 약 40%, 약 50%, 약 60%, 약 70%, 약 80%, 약 90%, 또는 약 100% 이상 증가한 경우, 중증도-중증 건선으로 판정 또는 발생위험도가 추가로 증가 또는 더 높은 것으로 판단할 수 있다.
본원에 따른 바이오마커는 기존의 마커 및/또는 진단방법등과 함께 사용될 수 있다. 예를 들면, PASI 및 BSA 결과와 함께 사용될 수 있다.
본 발명의 정보제공방법에서, 경증 건선 시료의 miRNA 발현 수준은 문헌에 공개되거나 미리 측정된 값일 수 있으며, 경증 건선이 발병된 개체에서 미리 측정될 수 있다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1. 건선 환자에서 건선 특이적 및 질병 활성도 차이에 따른 엑소좀 유래 miRNA 발현 양상 확인
본 발명에서 환자를 대상으로 한 실험은 아주대학교병원 기관심의위원회(IRB 번호: AJIRB-BMR-OBS-15-398)의 승인을 받아, 헬싱키 원칙 선언에 따라 수행되었으며, 모든 시험 참여자의 사전 동의를 받아 수행되었다.
건선의 진단은 피부 생검에서 임상적 특징과 조직학적 특징에 기초하여 이루어졌다. PASI 및 BSA는 샘플링 당일에 평가하였다.
건선 환자로부터 혈장 샘플은 혈청 분리기 튜브 및 EDTA 처리된 튜브에서 수집한 후 4℃에서 10분 동안 3,000rpm으로 즉시 원심분리하였다.
PASI > 10 점 이상인 환자 5명 및 PASI < 5 점인 환자 3명의 혈액을 대상으로 차등 발현된 miRNA(differentially expressed (DE) miRNAs)를 선별하고자 차세대 염기서열 분석(next generation sequencing, NGS)을 시행하였다 (도 1a, 파란색 화살표(점선)).
이를 위하여, miRCURYTM Exosome isolation kit(Qiagen, Hilden, Germany)를 사용하여 혈장에서 엑소좀을 추출하고 제조사의 지침에 따라 RNA 분리 키트(miRNeasy Serum/Plasma Kit; Qiagen, Hilden, Germany)를 사용하여 엑소좀에서 총 miRNA를 추출하였다.
제조사 지침에 따라 변성된 주형의 클러스터 증폭 후, Illumina 서열분석용 NovaSeq6000 S4 플랫폼(Illumina, CA, USA)을 사용하여 페어드 엔드(150bp)로 시퀀싱을 진행하였다
miRNA 발현 수준은 miRBase(Nucleic acids research. 2014;42(D1):D68-D73)에서 추출할 수 있는 hairpin 및 성숙한 miRNA 서열 정보와 함께 종의 유전자 주석 데이터베이스를 사용하여 mirdeep2(Nucleic acids research. 2012;40(1):37-52)로 측정되었다. DEmiRNA 분석을 위해 miRNA 수준 카운트 데이터는 mirdeep2를 사용하여 생성되었다. 계산된 리드 카운트 데이터(read count data)를 기반으로 DEmiRNA는 태그 카운트 데이터(tag count data)를 비교하기 위해 강력한 정규화 전략을 위한 TCC R 패키지(BMC bioinformatics. 2013;14(1):1-14)를 사용하여 식별되었다. 정규화 인자는 반복 DEGES/edgeR 방법을 사용하여 계산되었다. Q-값은 기본 매개변수 설정과 함께 R 패키지의 p.adjust 기능을 사용하여 p-값을 기반으로 계산되었다. DEmiRNA는 다중 테스트로 인한 오류를 수정하기 위해 0.05 미만의 q-값 임계값을 기반으로 식별되었다 (Journal of the Royal statistical society: series B (Methodological). 1995;57(1):289-300).
그 결과, 검출된 총 805개의 miRNA 중에서 19개의 유의미한 DE miRNA, 즉, 9개의 상향 조절 및 10개의 하향 조절된 miRNA를 식별하였다 (도 1b). 폴드 변화와 p-값을 기반으로 각각 상향 조절된 miRNA의 miR-625-3p, miR-4488 및 miR-342-3p와 하향 조절된 miRNA의 miR-5698, miR-1255b-5p 및 miR323a-5p의 miRNA를 선별하였다.
더 많은 수의 환자에 대하여 앞서 선별된 miRNA의 바이오마커로의 사용 가능성을 검증하기 위하여 PASI 점수(PASI <5, 5≤ PASI <10, PASI ≥10, 각 그룹은 14명의 환자로 구성됨)에 따라 분류된 조직 샘플을 이용하여 qRT-PCR을 수행하였다 (도 1a, 빨간색 화살표(실선)).
건선 환자로부터 혈장 샘플에서의 총 RNA 추출은 상술한 바와 동일한 절차로 진행하였으며, 건선 환자로부터 피부 조직 샘플은 3mm 일회용 생검 펀치를 사용하여 건선 병변에서 수득하였고, 환자의 급속 냉동 조직 샘플은 분석 시점까지 아주대학교 병원 인간 바이오뱅크(AUHHB) 내 -80℃질소 탱크에 보관하였다. 피부 조직 샘플을 QIAzol Lysis Reagent에서 균질화하고 TissueLyser II (Qiagen, Hilden, Germany)를 사용하여 병변 조직을 분쇄하여 총 RNA를 추출하였다.
cDNA는 제조사의 지침에 따라 miRCURY LNA RT Kit(Qiagen)와 함께 miRCURY LNA miRNA PCR Assays(Qiagen)를 사용하여 추출된 총 RNA로부터 합성하였으며, 총 RNA의 양과 질은 분광광도법(NanodropTM ND-1000, ThermoFisherScientific, Copenhagen, Denmark)으로 평가하였다.
qRT-PCR은 QuantStudio 3 Real-Time PCR System(Applied Biosystems, Foster City, CA, USA)을 사용하여 수행되었다. qRT-PCR로 얻은 miRNA 발현 값은 miR-103-3p로 정규화하였다(International journal of molecular sciences. 2019;20(18):4353). 이후 상대표준곡선법(2-ΔΔ을 이용하여 결과를 정량적으로 분석하였다.
그 결과, 선별된 하향 조절된 miRNA는 그룹 간에 유의한 발현 차이를 나타내지 않았지만(도 1c), 선별된 상향 조절된 miRNA는 모두 PASI < 5 그룹과 PASI ≥ 10 그룹 사이에서 유의한 발현량 차이를 보였으며, 특히 miR-4488과 miR-625-3p 모두 PASI < 5 그룹과 5≤ PASI <10 그룹 사이에 상당한 발현량 차이를 보여주었다 (도 1d).
한편, 피부 조직에서 분리된 엑소좀 miRNA를 사용한 결과에서도, miR-625-3p는 PASI<5군과 5≤ PASI<10군, PASI<5군과 PASI≥10군에서 유의한 차이를 나타내었다 (도 1e). 특히, miR-625-3p는 PASI와 BSA 사이에 강한 연관성(0.60 ≤ρ)을 가진 miRNA 였다 (도 1f, miR-4488 및 PASI: Spearman ρ: 0.5862, p = 0.0236, miR-342-3p 및 PASI: Spearman ρ: 0.3718, p = 0.1719).
실시예 2. miR-625-3p와 건선 중증도와의 상관성과 질병 특이성 및 치료 반응에 따른 발현 확인
실시예 1에서 추가로 분석된 건선 환자 42명의 상승 발현된 miR-625-3p, miR-4488 및 miR-342-3p의 상대적인 발현량과 건선 중증도 지수인 PASI 또는 BSA와의 관련성을 스피어만 상관분석을 통해 분석하였다.
그 결과, 선별된 3 종류의 miRNA는 발현 수준과 PASI 사이에 유의한 상관관계(p < 0.0001)를 나타내었으나 miR-625-3p는 예외적으로 높은 수준의 상관관계를 나타내었다 (도 2a). BSA와의 상관관계에서도 유사한 결과가 관찰되었는데, miR-625-3p가 다른 miRNA에 비해 상관계수 값이 가장 높은 것으로 나타났다 (도 2b).
한편, 상승 발현된 miRNA가 PASI < 10, PASI ≥ 10인 두 환자군을 어느 정도 예측할 수 있는지 ROC curve를 통해 분석하였다.
그 결과, ROC 곡선에서 AUC 값에서 miR-4488도 유의한 결과가 확인되었으나, 특히, miR-625-3p는 AUC 값이 0.9515의 예외적인 값으로 가장 높아, 경증 건선(PASI <10)과 중증 건선(PASI ≥10)을 구별하는 건선 질환 중증도 판별을 위한 바이오마커로서의 진단적 가치를 확인할 수 있었다.
한편, miRNA가 건선 특이적이지 않은 염증의 마커일 가능성을 배제하기 위하여 베체트병(BD) 환자의 순환하는 엑소좀 miRNA를 추가로 분석하였다(도 2d, 파란색 화살표(점선)).
이를 위하여, 베체트병 환자 12명의 혈장을 채취하여 엑소좀을 추출 후 활성(active)/불활성(inactive) 또는 경구약제의 치료 반응 유/무에 따라 선정된 miRNA가 치료 반응을 반영하는지 qRT-PCR을 통해 확인하였다. 시료 준비와 qRT-PCR은 실시예 1과 동일한 방법으로 수행하였다.
그 결과, 반응자(치료 후 PASI 50에 도달한 사람들)는 miR-625-3p 발현량에서 상당한 감소를 나타내었다(도 2f). 따라서, miR-625-3p가 건선 활성을 가장 정확하게 나타낼 수 있는 바이오마커임을 알 수 있었다.
실시예 3. 엑소좀 유래 (exosomal) miR-625-3p의 기원 확인
피부 조직에서 엑소좀 miR-625-3p의 해부학적 위치를 식별하기 위하여 환자의 파라핀화된 피부 조직에서 ISH (in situ hybridization)를 수행하였다.
ISH를 위하여 포르말린으로 고정된 파라핀이 포매된 절편을 6-μm 두께로 절단하여 슬라이드에 마운팅하고, miRCURY LNA miRNA Detection Probe(Qiagen)를 사용하여 제조사 지침에 따라 실험을 진행하였다. 간단히 서술하면, 환자의 병변 표본의 절편을 탈파라핀화하고 37℃에서 10분 동안 proteinase K로 처리하였다. hsa-miR-625-3p 및 hsa-miR-4488에 대한 LNA 검출 프로브(Qiagen, 5'-DIG- 및 3'-DIG-표지됨)를 miRNA ISH 완충액(Qiagen)에 추가하여 혼성화 믹스를 준비하였다. 하이브리드화 믹스를 인큐베이션된 슬라이드에 적용하고 55℃내지 60℃범위의 온도로 하이브리드화기에 넣었다. 이후 슬라이드를 5X SSC, 1X SSC 및 0.2X SSC 완충액으로 세척하고 0.2X SSC 완충액으로 60℃에서 1시간 동안 인큐베이션하였다. 이를 완전히 세척한 후, RT에서 1시간 동안 알칼리성 포스파타제(AP)-접합된 항-DIG Ab로 절편을 배양하여 프로브를 검출하였다. U6는 핵에 염색되는 양성 대조군, Scram은 음성 대조군으로 사용하였다.
그 결과, miR-625-3p는 침윤성 면역 세포가 아닌 기저 각질세포에서 확인되었다 (도 3a). 한편, 고전력장에서 miR-625-3p는 핵 (U6으로 염색됨)이 아닌 기저 각질세포의 세포질과 세포외 기질에서 관찰되었다 (도 3b).
이에, miR-625-3p가 건선 기저 각질세포에서 유래한다고 가정하고, 유사한 조건을 모방하기 위하여 IL-12 (Recombinant Human IL-12 (Cat No. 573002) BioLegend)및 IL-23 (Recombinant Human IL-23 (Cat No. 1290-IL) Bio-Techne)(각각 50ng/ml)으로 HaCaT 세포 또는 JurkaT 세포를 자극한 후, qRT-PCR을 통해 miR-625-3p와 miR-4488의 발현량을 확인하였다.
이를 위하여, Immortalized human keratinocytes(HaCaT) 세포와 T(Jurkat) 세포를 배양하였다. 세포주는 마이코플라스마에 대해 음성으로 테스트되었으며 10% 열-불활성화된 FBS가 보충된 L-글루타민이 포함된 RPMI 배지 1640에서 배양하였다. HaCaT 세포 및 Jurkat 세포는 12-웰 플레이트에 각각 4 x 104 세포 및 5 x 105 세포의 농도로 배양하였으며, 인터루킨(IL)-12 및/또는 IL-23을 각 웰 플레이트에 처리하였다. 24시간 후에 수확하고, HaCaT 및 Jurkat 세포 내 총 RNA는 제조사의 지침에 따라 miRNeasy Micro Kit(Qiagen)로 분리하거나, HaCaT 및 Jurkat 세포의 배양 상등액에서 제조사의 방법에 따라 QIAGEN exoRNeasy Midi Kit (Cat. No. 77144)로 엑소좀 추출 후, 실시예 1에 기재된 방법과 동일하게 qRT-PCR을 진행하였다.
그 결과, IL-12와 IL-23을 동시에 처리한 HaCaT 세포에서는 miR-625-3p가 유의하게 발현이 증가하였고 JurkaT 세포에서는 증가하지 않는 것으로 확인되었고 (도 3c), HaCaT 세포의 상등액 유래 엑소좀에서도 IL-12와 IL-23로 자극시 miR-625-3p 발현이 유의하게 증가하는 것으로 나타났다(도 3d). 따라서, 상기와 같은 결과로부터, 활성화된 각질세포가 miR-625-3p를 생산하고 이를 분비한다는 것을 알 수 있었다.
실시예 4. miR-625-3p와 IGF-1 신호 전달 체계와의 상관성 확인
건선에서 miR-625-3p의 표적을 확인하고자, miRNA 데이터베이스를 사용하여 miR-625-3p의 건선 발병에서 가능한 역할을 조사하고자 하였다.
이를 위하여 miRNA 표적 예측 및 기능 주석을 위하여 각각 miRDB(Nucleic Acids Research. 48(D1):D127-D131 (2020)), TargetScan(Genome Biol. 11:R90. (2010)) 및 miRTarBase(Nucliec Acid Res. 8;48(D1):D148-D154 (2020))와 같은 3개의 온라인 데이터베이스를 사용하였다. 그 결과, miRDB, TargetScan 및 mirRTarBase에서 각각 294개, 2906개 및 33개의 표적이 miR-625-3p의 표적으로 예측되었다. 상위 100개의 중복 유전자(3개 모두 중복되는 6개의 유전자, 임의의 2개와 중복되는 94개의 유전자)를 선택하고 Enrichr tool(BMC Bioinformatics 14, 128 (2013))을 사용하여 HGNC 명칭을 입력하고 KEGG 경로 및 GO 용어에 대한 농축 점수(P-값)를 얻었다. 각 범주에 대한 상위 4개(가장 낮은 P 값)를 기록하였다.
그 결과, miR-625-3p은 인슐린 유사 성장 인자(IGF)와의 상관성이 있을 수 있는 것으로 확인되었다 (도 4a).
이에, 사전 설계된 mirVanaTM miRNA Mimic (Negative control , Thermo Fisher Scientific (#4464058) (또는 mirVanaTM miRNA Mimic (has-miR-625-3p, Thermo Fisher Scientific, (#4464066)을 구입하여 50pmol 농도의 miRNA Mimic을 제조사에 방침에 따라 Lipofectamine® RNAiMAX reagent를 이용하여 트랜스펙션 시킨 후, (도 4b), 다양한 IGF-1 신호전달 유전자의 발현 수준을 확인하고자 실시예 1과 동일한 방법으로 하기 프라이머를 이용하여 qRT-PCR 분석하였다.
Gene name Forward Reverse
IGF1R GCA CCA TCT TCA AGG GCA ATT TG AGG AAG GAC AAG GAG ACC AAG G　
IGFBP1 AGG CTC TCC ATG TCA CCA AC CCT GTG CCT TGG CTA AAC TC　
IGFBP2 CCT CTA CTC CCT GCA CAT CC TGC CCG TTC AGA GAC ATC TT
IGFBP3 TGT GGC CAT GAC TGA GGA AA TGC CAG ACC TTC TTG GGT TT
IGFBP4 ACT CTG CTG GTG CGT CTA CC TAT CTG GCA GTT GGG GTC TC
GAPDH GAA CGG GAA GCT CAC TGG GCC TGC TTC ACC ACC TTC T　
그 결과, IGF1R의 유의한 증가와 IGFBP2 및 IGFBP3의 감소를 확인할 수 있었으며(도 4c), 이로부터 miR-625-3p이 IGF-1 신호전달체계를 강화시킬 수 있음을 알 수 있었다.
한편, IGF-1 신호 전달 체계가 강화된다면, IGF-1 신호 전달 체계에서 중추적인 역할을 하는 p-Akt의 증가를 관찰할 수 있다.
따라서, 이를 확인하고자 625-3p mimic이 트랜스팩션된 HaCaT 세포에 RIPA buffer (protease inhibitor cocktail이 포함된)을 이용하여 세포내 단백질을 분리하였다. 단백질 정량 후, sodium dodecyl sulfate (SDS) sample buffer에 단백질을 희석하여 5분간 끓인 다음 20 ug의 단백질을 10% SDS-polyacrylamid gel에 전기 영동하고 단백질을 PVDF membrane으로 이동시킨 후 5% skim milk로 블로킹 하였다. 각각 P-Akt (cell signaling; #9271, 1:1000), T-Akt (cell signaling; #9272, 1:1000), Actin (Bethyl; A300-491A, 1:5000)의 항체를 반응시킨 후 2차 항체를 반응시켜 Enhanced chemiluminescence system (Thermo Fisher Scientific)을 사용해 단백질 밴드를 확인하였다. 그 결과, 실제로 p-Akt가 증가되는 것을 알 수 있었다 (도 4d).
IGF-1의 증가된 신호전달체계는 세포 증식으로 이어질 수 있다. Ki67 유전자는 세포 분열시 발현량이 증가하는 바, Ki67 유전자의 발현량을 실시예 1에서와 같은 qRT-PCR (Ki67-Forward : 5'- GAGAGCTCCCAGCCTAAGGT, Reverse : 5'- CCTGCT TCTCCTTTCCCTTT) 방법으로 확인하고, D-Plus™CCK cell viability assay kit (Dougin; #CCK-3000)을 이용한 CCK8 분석법으로 세포 수 측정 분석 (Cell counting kit analysis)을 진행하였다.
그 결과, 625-3p mimic 트랜스펙션된 세포에서 Ki67 유전자의 유의미한 증가와 함께(도 4e), 생존 세포의 수도 상당한 증가를 관찰할 수 있었다 (도 4f). 따라서, 상기와 같은 결과로부터, miR-625-3p는 IGF-1 신호 전달 체계를 통하여 각질 세포 분열을 촉진한다는 것을 알 수 있었다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (13)

  1. miR-625-3p 바이오마커 검출용 물질을 포함하는, 건선 중증도 (psoriasis disease severity) 진단용 조성물.
  2. 제1항에 있어서, 상기 검출용 물질은 상기 miR-625-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 포함하는 것을 특징으로 하는, 건선 중증도 진단용 조성물.
  3. 제1항에 있어서, 상기 조성물은 miR-4488 바이오마커 검출용 물질 및/또는 miR-342-3p 바이오마커 검출용 물질을 추가로 포함하는 것을 특징으로 하는, 건선 중증도 진단용 조성물.
  4. 제3항에 있어서, 상기 검출용 물질은 상기 miR-4488 바이오마커 및/또는 miR-342-3p 바이오마커에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드 중 어느 하나 이상을 포함하는 것을 특징으로 하는, 건선 중증도 진단용 조성물.
  5. 제1항 내지 제4항 중 어느 한 항의 조성물을 포함하는, 건선 중증도 진단용 키트.
  6. (a) 환자로부터 분리된 시료 중 miR-625-3p의 발현 수준을 측정하는 단계; 및
    (b) 상기 miR-625-3p의 발현 수준을 경증 건선 시료의 miR-625-3p 발현 수준과 비교하는 단계;를 포함하는, 중증도-중증 건선을 진단하기 위한 정보제공방법.
  7. 제6항에 있어서,
    상기 miR-625-3p의 발현 수준은, 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 또는 유전자칩을 이용하여 측정되는 것을 특징으로 하는, 정보제공방법.
  8. 제6항에 있어서,
    상기 시료는 조직, 세포, 혈액 또는 혈청 시료인 것을 특징으로 하는, 정보제공방법.
  9. 제8항에 있어서, 상기 시료는 조직, 세포, 혈액 또는 혈청으로부터 분리된 엑소좀을 포함하는 것을 특징으로 하는, 정보제공방법.
  10. 제7항에 있어서,
    상기 miR-625-3p의 발현 수준이 경증 건선 시료의 miR-625-3p 발현 수준과 비교하여 3.46배 이상 증가하는 경우, 중등도-중증 건선으로 진단하는 것을 특징으로 하는, 정보제공방법.
  11. 제7항에 있어서,
    상기 (a) 단계는 환자로부터 분리된 시료 중 miR-4488 및/또는 miR-342-3p의 발현 수준을 추가로 측정하고,
    상기 (b) 단계는 상기 miR-4488의 발현 수준을 경증 건선 시료의 miR-4488 발현 수준과 비교 및/또는 상기 miR-342-3p의 발현 수준을 경증 건선 시료의 miR-342-3p 발현 수준과 비교하는 단계를 포함하는 것을 특징으로 하는, 정보제공방법.
  12. 제11항에 있어서,
    상기 miR-4488의 발현 수준이 경증 건선 시료의 miR-4488의 발현 수준과 비교하여 2.375배 이상 증가하는 경우 및/또는
    상기 miR-342-3p의 발현 수준이 경증 건선 시료의 miR-342-3p 발현 수준과 비교하여 1.657배 이상 증가하는 경우, 중등도-중증 건선으로 진단하는 것을 특징으로 하는, 정보제공방법.
  13. 제11항에 있어서,
    상기 miR-4488 및/또는 miR-342-3p의 발현 수준은, 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 또는 유전자칩을 이용하여 측정되는 것을 특징으로 하는, 정보제공방법.
PCT/KR2022/015595 2021-10-15 2022-10-14 Mir-625-3p의 건선 중증도 진단용 바이오마커로서의 용도 WO2023063775A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210137391 2021-10-15
KR10-2021-0137391 2021-10-15

Publications (1)

Publication Number Publication Date
WO2023063775A1 true WO2023063775A1 (ko) 2023-04-20

Family

ID=85987565

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/015595 WO2023063775A1 (ko) 2021-10-15 2022-10-14 Mir-625-3p의 건선 중증도 진단용 바이오마커로서의 용도

Country Status (2)

Country Link
KR (1) KR20230055951A (ko)
WO (1) WO2023063775A1 (ko)

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5556752A (en) 1994-10-24 1996-09-17 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
US5599695A (en) 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
US5631734A (en) 1994-02-10 1997-05-20 Affymetrix, Inc. Method and apparatus for detection of fluorescently labeled materials
WO1997045539A1 (en) 1996-05-31 1997-12-04 Mikael Kubista Probe for analysis of nucleic acids
US5945526A (en) 1996-05-03 1999-08-31 Perkin-Elmer Corporation Energy transfer dyes with enhanced fluorescence
US6020481A (en) 1996-04-01 2000-02-01 The Perkin-Elmer Corporation Asymmetric benzoxanthene dyes
US6140500A (en) 1999-09-03 2000-10-31 Pe Corporation Red-emitting [8,9]benzophenoxazine nucleic acid dyes and methods for their use
US6191278B1 (en) 1999-11-03 2001-02-20 Pe Corporation Water-soluble rhodamine dyes and conjugates thereof
US20060078894A1 (en) 2004-10-12 2006-04-13 Winkler Matthew M Methods and compositions for analyzing nucleic acids
KR20090056732A (ko) * 2007-11-30 2009-06-03 (주)지노믹트리 건선 진단용 키트 및 칩
US20140274789A1 (en) * 2011-08-11 2014-09-18 Andreas Keller Complex sets of mirnas as non-invasive biomarkers for psoriasis
KR20140123777A (ko) * 2013-04-15 2014-10-23 가톨릭대학교 산학협력단 건선 진단용 유전자 마커 및 이를 이용한 건선 진단 방법
KR20160022017A (ko) 2014-08-19 2016-02-29 주식회사 엠모니터 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5631734A (en) 1994-02-10 1997-05-20 Affymetrix, Inc. Method and apparatus for detection of fluorescently labeled materials
US5556752A (en) 1994-10-24 1996-09-17 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
US5599695A (en) 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
US6020481A (en) 1996-04-01 2000-02-01 The Perkin-Elmer Corporation Asymmetric benzoxanthene dyes
US5945526A (en) 1996-05-03 1999-08-31 Perkin-Elmer Corporation Energy transfer dyes with enhanced fluorescence
WO1997045539A1 (en) 1996-05-31 1997-12-04 Mikael Kubista Probe for analysis of nucleic acids
US6140500A (en) 1999-09-03 2000-10-31 Pe Corporation Red-emitting [8,9]benzophenoxazine nucleic acid dyes and methods for their use
US6191278B1 (en) 1999-11-03 2001-02-20 Pe Corporation Water-soluble rhodamine dyes and conjugates thereof
US20060078894A1 (en) 2004-10-12 2006-04-13 Winkler Matthew M Methods and compositions for analyzing nucleic acids
KR20090056732A (ko) * 2007-11-30 2009-06-03 (주)지노믹트리 건선 진단용 키트 및 칩
US20140274789A1 (en) * 2011-08-11 2014-09-18 Andreas Keller Complex sets of mirnas as non-invasive biomarkers for psoriasis
KR20140123777A (ko) * 2013-04-15 2014-10-23 가톨릭대학교 산학협력단 건선 진단용 유전자 마커 및 이를 이용한 건선 진단 방법
KR20160022017A (ko) 2014-08-19 2016-02-29 주식회사 엠모니터 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
"Nucleic Acids in Chemistry and Biology", 1996, article "DNA and RNA Structure"
ACS NANO., vol. 14, no. 10, 2020, pages 12732 - 48
ADVANCES IN CLINICAL AND EXPERIMENTAL MEDICINE., vol. 26, no. 5, 2017, pages 851 - 6
ALLAWI, H.T. ET AL.: "Quantitationof microRNAs using a modified Invader assay.", RNA, vol. 10, 2004, pages 1153
AYDIN BUSRA, ARGA KAZIM YALCIN, KARADAG AYSE SERAP: "Omics-Driven Biomarkers of Psoriasis: Recent Insights, Current Challenges, and Future Prospects", CLINICAL, COSMETIC AND INVESTIGATIONAL DERMATOLOGY, vol. 13, 1 January 2020 (2020-01-01), pages 611 - 625, XP093058763, DOI: 10.2147/CCID.S227896 *
BIOMEDICAL REPORTS., vol. 9, no. 5, 2018, pages 367 - 74
BMC BIOINFORMATICS., vol. 14, no. 1, 2013, pages 1 - 14
CALIN, G.A. ET AL., PROC NATL ACAD SCI USA, vol. 101, 2004, pages 11755
CELL DEATH & DISEASE, vol. 13, no. 1, 2022, pages 1 - 13
CHEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 20, 2005, pages e179
CHEN, J. ET AL.: "Highly sensitive and specific microRNA expression profiling using BeadArray technology.", NUCLEIC ACIDS RES, vol. 36, 2008, pages e87, XP055004505, DOI: 10.1093/nar/gkn387
GARMAN A: "Non Radioactive Labeling", 1997, ACADEMIC PRESS
GENOME BIOL., vol. 11, 2010, pages R90
HAWKES JASON E., NGUYEN GIANG HUONG, FUJITA MAYUMI, FLORELL SCOTT R., CALLIS DUFFIN KRISTINA, KRUEGER GERALD G., O’CONNELL RYAN M.: "microRNAs in Psoriasis", JOURNAL OF INVESTIGATIVE DERMATOLOGY, ELSEVIER, NL, vol. 136, no. 2, 1 February 2016 (2016-02-01), NL , pages 365 - 371, XP093058760, ISSN: 0022-202X, DOI: 10.1038/JID.2015.409 *
INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 20, no. 18, 2019, pages 4353
JONSTRUP, S.P. ET AL.: "AmicroRNA detection system based on padlockprobes and rolling circle amplification", RNA, vol. 12, 2006, pages 1747
JOURNAL OF THE ROYAL STATISTICAL SOCIETY: SERIES B (METHODOLOGICAL)., vol. 57, no. 1, 1995, pages 289 - 300
NUCLEIC ACID RES., vol. 8, no. 48, 2020, pages 148 - 154
NUCLEIC ACIDS RESEARCH, vol. 40, no. 1, 2012, pages 37 - 52
NUCLEIC ACIDS RESEARCH, vol. 42, no. D1, 2014, pages 68 - 73
NUCLEIC ACIDS RESEARCH, vol. 48, no. D1, 2020, pages 127 - 131
SCHENA ET AL., PROC NATL ACAD SCI USA., vol. 93, no. 20, 1996, pages 10614 - 9
SCHENA ET AL., SCIENCE, vol. 270, no. 5235, 1995, pages 467 - 70
SCHMITTGEN, T.D. ET AL.: "Real-time PCR quantification of precursor and mature microRNA", METHODS, vol. 44, no. 31, 2008, pages 8
SCHOUTEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 30, 2002, pages e57
SHARBATI-TEHRANI ET AL.: "miR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complex sample", BMC MOL BIOL, vol. 9, 2008, pages 34, XP002553995, DOI: 10.1186/1471-2199-9-34

Also Published As

Publication number Publication date
KR20230055951A (ko) 2023-04-26

Similar Documents

Publication Publication Date Title
US20070264635A1 (en) Probe, probe set and information acquisition method using the same
EP2765227A2 (en) Compositions and methods for identifying autism spectrum disorders
US20230183780A1 (en) Dna probes for in situ hybridization on chromosomes
KR101169653B1 (ko) 마이크로 알엔에이 염기서열 다형을 이용한 원인불명 반복 자연 유산 진단에 필요한 정보제공 방법 및 진단용 조성물
KR101784714B1 (ko) 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도
KR20140087785A (ko) 돼지의 흑모색 판단용 ｓｎｐ 마커 및 이의 용도
KR101929009B1 (ko) 뇌졸중 진단용 조성물 및 이를 진단하는 방법
WO2023063775A1 (ko) Mir-625-3p의 건선 중증도 진단용 바이오마커로서의 용도
KR101992539B1 (ko) miRNA 기반의 인지장애 질환 진단용 조성물 및 방법
WO2019132581A1 (ko) 유방암 및 난소암 등 암 진단용 조성물 및 이의 용도
WO2021080335A1 (ko) 비결핵 항산균에 의한 감염 또는 감염 질환의 진단용 조성물
WO2018062683A1 (ko) 피부 장벽 기능 진단용 바이오마커 조성물
KR20110034297A (ko) 내인성 아토피 피부염 진단용 마커 및 그의 용도
WO2021107713A1 (ko) Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법
WO2011142646A2 (ko) 인유두종바이러스 검출 및 유전형 확인 방법
WO2020204313A1 (ko) Gba 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커
WO2021172653A1 (ko) 단일 표적 유전자의 유전적 변이 실시간 검출용 단일핵산 및 이를 이용한 검출 방법
WO2020096247A1 (ko) 유방암 조직 내 세포 유래 돌연변이를 검출하기 위한 프로브 제조 및 검출 방법
WO2022124564A1 (ko) 마이크로rna를 이용한 당뇨병성 신경병증의 예측 및 진단 방법 및 이를 위한 키트
KR101742261B1 (ko) 다중 증폭 이중 신호 증폭에 의한 brca 유전자 변이 검출 방법
LU102676B1 (en) A Biomarker for Severe Asthma and Application Thereof
WO2011122859A2 (ko) 뇌종양의 재발 가능성 및 생존 예후 예측용 조성물 및 이를 포함하는 키트
WO2023132626A1 (ko) 특정 유전자의 cpg 메틸화 변화를 이용한 전립선암 진단용 조성물 및 이의 용도
WO2023219447A1 (ko) 세포외 소포체 유래 mirna를 검출하는 제제를 포함하는 난소암 진단용 조성물
WO2024091020A1 (ko) 유방암 진단 또는 재발 예측을 위한 세포외 소포체 유래 miRNA 유전자 바이오마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22881402

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022881402

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022881402

Country of ref document: EP

Effective date: 20240515