WO2023063775A1 - Utilisation de mir-625-3 p en tant que biomarqueur pour diagnostiquer la gravité du psoriasis - Google Patents

Utilisation de mir-625-3 p en tant que biomarqueur pour diagnostiquer la gravité du psoriasis Download PDF

Info

Publication number
WO2023063775A1
WO2023063775A1 PCT/KR2022/015595 KR2022015595W WO2023063775A1 WO 2023063775 A1 WO2023063775 A1 WO 2023063775A1 KR 2022015595 W KR2022015595 W KR 2022015595W WO 2023063775 A1 WO2023063775 A1 WO 2023063775A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
psoriasis
expression level
biomarker
diagnosing
Prior art date
Application number
PCT/KR2022/015595
Other languages
English (en)
Korean (ko)
Inventor
이은소
박영준
김동찬
박지영
Original Assignee
아주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단 filed Critical 아주대학교산학협력단
Publication of WO2023063775A1 publication Critical patent/WO2023063775A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to the use of miR-625-3p as a biomarker for diagnosing severity of psoriasis, and more particularly, to a composition for diagnosing psoriasis severity or a kit for diagnosing severity of psoriasis, including a substance for detecting miR-625-3p biomarker, and the miR It relates to a method for diagnosing psoriasis severity-severe using -625-3p as a biomarker.
  • Psoriasis is a relatively common skin inflammatory disease, which occurs in 1-3% of the population, and is a disease that requires long-term treatment by repeating improvement and exacerbation after onset at a young age. It has been reported that arthritis is induced in about 10% of patients with psoriasis, and it has also been reported to be associated with cardiovascular disease and metabolic syndrome.
  • PASI psoriasis area severity index
  • BSA body surface area
  • Exosomes are the smallest (30-120 nm) extracellular vesicles and contain various biomolecules such as microRNA (miRNA), nucleic acids, and proteins that enable cell-to-cell communication.
  • miRNA microRNA
  • the stable lipid bilayer of exosomes prevents degradation of biomolecules.
  • damaged keratinocytes can secrete exosomes, and psoriatic keratinocytes secrete exosomes due to excessive inflammation and abnormal differentiation (ACS nano. 2020;14(10):12732-48; Cell death & disease 2022;13(1):1-13).
  • miRNA is a small-sized non-coding RNA (20-25 nucleotides) known to play a role in regulating gene expression. miRNA is involved in the proliferation and activation of T cells and is differentially expressed in psoriasis patients compared to healthy controls. (Biomedical reports. 2018;9(5):367-74). Circulating exosomal miRNAs have been used as potential biomarkers reflecting disease activity for diseases such as cancer, hepatitis, dermatomyositis, and neurodegenerative diseases, as they are known to correlate with disease with remarkable stability.
  • miRNAs there are more than 250 differentially expressed miRNAs in the skin or blood of psoriasis patients, but since miRNAs are small single-stranded non-coding RNA molecules that are vulnerable to external stimulation and degradation, miRNAs are used to diagnose psoriasis patients. had limitations.
  • miRNAs in circulating exosomes could be used for diagnosing psoriasis as a relatively stable biomarker. Efforts were made to invent markers, and as a result, miR-625-3p expression in circulating exosomes was not only expressed at a significantly high level in psoriasis, but also miR-625-3p expression level faithfully correlated with psoriasis disease severity. The present invention was completed by confirming the reflection.
  • An object of the present invention is to provide a novel biomarker capable of accurately diagnosing the severity of psoriasis.
  • composition for diagnosing psoriasis disease severity comprising the present miR-625-3p biomarker detecting substance.
  • the detection material may include at least one of a primer, a probe, and an antisense nucleotide specifically binding to the miR-625-3p biomarker.
  • the composition may be characterized in that it further comprises a substance for detecting the miR-4488 biomarker and/or a substance for detecting the miR-342-3p biomarker.
  • the detection substance may include at least one of a primer, a probe, and an antisense nucleotide that specifically binds to the miR-4488 biomarker and/or the miR-342-3p biomarker. there is.
  • the present invention also provides the use of the miR-625-3p biomarker for diagnosing the severity of psoriasis.
  • the present invention also provides the use of the miR-625-3p biomarker for the preparation of a reagent for diagnosing the severity of psoriasis.
  • the present invention also provides a method for diagnosing severity of psoriasis comprising measuring the expression level of the miR-625-3p biomarker in a subject in need of diagnosis of severity of psoriasis.
  • the present invention also provides a kit for diagnosing the severity of psoriasis, including the composition.
  • the present invention also includes (a) measuring the expression level of miR-625-3p in a sample isolated from a patient; and
  • the expression level of miR-625-3p is measured using reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip can be done with
  • the sample may be a tissue, cell, blood or serum sample.
  • the sample may be characterized in that it includes exosomes isolated from tissue, cell, blood or serum.
  • the information providing method is moderate-severe when the expression level of miR-625-3p is increased by about 3.46 times or more compared to the expression level of miR-625-3p in mild psoriasis samples. to severe) psoriasis.
  • step (a) further measures the expression level of miR-4488 and/or miR-342-3p in samples isolated from the patient,
  • the miR-4488 expression level is compared with the miR-4488 expression level of the mild psoriasis sample and/or the miR-342-3p expression level is compared with the miR-342-3p expression level of the mild psoriasis sample. It can be characterized by comparison.
  • the information providing method is performed when the miR-4488 expression level is increased by about 2.375 times or more compared to the miR-4488 expression level of the mild psoriasis sample and/or
  • the diagnosis of moderate-severe psoriasis may be characterized.
  • the expression level of miR-4488 and/or miR-342-3p is determined by reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip. It can be characterized by being measured using.
  • the biomarker for diagnosing psoriasis can objectively diagnose psoriasis at an early stage at the molecular level and accurately determine the severity of psoriasis disease, thereby increasing the treatment efficiency of diagnosing a chronic disease.
  • FIG. 1 shows that miRNA (differentially expressed miRNA) showing a significant difference is screened by next-generation sequencing (NGS) after extracting exosomes from blood and skin tissue of psoriasis patients, and miRNAs expressed up and down are This is the result of validating the expression pattern by performing quantitative real-time PCR on it. Significance of correlations was tested using Spearman's rank correlation test. *P ⁇ 0.05, **P ⁇ 0.01.
  • Figure 1a is a schematic diagram showing the experimental process of acquisition and analysis of exosome miRNA (blue arrow (dotted line) indicates the screening step, red arrow (solid line) indicates the validation step).
  • FIG 1b shows the differentially expressed genes (DEG) on the Volcano plot. Screened exosomal miRNAs are indicated in bold.
  • Figure 1c shows downregulated miRNAs in the plasma of psoriasis patients with PASI >10.
  • Figure 1d shows upregulated miRNAs in the plasma of psoriasis patients with PASI >10.
  • Figure 1e shows the qRT-PCR results of miRNAs upregulated in the skin of psoriasis patients.
  • 1F shows skin miR-625-3p levels plotted against PASI and BSA.
  • Figure 2 is a result of verifying the diagnostic accuracy of miRNAs that are elevated in screening.
  • 2a and 2b show the results of plotting plasma miR-625-3p, miR-4488, and miR-342-3p levels against psoriasis severity indices (a) PASI and (b) BSA, respectively. Significance of correlations was tested using Spearman's rank correlation test.
  • Figure 2c is the result of confirming the sensitivity and specificity through the ROC (receiver operating characteristic) curve and related AUC values of each upregulated exosome miRNA.
  • Figure 2d is a schematic diagram showing the experimental process for analyzing exosome miRNA levels before and after treatment according to the active and inactive states of Behcet's disease patients.
  • Figure 2e is the result of confirming the difference in miRNA expression by performing qRT-PCR after extracting exosomes from plasma according to the active and inactive states of Behcet's disease patients.
  • FIG. 2f is a result of extracting exosomes from the plasma of patients with Behcet's disease before and after treatment and performing qRT-PCR to confirm the difference in miRNA expression between a group showing an improvement in PASI of 50 or more after treatment and a group without. *P ⁇ 0.05.
  • Figure 3 is the result of confirming the origin of exosome miRNA through in situ hybridization (ISH) technique in paraffin tissue.
  • ISH in situ hybridization
  • 3a and 3b show the results of detecting miR-625-3p expression in the skin through ISH at (a) a low power field (x100) and (b) a high power field (x400), respectively.
  • 3c and 3d show that in order to confirm whether the miRNAs that were elevated were derived from keratinocytes or T cells, HaCaT cells and JurkaT cells were used to (c) collected cells and (d) supernatants of IL-12 (Th1), IL-12 (Th1) and IL-12 (Th1). 23 (Th17) and confirmed the expression levels of miR-625-3p and miR-4488 through qRT-PCR. *P ⁇ 0.05 and **P ⁇ 0.01.
  • Figure 4 is the result of confirming the possibility of association with the IGF-1 signaling system of miR-625-3p through the miRNA database. Data are presented as mean ⁇ SEM. Horizontal lines above the bars represent statistical differences and statistical comparisons between categories. *P ⁇ 0.05, **P ⁇ 0.01, and ****P ⁇ 0.0001.
  • Figure 4a shows the results of predicting the target and function of miR-625-3p using three miRNA databases (miRDB/TargetScan/miRTarBase).
  • Figure 4b is the result of confirming the expression level after transfection with miR-625-3p mimic.
  • Figure 4c is a qRT-PCR result of IGF-1 signaling genes after transfection with miR-625-3p mimic.
  • Figure 4d shows the result of western blotting analysis of Akt protein in HaCat cells cultured for 48 hours after transfection with the miR-625-3p mimic.
  • Figure 4e is a result confirming the increase in the expression level of the Ki67 gene, which increases during cell division after transfection with the miR-625-3p mimic.
  • Figure 4f shows the results of confirming the survival of HaCaT cells by CCK8 assay at different dopamine concentrations for 24, 48 and 72 hours after transfection with the miR-625-3p mimic.
  • miR-625-3p which can objectively diagnose psoriasis with miRNA in circulating exosomes, was identified as a novel biomarker for diagnosing psoriasis severity.
  • the expression level of miR-625-3p showed a significant correlation according to the severity, and it was confirmed that miR-625-3p is a biomarker that reflects the severity of psoriasis disease.
  • the present invention relates to a composition for diagnosing psoriasis disease severity, including a substance for detecting the miR-625-3p biomarker.
  • the detection material may include at least one of a primer, a probe, and an antisense nucleotide specifically binding to the miR-625-3p biomarker, but is not limited thereto.
  • the miR-625-3p biomarker may be characterized in that it is possible to determine psoriasis disease severity.
  • the composition may be characterized in that it further comprises a substance for detecting the miR-4488 biomarker and/or a substance for detecting the miR-342-3p biomarker.
  • the detection substance may include at least one of a primer, a probe, and an antisense nucleotide that specifically binds to the miR-4488 biomarker and/or the miR-342-3p biomarker.
  • a primer a probe
  • an antisense nucleotide that specifically binds to the miR-4488 biomarker and/or the miR-342-3p biomarker.
  • it is not limited thereto.
  • miRNA refers to a 21- to 21-to-2 gene expression that regulates gene expression post-transcriptionally by promoting degradation of target RNA or inhibiting their translation. 23 non-coding RNAs.
  • the mature sequences of the miRNAs used herein can be obtained from the miRNA database (http://www.mirbase.org).
  • microRNA is transcribed as a stem-loop (primary miRNA or pri-miRNA) precursor with a hairpin structure called pre-miRNA and about 70-80 nt (nucleotides) in length.
  • pri-miRNAs may include several miRNA precursors, and are processed into precursor miRNAs (pre-miRNAs) having a hairpin structure by the action of enzymes.
  • pre-miRNAs precursor miRNAs having a hairpin structure by the action of enzymes.
  • the pre-miRNA moves out of the nucleus and the hairpin structure is cleaved by RNase enzyme (Dicer) in the cytoplasm.
  • Dicer binds to the 3' end of the hairpin, cuts the loop connecting the 3' and 5' arms, and forms an unstable double-stranded miRNA, ultimately mature miR-3p and miR-5p. is formed
  • miR-625-3p is derived from the 3p end of pre-miRNA miR-625 having a hairpin structure. In the present study, it was found that miR-625-3p was particularly elevated in psoriasis patients.
  • the miR-625-3p biomarker according to the present disclosure includes mature miR-625-3p as well as a precursor pre-miR-625 capable of producing it.
  • human-derived pre-miR-625 including miR-625 can be represented by SEQ ID NO: 1: AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUGUAAUUA GAUCUCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCCCU, and miR-625-3p can be represented by SEQ ID NO: 2: GACUAUAGAACUUUCCCCCUCA,
  • SEQ ID NO: 1 AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUGUAAUUA GAUCUCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCCCU
  • miR-625-3p can be represented by SEQ ID NO: 2: GACUAUAGAACUUUCCCCCUCA
  • the underlined part in SEQ ID NO: 1 is a sequence forming a loop.
  • Pre-miR-625 includes both 5p and 3p sequences based on the loop, and when a probe and/or primer described later is used for detection, it is preferable to
  • the human-derived pre-miR-4488 sequence including miR-4488 may be represented by SEQ ID NO: 3: GGUAGGGGGCGGGCUCCGGCGCUGGGACCCCACUAGGGU GGCGCCUUGGCCCCGCCCCGCCC, and miR-4488 may be represented by SEQ ID NO: 4: AGGGGGCGGGCUCCGGCG.
  • human-derived pre-miR-342 including miR-342 may be represented by SEQ ID NO: 5: GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGA CAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA, and miR-342-3p may be represented by SEQ ID NO: 6: UCUCACACAGAAAUCG CACCCGU
  • the underlined portion is a sequence forming a loop.
  • Pre-miR-342 includes both 5p and 3p sequences based on the loop, and when a probe and/or primer described later is used for detection, it is preferable to design to specifically recognize 3p.
  • biomarker or diagnostic marker is a substance that can be diagnosed by distinguishing a sample from a patient with psoriasis from a control group, It includes non-coding nucleic acids that show an increased expression pattern in the sample.
  • diagnosis refers to determining the susceptibility of a test subject to a specific disease or disorder, determining whether or not currently having a specific disease or disorder, and determining whether a test subject has a specific disease or disorder This includes determining prognosis, recurrence of a disease after treatment, or therametrics (eg, monitoring a subject's condition to provide information about therapeutic efficacy).
  • the biomarker according to the present disclosure can be used for diagnosing psoriasis by detecting the presence or absence of miRNA and/or detecting its expression level itself, change in expression level, or difference in expression level through quantitative and/or qualitative analysis.
  • the detection substance according to the present application is a substance capable of detecting the presence or absence of miRNA or its cRNA or cDNA and/or detecting its expression level itself, change in expression level, or difference in expression level, and the composition is the substance for detection.
  • the detection material may further include a reagent suitable for detecting the biomarker.
  • the detection material includes a probe that specifically binds to the miRNA disclosed herein or its cRNA or cDNA.
  • the probe specifically and complementarily binds to single-stranded RNA or DNA as a template and has a free 3' hydroxyl group that allows reverse transcriptase or DNA polymerase to initiate replication of the template. It refers to a nucleic acid molecule, which enables qualitative and / or quantitative measurement of a target by specific binding to a template or target, and can be used in various methods as described below, and also for detection of amplified products As described below, it may be labeled with a color, luminescent, or fluorescent substance.
  • the detection substance according to the present application specifically and complementarily binds to the miRNA disclosed herein or its cRNA or cDNA, and has a free 3' end that allows reverse transcriptase or DNA polymerase to initiate replication of the template. It is a primer having a hydroxyl group (free 3' hydroxyl group). Primers are generally designed to bind to the vicinity of both ends of a site to be amplified in a target nucleic acid in a nucleic acid amplification reaction, and specifically bind to a template (or target) to perform qualitative and/or quantitative analysis of the template or target material. and can be used in a variety of ways as described below. In addition, for detection of the amplified product, it may be labeled with a color, luminescent, or fluorescent substance as described below.
  • the detection substance according to the present application includes a probe and a primer pair that specifically bind to the miRNA disclosed herein or its cRNA or cDNA, and in this case, the probe is located between the primer pair.
  • Probes and/or primers capable of detecting miR-625-3p, miR-4488 or miR-342-3p according to the present application may be used in various known methods, and various reagents are specifically provided herein according to the method used. It can also be included in the composition according to.
  • Such methods include, but are not limited to, for example, nucleic acid hybridization, polymerization, amplification methods and hybridization-based ligation, and the like.
  • Nucleic acid hybridization can be performed in the form of nucleic acids bound to a solid phase support, such as beads, nanoparticles or biochip arrays (microarrays), or using in situ hybridization.
  • miRNA microarray technology allows the analysis of multiple miRNAs simultaneously.
  • Nucleotides complementary to miRNAs according to the present disclosure may be spotted on a coated solid support or spotted on a solid support using an in situ synthesis method.
  • miRNA isolated from a biological sample can be detected by incorporation of a label (e.g., biotin, fluorescent dye) detected by hybridization with a complementary sequence on the solid support, for example, a probe. .
  • a label e.g., biotin, fluorescent dye
  • miRNA isolated from a biological sample is labeled with a fluorescent material and binds to a corresponding sequence, and the resulting fluorescence signal indicates the presence of a specific miRNA.
  • Microarray fabrication techniques are described, for example, in Schena et al., 1996, Proc Natl Acad Sci USA.93(20):10614-9; Schena et al., 1995, Science 270(5235):467-70; and U.S. Pat. Nos. 5,599,695, 5,556,752 or 5,631,734.
  • a substance or reagent for detection may be provided in a form bound to a solid support.
  • the detection reagent may be labeled directly or indirectly in a sandwich form for detection, and reference may be made to the bar described below.
  • a nucleic acid polymerization or amplification method may also be used to detect miRNA according to the present disclosure, and is particularly suitable for detecting miRNA present in a small amount.
  • Various known nucleic acid amplification or synthesis methods may be used, for example, reverse transcription reaction, reverse transcription polymerase chain reaction (RT-PCR), real-time RT-PCR, PCR, real-time PCR, quantitative RT-PCR, quantitative PCR, NASBA ( Nucleic Acid Sequence-Base Amplification (LCR), Ligase Chain Reaction (LCR), Multiple ligatable probe amplification (Multiple ligatable probe amplification), Invader technology (Third Wave), Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), and Eberwine RNA amplification, etc., but is not limited thereto.
  • LCR Nucleic Acid Sequence-Base Amplification
  • LCR Ligase Chain Reaction
  • Multiple ligatable probe amplification Multiple ligatable probe amplification
  • a typical PCR method consists of three steps, denaturation of the template, annealing in which forward and reverse primers bind to the target sequence, and elongation with a thermostable polymerase for amplification of a specific target sequence, usually in several cycles, for example, 20 More than once is done. Alternatively, annealing and stretching may be performed in the same step. Since mature miRNAs are single-stranded, a reverse transcription reaction can be performed first before PCR. The reverse transcription reaction requires the use of primers and reverse transcriptase.
  • a set of forward and reverse primers or probes together with the primers can be used.
  • the length of probes and primers is determined according to various factors such as hybridization temperature, composition of target sequence, and complexity of target sequence.
  • the probe is 7 nucleotides or more
  • the primer is about 10 to 35 nucleotides in length, such as 15, 20, 25, 30 or 35 nucleotides.
  • the forward primer includes at least one sequence capable of specifically binding to the biomarker miRNA, and may further include a non-complementary sequence at the 5' side.
  • the sequence of the reverse primer may be independent of the sequence of the biomarker, and multiple miRNA biomarkers may be amplified with one type of reverse primer, or may include one or more sequences specific to the biomarker.
  • a primer capable of amplifying miR-625-3p may be MystiCq®microRNA qPCR Assay Primer hsa-miR-625-3p, but is not limited thereto.
  • primers capable of amplifying miR-625-3p may be forward: 5'-GCGCAGGACTATAGAACTTTC-3' and reverse: 5'-GGTCCAGTTTTTTTTTTTTTGAG-3', but are not limited thereto.
  • Amplification products can be analyzed during or after amplification by various methods known in the art. These methods are known in the art and include, for example, gel electrophoresis, real-time PCR analysis, SSCP (single strand conformational polymorphism), RFLP (restriction fragment length polymorphism), CZE (capillary zone electrophoresis), WAVE (HPLC-based nucleic acid analyzing technology), microchip, but is not limited thereto.
  • a real-time quantitative PCR method that is, RT-PCR is used after reverse transcription reaction, which isolates RNA from a sample, and then primers, for example, a stem-loop capable of forming a stem-loop therefrom.
  • primers for example, a stem-loop capable of forming a stem-loop therefrom.
  • forward and reverse primers, or a combination of forward and reverse primers and probes are used here as end-points, or using dyes that bind to nucleic acids such as SYBR Therefore, a stem-loop RT-based nucleic acid amplification method using a TaqMan type probe labeled with a fluorescent material or in real time is used.
  • hybridization-based ligation techniques can be used for quantitative analysis of miRNAs. Such methods are known in the art and do not bind a detectable probe that binds to a target nucleic acid sequence, such as, for example, oligonucleotide ligation (OLA) and methods using HARP-like probes described, for example, in US Publication No. 2006-0078894. It includes, but is not limited to, a method of separating from an unidentified probe.
  • Another technique using ligation may include Multiplex Ligation-dependent Probe Amplification (MLPA) (Schouten et al., Nucleic Acids Research 30:e57 (2002)). In this technique, ligation occurs only when a pair of probes bind to the target sequence side by side, and the ligated probes include primer binding sites so that they can be amplified by PCR.
  • MLPA Multiplex Ligation-dependent Probe Amplification
  • hybridized or amplified miRNA products can be detected through staining or labeling of the target, staining or labeling of primers or probes.
  • a known technique in the art may be used for detection, and a person skilled in the art may select an appropriate method in consideration of detection sensitivity and/or target quantity. Depending on the amount of target and/or the sensitivity of the detection method, amplification may not be necessary prior to detection.
  • miRNAs can be detected by direct or indirect methods.
  • miRNA is labeled with a detectable label attached thereto, and then bound to a probe linked to a solid support such as a bead, and then the labeled miRNA is screened for detection.
  • a labeled probe may be used for direct detection, and detection is performed through screening of the labeled probe after specific binding to the miRNA.
  • the amplified miRNA is detected using beads conjugated with a probe capable of capturing a target nucleic acid.
  • the probe may be labeled with a fluorophore. Indirect detection methods may also be used.
  • biotinylated probes can be used to detect bound nucleic acids using streptavidin conjugated dyes.
  • streptavidin conjugated dyes The streptavidin molecule binds to the biotin label of the amplified miRNA, and the bound miRNA is detected by a dye conjugated to streptavidin.
  • Dyes conjugated to such streptavidin are known in the art and for example Phycolink(R) Streptavidin R-Phycoerythrin (PROzyme) can be used.
  • Labels for detection include, but are not limited to, compounds capable of generating or quenching detectable fluorescence, chemiluminescence, or bioluminescence signals such as light-emitting, light-scattering, and light-absorbing materials, such as Garman A., Non_Radioactive Labeling, Academic Press 1997.
  • Fluorescent materials include, but are not limited to, fluorescein (eg US Patent 6,020,481), rhodamine (eg US Patent 6,191,278), benzophenoxazine (eg US Patent 6,140,500), donor and acceptor.
  • Energy transfer fluorescent dyes including (eg US Patent Publication No.
  • Fluorescent dye is 6-carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; and 2', 4', 5', 7', 1,4-hexachlorofluorescein, but is not limited thereto.
  • SYBR-Green, 6-carboxyfluorescein (“FAM”), TET, ROX, VICTM, or JOE are used as fluorescent labels.
  • FAM 6-carboxyfluorescein
  • TET 6-carboxyfluorescein
  • ROX ROX
  • VICTM VICTM
  • JOE JOE
  • a probe labeled with two fluorescent substances, a reporter fluorescent substance and a scavenger fluorescent substance is used.
  • a fluorescent substance that emits a spectrum of distinguishable wavelengths is used as the fluorescent substance.
  • a compound capable of improving, stabilizing, or influencing nucleic acid binding may be used, for example, an intercalator including etcidium bromide and SYBR-Green, a minor groove conjugate, and a crosslinkable functional group. , but not limited to, Blackburn et al., eds. See “DNA and RNA Structure” in Nucleic Acids in Chemistry and Biology (1996).
  • miRNA quantification can also be performed with reference to the following literature, for example, miRNA microarrays (Calin, G.A. et al. (2004) Proc Natl Acad Sci USA 101,11755.60.), SYBR-based miRNA RT-qPCR assays ( Sharbati-Tehrani et al. (2008) miR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complexsample. BMC Mol Biol 9, 34.), BeadArray (Chen, J. (2008) Highly sensitive and specific microRNA expression profiling using BeadArray technology. Nucleic Acids Res 36, e87.), Invader Assays (Allawi, H.T. et al.
  • kits based on RT-PCR using primers and probes may be used, for example, Stem-loop RT based TaqMan MicroRNA Assays (ThermoFisher Scientific, USA) may be used.
  • composition according to the present disclosure may include reagents used in any one or more of the methods described above.
  • biomarker or composition containing the biomarker according to the present disclosure may be usefully used for diagnosis of psoriasis, prediction of recurrence and/or prognosis, and/or prediction of response after drug treatment.
  • the present invention relates to the use of the miR-625-3p biomarker for diagnosing the severity of psoriasis.
  • the present invention can be interpreted as a composition for diagnosing psoriasis disease severity, including a substance for detecting the miR-625-3p biomarker, for use in diagnosing psoriasis disease severity.
  • the present invention relates to the use of a miR-625-3p biomarker for the preparation of a reagent for diagnosing the severity of psoriasis.
  • the present invention can be interpreted as a composition for diagnosing psoriasis disease severity, including a substance for detecting the miR-625-3p biomarker, for the preparation of a reagent for diagnosing the severity of psoriasis.
  • the present invention provides a method for diagnosing severity of psoriasis comprising measuring the expression level of the miR-625-3p biomarker in a subject in need of diagnosis of severity of psoriasis.
  • the miR-625-3p biomarker can be used for diagnosing the severity of psoriasis by measuring its expression level using any one or more of primers, probes, and antisense nucleotides that specifically bind to the miR-625-3p biomarker.
  • the miR-625-3p biomarker can be used together with the miR-4488 biomarker and/or the miR-342-3p biomarker to diagnose the severity of psoriasis.
  • the present invention can provide the use of the miR-4488 biomarker and/or the miR-342-3p biomarker for diagnosing the severity of psoriasis together with the miR-625-3p biomarker.
  • the composition for diagnosing psoriasis disease severity which further includes a substance for detecting miR-4488 biomarker and/or miR-342-3p biomarker, can be interpreted as a composition for diagnosing psoriasis disease severity.
  • the present invention is interpreted as a composition for diagnosing psoriasis disease severity, including a substance for detecting miR-4488 biomarker and/or miR-342-3p biomarker, for the preparation of a reagent for diagnosing psoriasis disease severity. It can be.
  • the miR-4488 biomarker and/or the miR-342-3p biomarker are expressed by measuring the expression level using at least one of primers, probes, and antisense nucleotides that specifically bind to each marker. It can be used to diagnose the severity of psoriasis.
  • the present invention relates to a kit for diagnosing the severity of psoriasis, including the composition.
  • the kit is used for nucleic acid amplification, in particular for amplification using RT-PCR.
  • the kit may include primer sets and/or probes, buffers, reverse transcriptase, and Taq polymerase necessary for the RT-PCR reaction.
  • it may further include a nuclease capable of removing single-stranded nucleic acids.
  • buffers known in the art may be used, for example, Tris-HCl, pH 9.0 buffer may be used, but is not limited thereto.
  • Reverse transcriptase and Taq polymerase are commercially available.
  • AmpliTaq Gold (Applied Biosystems, USA) capable of hot start reaction as a polymerase can be used, and appropriate concentrations, for example, of 1.5 mM to 2.5 mM MgCl 2 may be included.
  • the kit according to the present application further comprises a positive control, a negative control and instructions for use.
  • the negative control group may include a sample that does not contain miRNA, and the positive control group may include one or more miRNAs to be detected.
  • the present invention may provide information necessary for a method for diagnosing moderate-to-severe psoriasis or for diagnosing or prognosing psoriasis.
  • the present invention provides (a) measuring the expression level of miR-625-3p in a sample isolated from a patient; and (b) comparing the expression level of miR-625-3p with the expression level of miR-625-3p in mild psoriasis samples; It relates to an information providing method for diagnosing moderate-to-severe psoriasis, including.
  • the expression level of miR-625-3p is measured using reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip , but is not limited thereto.
  • the sample may be a tissue, cell, blood or serum sample, but is not limited thereto.
  • the sample may include exosomes isolated from tissues, cells, blood or serum, but is not limited thereto.
  • the expression level of miR-625-3p when the expression level of miR-625-3p is increased by about 3.46 times or more compared to the expression level of miR-625-3p in mild samples, moderate-severe psoriasis can be diagnosed. It is not limited to this.
  • step (a) further measures the expression level of miR-4488 and/or miR-342-3p in samples isolated from the patient,
  • the miR-4488 expression level is compared with the miR-4488 expression level of the mild psoriasis sample and/or the miR-342-3p expression level is compared with the miR-342-3p expression level of the mild psoriasis sample. It can be characterized by comparison.
  • the miR-4488 expression level when the miR-4488 expression level is increased by about 2.375 times or more compared to the miR-4488 expression level of the mild psoriasis sample and/or
  • the diagnosis of moderate-severe psoriasis may be characterized.
  • the expression level of miR-4488 and/or miR-342-3p may be additionally verified along with the expression level of miR-625-3p to diagnose moderate to severe psoriasis, but is not limited thereto.
  • the expression level of miR-4488 and/or miR-342-3p is determined by reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real-time reverse transcriptase polymerase reaction, RNase protection assay, or gene chip. It may be characterized in that it is measured using, but is not limited thereto.
  • the sample may be a biological sample
  • biological sample refers to a biologically derived organ, tissue, cell or body fluid.
  • biological samples include, but are not limited to, tissue sections, whole blood, plasma, serum, urine or blood derived leukocytes, red blood cells or platelets, or tissue or cell cultures.
  • one or more of the above samples may be mixed and used.
  • Such a biological sample may be directly obtained from a patient suspected of having psoriasis immediately before the test by a conventional sample obtaining method, or may be previously separated and stored.
  • skin tissue or blood samples are used.
  • skin tissue or blood obtained from a subject with or suspected or likely to have psoriasis may be used, but is not limited thereto.
  • a subject herein includes a mammal suspected of having a disease, a mammal suffering from a disease and then treated but suspected of recurrence, particularly a human.
  • the expression levels of miR-625-3p, miR-4488 and/or miR-342-3p in the subject are compared with miR-625-3p, miR-4488 and/or miR-4488 and/or miR-3488 and/or
  • the subject sample and the normal sample may be characterized by comparing the expression level of the above biomarker after normalizing to miR-103-3p.
  • miR-103-3p can be normalized to other miRNAs having uniform intracellular expression levels.
  • composition according to the present application detects the expression level of the one or more miRNAs in a biological sample, compares it with a control group or reference group, and predicts the risk of diagnosis or recurrence or occurrence of psoriasis according to the degree of decrease or change in the expression level.
  • control group is a sample showing differential expression from moderate to severe psoriasis disease, and a sample derived from a subject of the same species having mild psoriasis disease is used.
  • the miR-625-3p expression level when the miR-625-3p expression level is compared with the miR-625-3p expression level of a mild psoriasis sample, the miR-625-3p expression level is increased, for example, by about 10%, An increase of more than about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% is considered moderate to severe psoriasis or the risk of developing It can be judged as increased or high.
  • the expression level of miR-4488 and/or miR-342-3p is increased in the miR-4488 and/or miR-342-
  • the expression level of miR-4488 and/or miR-342-3p is increased compared to the expression level of 3p, for example, about 10%, about 20%, about 30%, about 40%, about 50%, about 60 %, about 70%, about 80%, about 90%, or about 100% or more, it can be judged as moderate-to-severe psoriasis or the risk of occurrence is further increased or higher.
  • biomarkers according to the present disclosure may be used together with existing markers and/or diagnostic methods. For example, it can be used with PASI and BSA results.
  • the miRNA expression level of mild psoriasis samples may be published in literature or previously measured, and may be measured in advance in individuals with mild psoriasis.
  • Example 1 Confirmation of exosome-derived miRNA expression patterns according to psoriasis-specific and disease activity differences in psoriasis patients
  • Diagnosis of psoriasis was made based on clinical and histological features in skin biopsy. PASI and BSA were assessed on the day of sampling.
  • Plasma samples from psoriasis patients were collected in serum separator tubes and EDTA treated tubes and immediately centrifuged at 3,000 rpm for 10 minutes at 4°C.
  • NGS Next generation sequencing
  • exosomes were extracted from plasma using the miRCURY TM Exosome isolation kit (Qiagen, Hilden, Germany) and exosomes were isolated using an RNA isolation kit (miRNeasy Serum/Plasma Kit; Qiagen, Hilden, Germany) according to the manufacturer's instructions. Total miRNAs were extracted from some.
  • paired-end (150 bp) sequencing was performed using the Illumina NovaSeq6000 S4 platform for sequencing (Illumina, CA, USA).
  • miRNA expression levels were determined using the gene annotation database of species with hairpin and mature miRNA sequence information extractable from miRBase (Nucleic acids research. 2014;42(D1):D68-D73), mirdeep2 (Nucleic acids research. 2012; 40(1):37-52).
  • miRNA level count data were generated using mirdeep2.
  • DEmiRNA was developed using the TCC R package for a robust normalization strategy to compare tag count data (BMC bioinformatics. 2013;14(1):1-14). was identified using Normalization factors were calculated using the iterative DEGES/edgeR method. Q-values were calculated based on p-values using the p.adjust function of the R package with default parameter settings.
  • DEmiRNAs were identified based on a q-value threshold of less than 0.05 to correct errors due to multiple testing (Journal of the Royal statistical society: series B (Methodological). 1995;57(1):289-300).
  • Fig. 1b 19 significant DE miRNAs were identified among the total of 805 detected miRNAs, that is, 9 up-regulated and 10 down-regulated miRNAs (Fig. 1b). Based on fold change and p-value, miR-625-3p, miR-4488 and miR-342-3p of upregulated miRNAs and miR-5698, miR-1255b-5p and miR323a-5p of downregulated miRNAs, respectively miRNAs were selected.
  • RNA extraction from plasma samples from psoriasis patients proceeded with the same procedure as described above, skin tissue samples from psoriasis patients were obtained from psoriasis lesions using a 3 mm disposable biopsy punch, and quick-frozen tissue samples from patients were collected until the time of analysis. It was stored in -80 °C nitrogen tank in Ajou University Hospital Human Biobank (AUHHB). Skin tissue samples were homogenized in QIAzol Lysis Reagent and total RNA was extracted by pulverizing lesion tissue using TissueLyser II (Qiagen, Hilden, Germany).
  • cDNA was synthesized from total RNA extracted using miRCURY LNA miRNA PCR Assays (Qiagen) with the miRCURY LNA RT Kit (Qiagen) according to the manufacturer's instructions, and the quantity and quality of total RNA was measured spectrophotometrically (NanodropTM ND-1000, ThermoFisherScientific , Copenhagen, Denmark).
  • qRT-PCR was performed using the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). miRNA expression values obtained by qRT-PCR were normalized to miR-103-3p (International journal of molecular sciences. 2019;20(18):4353). Afterwards, the results were quantitatively analyzed using the relative standard curve method (2- ⁇ ).
  • the selected down-regulated miRNAs did not show a significant difference in expression between the groups (Fig. 1c), but all of the selected up-regulated miRNAs showed a significant difference in expression between the PASI ⁇ 5 group and the PASI ⁇ 10 group.
  • both miR-4488 and miR-625-3p showed significant expression differences between the PASI ⁇ 5 group and the 5 ⁇ PASI ⁇ 10 group (FIG. 1d).
  • miR-625-3p showed a significant difference between the PASI ⁇ 5 group and the 5 ⁇ PASI ⁇ 10 group, and the PASI ⁇ 5 group and the PASI ⁇ 10 group ( Fig. 1e).
  • the three selected miRNAs showed a significant correlation (p ⁇ 0.0001) between the expression level and PASI, but miR-625-3p showed an exceptionally high level of correlation (FIG. 2a). Similar results were observed in the correlation with BSA, and miR-625-3p showed the highest correlation coefficient value compared to other miRNAs (Fig. 2b).
  • the ROC curve was analyzed to what extent the elevated miRNAs could predict the two patient groups with PASI ⁇ 10 and PASI ⁇ 10.
  • miR-4488 was also found to have significant results in the AUC value in the ROC curve, but in particular, miR-625-3p had the highest AUC value with an exceptional value of 0.9515, indicating mild psoriasis (PASI ⁇ 10) and severe psoriasis. (PASI ⁇ 10), and the diagnostic value as a biomarker for determining the severity of psoriasis disease was confirmed.
  • circulating exosome miRNAs from Behcet's disease (BD) patients were additionally analyzed (Fig. 2d, blue arrow (dotted line)).
  • miR-625-3p is a biomarker that can most accurately indicate psoriasis activity.
  • ISH In situ hybridization
  • ISH ISH paraffin-embedded sections fixed in formalin were cut to a thickness of 6 ⁇ m, mounted on slides, and experiments were performed using miRCURY LNA miRNA Detection Probe (Qiagen) according to the manufacturer's instructions. Briefly, sections of patient lesion specimens were deparaffinized and treated with proteinase K for 10 minutes at 37°C. Hybridization mix was prepared by adding LNA detection probes (Qiagen, 5'-DIG- and 3'-DIG-labeled) for hsa-miR-625-3p and hsa-miR-4488 to miRNA ISH buffer (Qiagen) .
  • LNA detection probes Qiagen, 5'-DIG- and 3'-DIG-labeled
  • the hybridization mix was applied to the incubated slide and placed in a hybridizer at a temperature ranging from 55°C to 60°C.
  • the slides were then washed with 5X SSC, 1X SSC and 0.2X SSC buffer and incubated with 0.2X SSC buffer at 60°C for 1 hour. After washing thoroughly, the probe was detected by incubating the sections with alkaline phosphatase (AP)-conjugated anti-DIG Ab for 1 hour at RT.
  • AP alkaline phosphatase
  • miR-625-3p was identified in basal keratinocytes, not in infiltrating immune cells (FIG. 3a).
  • miR-625-3p was observed in the cytoplasm and extracellular matrix of basal keratinocytes, but not in the nucleus (stained with U6) under high-power fields (Fig. 3b).
  • miR-625-3p is derived from psoriasis basal keratinocytes, and IL-12 (Recombinant Human IL-12 (Cat No. 573002) BioLegend) and IL-23 (Recombinant Human IL-23) are used to mimic similar conditions.
  • 23 (Cat No. 1290-IL) Bio-Techne) (each 50ng/ml) after stimulating HaCaT cells or JurkaT cells, the expression levels of miR-625-3p and miR-4488 were confirmed by qRT-PCR. .
  • HaCaT human keratinocytes
  • T Jurkat cells
  • the cell line tested negative for mycoplasma was cultured in RPMI medium 1640 with L-glutamine supplemented with 10% heat-inactivated FBS.
  • HaCaT cells and Jurkat cells were cultured in a 12-well plate at a concentration of 4 x 10 4 cells and 5 x 10 5 cells, respectively, and interleukin (IL)-12 and/or IL-23 were treated in each well plate.
  • IL interleukin
  • RNA in HaCaT and Jurkat cells was isolated with the miRNeasy Micro Kit (Qiagen) according to the manufacturer's instructions, or from the culture supernatant of HaCaT and Jurkat cells using the QIAGEN exoRNeasy Midi Kit (Cat. No. 77144), qRT-PCR was performed in the same manner as described in Example 1 after exosome extraction.
  • miRDB Nucleic Acids Research. 48(D1):D127-D131 (2020)
  • TargetScan Gene Biol. 11:R90. (2010)
  • miRTarBase Nucleic Acid Res. 8;48(D1):D148-D154 (2020)
  • 294, 2906, and 33 targets were predicted as targets of miR-625-3p in miRDB, TargetScan, and mirRTarBase, respectively.
  • Select the top 100 overlapping genes (6 genes with all 3 overlaps, 94 genes with random 2 overlaps), enter the HGNC names using the Enrichr tool (BMC Bioinformatics 14, 128 (2013)) and enter the KEGG pathway and enrichment scores (P-values) for GO terms.
  • the top 4 (lowest P values) for each category were scored.
  • miR-625-3p was confirmed to be correlated with insulin-like growth factor (IGF) (FIG. 4a).
  • IGF insulin-like growth factor
  • mir Vana TM miRNA Mimic (Negative control, Thermo Fisher Scientific (#4464058)) (or mir Vana TM miRNA Mimic (has-miR-625-3p, Thermo Fisher Scientific, (#4464066)) was purchased and used at a concentration of 50 pmol.
  • miRNA Mimic was transfected using Lipofectamine ® RNAiMAX reagent according to the manufacturer's instructions (Fig. 4b), the following primers were used in the same manner as in Example 1 to confirm the expression level of various IGF-1 signaling genes and subjected to qRT-PCR analysis.
  • Ki67-Forward 5'-GAGAGCTCCCAGCCTAAGGT, Reverse: 5'-CCTGCT TCTCCTTTCCCTTT
  • Cell counting kit analysis was performed by CCK8 assay using D-PlusTMCCK cell viability assay kit (Dougin; #CCK-3000).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une utilisation de miR-625-3p en tant que biomarqueur pour diagnostiquer la gravité du psoriasis, et plus spécifiquement : une composition ou un kit pour diagnostiquer la gravité du psoriasis, la composition ou le kit contenant une matière pour détecter un biomarqueur de miR-625-3p; et un procédé de diagnostic de la gravité du psoriasis à l'aide du miR-625-3p en tant que biomarqueur. Le biomarqueur de diagnostic du psoriasis selon la présente invention possède l'avantage de permettre le diagnostic objectif précoce du psoriasis au niveau moléculaire et de déterminer avec précision la gravité du psoriasis, ce qui permet d'augmenter l'efficacité du traitement lors du diagnostic d'une maladie chronique.
PCT/KR2022/015595 2021-10-15 2022-10-14 Utilisation de mir-625-3 p en tant que biomarqueur pour diagnostiquer la gravité du psoriasis WO2023063775A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0137391 2021-10-15
KR20210137391 2021-10-15

Publications (1)

Publication Number Publication Date
WO2023063775A1 true WO2023063775A1 (fr) 2023-04-20

Family

ID=85987565

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/015595 WO2023063775A1 (fr) 2021-10-15 2022-10-14 Utilisation de mir-625-3 p en tant que biomarqueur pour diagnostiquer la gravité du psoriasis

Country Status (2)

Country Link
KR (1) KR20230055951A (fr)
WO (1) WO2023063775A1 (fr)

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5556752A (en) 1994-10-24 1996-09-17 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
US5599695A (en) 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
US5631734A (en) 1994-02-10 1997-05-20 Affymetrix, Inc. Method and apparatus for detection of fluorescently labeled materials
WO1997045539A1 (fr) 1996-05-31 1997-12-04 Mikael Kubista Sonde pour l'analyse d'acides nucleiques
US5945526A (en) 1996-05-03 1999-08-31 Perkin-Elmer Corporation Energy transfer dyes with enhanced fluorescence
US6020481A (en) 1996-04-01 2000-02-01 The Perkin-Elmer Corporation Asymmetric benzoxanthene dyes
US6140500A (en) 1999-09-03 2000-10-31 Pe Corporation Red-emitting [8,9]benzophenoxazine nucleic acid dyes and methods for their use
US6191278B1 (en) 1999-11-03 2001-02-20 Pe Corporation Water-soluble rhodamine dyes and conjugates thereof
US20060078894A1 (en) 2004-10-12 2006-04-13 Winkler Matthew M Methods and compositions for analyzing nucleic acids
KR20090056732A (ko) * 2007-11-30 2009-06-03 (주)지노믹트리 건선 진단용 키트 및 칩
US20140274789A1 (en) * 2011-08-11 2014-09-18 Andreas Keller Complex sets of mirnas as non-invasive biomarkers for psoriasis
KR20140123777A (ko) * 2013-04-15 2014-10-23 가톨릭대학교 산학협력단 건선 진단용 유전자 마커 및 이를 이용한 건선 진단 방법
KR20160022017A (ko) 2014-08-19 2016-02-29 주식회사 엠모니터 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5631734A (en) 1994-02-10 1997-05-20 Affymetrix, Inc. Method and apparatus for detection of fluorescently labeled materials
US5556752A (en) 1994-10-24 1996-09-17 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
US5599695A (en) 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
US6020481A (en) 1996-04-01 2000-02-01 The Perkin-Elmer Corporation Asymmetric benzoxanthene dyes
US5945526A (en) 1996-05-03 1999-08-31 Perkin-Elmer Corporation Energy transfer dyes with enhanced fluorescence
WO1997045539A1 (fr) 1996-05-31 1997-12-04 Mikael Kubista Sonde pour l'analyse d'acides nucleiques
US6140500A (en) 1999-09-03 2000-10-31 Pe Corporation Red-emitting [8,9]benzophenoxazine nucleic acid dyes and methods for their use
US6191278B1 (en) 1999-11-03 2001-02-20 Pe Corporation Water-soluble rhodamine dyes and conjugates thereof
US20060078894A1 (en) 2004-10-12 2006-04-13 Winkler Matthew M Methods and compositions for analyzing nucleic acids
KR20090056732A (ko) * 2007-11-30 2009-06-03 (주)지노믹트리 건선 진단용 키트 및 칩
US20140274789A1 (en) * 2011-08-11 2014-09-18 Andreas Keller Complex sets of mirnas as non-invasive biomarkers for psoriasis
KR20140123777A (ko) * 2013-04-15 2014-10-23 가톨릭대학교 산학협력단 건선 진단용 유전자 마커 및 이를 이용한 건선 진단 방법
KR20160022017A (ko) 2014-08-19 2016-02-29 주식회사 엠모니터 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
"Nucleic Acids in Chemistry and Biology", 1996, article "DNA and RNA Structure"
ACS NANO., vol. 14, no. 10, 2020, pages 12732 - 48
ADVANCES IN CLINICAL AND EXPERIMENTAL MEDICINE., vol. 26, no. 5, 2017, pages 851 - 6
ALLAWI, H.T. ET AL.: "Quantitationof microRNAs using a modified Invader assay.", RNA, vol. 10, 2004, pages 1153
AYDIN BUSRA, ARGA KAZIM YALCIN, KARADAG AYSE SERAP: "Omics-Driven Biomarkers of Psoriasis: Recent Insights, Current Challenges, and Future Prospects", CLINICAL, COSMETIC AND INVESTIGATIONAL DERMATOLOGY, vol. 13, 1 January 2020 (2020-01-01), pages 611 - 625, XP093058763, DOI: 10.2147/CCID.S227896 *
BIOMEDICAL REPORTS., vol. 9, no. 5, 2018, pages 367 - 74
BMC BIOINFORMATICS., vol. 14, no. 1, 2013, pages 1 - 14
CALIN, G.A. ET AL., PROC NATL ACAD SCI USA, vol. 101, 2004, pages 11755
CELL DEATH & DISEASE, vol. 13, no. 1, 2022, pages 1 - 13
CHEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 20, 2005, pages e179
CHEN, J. ET AL.: "Highly sensitive and specific microRNA expression profiling using BeadArray technology.", NUCLEIC ACIDS RES, vol. 36, 2008, pages e87, XP055004505, DOI: 10.1093/nar/gkn387
GARMAN A: "Non Radioactive Labeling", 1997, ACADEMIC PRESS
GENOME BIOL., vol. 11, 2010, pages R90
HAWKES JASON E., NGUYEN GIANG HUONG, FUJITA MAYUMI, FLORELL SCOTT R., CALLIS DUFFIN KRISTINA, KRUEGER GERALD G., O’CONNELL RYAN M.: "microRNAs in Psoriasis", JOURNAL OF INVESTIGATIVE DERMATOLOGY, ELSEVIER, NL, vol. 136, no. 2, 1 February 2016 (2016-02-01), NL , pages 365 - 371, XP093058760, ISSN: 0022-202X, DOI: 10.1038/JID.2015.409 *
INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 20, no. 18, 2019, pages 4353
JONSTRUP, S.P. ET AL.: "AmicroRNA detection system based on padlockprobes and rolling circle amplification", RNA, vol. 12, 2006, pages 1747
JOURNAL OF THE ROYAL STATISTICAL SOCIETY: SERIES B (METHODOLOGICAL)., vol. 57, no. 1, 1995, pages 289 - 300
NUCLEIC ACID RES., vol. 8, no. 48, 2020, pages 148 - 154
NUCLEIC ACIDS RESEARCH, vol. 40, no. 1, 2012, pages 37 - 52
NUCLEIC ACIDS RESEARCH, vol. 42, no. D1, 2014, pages 68 - 73
NUCLEIC ACIDS RESEARCH, vol. 48, no. D1, 2020, pages 127 - 131
SCHENA ET AL., PROC NATL ACAD SCI USA., vol. 93, no. 20, 1996, pages 10614 - 9
SCHENA ET AL., SCIENCE, vol. 270, no. 5235, 1995, pages 467 - 70
SCHMITTGEN, T.D. ET AL.: "Real-time PCR quantification of precursor and mature microRNA", METHODS, vol. 44, no. 31, 2008, pages 8
SCHOUTEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 30, 2002, pages e57
SHARBATI-TEHRANI ET AL.: "miR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complex sample", BMC MOL BIOL, vol. 9, 2008, pages 34, XP002553995, DOI: 10.1186/1471-2199-9-34

Also Published As

Publication number Publication date
KR20230055951A (ko) 2023-04-26

Similar Documents

Publication Publication Date Title
US20070264635A1 (en) Probe, probe set and information acquisition method using the same
EP2765227A2 (fr) Compositions et procédés permettant d'identifier des troubles du spectre autistique
KR101169653B1 (ko) 마이크로 알엔에이 염기서열 다형을 이용한 원인불명 반복 자연 유산 진단에 필요한 정보제공 방법 및 진단용 조성물
KR101784714B1 (ko) 재발 난소암 진단 또는 난소암 재발 예측용 mirna 마커 및 그 용도
KR20140087785A (ko) 돼지의 흑모색 판단용 ｓｎｐ 마커 및 이의 용도
KR101929009B1 (ko) 뇌졸중 진단용 조성물 및 이를 진단하는 방법
WO2023063775A1 (fr) Utilisation de mir-625-3 p en tant que biomarqueur pour diagnostiquer la gravité du psoriasis
KR101992539B1 (ko) miRNA 기반의 인지장애 질환 진단용 조성물 및 방법
WO2019132581A1 (fr) Composition de diagnostic du cancer, tel que du cancer du sein et du cancer de l'ovaire, et son utilisation
WO2021080335A1 (fr) Composition pour le diagnostic d'une infection provoquée par des mycobactéries non tuberculeuses ou d'une maladie infectieuse
WO2018062683A1 (fr) Composition de biomarqueur pour le diagnostic de la fonction barrière cutanée
KR20110034297A (ko) 내인성 아토피 피부염 진단용 마커 및 그의 용도
WO2021107713A1 (fr) Procédé de diagnostic de la sclérose latérale amyotrophique sur la base d'un marqueur de mutation du gène lats1
WO2011142646A2 (fr) Procédé de détection de hpv (papillomavirus humain) et de son génotype
WO2020204313A1 (fr) Marqueur snp pour diagnostiquer un anévrisme cérébral, comprenant un polymorphisme monobasique du gène gba
WO2021172653A1 (fr) Acide nucléique unique pour la détection en temps réel de variation génétique d'un gène cible unique et procédé de détection l'utilisant
WO2020096247A1 (fr) Procédé de préparation d'une sonde permettant de détecter une mutation dérivée de cellules dans des tissus d'un cancer du sein et procédé de détection
WO2022124564A1 (fr) Procédé de prédiction et de diagnostic de neuropathie diabétique à l'aide de micro-arn, et kit associé
KR101742261B1 (ko) 다중 증폭 이중 신호 증폭에 의한 brca 유전자 변이 검출 방법
LU102676B1 (en) A Biomarker for Severe Asthma and Application Thereof
WO2011122859A2 (fr) Composition permettant de prédire la récidive d'une tumeur cérébrale et les chances de survie et kit la contenant
WO2023132626A1 (fr) Composition pour diagnostiquer le cancer de la prostate en utilisant les changements de methylation des gènes cpg dans des gènes specifiques, et son utilisation
WO2011049322A2 (fr) Procédé de détection de la méthylation d'un gène de marqueur de méthylation spécifique de cancer du sein pour le diagnostic du cancer du sein
WO2023219447A1 (fr) Composition pour diagnostiquer un cancer de l'ovaire comprenant un agent pour détecter un miarn dérivé de vésicule extracellulaire
WO2024091020A1 (fr) Biomarqueur du gène de miarn dérivé de vésicule extracellulaire pour le diagnostic du cancer du sein ou la prédiction de la récidive, et son utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22881402

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022881402

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022881402

Country of ref document: EP

Effective date: 20240515