WO2022114491A1 - 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트 - Google Patents

한국인의 치주질환 진단을 위한 정보제공 방법 및 키트 Download PDF

Info

Publication number
WO2022114491A1
WO2022114491A1 PCT/KR2021/013288 KR2021013288W WO2022114491A1 WO 2022114491 A1 WO2022114491 A1 WO 2022114491A1 KR 2021013288 W KR2021013288 W KR 2021013288W WO 2022114491 A1 WO2022114491 A1 WO 2022114491A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
primer
probe
pcr
detection
Prior art date
Application number
PCT/KR2021/013288
Other languages
English (en)
French (fr)
Inventor
강지훈
임재성
Original Assignee
주식회사 힐릭스코
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 힐릭스코 filed Critical 주식회사 힐릭스코
Publication of WO2022114491A1 publication Critical patent/WO2022114491A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a method and kit for providing information for diagnosing periodontal disease in Koreans, specifically, in a sample derived from the oral cavity of a subject, Actinomyces , microorganisms of the genus; microorganisms of the genus Fretibacterium ; Prevotella dentalis ( Prevotella dentalis ); Tannerella forsythia ; Eubacterium nodatum ; Microorganisms of the genus Mogibacterium ; Porphyromonas endodontalis ( Porphyromonas endodontalis ); Treponema ( Treponema ) microorganisms; Filifactor alocis ; Treponema denticola ; Treponema socranskii ; Eubacterium saphenum ; Haemophilus parainfluenzae ; Oribacterium ( Oribacterium ) microorganisms; Porphyromonas gingivalis; Porphy
  • Periodontal disease is a chronic inflammatory disease in which periodontal tissues are destroyed by the bacteria that cause periodontal disease in the oral cavity and the toxins produced by these bacteria.
  • the direct causes of periodontal disease include bacterial plaque, tartar, and smoking.
  • Periodontal disease In the human oral cavity, more than 700 types of microorganisms form a community and compete with each other to achieve homeostasis, but it is known that periodontal disease can occur if the balance of the oral ecosystem is disrupted due to direct or indirect causes.
  • Periodontal disease is a chronic disease. Chronic diseases, once onset, are difficult to cure and require lifelong management. In addition, holistic management for treatment is required because the effects are exchanged between diseases under common factors of action. Periodontal disease, as a 'silent disease', has no symptoms in the early stages, and is easy to overlook even if there are minor symptoms. The incidence increases with increasing age, and according to the 2019 frequent morbidity statistics, gingivitis and periodontal disease ranked first, with an increase of 6.7% compared to last year.
  • the present inventors have attempted to develop a method and related products that can be used to diagnose or diagnose periodontal disease of Koreans more accurately and efficiently by fully considering the overall oral microbial environment of Koreans.
  • Non-Patent Document 1 Seon-Mi Kim, et al. "Quantitative analysis of bacteria causing periodontal disease using real-time PCR.” Korean Journal of Pediatric Dentistry 35.3 (2008): 494-503.
  • Non-Patent Document 2 Kyung Hee Medicine: Volume 32, 1st, J Kyung Hee Univ Med Cent: Vol. 32, No. 1, 2017.
  • Non-Patent Document 3 Yun, Jeong-Ho, et al, 2008, The Korean Academy Of Periodontology, 143-152.
  • Non-Patent Document 4 J Clin Periodontol. 2000 Sep;27(9):648-57.
  • Non-Patent Document 5 Pereira JV, Leomil L, Rodrigues-Albuquerque F, Pereira JO, Brazilian dental journal. 2012;23(4):409-16.
  • Non-Patent Document 6 Van Hoogmoed CG, Geertsema-Doornbusch GI, Teughels W, Quirynen M, Busscher HJ, Van der Mei HC. Oral Microbiol Immun. 2008;23(1):43-8.
  • Non-Patent Document 7 Khemwong T, Kobayashi H, Ikeda Y, Matsuura T, Sudo T, Kano C, et al. Pls One. 2019;14(6).
  • Non-Patent Document 8 Casarin RC, Saito D, Santos VR, Pimentel SP, Duarte PM, Casati MZ, et al. Brazilian journal of microbiology. 2012;43(3):931-7.
  • Non-Patent Document 9 Zhou X, Li Y. Atlas of oral microbiology: From healthy microflora to disease: Academic press; 2015.
  • Non-Patent Document 10 Kwek, H. S. N., M. Wilson, and H. N. Newman Journal of clinical periodontology 17.2 (1990): 119-122.
  • Non-Patent Document 11 Hiranmayi KV, Sirisha K, Ramoji Rao MV, Sudhakar P. Journal of pharmacy & bioallied sciences. 2017;9(3):155-63.
  • Non-Patent Document 13 Lee M-Y, Kwon E-Y, Kim H-J, Lee J-Y, Joo J-Y. Journal of Dental Rehabilitation and Applied Science. 2018;34(3):186-95.
  • Non-Patent Document 14 J Periodontol. 2001 Oct;72(10):1354-63.
  • Non-Patent Document 15 Marchesan J, Jiao Y, Schaff RA, Hao J, Morelli T, Kinney JS, et al. Molecular oral microbiology. 2016;31(3):243-58.
  • Non-Patent Document 16 Jia, Lu, et al. (2019) Frontiers in cellular and infection microbiology 9.
  • the main object of the present invention is to provide an information providing method and kit that can be used to more accurately and efficiently diagnose periodontal disease in Koreans by considering the overall oral microbial environment of Koreans.
  • the present invention is a sample from the oral cavity of the subject, Actinomyces ( Actinomyces ) genus microorganisms detected by PCR using a primer of SEQ ID NO: 1, a primer of SEQ ID NO: 2, and a probe of SEQ ID NO: 35 ; Fretibacterium genus microorganisms detected by PCR using the primer of SEQ ID NO: 3, the primer of SEQ ID NO: 4 and the probe of SEQ ID NO: 36; Prevotella dentalis ( Prevotella dentalis ); Tannerella forsythia ; Eubacterium nodatum ; Mogibacterium genus microorganisms detected by PCR using the primer of SEQ ID NO: 11, the primer of SEQ ID NO: 12 and the probe of SEQ ID NO: 40; Porphyromonas endodontalis ( Porphyromonas endodontalis ); Treponema genus microorganisms detected by PCR using the primer
  • the present invention provides a first primer-probe set comprising a primer of SEQ ID NO: 1, a primer of SEQ ID NO: 2 and a probe of SEQ ID NO: 35; a second primer-probe set comprising the primer of SEQ ID NO: 3, the primer of SEQ ID NO: 4, and the probe of SEQ ID NO: 36; a third primer-probe set comprising the primer of SEQ ID NO: 5, the primer of SEQ ID NO: 6 and the probe of SEQ ID NO: 37; a fourth primer-probe set comprising the primer of SEQ ID NO: 7, the primer of SEQ ID NO: 8 and the probe of SEQ ID NO: 38; a fifth primer-probe set comprising the primer of SEQ ID NO: 9, the primer of SEQ ID NO: 10 and the probe of SEQ ID NO: 39; a sixth primer-probe set comprising the primer of SEQ ID NO: 11, the primer of SEQ ID NO: 12 and the probe of SEQ ID NO: 40; a seventh primer-
  • the first primer-probe set, the second primer-probe set, the third primer-probe set and the fourth primer-probe set are included in one composition
  • the 12th primer-probe set, the 13th primer-probe set, the 14th primer-probe set, and the 15th primer-probe set are preferably included as one composition.
  • the 17th primer-probe set comprising the primer of SEQ ID NO: 33, the primer of SEQ ID NO: 34, the probe of SEQ ID NO: 51, and the probe of SEQ ID NO: 52; further comprising; the 16th primer- It is preferable to include the probe set and the 17th primer-probe set as one composition.
  • the information providing method and kit of the present invention fully considers the overall oral microbial environment of Koreans, and using it, it is possible to accurately and efficiently diagnose periodontal disease in Koreans.
  • M size marker
  • Pd Prevotella dentalis
  • Tf Tanerella forsytia
  • En Eubacterium nodatum
  • Pe Porphyromonas endodontalis
  • Fa Filifactor alosis
  • Td Treponema denti Coke
  • Ts Treponema sokranskii
  • Es Eubacterium safenum
  • Hp Haemophilus parainfluenza
  • Pg Porphyromonas gingivalis.
  • 2 to 17 are results of single real-time PCR using each primer-probe of the present invention and plasmid DNA for the corresponding target microorganism. 2 to 17 in order, P. endodontalis, Treponema sokranskii, Prevotella dentalis, Eubacterium safenum, Treponema denticola, Eubacterium nodatum, Tanerella posi Tia, P. allosis, P. gingivalis, Treponema genus, Mycoplasma genus, Pretibacterium genus, Mosquito bacterium genus microorganism, Haemophilus parainfluenza, Actinomyces It is a result for microorganisms of the genus Oribacterium.
  • 18 to 26 are results of performing multiplex real-time PCR with each set of Table 4 using each primer-probe of the present invention and plasmid DNA for the corresponding target microorganism.
  • Pd Prevotella dentalis
  • Tf Tannerella forsytia
  • En Eubacterium nodatium
  • Pe Porphyromonas endodontalis
  • Fa Filifactor alosis
  • Td Treponema denticola
  • Ts Tre Ponema Sokranskii
  • Es Eubacterium safenum
  • Hp Haemophilus parainfluenza
  • Pg Porphyromonas gingivalis.
  • the information providing method for the diagnosis of periodontal disease in Koreans of the present invention is Actinomyces detected by PCR using a primer of SEQ ID NO: 1, a primer of SEQ ID NO: 2, and a probe of SEQ ID NO: 35 in a sample derived from the oral cavity of a subject.
  • genus microorganisms Fretibacterium genus microorganisms detected by PCR using the primer of SEQ ID NO: 3, the primer of SEQ ID NO: 4 and the probe of SEQ ID NO: 36; Prevotella dentalis ( Prevotella dentalis ); Tannerella forsythia ; Eubacterium nodatum ; Mogibacterium genus microorganisms detected by PCR using the primer of SEQ ID NO: 11, the primer of SEQ ID NO: 12 and the probe of SEQ ID NO: 40; Porphyromonas endodontalis ( Porphyromonas endodontalis ); Treponema genus microorganisms detected by PCR using the primer of SEQ ID NO: 15, the primer of SEQ ID NO: 16 and the probe of SEQ ID NO: 42; Filifactor alocis ; Treponema denticola ; Treponema socranskii ; Eubacterium saphenum ; Haemophilus
  • the microorganisms were selected through a study on the oral microbial environment for Koreans, specifically, a study on the oral microbial environment for Koreans with a healthy oral environment without periodontal disease and Koreans with periodontal disease, Microorganisms of the genus Pretibacterium, Prevotella dentalis, Tanerella forsythia, Eubacterium nodatum, microorganisms of the genus Mosquitobacterium, P.
  • Microorganisms of the genera Nema denticola, Treponema Sokranskii, Eubacterium safenum, Porphyromonas gingivalis and Mycoplasma are selected as harmful bacteria that cause periodontal disease, and the microorganisms of the genus Actinomyces, duck The microorganisms of the genus Bacterium and Haemophilus parainfluenza were selected as the flora existing in healthy subjects.
  • the subject's risk of periodontal disease is classified as high, and if the balance of microorganisms in the oral cavity is maintained, such as a small amount of the microorganism selected as the harmful bacteria is detected and a large amount of the microorganism selected as the flora is detected in the sample derived from the subject's oral cavity, the subject's risk of periodontal disease can be classified as low. have.
  • the periodontal disease risk may be indicated by giving '+1 point' to each detected harmful bacteria and '-1 point' to each detected common bacterial species.
  • the sample derived from the subject's oral cavity refers to a biological sample derived from the subject's oral cavity, and is preferably the subject's saliva (saliva) or mouthwash.
  • the microorganism specified to be detected by PCR using a specific primer and probe refers to a microorganism in which a sequence detected by PCR using the corresponding primer and probe, for example, real-time PCR, is included in the genome.
  • the microorganism of the genus Actinomyces may be a microorganism in which a sequence registered as an accession number KF933792.1 in the GenBank database is included in the genome, and Actinomyces sp. ChDC B642.
  • the microorganism of the genus Pretibacterium may be a microorganism in which a sequence registered as registration number KT895067.1 in the GenBank database is included in the genome.
  • the Prevotella dentalis may be a microorganism in which the sequence registered as registration number NR_102481.1 in the GenBank database is included in the genome, and may be Prevotella dentalis DSM 3688.
  • the Tannerella forsythia may be a microorganism in which the sequence registered as NR_074140.1 in the GenBank database is included in the genome, and may be Tannerella forsythia strain ATCC 43037.
  • the Eubacterium nodatium may be a microorganism in which the sequence registered in the GenBank database as registration number GU424720.1 is included in the genome.
  • the microorganism of the genus Mosquitobacterium may be a microorganism in which a sequence registered as registration number MT482651.1 in the GenBank database is included in the genome, and Mogibacterium sp. It may be strain KCOM 3331.
  • the Porphyromonas endodontalis may be a microorganism in which a sequence registered as an accession number LT676548.1 in the GenBank database is included in the genome.
  • the microorganism of the genus Treponema may be a microorganism in which a sequence registered as registration number GU408605.1 in the GenBank database is included in the genome, and Treponema sp. It may be oral taxon 230.
  • the Treponema denticola may be a microorganism in which a sequence registered as NR_036899.1 in the GenBank database is included in the genome.
  • the Treponema Sokranskii may be a microorganism in which a sequence registered as an accession number LT698215.1 in the GenBank database is included in the genome.
  • the Eubacterium saphenum may be a microorganism in which the sequence registered as registration number NR_026031.1 in the GenBank database is included in the genome, and may be Eubacterium saphenum strain 164-47.
  • the Haemophilus parainfluenza may be a microorganism in which the sequence registered as registration number MT096513.1 in the GenBank database is included in the genome, or may be Haemophilus parainfluenzae strain Ch6.
  • the microorganism of the genus Oribacterium may be a microorganism in which a sequence registered as registration number LT698418.1 in the GenBank database is included in the genome.
  • the Porphyromonas gingivalis may be a microorganism in which the sequence registered as registration number KR074427.1 in the GenBank database is included in the genome, or Porphyromonas gingivalis strain CP41.
  • the microorganism of the genus Mycoplasma may be a microorganism in which a sequence registered as registration number AM420094.1 in the GenBank database is included in the genome.
  • PCR is performed using the primer of SEQ ID NO: 1, the primer of SEQ ID NO: 2 and the probe of SEQ ID NO: 35 for detection of the microorganism of the genus Actinomyces, and the detection of the microorganism of the genus Pretibacterium
  • PCR is performed using the primer of SEQ ID NO: 3, the primer of SEQ ID NO: 4 and the probe of SEQ ID NO: 36, and preferably the primer of SEQ ID NO: 5,
  • SEQ ID NO: PCR is performed using the primer of 6 and the probe of SEQ ID NO: 37, and PCR is preferably performed using the primer of SEQ ID NO: 7, the primer of SEQ ID NO: 8, and the probe of SEQ ID NO: 38 for detection of the Tanerella forsythia.
  • PCR for the detection of the Eubacterium nodatum, preferably PCR using the primer of SEQ ID NO: 9, the primer of SEQ ID NO: 10 and the probe of SEQ ID NO: 39 is performed, and it is preferable for the detection of microorganisms of the genus Mosquitobacterium
  • PCR is performed using the primer of SEQ ID NO: 11, the primer of SEQ ID NO: 12, and the probe of SEQ ID NO: 40, and preferably the primer of SEQ ID NO: 13 for the detection of the P.
  • SEQ ID NO: 14 PCR is performed using a primer and a probe of SEQ ID NO: 41, and PCR is preferably performed using a primer of SEQ ID NO: 15, a primer of SEQ ID NO: 16, and a probe of SEQ ID NO: 42 for detection of the microorganism of the genus Treponema ,
  • PCR is performed using the primer of SEQ ID NO: 17, the primer of SEQ ID NO: 18 and the probe of SEQ ID NO: 43 for the detection of the Filifactor allosis, and preferably for the detection of the Treponema denticola PCR is performed using the primer of SEQ ID NO: 19, the primer of SEQ ID NO: 20 and the probe of SEQ ID NO: 44, and preferably the primer of SEQ ID NO: 21, the primer of SEQ ID NO: 22, and PCR was performed using the probe of SEQ ID NO: 45, and the Eubacterium safenum
  • PCR for the detection of the microorganism of the genus Actinomyces can be performed in one reaction solution
  • PCR for the detection of the microorganism of the genus Pretibacterium can be performed in one reaction solution
  • PCR for the detection of the microorganisms in the genus Mosquitobacterium can be performed in one reaction solution
  • PCR for the detection of the Porphyromonas endodontalis can be performed in one reaction solution
  • PCR for detection of the microorganism of the genus Treponema can be performed in one reaction solution, and PCR for detection of the Filifactor allosis
  • PCR for detection of the Treponema denticola can be performed in one reaction solution
  • PCR for detection of Treponema Sokranskii can be performed in one reaction solution
  • gingivalis can be performed in one reaction solution.
  • the primers and probes of PCR which are presented as being able to be performed in one reaction solution, are designed to have high specificity and sensitivity without interfering with each other. Accordingly, faster detection or easier detection is possible by using the corresponding primers and probes presented above, so that it is possible to provide more efficient information for diagnosing periodontal disease in Koreans.
  • These PCRs are for the role of a control, and when these PCRs are additionally performed, the reliability of information can be increased.
  • PCR for detection of the gram-positive microorganism and PCR for detection of Gram-negative microorganisms; PCR for detection of microorganisms of the genus Mycoplasma; together with can be performed in one reaction solution.
  • PCR three-step PCR (3-step PCR) that repeats three steps of denaturation - annealing - extension, or two-step PCR (2-step PCR) that performs binding and extension at the same time ) can be used.
  • two-step PCR which can reduce the reaction time, is used.
  • the PCR conditions are preferably a denaturation step at 95° C. for 15 seconds and a binding and elongation step at 60° C. for 30 seconds, repeating (cycles) 40 times.
  • a UDG (Uracil-DNA Glycosylase) reaction step is added before performing PCR under the same conditions as above to prevent error results due to contamination.
  • the information provision method of the present invention is effective as an information provision method for the diagnosis of periodontitis, especially among periodontal diseases.
  • the kit for diagnosing periodontal disease of Koreans of the present invention is a kit for diagnosing periodontal disease of Koreans by detecting the periodontal disease-related microorganisms by PCR, preferably real-time PCR, and the primers of SEQ ID NO: 1, the primers of SEQ ID NO: 2 and the sequence a first primer-probe set comprising the probe of No.
  • a second primer-probe set comprising the primer of SEQ ID NO: 3, the primer of SEQ ID NO: 4, and the probe of SEQ ID NO: 36; a third primer-probe set comprising the primer of SEQ ID NO: 5, the primer of SEQ ID NO: 6 and the probe of SEQ ID NO: 37; a fourth primer-probe set comprising the primer of SEQ ID NO: 7, the primer of SEQ ID NO: 8 and the probe of SEQ ID NO: 38; a fifth primer-probe set comprising the primer of SEQ ID NO: 9, the primer of SEQ ID NO: 10 and the probe of SEQ ID NO: 39; a sixth primer-probe set comprising the primer of SEQ ID NO: 11, the primer of SEQ ID NO: 12 and the probe of SEQ ID NO: 40; a seventh primer-probe set comprising the primer of SEQ ID NO: 13, the primer of SEQ ID NO: 14 and the probe of SEQ ID NO: 41; an eighth primer-probe set comprising the primer of SEQ ID NO: 15, the
  • the first primer-probe set is a primer-probe set for the detection of the microorganism of the genus Actinomyces
  • the second primer-probe set is a primer-probe set for the detection of the microorganism of the genus Pretibacterium
  • the third primer-probe set is a primer-probe set for the detection of Prevotella dentalis
  • the fourth primer-probe set is a primer-probe set for the detection of Tanerella focitiia
  • the fifth The primer-probe set is a primer-probe set for the detection of Eubacterium nodatium
  • the sixth primer-probe set is a primer-probe set for the detection of microorganisms of the genus Mosquitobacterium
  • the seventh primer- The probe set is a primer-probe set for the detection of the P.
  • the eighth primer-probe set is a primer-probe set for the detection of the microorganism of the genus Treponema
  • the ninth primer-probe a set is a primer-probe set for the detection of Filifactor alosis
  • the tenth primer-probe set is a primer-probe set for the detection of the Treponema denticola
  • the eleventh primer-probe set is the a primer-probe set for the detection of Treponema sokranskii
  • the twelfth primer-probe set is a primer-probe set for the detection of the Eubacterium safenum
  • the thirteenth primer-probe set is the A primer-probe set for the detection of Morophilus parainfluenza
  • the 14th primer-probe set is a primer-probe set for the detection of the microorganism of the genus Oribacterium
  • the 15th primer-probe set is the foreskin.
  • PCR for the detection of the microorganism of the genus Actinomyces can be performed in one reaction solution
  • PCR for the detection of the microorganism of the genus Pretibacterium can be performed in one reaction solution
  • PCR for the detection of the microorganisms in the genus Mosquitobacterium can be performed in one reaction solution
  • PCR for the detection of the Porphyromonas endodontalis can be performed in one reaction solution
  • PCR for detection of the microorganism of the genus Treponema can be performed in one reaction solution, and PCR for detection of the Filifactor allosis
  • PCR for detection of the Treponema denticola can be performed in one reaction solution
  • PCR for detection of Treponema Sokranskii can be performed in one reaction solution
  • PCR for detection of the Haemophilus parainfluenza can be performed in one reaction solution
  • PCR for detection of the Haemophilus parainfluenza can be performed in
  • the kit of the present invention includes the first primer-probe set, the second primer -A probe set, a third primer-probe set and a fourth primer-probe set are included in one composition, and the fifth primer-probe set, the sixth primer-probe set, the seventh primer-probe set and the eighth primer set are included.
  • the ninth primer-probe set, the tenth primer-probe set and the eleventh primer-probe set are included in one composition
  • the twelfth primer-probe set, the thirteenth The primer-probe set, the 14th primer-probe set, and the 15th primer-probe set may be included in one composition.
  • the composition is, for example, a composition for a PCR reaction, and in addition to the primer-probe set, a material necessary for the PCR reaction, for example, a polymerase, dNTP, a buffer, and the like may be further included.
  • the kit of the present invention includes, in addition to the primer-probe set as described above, a 17th primer-probe set comprising a primer of SEQ ID NO: 33, a primer of SEQ ID NO: 34, a probe of SEQ ID NO: 51, and a probe of SEQ ID NO: 52; may include This is a primer-probe set for the detection of gram-positive microorganisms and gram-negative microorganisms, and can serve as a control, and can contribute to increasing the reliability of diagnosis.
  • the kit of the present invention is the The sixteenth primer-probe set and the seventeenth primer-probe set may be included in one composition.
  • the composition is also, for example, a composition for a PCR reaction, and in addition to the primer-probe set, a material necessary for the PCR reaction, for example, a polymerase, dNTP, a buffer, and the like may be further included.
  • the primers and probes may be labeled with a labeling material commonly used in this field. Both the primer and the probe may be labeled, but generally only the probe is labeled. Although there is no particular limitation on the labeling material used herein, the primer-probe sets suggested to be performed in one reaction solution are labeled with different labeling materials so that they can be detected separately in one PCR reaction.
  • the probe of the first primer-probe set (the probe of SEQ ID NO: 35), the probe of the second primer-probe set (the probe of SEQ ID NO: 36), the probe of the third primer-probe set (the probe of SEQ ID NO: 37) ) and the probe of the fourth primer-probe set (the probe of SEQ ID NO: 38) are labeled with different labeling substances.
  • the probe of the first primer-probe set (the probe of SEQ ID NO: 35), the probe of the second primer-probe set (the probe of SEQ ID NO: 36), the probe of the third primer-probe set (the probe of SEQ ID NO: 37) ) and the probe of the fourth primer-probe set (the probe of SEQ ID NO: 38) are labeled with different labeling substances.
  • the kit of the present invention is a kit for diagnosing periodontitis in particular among periodontal diseases.
  • the kit of the present invention may further include reagents and instruments necessary for easily performing PCR.
  • reagents and instruments necessary for easily performing PCR For example, polymerase, dNTP, buffer, etc. required for PCR may be included, and reagents and instruments necessary for extracting DNA from a sample may be further included.
  • Subject selection criteria were based on the criteria proposed by APP (American Academy of Periodontology) in 1999.
  • healthy people and chronic periodontitis patients were diagnosed with 250 adults who visited the Department of Periodontology, Pusan National University Dental Hospital, for examination and treatment.
  • Chronic periodontitis patients were divided into 4 groups, and classified into early, intermediate, and late periodontitis according to the severity of the disease.
  • Based on the CAL (clinimcal attachment level) the severity of chronic periodontitis was divided into an early stage if 1 or 2, a middle stage if 3 or 4, and an end stage if more than 5 (Table 1).
  • consent to voluntarily participate in the study and a clinical research questionnaire were obtained.
  • Subjects who had systemic diseases that could affect oral care hygiene, had received dental treatment up to 6 months prior to the examination, withdrew consent to participate in the study, or had less than 20 teeth were excluded.
  • the subject's saliva was collected by providing gargle solution and gargling for 30 seconds, then collecting the gargle solution in a designated container, and refrigerated storage until the experiment.
  • Table 1 is a list by group of the present invention.
  • NGS Next-generation sequencing
  • Tables 2 and 3 are lists of selected strains.
  • oral bacteria candidate groups selected by the method of 2.1 oral bacteria related to periodontitis were selected with reference to the non-patent literature.
  • the relevant species was selected.
  • Non-Patent Document 0013 which forms harmful factors in the oral cavity and is involved in the stage of periodontitis or intractable periodontitis and acute necrotizing gingivitis by infiltrating periodontal tissue, and oral cavity through adhesion with other bacteria Tannerella forsythia
  • Non-Patent Document 0012 which acts as a mediator of the formation of an internal biofilm and causes periodontitis by destroying periodontal tissue, destroys the host's immune system by generating various toxic factors Porphyromonas gingivalis that can destroy periodontal tissue (Non-patent document 0016), found in acute and chronic periodontitis and attaches to periodontal tissue to induce periodontal tissue destruction Treponema ( Treponema ) socranskii ) (Non-Patent Document 0014), Prevotella dentalis ( Prevotella dentalis )
  • Oribacterium genus ( Oribacterium ) (Non-patent document 0005), Haemophilus parainfluenzae (Non-patent document 0006) which suppresses adhesion of P. gingivalis was selected.
  • Non-patent literature, next-generation sequencing (NGS), and strains that confirmed the results consistent with the clinical samples of Example 1 were selected as final candidates, and finally, a total of 4 genera and 9 types of harmful bacteria, As flora, a total of 2 genera and 1 type were finally selected (see Table 4).
  • ⁇ Finally selected periodontitis-related oral bacteria set strain A Actinomyces Fretibacterium Prevotella dentalis (Pd) Tannerella forsythia (Tf) B Eubacterium nodatum (En) Mogibacterium Porphyromonas endodontalis (Pe) Treponema C Filifactor alocis (Fa) Treponema denticola (Td) Treponema socranskii (Ts) D Eubacterium saphenum (Es) Haemophilus parainfluenzae (Hp) Oribacterium Porphyromonas gingivalis (Pg) E Mycoplasma Total bacteria
  • the probe used for real-time PCR is a TaqMan probe type, and as a fluorescent dye attached to the probe, considering the wavelength that does not overlap with the sequence number (reads) of next-generation sequencing (NGS) data, Four probe dyes were used.
  • Tables 5 and 6 are lists of primers and probes designed to specifically bind genus/species.
  • the target sequences of the selected strains in Table 4 were cloned into plasmids and prepared at a concentration of 10 9 and used as an analysis sample.
  • composition for single real-time PCR and PCR conditions 2 ⁇ l of forward and reverse primer and probe mixture for each concentration of strain, 2 ⁇ l of strain plasmid DNA, 10 ⁇ l of 2X Taqman multiplex mastermix (Thermofisher, USA), 3 Including 6 ⁇ l of sterile water, the final volume was 20 ⁇ l. Then, it was aliquoted into a 96-well plate, and a single real-time polymerase chain reaction (Singleplex Real-time PCR) was performed. QuantStudio 6 Flex Real-Time PCR System (Thermofisher, USA) was used as a PCR device for performing the PCR reaction, and reacted at 50° C.
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • Each composition of multiplex real-time PCR consists of forward and reverse primer and probe mixture 2 of the strains corresponding to each set (set A 4 types, set B 4 types, C set 3 types, D set 4 types, E set 2 types) ⁇ l, DNA of the strain plasmid corresponding to each set (8 ⁇ l of A, B, D set, 6 ⁇ l of C set, 4 ⁇ l of E set) and 10 ⁇ l of 2X Taqman multiplex mastermix (Thermofisher, USA), finally in the same volume A total of 20 ⁇ l was made including the tertiary sterile water (C set 2 ⁇ l, E set 4 ⁇ l) for matching (see Table 12).
  • Fig. 18 is an image showing multiple real-time PCR
  • set A shows Figs. 18 and 19
  • set B is Figs. 20, 21
  • set C is Figs. 22 and 23
  • set D is Figs. 24, Fig. 25, set E is Fig. 26 is shown.
  • dental caries-related oral microbiome data were produced by next-generation sequencing (NGS) based on clinical research samples, and primers and probes for selected harmful bacteria and flora were prepared.
  • NGS next-generation sequencing
  • primers and probes for selected harmful bacteria and flora were prepared.
  • TaqMan simultaneous multiplex real-time PCR technique species-specific PCR primers and probes that can amplify and detect up to four target strains in a single reaction were developed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medical Treatment And Welfare Office Work (AREA)
  • Instructional Devices (AREA)

Abstract

본 발명은 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트에 관한 것으로, 한국인의 치주질환 진단을 위한 정보제공 방법 및 상기 16가지의 미생물 검출을 위한 프라이머-프로브 세트를 포함하는 한국인의 치주질환 진단용 키트에 관한 것이다. 본 발명의 정보제공 방법 및 키트는 한국인의 종합적인 구강 미생물 환경이 충분히 고려된 것으로, 이를 사용하면 한국인의 치주질환을 정확하고 효율적으로 진단할 수 있다.

Description

한국인의 치주질환 진단을 위한 정보제공 방법 및 키트
본 발명은 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트에 관한 것으로, 구체적으로 피검자의 구강 유래 시료에서 액티노마이세스(Actinomyces) 속 미생물; 프레티박테리움(Fretibacterium) 속 미생물; 프레보텔라 덴탈리스(Prevotella dentalis); 타네렐라 포시티아(Tannerella forsythia); 유박테리움 노다튬(Eubacterium nodatum); 모기박테리움(Mogibacterium) 속 미생물; 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis); 트레포네마(Treponema) 속 미생물; 필리팩터 알로시스(Filifactor alocis); 트레포네마 덴티콜라(Treponema denticola); 트레포네마 소크란스키이(Treponema socranskii); 유박테리움 사페눔(Eubacterium saphenum); 헤모필러스 파라인플루엔제(Haemophilus parainfluenzae); 오리박테리움(Oribacterium) 속 미생물; 포피로모나스 진지발리스(Porphyromonas gingivalis); 및 마이코플라즈마(Mycoplasma) 속 미생물;을 검출하는 한국인의 치주질환 진단을 위한 정보제공 방법 및 상기 16가지의 미생물 검출을 위한 프라이머-프로브 세트를 포함하는 한국인의 치주질환 진단용 키트에 관한 것이다.
치주질환은 구강 내에 존재하는 치주질환 원인균 및 이 세균들이 생성하는 독소들에 의해서 치주조직이 파괴되는 만성 염증성 질환으로 잇몸에 발생하는 치은염과 염증이 잇몸 뼈까지 진행되어 치아 손실을 일으킬 수 있는 치주염을 포함한다. 치주질환의 직접적 원인은 세균성 치태, 치석, 흡연 등이 있으며 간접적으로는 사회 경제 수준은 물론, 생활 습관 및 전신 건강과도 연관이 있는 것으로 알려져 있다.
인간의 구강에는 700종 이상의 미생물이 군집을 이루고 있으며 서로 경쟁하며 항상성을 이루고 있지만 직간접적인 원인으로 인해 구강 생태계의 균형이 깨지면 치주질환을 일으킬 수 있다고 알려져 있다. 치주질환은 만성질환이다. 만성질환은 한 번 발병하면 완치가 힘들고 평생 관리해야 하는 특징이 있으며, 생물학적 요인, 환경적 요인, 사회경제적 요인이 복합적으로 작용하는 경우가 많다. 또한, 공통의 작용 요인 하에 질환 간 영향을 주고받기 때문에 치료를 위한 총체적 관리가 필요하다. 치주질환은 '침묵의 질병'으로써 초기에는 별다른 증세가 없고, 미미한 증세가 있어도 대수롭지 않게 지나치기 쉽다. 연령이 증가할수록 발병이 증가하며, 2019년 다빈도 상병 통계를 따르면 치은염 및 치주질환이 1위로 작년 대비 환자가 6.7% 증가하였다.
여러 연구에서 치주질환 발생 빈도와 진행 정도에 민족적 차이가 존재하며 치주염에 대한 민족적 특성에 따라 치주질환 원인균의 차이와 특정 치주질환 원인균에 대한 숙주 반응 정도의 차이에 기인한다고 보고되었다. 그러므로 특정 국가 및 민족에 존재하는 치주질환 원인균의 분포를 분석하는 것은 치주질환의 발생빈도를 예견하고 최적의 치료계획을 세우는데 도움이 될 수 있다.
현재 국내에서 치주질환 진단을 위해 치주염의 주요 원인균으로 알려진 예를 들어 포르피로모나스 진지발리스(Porphyromonas gingivalis)를 포함하는 몇몇 미생물을 실시간 중합효소 연쇄반응(Real-time Polymerase Chain Reaction, Real-time PCR)을 사용하여 정성 및 정량 분석하는 서비스가 이루어지고 있으나, 이러한 서비스나 관련 제품들 대부분이 국가 및 민족에 따른 관련성이 고려되지 않은 것이고, 종합적인 구강 미생물 환경이 고려되지 않은 것이다.
이에 본 발명자는 한국인의 종합적인 구강 미생물 환경이 충분히 고려되어 한국인의 치주질환을 보다 정확하고 효율적으로 진단하거나 진단에 이용할 수 있는 방법 및 관련 제품을 개발하고자 하였다.
본 발명은 아래와 같은 비특허문헌 1 내지 비특허문헌 16의 게시내용을 참조로하여, 새로운 치주질환 진단 기술을 도출하였다.
(비특허문헌 1)김선미, et al. "Real-time PCR 을 이용한 치주질환 원인균의 정량적 분석." 대한소아치과학회지 35.3 (2008): 494-503.
(비특허문헌 2)경희의학:제32 권 제 1회, J Kyung Hee Univ Med Cent : Vol. 32, No. 1, 2017.
(비특허문헌 3)Yun, Jeong-Ho, et al, 2008, The Korean Academy Of Periodontology, 143-152.
(비특허문헌 4)J Clin Periodontol. 2000 Sep;27(9):648-57.
(비특허문헌 5)Pereira JV, Leomil L, Rodrigues-Albuquerque F, Pereira JO, Brazilian dental journal. 2012;23(4):409-16.
(비특허문헌 6)Van Hoogmoed CG, Geertsema-Doornbusch GI, Teughels W, Quirynen M, Busscher HJ, Van der Mei HC. Oral Microbiol Immun. 2008;23(1):43-8.
(비특허문헌 7)Khemwong T, Kobayashi H, Ikeda Y, Matsuura T, Sudo T, Kano C, et al. Plos One. 2019;14(6).
(비특허문헌 8)Casarin RC, Saito D, Santos VR, Pimentel SP, Duarte PM, Casati MZ, et al. Brazilian journal of microbiology. 2012;43(3):931-7.
(비특허문헌 9)Zhou X, Li Y. Atlas of oral microbiology: From healthy microflora to disease: Academic press; 2015.
(비특허문헌 10)Kwek, H. S. N., M. Wilson, and H. N. Newman Journal of clinical periodontology 17.2 (1990): 119-122.
(비특허문헌 11)Hiranmayi KV, Sirisha K, Ramoji Rao MV, Sudhakar P. Journal of pharmacy & bioallied sciences. 2017;9(3):155-63.
(비특허문헌 12)대한치주과학회지 2008;38:543-550.
(비특허문헌 13)Lee M-Y, Kwon E-Y, Kim H-J, Lee J-Y, Joo J-Y. Journal of Dental Rehabilitation and Applied Science. 2018;34(3):186-95.
(비특허문헌 14)J Periodontol. 2001 Oct;72(10):1354-63.
(비특허문헌 15)Marchesan J, Jiao Y, Schaff RA, Hao J, Morelli T, Kinney JS, et al. Molecular oral microbiology. 2016;31(3):243-58.
(비특허문헌 16)Jia, Lu, et al. (2019) Frontiers in cellular and infection microbiology 9.
본 발명의 주된 목적은 한국인의 종합적인 구강 미생물 환경이 충분히 고려되어 한국인의 치주질환을 보다 정확하고 효율적으로 진단하는데 이용할 수 있는 정보제공 방법 및 키트를 제공하는데 있다.
본 발명의 한 양태에 따르면, 본 발명은 피검자의 구강 유래 시료에서, 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스(Actinomyces) 속 미생물; 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움(Fretibacterium) 속 미생물; 프레보텔라 덴탈리스(Prevotella dentalis); 타네렐라 포시티아(Tannerella forsythia); 유박테리움 노다튬(Eubacterium nodatum); 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움(Mogibacterium) 속 미생물; 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis); 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마(Treponema) 속 미생물; 필리팩터 알로시스(Filifactor alocis); 트레포네마 덴티콜라(Treponema denticola); 트레포네마 소크란스키이(Treponema socranskii); 유박테리움 사페눔(Eubacterium saphenum); 헤모필러스 파라인플루엔제(Haemophilus parainfluenzae); 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움(Oribacterium) 속 미생물; 포피로모나스 진지발리스(Porphyromonas gingivalis); 및 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마(Mycoplasma) 속 미생물;을 검출하는 한국인의 치주질환 진단을 위한 정보제공 방법을 제공한다.
본 발명의 정보제공 방법에 있어서, 상기 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스 속 미생물의 검출을 위해 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR; 상기 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움 속 미생물의 검출을 위해 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR; 상기 프레보텔라 덴탈리스의 검출을 위해 서열번호 5의 프라이머, 서열번호 6의 프라이머 및 서열번호 37의 프로브를 사용한 PCR; 상기 타네렐라 포시티아의 검출을 위해 서열번호 7의 프라이머, 서열번호 8의 프라이머 및 서열번호 38의 프로브를 사용한 PCR; 상기 유박테리움 노다튬의 검출을 위해 서열번호 9의 프라이머, 서열번호 10의 프라이머 및 서열번호 39의 프로브를 사용한 PCR; 상기 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움 속 미생물의 검출을 위해 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR; 상기 포피로모나스 엔도돈탈리스의 검출을 위해 서열번호 13의 프라이머, 서열번호 14의 프라이머 및 서열번호 41의 프로브를 사용한 PCR; 상기 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마 속 미생물의 검출을 위해 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR; 상기 필리팩터 알로시스의 검출을 위해 서열번호 17의 프라이머, 서열번호 18의 프라이머 및 서열번호 43의 프로브를 사용한 PCR; 상기 트레포네마 덴티콜라의 검출을 위해 서열번호 19의 프라이머, 서열번호 20의 프라이머 및 서열번호 44의 프로브를 사용한 PCR; 상기 트레포네마 소크란스키이의 검출을 위해 서열번호 21의 프라이머, 서열번호 22의 프라이머 및 서열번호 45의 프로브를 사용한 PCR; 상기 유박테리움 사페눔의 검출을 위해 서열번호 23의 프라이머, 서열번호 24의 프라이머 및 서열번호 46의 프로브를 사용한 PCR; 상기 헤모필러스 파라인플루엔제의 검출을 위해 서열번호 25의 프라이머, 서열번호 26의 프라이머 및 서열번호 47의 프로브를 사용한 PCR; 상기 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움 속 미생물의 검출을 위해 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR; 상기 포피로모나스 진지발리스의 검출을 위해 서열번호 29의 프라이머, 서열번호 30의 프라이머 및 서열번호 49의 프로브를 사용한 PCR; 상기 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마 속 미생물의 검출을 위해 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR;을 수행하는 것이 바람직하다.
본 발명의 정보제공 방법에 있어서, 상기 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스 속 미생물의 검출을 위한 PCR; 상기 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움 속 미생물의 검출을 위한 PCR; 상기 프레보텔라 덴탈리스의 검출을 위한 PCR; 및 상기 타네렐라 포시티아의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하고, 상기 유박테리움 노다튬의 검출을 위한 PCR; 상기 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움 속 미생물의 검출을 위한 PCR; 상기 포피로모나스 엔도돈탈리스의 검출을 위한 PCR; 및 상기 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마 속 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하고, 상기 필리팩터 알로시스의 검출을 위한 PCR; 상기 트레포네마 덴티콜라의 검출을 위한 PCR; 및 상기 트레포네마 소크란스키이의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하고, 상기 유박테리움 사페눔의 검출을 위한 PCR; 상기 헤모필러스 파라인플루엔제의 검출을 위한 PCR; 상기 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움 속 미생물의 검출을 위한 PCR; 및 상기 포피로모나스 진지발리스의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하는 것이 바람직하다.
본 발명의 정보제공 방법에 있어서, 그람 양성 미생물의 검출을 위해 서열번호 33의 프라이머, 서열번호 34의 프라이머 및 서열번호 51의 프로브를 사용한 PCR; 및 그람 음성 미생물의 검출을 위해 서열번호 33의 프라이머, 서열번호 34의 프라이머 및 서열번호 52의 프로브를 사용한 PCR;을 더 수행하며, 상기 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마 속 미생물의 검출을 위한 PCR; 상기 그람 양성 미생물의 검출을 위한 PCR; 및 상기 그람 음성 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하는 것이 바람직하다.
본 발명의 다른 양태에 따르면, 본 발명은 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 포함하는 제1프라이머-프로브 세트; 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 포함하는 제2프라이머-프로브 세트; 서열번호 5의 프라이머, 서열번호 6의 프라이머 및 서열번호 37의 프로브를 포함하는 제3프라이머-프로브 세트; 서열번호 7의 프라이머, 서열번호 8의 프라이머 및 서열번호 38의 프로브를 포함하는 제4프라이머-프로브 세트; 서열번호 9의 프라이머, 서열번호 10의 프라이머 및 서열번호 39의 프로브를 포함하는 제5프라이머-프로브 세트; 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 포함하는 제6프라이머-프로브 세트; 서열번호 13의 프라이머, 서열번호 14의 프라이머 및 서열번호 41의 프로브를 포함하는 제7프라이머-프로브 세트; 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 포함하는 제8프라이머-프로브 세트; 서열번호 17의 프라이머, 서열번호 18의 프라이머 및 서열번호 43의 프로브를 포함하는 제9프라이머-프로브 세트; 서열번호 19의 프라이머, 서열번호 20의 프라이머 및 서열번호 44의 프로브를 포함하는 제10프라이머-프로브 세트; 서열번호 21의 프라이머, 서열번호 22의 프라이머 및 서열번호 45의 프로브를 포함하는 제11프라이머-프로브 세트; 서열번호 23의 프라이머, 서열번호 24의 프라이머 및 서열번호 46의 프로브를 포함하는 제12프라이머-프로브 세트; 서열번호 25의 프라이머, 서열번호 26의 프라이머 및 서열번호 47의 프로브를 포함하는 제13프라이머-프로브 세트; 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 포함하는 제14프라이머-프로브 세트; 서열번호 29의 프라이머, 서열번호 30의 프라이머 및 서열번호 49의 프로브를 포함하는 제15프라이머-프로브 세트; 및 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 포함하는 제16프라이머-프로브 세트;를 포함하는 한국인의 치주질환 진단용 PCR 키트를 제공한다.
본 발명의 키트에 있어서, 상기 제1프라이머-프로브 세트, 제2프라이머-프로브 세트, 제3프라이머-프로브 세트 및 제4프라이머-프로브 세트를 하나의 조성물로 포함하고, 상기 제5프라이머-프로브 세트, 제6프라이머-프로브 세트, 제7프라이머-프로브 세트 및 제8프라이머-프로브 세트를 하나의 조성물로 포함하고, 상기 제9프라이머-프로브 세트, 제10프라이머-프로브 세트 및 제11프라이머-프로브 세트를 하나의 조성물로 포함하고, 상기 제12프라이머-프로브 세트, 제13프라이머-프로브 세트, 제14프라이머-프로브 세트 및 제15프라이머-프로브 세트를 하나의 조성물로 포함하는 것이 바람직하다.
본 발명의 키트에 있어서, 서열번호 33의 프라이머, 서열번호 34의 프라이머, 서열번호 51의 프로브 및 서열번호 52의 프로브를 포함하는 제17프라이머-프로브 세트;를 더 포함하며, 상기 제16프라이머-프로브 세트 및 제17프라이머-프로브 세트를 하나의 조성물로 포함하는 것이 바람직하다.
본 발명의 정보제공 방법 및 키트는 한국인의 종합적인 구강 미생물 환경이 충분히 고려된 것으로, 이를 사용하면 한국인의 치주질환을 정확하고 효율적으로 진단할 수 있다.
도 1은 각 표적 미생물에 대한 16종의 플라스미드 DNA 모두(Total bacteria 제외)를 주형으로 하여 본 발명의 각 프라이머 및 프로브로 단일 실시간 PCR을 수행한 결과이다. M: 크기 마커, Pd: 프레보텔라 덴탈리스, Tf: 타네렐라 포시티아, En: 유박테리움 노다튬, Pe: 포피로모나스 엔도돈탈리스, Fa: 필리팩터 알로시스, Td: 트레포네마 덴티콜라, Ts: 트레포네마 소크란스키이, Es: 유박테리움 사페눔, Hp: 헤모필러스 파라인플루엔제, Pg: 포피로모나스 진지발리스.
도 2 내지 17은 본 발명의 각 프라이머-프로브 및 해당 표적 미생물에 대한 플라스미드 DNA를 사용하여 단일 실시간 PCR을 수행한 결과이다. 도 2부터 도 17까지 순서대로, 포피로모나스 엔도돈탈리스, 트레포네마 소크란스키이, 프레보텔라 덴탈리스, 유박테리움 사페눔, 트레포네마 덴티콜라, 유박테리움 노다튬, 타네렐라 포시티아, 필리팩터 알로시스, 포피로모나스 진지발리스, 트레포네마 속 미생물, 마이코플라즈마 속 미생물, 프레티박테리움 속 미생물, 모기박테리움 속 미생물, 헤모필러스 파라인플루엔제, 액티노마이세스 속 미생물, 오리박테리움 속 미생물에 대한 결과이다.
도 18 내지 26은 본 발명의 각 프라이머-프로브 및 해당 표적 미생물에 대한 플라스미드 DNA를 사용하여 표 4의 각 세트로 다중 실시간 PCR을 수행한 결과이다. Pd: 프레보텔라 덴탈리스, Tf: 타네렐라 포시티아, En: 유박테리움 노다튬, Pe: 포피로모나스 엔도돈탈리스, Fa: 필리팩터 알로시스, Td: 트레포네마 덴티콜라, Ts: 트레포네마 소크란스키이, Es: 유박테리움 사페눔, Hp: 헤모필러스 파라인플루엔제, Pg: 포피로모나스 진지발리스.
본 발명의 한국인의 치주질환 진단을 위한 정보제공 방법은 피검자의 구강 유래 시료에서, 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스(Actinomyces) 속 미생물; 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움(Fretibacterium) 속 미생물; 프레보텔라 덴탈리스(Prevotella dentalis); 타네렐라 포시티아(Tannerella forsythia); 유박테리움 노다튬(Eubacterium nodatum); 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움(Mogibacterium) 속 미생물; 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis); 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마(Treponema) 속 미생물; 필리팩터 알로시스(Filifactor alocis); 트레포네마 덴티콜라(Treponema denticola); 트레포네마 소크란스키이(Treponema socranskii); 유박테리움 사페눔(Eubacterium saphenum); 헤모필러스 파라인플루엔제(Haemophilus parainfluenzae); 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움(Oribacterium) 속 미생물; 포피로모나스 진지발리스(Porphyromonas gingivalis); 및 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마(Mycoplasma) 속 미생물;을 검출하는 것을 특징으로 한다.
상기 미생물들은 한국인을 대상으로 한 구강 미생물 환경에 관한 연구, 구체적으로 치주질환이 없는 건강한 구강 환경을 갖는 한국인과 치주질환을 갖는 한국인을 대상으로 한 구강 미생물 환경에 관한 연구를 통해 선정된 것으로, 상기 프레티박테리움 속 미생물, 프레보텔라 덴탈리스, 타네렐라 포시티아, 유박테리움 노다튬, 모기박테리움 속 미생물, 포피로모나스 엔도돈탈리스, 트레포네마 속 미생물, 필리팩터 알로시스, 트레포네마 덴티콜라, 트레포네마 소크란스키이, 유박테리움 사페눔, 포피로모나스 진지발리스 및 마이코플라즈마 속 미생물은 치주질환의 원인이 되는 유해균으로 선정된 것이며, 상기 액티노마이세스 속 미생물, 오리박테리움 속 미생물 및 헤모필러스 파라인플루엔제는 건강한 대상에서 존재하는 상재균으로 선정된 것이다.
피검자, 즉 한국인 피검자의 구강 유래 시료에서 상기 유해균으로 선정된 미생물이 많이 검출되고 상기 상재균으로 선정된 미생물이 적게 검출되는 등의 구강 내 미생물 균형이 깨지게 되면 피검자의 치주질환 위험이 높은 것으로 분류하고, 반대로 피검자의 구강 유래 시료에서 상기 유해균으로 선정된 미생물이 적게 검출되고 상기 상재균으로 선정된 미생물이 많이 검출되는 등의 구강 내 미생물의 균형이 유지된다면 피검자의 치주질환 위험이 낮은 것으로 분류할 수 있다. 예를 들어, 검출된 유해균 1종 당 '+1점'을 부여하고, 검출된 상재균 1종 당 '-1점'을 부여하는 방식으로 치주질환 위험도를 표시할 수 있다.
본 발명에서 피검자의 구강 유래 시료는 피검자의 구강에서 유래된 생물학적 시료를 의미하는 것으로, 바람직하게는 피검자의 타액(침) 또는 가글액이다.
본 발명에서 특정 프라이머 및 프로브를 사용한 PCR로 검출되는 것으로 특정된 미생물은 해당 프라이머 및 프로브를 사용한 PCR, 예를 들어 실시간 PCR로 검출되는 서열이 유전체에 포함된 미생물을 의미한다.
본 발명에서 상기 액티노마이세스 속 미생물은 GenBank 데이터베이스에 등록번호(accession number) KF933792.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Actinomyces sp. ChDC B642일 수 있다.
본 발명에서 상기 프레티박테리움 속 미생물은 GenBank 데이터베이스에 등록번호 KT895067.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 프레보텔라 덴탈리스는 GenBank 데이터베이스에 등록번호 NR_102481.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Prevotella dentalis DSM 3688일 수 있다.
본 발명에서 상기 타네렐라 포시티아는 GenBank 데이터베이스에 등록번호 NR_074140.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Tannerella forsythia strain ATCC 43037일 수 있다.
본 발명에서 상기 유박테리움 노다튬는 GenBank 데이터베이스에 등록번호 GU424720.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 모기박테리움 속 미생물은 GenBank 데이터베이스에 등록번호 MT482651.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Mogibacterium sp. strain KCOM 3331일 수 있다.
본 발명에서 상기 포피로모나스 엔도돈탈리스는 GenBank 데이터베이스에 등록번호 LT676548.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 트레포네마 속 미생물은 GenBank 데이터베이스에 등록번호 GU408605.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Treponema sp. oral taxon 230일 수 있다.
본 발명에서 상기 필리팩터 알로시스는 GenBank 데이터베이스에 등록번호 MT322993.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Filifactor alocis strain KCOM 3147(=JS254)일 수 있다.
본 발명에서 상기 트레포네마 덴티콜라는 GenBank 데이터베이스에 등록번호 NR_036899.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 트레포네마 소크란스키이는 GenBank 데이터베이스에 등록번호 LT698215.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 유박테리움 사페눔은 GenBank 데이터베이스에 등록번호 NR_026031.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Eubacterium saphenum strain 164-47일 수 있다.
본 발명에서 상기 헤모필러스 파라인플루엔제는 GenBank 데이터베이스에 등록번호 MT096513.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Haemophilus parainfluenzae strain Ch6일 수 있다.
본 발명에서 상기 오리박테리움 속 미생물은 GenBank 데이터베이스에 등록번호 LT698418.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 포피로모나스 진지발리스는 GenBank 데이터베이스에 등록번호 KR074427.1로 등록된 서열이 유전체에 포함된 미생물일 수 있고, Porphyromonas gingivalis strain CP41일 수 있다.
본 발명에서 상기 마이코플라즈마 속 미생물은 GenBank 데이터베이스에 등록번호 AM420094.1로 등록된 서열이 유전체에 포함된 미생물일 수 있다.
본 발명에서 상기 액티노마이세스 속 미생물의 검출을 위해 바람직하게는 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR을 수행하고, 상기 프레티박테리움 속 미생물의 검출을 위해 바람직하게는 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR을 수행하고, 상기 프레보텔라 덴탈리스의 검출을 위해 바람직하게는 서열번호 5의 프라이머, 서열번호 6의 프라이머 및 서열번호 37의 프로브를 사용한 PCR을 수행하고, 상기 타네렐라 포시티아의 검출을 위해 바람직하게는 서열번호 7의 프라이머, 서열번호 8의 프라이머 및 서열번호 38의 프로브를 사용한 PCR을 수행하고, 상기 유박테리움 노다튬의 검출을 위해 바람직하게는 서열번호 9의 프라이머, 서열번호 10의 프라이머 및 서열번호 39의 프로브를 사용한 PCR을 수행하고, 상기 모기박테리움 속 미생물의 검출을 위해 바람직하게는 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR을 수행하고, 상기 포피로모나스 엔도돈탈리스의 검출을 위해 바람직하게는 서열번호 13의 프라이머, 서열번호 14의 프라이머 및 서열번호 41의 프로브를 사용한 PCR을 수행하고, 상기 트레포네마 속 미생물의 검출을 위해 바람직하게는 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR을 수행하고, 상기 필리팩터 알로시스의 검출을 위해 바람직하게는 서열번호 17의 프라이머, 서열번호 18의 프라이머 및 서열번호 43의 프로브를 사용한 PCR을 수행하고, 상기 트레포네마 덴티콜라의 검출을 위해 바람직하게는 서열번호 19의 프라이머, 서열번호 20의 프라이머 및 서열번호 44의 프로브를 사용한 PCR을 수행하고, 상기 트레포네마 소크란스키이의 검출을 위해 바람직하게는 서열번호 21의 프라이머, 서열번호 22의 프라이머 및 서열번호 45의 프로브를 사용한 PCR을 수행하고, 상기 유박테리움 사페눔의 검출을 위해 바람직하게는 서열번호 23의 프라이머, 서열번호 24의 프라이머 및 서열번호 46의 프로브를 사용한 PCR을 수행하고, 상기 헤모필러스 파라인플루엔제의 검출을 위해 바람직하게는 서열번호 25의 프라이머, 서열번호 26의 프라이머 및 서열번호 47의 프로브를 사용한 PCR을 수행하고, 상기 오리박테리움 속 미생물의 검출을 위해 바람직하게는 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR을 수행하고, 상기 포피로모나스 진지발리스의 검출을 위해 바람직하게는 서열번호 29의 프라이머, 서열번호 30의 프라이머 및 서열번호 49의 프로브를 사용한 PCR을 수행하고, 상기 마이코플라즈마 속 미생물의 검출을 위해 바람직하게는 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR;을 수행한다.
상기와 같은 프라이머 및 프로브를 사용하는 경우, 상기 액티노마이세스 속 미생물의 검출을 위한 PCR; 상기 프레티박테리움 속 미생물의 검출을 위한 PCR; 상기 프레보텔라 덴탈리스의 검출을 위한 PCR; 및 상기 타네렐라 포시티아의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있고, 상기 유박테리움 노다튬의 검출을 위한 PCR; 상기 모기박테리움 속 미생물의 검출을 위한 PCR; 상기 포피로모나스 엔도돈탈리스의 검출을 위한 PCR; 및 상기 트레포네마 속 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있고, 상기 필리팩터 알로시스의 검출을 위한 PCR; 상기 트레포네마 덴티콜라의 검출을 위한 PCR; 및 상기 트레포네마 소크란스키이의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있고, 상기 유박테리움 사페눔의 검출을 위한 PCR; 상기 헤모필러스 파라인플루엔제의 검출을 위한 PCR; 상기 오리박테리움 속 미생물의 검출을 위한 PCR; 및 상기 포피로모나스 진지발리스의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있다. 이는 상기 하나의 반응액 내에서 수행할 수 있는 것으로 제시된 PCR의 프라이머 및 프로브들이 서로 간에 간섭 없이 높은 특이성 및 민감도를 갖도록 디자인되었기에 가능한 것이다. 이에 따라, 상기 제시된 해당 프라이머 및 프로브를 사용하면 보다 신속한 검출 또는 용이한 검출이 가능하므로, 한국인의 치주질환 진단을 위한 보다 효율적인 정보제공이 가능하다.
본 발명에서 상기 각 미생물의 검출을 위한 PCR에 더하여, 그람 양성 미생물의 검출을 위한 서열번호 33의 프라이머, 서열번호 34의 프라이머 및 서열번호 51의 프로브를 사용한 PCR; 및 그람 음성 미생물의 검출을 위한 서열번호 33의 프라이머, 서열번호 34의 프라이머 및 서열번호 52의 프로브를 사용한 PCR;을 더 수행하는 것이 바람직하다. 이들 PCR은 대조군의 역할을 위한 것으로, 이들 PCR을 추가로 수행할 경우, 정보의 신뢰도를 높일 수 있다.
또한, 상기 그람 양성 미생물의 검출을 위한 PCR; 및 그람 음성 미생물의 검출을 위한 PCR;은 상기 마이코플라즈마 속 미생물의 검출을 위한 PCR;과 함께 하나의 반응액 내에서 수행할 수 있다.
본 발명에서 PCR로는 변성(denaturation) - 결합(annealing) - 신장(extension)의 3단계를 반복하는 3단계 PCR(3-step PCR) 또는 결합과 신장을 동시에 수행하는 2단계 PCR(2-step PCR)을 사용할 수 있다. 바람직하게는 반응시간을 줄일 수 있는 2단계 PCR을 사용한다.
PCR 조건은 95℃로 15초 동안의 변성 단계와 60℃로 30초 동안의 결합 및 신장 단계를 40회 반복(사이클)하는 조건인 것이 바람직하다.
바람직하게는 상기와 같은 조건으로 PCR을 수행하기 전 UDG(Uracil-DNA Glycosylase) 반응 단계를 추가하여 오염으로 인한 결과오류를 방지한다.
본 발명의 정보제공 방법은 치주질환 중에서도 특히 치주염의 진단을 위한 정보제공 방법으로서 효과적이다.
본 발명의 한국인의 치주질환 진단용 키트는 PCR, 바람직하게는 실시간 PCR로 상기 치주질환 관련 미생물을 검출하여 한국인의 치주질환을 진단하기 위한 키트로, 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 포함하는 제1프라이머-프로브 세트; 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 포함하는 제2프라이머-프로브 세트; 서열번호 5의 프라이머, 서열번호 6의 프라이머 및 서열번호 37의 프로브를 포함하는 제3프라이머-프로브 세트; 서열번호 7의 프라이머, 서열번호 8의 프라이머 및 서열번호 38의 프로브를 포함하는 제4프라이머-프로브 세트; 서열번호 9의 프라이머, 서열번호 10의 프라이머 및 서열번호 39의 프로브를 포함하는 제5프라이머-프로브 세트; 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 포함하는 제6프라이머-프로브 세트; 서열번호 13의 프라이머, 서열번호 14의 프라이머 및 서열번호 41의 프로브를 포함하는 제7프라이머-프로브 세트; 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 포함하는 제8프라이머-프로브 세트; 서열번호 17의 프라이머, 서열번호 18의 프라이머 및 서열번호 43의 프로브를 포함하는 제9프라이머-프로브 세트; 서열번호 19의 프라이머, 서열번호 20의 프라이머 및 서열번호 44의 프로브를 포함하는 제10프라이머-프로브 세트; 서열번호 21의 프라이머, 서열번호 22의 프라이머 및 서열번호 45의 프로브를 포함하는 제11프라이머-프로브 세트; 서열번호 23의 프라이머, 서열번호 24의 프라이머 및 서열번호 46의 프로브를 포함하는 제12프라이머-프로브 세트; 서열번호 25의 프라이머, 서열번호 26의 프라이머 및 서열번호 47의 프로브를 포함하는 제13프라이머-프로브 세트; 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 포함하는 제14프라이머-프로브 세트; 서열번호 29의 프라이머, 서열번호 30의 프라이머 및 서열번호 49의 프로브를 포함하는 제15프라이머-프로브 세트; 및 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 포함하는 제16프라이머-프로브 세트;를 포함하는 것을 특징으로 한다.
상기 제1프라이머-프로브 세트는 상기 액티노마이세스 속 미생물의 검출을 위한 프라이머-프로브 세트이고, 상기 제2프라이머-프로브 세트는 상기 프레티박테리움 속 미생물의 검출을 위한 프라이머-프로브 세트이고, 상기 제3프라이머-프로브 세트는 상기 프레보텔라 덴탈리스의 검출을 위한 프라이머-프로브 세트이고, 상기 제4프라이머-프로브 세트는 상기 타네렐라 포시티아의 검출을 위한 프라이머-프로브 세트이고, 상기 제5프라이머-프로브 세트는 상기 유박테리움 노다튬의 검출을 위한 프라이머-프로브 세트이고, 상기 제6프라이머-프로브 세트는 상기 모기박테리움 속 미생물의 검출을 위한 프라이머-프로브 세트이고, 상기 제7프라이머-프로브 세트는 상기 포피로모나스 엔도돈탈리스의 검출을 위한 프라이머-프로브 세트이고, 상기 제8프라이머-프로브 세트는 상기 트레포네마 속 미생물의 검출을 위한 프라이머-프로브 세트이고, 상기 제9프라이머-프로브 세트는 상기 필리팩터 알로시스의 검출을 위한 프라이머-프로브 세트이고, 상기 제10프라이머-프로브 세트는 상기 트레포네마 덴티콜라의 검출을 위한 프라이머-프로브 세트이고, 상기 제11프라이머-프로브 세트는 상기 트레포네마 소크란스키이의 검출을 위한 프라이머-프로브 세트이고, 상기 제12프라이머-프로브 세트는 상기 유박테리움 사페눔의 검출을 위한 프라이머-프로브 세트이고, 상기 제13프라이머-프로브 세트는 상기 헤모필러스 파라인플루엔제의 검출을 위한 프라이머-프로브 세트이고, 상기 제14프라이머-프로브 세트는 상기 오리박테리움 속 미생물의 검출을 위한 프라이머-프로브 세트이고, 상기 제15프라이머-프로브 세트는 상기 포피로모나스 진지발리스의 검출을 위한 프라이머-프로브 세트이고, 상기 제16프라이머-프로브 세트는 상기 마이코플라즈마 속 미생물의 검출을 위한 프라이머-프로브 세트이다.
위에서 설명한 바와 같이, 상기 액티노마이세스 속 미생물의 검출을 위한 PCR; 상기 프레티박테리움 속 미생물의 검출을 위한 PCR; 상기 프레보텔라 덴탈리스의 검출을 위한 PCR; 및 상기 타네렐라 포시티아의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있고, 상기 유박테리움 노다튬의 검출을 위한 PCR; 상기 모기박테리움 속 미생물의 검출을 위한 PCR; 상기 포피로모나스 엔도돈탈리스의 검출을 위한 PCR; 및 상기 트레포네마 속 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있고, 상기 필리팩터 알로시스의 검출을 위한 PCR; 상기 트레포네마 덴티콜라의 검출을 위한 PCR; 및 상기 트레포네마 소크란스키이의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있고, 상기 유박테리움 사페눔의 검출을 위한 PCR; 상기 헤모필러스 파라인플루엔제의 검출을 위한 PCR; 상기 오리박테리움 속 미생물의 검출을 위한 PCR; 및 상기 포피로모나스 진지발리스의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있도록, 상기 프라이머 및 프로브가 설계되었으므로, 본 발명의 키트는 상기 제1프라이머-프로브 세트, 제2프라이머-프로브 세트, 제3프라이머-프로브 세트 및 제4프라이머-프로브 세트를 하나의 조성물로 포함하고, 상기 제5프라이머-프로브 세트, 제6프라이머-프로브 세트, 제7프라이머-프로브 세트 및 제8프라이머-프로브 세트를 하나의 조성물로 포함하고, 상기 제9프라이머-프로브 세트, 제10프라이머-프로브 세트 및 제11프라이머-프로브 세트를 하나의 조성물로 포함하고, 상기 제12프라이머-프로브 세트, 제13프라이머-프로브 세트, 제14프라이머-프로브 세트 및 제15프라이머-프로브 세트를 하나의 조성물로 포함하도록 이루어질 수 있다. 이때 조성물은 예를 들어 PCR 반응용 조성물이고, 상기 프라이머-프로브 세트 이외에 PCR 반응에 필요한 물질, 예를 들어 중합효소, dNTP, 완충제 등이 더 포함될 수 있다.
본 발명의 키트는 상기와 같은 프라이머-프로브 세트에 더하여, 서열번호 33의 프라이머, 서열번호 34의 프라이머, 서열번호 51의 프로브 및 서열번호 52의 프로브를 포함하는 제17프라이머-프로브 세트;를 더 포함할 수 있다. 이는 그람 양성 미생물 및 그람 음성 미생물의 검출을 위한 프라이머-프로브 세트로, 대조군의 역할을 수행할 수 있으며, 진단의 신뢰도를 높이는데 기여할 수 있다.
위에서 설명한 바와 같이, 상기 그람 양성 미생물의 검출을 위한 PCR; 및 그람 음성 미생물의 검출을 위한 PCR;은 상기 마이코플라즈마 속 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행할 수 있도록, 본 발명의 프라이머 및 프로브가 설계되었으므로, 본 발명의 키트는 상기 제16프라이머-프로브 세트 및 제17프라이머-프로브 세트를 하나의 조성물로 포함하도록 이루어질 수 있다. 이때의 조성물 또한 예를 들어 PCR 반응용 조성물이고, 상기 프라이머-프로브 세트 이외에 PCR 반응에 필요한 물질, 예를 들어 중합효소, dNTP, 완충제 등이 더 포함될 수 있다.
본 발명에서 프라이머 및 프로브는 이 분야에서 통상적으로 사용되는 표지 물질로 표지된 것일 수 있다. 프라이머 및 프로브 모두 표지된 것일 수도 있지만, 일반적으로는 프로브 만 표지된 것이다. 여기에 사용되는 표지 물질에 특별한 제한은 없으나, 하나의 반응액 내에서 수행할 수 있는 것으로 제시된 프라이머-프로브 세트들은 서로 다른 표지 물질로 표지되어 하나의 PCR 반응 내에서 서로 구분하여 검출할 수 있도록 이루어지는 것이 바람직하다. 예를 들어, 제1프라이머-프로브 세트의 프로브(서열번호 35의 프로브), 제2프라이머-프로브 세트의 프로브(서열번호 36의 프로브), 제3프라이머-프로브 세트의 프로브(서열번호 37의 프로브) 및 제4프라이머-프로브 세트의 프로브(서열번호 38의 프로브)는 서로 다른 표지 물질로 표지된다. 하나의 프로브를 여러 종류의 표지 물질로 표지하는 경우 이중 일부 만을 다른 세트의 프로브와 차별화할 수 있다.
본 발명의 키트는 치주질환 중에서도 특히 치주염의 진단을 위한 키트인 것이 바람직하다.
본 발명의 키트는 상기와 같은 프라이머 세트 이외에도 PCR을 용이하게 수행하는데 필요한 시약, 기구 등이 더 포함될 수 있다. 예를 들어, PCR에 필요한 중합효소(polymerase), dNTP, 완충액 등이 포함될 수 있으며, 시료로부터 DNA를 추출하는데 필요한 시약, 기구 등이 더 포함될 수도 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것이므로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
[실시예]
실시예 1
1.1 피험자 모집 및 구강 시료(타액) 수집
피험자 선정 기준은 1999년 APP(American Academy of Periodontology)에서 제안된 기준에 의거하였다. 부산대학교 치과병원 치주과에 검진 및 치료를 위해 내원한 성인 250명을 대상으로 건강한 사람과 만성 치주염 환자를 진단하였다. 만성 치주염 환자는 총 4그룹으로 나눴으며, 질병 정도에 따라 초기, 중기, 말기 치주염으로 분류하였다. 만성 치주염의 심각도는 CAL(clinimcal attachment level)을 기준으로 1 또는 2이면 초기, 3 또는 4이면 중기, 5 이상은 말기로 나누었다(표 1). 또한 선정된 피험자로부터 본 발명의 위한 연구에 대해 충분히 이해시킨 후 자발적으로 연구 참여에 동의하는 동의서와 임상 연구 설문 조사서를 받았다.
구강관리 위생 능력에 영향을 줄 수 있는 전신질환을 가지고 있거나 검진 시점으로 6개월 전까지 치과치료를 받았거나 연구 참여에 대한 동의를 철회했거나 치아가 20개 이하인 피험자는 제외하였다. 여성의 경우, 임신 중이거나 수유 중일 때도 제외하였다. 피험자의 타액 수집은 가글액을 제공하여 30초간 가글한 후 가글액을 지정된 용기에 수집하는 방법으로 수행하였으며, 실험 전까지 냉장 보관하였다.
표 1은 본 발명의 그룹별 목록이다.
수집된 구강 시료(타액) 수
건강군
(명)		 만성치주염군 (명) 전체
(명)
초기 중기 말기
100 50 50 50 250
1.2 구강 시료(타액)에서 미생물 DNA 추출
GeneAll ExgeneTM Clinic SV kit(진올바이오테크놀러지, Korea)를 사용하여 제조사의 지시에 따라 냉장보관 되어있는 구강 시료(타액) 샘플로부터 유전체 DNA(genomic DNA)를 추출하였다. Microplate reader Epoch2(BioTek, USA)로 농도 및 품질(260/280 ratio, 260/230 ratio)을 확인한 후, 차세대 염기서열 분석(NGS)에 사용되기 전까지 -20℃에 냉동 보관하였다.
실시예 2
2.1 차세대 염기서열 분석법(NGS)을 통한 구강 미생물 군집(Microbiome) 분석
실시예 1의 방법으로 얻은 DNA 시료로 치주염과 관련된 구강 미생물 군집(Microbiome)을 파악하기 위해 차세대 염기서열 분석(NGS)을 수행하였다. 각 그룹 간 군집의 다양성을 확인하였고, 이 자료를 바탕으로 데이터베이스 Greengenes와 SILVA를 참조하여 건강한 그룹과 치주염 환자 그룹(초기, 중기, 말기)에서 유의한 차이가 나는 구강 미생물 후보군을 선별하였다.
종 단위에서 봤을 때, 건강한 그룹과 치주염 그룹(초기, 중기, 말기) 사이에서 유의한 결과를 나타내는 9종을 후보군으로 선별하였다. Greengenes 결과에서는 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 트레포네마 소크란스키이(Treponema socranskii), 헤모필러스 파라인플루엔제(Haemophilus parainfluenzae), 나이세리아 서브플라바(Neisseria subflava)가 선별되었으며, SILVA에서는 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 프레보텔라 덴탈리스(Prevotella dentalis), 유박테리움 사페눔(Eubacterium saphenum), 트레포네마 덴티콜라(Treponema denticola), 유박테리움 브라치(Eubacterium brachy), 유박테리움 노다튬(Eubacterium nodatum)이 선별되었다(표 2 참조).
속 단위에서 봤을 때, 건강한 그룹과 치주염 그룹(초기, 중기, 말기) 사이에서 유의한 결과를 나타내는 11종을 후보군으로 선별하였다. Greengenes 결과에서는 필리팩터 속(Filifactor), 트레포네마 속(Treponema), 타네넬라 속(Tannerella), 마이코플라즈마 속(Mycoplasma), 포피로모나스 속(Porphyromonas), 프레보텔라 속(Prevotella), 오리박테리움 속(Oribacterium), 모기박테리움 속(Mogibacterium), 액티노마이세스 속(Actinomyces), 로시아 속(Rothia)이 선별되었으며, SILVA에서는 필리팩터 속(Filifactor), 트레포네마 속(Treponema), 타네넬라 속(Tannerella), 마이코플라즈마 속(Mycoplasma), 포피로모나스 속(Porphyromonas), 모기박테리움 속(Mogibacterium), 프레티박테리움 속(Fretibacterium)이 선별되었다(표 3 참조).
표 2와 표 3은 선별된 균주 목록이다.
{데이터베이스를 이용하여 종 단위에서 NGS 분석결과}
Green
genes		 균주 W 귀무가설 기각
Porphyromonas endodontalis 226 진실
Treponema socranskii 205 진실
Haemophilus parainfluenzae 198 진실
Neisseria subflava 190 진실
SILVA 균주 W 귀무가설 기각
Porphyromonas endodontalis 362 진실
Prevotella dentalis 333 진실
Eubacterium saphenum 372 진실
Treponema denticola 362 진실
Eubacterium brachy 368 진실
Eubacterium nodatum 383 진실
{데이터베이스를 이용하여 속 단위에서 NGS 분석결과}
Green
genes		 균주 W 귀무가설 기각
Filifactor 230 진실
Treponema 230 진실
Tannerella 226 진실
Mycoplasma 226 진실
Porphyromonas 224 진실
Prevotella 224 진실
Oribacterium 189 진실
Mogibacterium 188 진실
Actinomyces 188 진실
Rothia 3 진실
Silva 균주 W 귀무가설 기각
Filifactor 390 진실
Treponema 390 진실
Tannerella 376 진실
Mycoplasma 383 진실
Porphyromonas 383 진실
Mogibacterium 343 진실
Fretibacterium 387 진실
2.2 치주염 관련 구강 세균 선정
상기 2.1의 방법으로 선별한 구강 세균 후보군 중 상기 비특허문헌을 참고하여 치주염과 관련된 구강 세균을 선정하였다. 속 단위의 경우 해당 균 속(Genus)을 검출하거나 NGS 서열이 단일 종(Species)으로 검색되는 경우에는 해당 종으로 선정하였다.
상기 비특허문헌을 참고하여 최종적으로 선정된 균은 다음과 같다. 구강 내 유해인자를 형성하고 치주조직에 침투하여 치주염 또는 난치성 치주염 및 급성 괴사 치은염이 진행된 단계에 관여하는 트레포네마 덴티콜라(Treponema denticola)(비특허문헌 0013), 다른 세균과의 부착을 통해 구강 내 바이오필름 형성의 매개체 역할을 하며 치주조직을 파괴하여 치주염을 유발하는 타네넬라 포시티아(Tannerella forsythia)(비특허문헌 0012), 다양한 독성인자를 생성하여 숙주의 면역체계를 무너뜨리고 치조골을 손실시키며 치주조직을 파괴시킬 수 있는 포피로모나스 진지발리스(Porphyromonas gingivalis)(비특허문헌 0016), 급성 및 만성 치주염에서 발견되며 치주조직에 부착하여 치주조직 파괴를 유발하는 트레포네마 소크란스키이(Treponema socranskii)(비특허문헌 0014), 병독성은 낮으나 최소한 치주염 유발에 역할을 하는 프레보텔라 덴탈리스(Prevotella dentalis)(비특허문헌 0011), 외부인자를 인식하여 면역반응을 시작되게 하는 NOD(nucleotide-binding oligomerization domain) 신호전달을 자극시켜 만성 염증성 질환인 치주염을 발병시키는데 기여하며 그 중 NOD1 신호전달을 자극시키는 유박테리움 사페눔(Eubacterium saphenum), 유박테리움 노다튬(Eubacterium nodatum), 필리팩터 알로시스(Filfactor alocis)(비특허문헌 0015)와 NOD2 신호전달을 자극시키는 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)(비특허문헌 0015), 치주염 및 임플란트 관절주위염을 일으켜 임플란트 손실을 초래하는 트레포네마 속(Treponema)(비특허문헌 0009), 치주낭 깊이와 관련있는 마이코플라즈마 속(Mycoplasma)(비특허문헌 0010), 다른 유해균과 작용하여 치주낭 깊이를 증가시키는 프레티박테리움 속(Fretibacterium)(비특허문헌 0007), 성인의 치은염과 치주염의 감수성 증가에 기여하는 모기박테리움 속(Mogibacterium)(비특허문헌 0008)이 선정되었다.
건강한 그룹에서 많이 발견되는 상재균으로는 구강 미생물 중 대부분을 차지하며 red, orange complex 비율이 증가하면 감소하는 액티노마이세스 속(Actinomyces)(비특허문헌 0004), 구강 위생이 청결한 성인에게서 발견되는 오리박테리움 속(Oribacterium)(비특허문헌 0005), 포피로모나스 진지발리스의 부착을 억제하는 헤모필러스 파라인플루엔제(Haemophilus parainfluenzae)(비특허문헌 0006)가 선정되었다.
비특허문헌, 차세대 염기서열분석(NGS), 실시예 1의 임상 시료(구강시료, 타액)와도 일치하는 결과를 확인한 균주들을 최종 후보균으로 선정하였고, 최종적으로 유해균으로 총 4속 및 9종, 상재균으로는 총 2속 및 1종을 최종적으로 선정하였다(표 4 참조).
{최종적으로 선정된 치주염 관련 구강 세균}
세트 균주
A Actinomyces
Fretibacterium
Prevotella dentalis (Pd)
Tannerella forsythia (Tf)
B Eubacterium nodatum (En)
Mogibacterium
Porphyromonas endodontalis (Pe)
Treponema
C Filifactor alocis (Fa)
Treponema denticola (Td)
Treponema socranskii (Ts)
D Eubacterium saphenum (Es)
Haemophilus parainfluenzae (Hp)
Oribacterium
Porphyromonas gingivalis (Pg)
E Mycoplasma
Total bacteria
실시예 3
3.1 프라이머 및 프로브 제작
상기 실시예 2에서 최종적으로 선정된 치주염 관련 균주를 검출하기 위한 프라이머(표 5 참조) 및 프로브(표 6 참조)를 디자인하였다. 각 균주의 표적서열(16s rRNA)만을 검출할 수 있게 상호간 간섭 없이 특이적이고 높은 민감도를 갖추도록 디자인하였으며, 'Total bacteria'는 선정된 치주염 관련 균을 포함하여 구강 내 존재하는 그람 양성, 그람 음성 미생물을 모두 검출할 수 있도록 디자인하였다.
또한, GC 함량, 녹는점, 헤어핀, 헤테로-다이머, 셀프-다이머 등을 고려하였으며, 해당 균만 특이적으로 검출하는지 blast search를 통해 확인하였다. 실시간 중합효소 연쇄반응(Real-time PCR)에 사용되는 프로브는 TaqMan 프로브 유형이며, 프로브에 부착되는 형광 염료로는 차세대 염기서열 분석(NGS) 데이터의 서열 개수(reads)와 겹치지 않는 파장을 고려하여 4종의 프로브 염료를 사용하였다.
표 5 및 표 6은 속/종 특이적으로 결합할 수 있도록 디자인한 각각의 프라이머 및 프로브 목록이다.
{치주염 관련 유해균 및 상재균 프라이머 서열}
균주 프라이머 명칭 서열번호 염기서열 (5'→3') 유전자 PCR
산물크기
Actinomyces Actinomyces-FP-1 1 TGTTTTTGGTGGGGGATGGG 16S rRNA 240bp
Actinomyces-RP-1 2 TGCTTCACTGGCGAAAGAGGTTT
Fretibacterium Fretibacterium-FP-1 3 AGAGATGCGCTGGAGGAGGT 16S rRNA 247bp
Fretibacterium-RP-1 4 ACTTCCTTCTTCCCACATAAAAGAAC
Prevotella
dentalis 		Pd-FP-1 5 TCAATGGGCGTAAGCCTGAA 16S rRNA 171bp
Pd-RP-1 6 CGGACCTTCCGTATTACCGC
Tannerella
forsythia 		Tf-FP-1 7 TTACAGGGGAATAAAATGAGATACGT 16S rRNA 235bp
Tf-RP-1 8 GCATTCCGCCTACTTCATCTAT
Eubacterium
nodatum 		En-FP-1 9 GAGCGAGAAATCACTTAAAGAAGC 16S rRNA 118bp
En-RP-1 10 AATCGAAATTTCTCTCGGCTATCC
Mogibacterium Mogibacterium-FP-1 11 ACGGTACCTTAGGAGCAAGC 16S rRNA 151bp
Mogibacterium-RP-1 12 CAAGTAGAGGTTGAGCCTCTAAATTA
Porphyromonas
endodontalis 		Pe-FP-1 13 GATTGTAAACTTCTTTTGTAGAGG 16S rRNA 134bp
Pe-RP-1 14 AATTCCGGATAACGCTCGTAT
Treponema Treponema-FP-1 15 AGCTAAGAATATTCCGCAATGGACG 16S rRNA 108bp
Treponema-RP-1 16 TCTCACCCTTATTCTTCATCAACA
Filifactor
alocis 		Filifactor-FP-1 17 GGCATTCGTGTCGTAAAACTCTGTA 16S rRNA 165bp
Filifactor-RP-1 18 ACTAACTTGTTAAACCACCTGCG
Treponema
denticola 		Td-FP-1 19 TGGTTGGTGAGGTAAAGGCC 16S rRNA 264bp
Td-RP-1 20 ATTAGCCGGGGCTTATTCGCATG
Treponema
socranskii 		Ts-FP-1 21 GGGAGGCAGCAGGTAAGAATAT 16S rRNA 127bp
Ts-RP-1 22 GGCATTTCCTCCTACACTTATTCC
Eubacterium
saphenum 		Es-FP-1 23 TGAGACACGGTCCAAACTCTACG 16S rRNA 250bp
Es-RP-1 24 TAGTAGACCACCTACGCACTCTTTA
Haemophilus
parainfluenzae 		Hp-FP-1 25 TCACCAAGCCGACGATCTCTA 16S rRNA 308bp
Hp-RP-1 26 CTTTACGCCCAGTTATTCCGATT
Oribacterium Oribacterium-FP-1 27 AGCCTACCAAAGCAACGATCAG 16S rRNA 195 bp
Oribacterium-RP-1 28 TGTCATTATCTTCCCTGCTGA
Porphyromonas
gingivalis 		PG_Sp_F 29 TGCAACTTGCCTTACAGAGGG 16s rRNA 344 bp
PG_Sp_R 30 ACTCGTATCGCCCGTTATTC
Mycoplasma Mycoplasma-FP-1 31 ATATTCCACAATGAGCGAAAGC 16S rRNA 109bp
Mycoplasma-RP-1 32 TGCATTTCCTCAACTAAGTGTTCT
Total bacteria Tb-FP-1 33 TGGAGCATGTGGTTTAATTCGAAG 16S rRNA 159bp
161bp
Tb-RP-1 34 TGCGGGACTTAACCCAACAT
[표 6]
{치주염 관련 유해균 및 상재균 프로브 서열}
Figure PCTKR2021013288-appb-img-000001
3.2 균주 플라스미드 제작
상기 프라이머 및 프로브의 유효성 확인을 평가하기 위해 표 4의 선별된 균주들의 표적서열을 플라스미드에 클로닝하여 109 농도로 제작하여 분석 시료로 사용하였다.
실시예 4
4.1 단일 실시간 PCR(Singleplex Real-time PCR) 조건
실시예 3에서 제작된 프라이머 및 프로브(표 5 및 6 참조)는 표 7에 표시된 농도로 사용하였다. 해당 농도는 가장 잘 반응하는 최적의 농도를 적용한 것이다.
단일 실시간 PCR을 위한 조성물의 구성 및 PCR의 조건으로, 균주의 각 농도에 대한 정방향 및 역방향 프라이머와 프로브 혼합물 2㎕, 균주 플라스미드 DNA 2㎕, 2X Taqman multiplex mastermix(Thermofisher, USA) 10㎕, 3차 멸균수 6㎕를 포함하여, 최종 용량이 20㎕가 되도록 하였다. 그 다음 96-웰의 플레이트에 분주하고, 단일 실시간 중합효소 연쇄반응(Singleplex Real-time PCR)을 실시하였다. PCR 반응을 수행하기 위한 PCR 장치로 QuantStudio 6 Flex Real-Time PCR System(Thermofisher, USA)을 사용하였고, 오염 방지 단계의 UDG 반응을 위해 50℃에서 2분간 반응시켰으며, 이후 UDG의 불활성화를 위해 95℃에서 10분간 유지하였다. PCR 증폭의 단계는 95℃에서 15초, 60℃에서 30초로 40회 반복하여 수행하였다(표 8 및 9 참조).
{치주염 관련 유해균 및 상재균 프라이머, 프로브 농도}
균주 프라이머 농도
(forward, reverse)		 프로브 농도
Actinomyces 4 μ㏖ 2 μ㏖
Fretibacterium 4 μ㏖ 2 μ㏖
Prevotella dentalis 9 μ㏖ 2 μ㏖
Tannerella forsythia 4 μ㏖ 2 μ㏖
Eubacterium nodatum 4 μ㏖ 2 μ㏖
Mogibacterium 4 μ㏖ 2 μ㏖
Porphyromonas endodontalis 4 μ㏖ 2 μ㏖
Treponema 4 μ㏖ 2 μ㏖
Filifactor alocis 4 μ㏖ 2 μ㏖
Treponema denticola 4 μ㏖ 2 μ㏖
Treponema socranskii 4 μ㏖ 2 μ㏖
Eubacterium saphenum 4 μ㏖ 2 μ㏖
Haemophilus parainfluenzae 4 μ㏖ 2 μ㏖
Oribacterium 4 μ㏖ 2 μ㏖
Porphyromonas gingivalis 4 μ㏖ 2 μ㏖
Mycoplasma 4 μ㏖ 2 μ㏖
Total bacteria 2 μ㏖ 1 μ㏖
{단일 실시간 중합효소 연쇄반응(PCR) 조건}
재료 부피
2X TaqMan Multiplex Master Mix 10 ㎕
10X 프라이머/프로브 혼합물 2 ㎕
플라스미드 DNA 2 ㎕
증류수 6 ㎕
전체 부피 20 ㎕
{단일 실시간 중합효소 연쇄반응(PCR) 조건}
목적 단계별 온도 시간 사이클
UDG 반응 50 ℃ 2 min 1
UDG 불활성화 95 ℃ 10 min 1
증폭 95 ℃ 15 sec 40
60 ℃ 30 sec
4.2 단일 실시간 PCR(Singleplex Real-time PCR)를 이용한 표준곡선(Standard Curve) 작성 및 민감도(Sensitivity), 특이도(Specificity) 평가
실시예 3에서 제작한 프라이머 및 프로브와 균주 플라스미드를 이용하여 치주염 관련 유해균 및 상재균 16종과 Total bacteria를 검출할 수 있는지 확인하기 위해 상기 4.1에서 제시된 조건을 적용하여 민감도(sensitiviity) 평가를 진행하였다.
각 균주 프라이머 및 프로브는 표 7에 제시되어 있는 농도로 준비하였으며 균주 플라스미드 DNA는 109 copy number에서 1/10배씩 순차적으로 101 copy number까지 희석한 후 표 8 및 9의 조건대로 단일 실시간 PCR을 수행하였다. 형광 증폭 곡선(amplification plot)으로 최소 검출 한도와 농도별 Ct 값(cycle threshold value)을 측정하고 민감도(sensitiviity)와 표준곡선(standard curve)을 산출하였다.
각 균주 플라스미스 DNA(Total bacteria 제외) 0.25 x 108 copy number를 준비하여 모두 섞은 후 확인하고자 하는 16개 균주의 프라이머 및 프로브를 최적의 농도(표 7 참조)로 제조한 후 각각 한 세트씩 넣어 실시간 PCR(real-time PCR)을 수행하였다. 실험이 끝난 PCR 생산물(PCR product)은 16㎕씩 5% 아가로스 겔(agarose gel)에 로딩하여 전기영동을 진행하고 특이도(specificity)를 확인하였다(도 1 참조).
실험 결과, 16종의 치주염 관련 유해균 및 상재균과 Total bacteria에 대하여 제작된 프라이머 및 프로브가 표적 균주만을 검출해내는 것을 확인하였고 각 균주별 플라스미드 DNA가 101 ~ 102 copy number에서 검출되었으며(표 10 및 11 참조) 기울기가 -3.33에 가깝고 이상적인 qPCR efficiency 범위(90 ~ 110%)에 속함을 확인하였다. 또한 각 균에 대한 표준 곡선의 R2값이 1(약 0.99)에 매우 근접한 값으로 신뢰도가 매우 높음을 확인할 수 있었다(도 2 내지 17 참조). 해당 실험을 통해 제작한 프라이머 및 프로브가 각 균주를 정량적으로 검출함과 동시에 정성적으로 구별할 수 있음을 확인하였다.
{단일 실시간 중합효소 연쇄반응(PCR) 검출 민감도}
Plasmid DNA 농도
균주 108 copy
(pg)		 107 copy
(pg)		 106 copy
(pg)		 105 copy
(fg)		 104 copy
(fg)		 103 copy
(fg)		 102 copy
(ag)		 101 copy
(ag)
Actinomyces 331 33.1 3.31 331 33.1 3.31 331 33.1
Fretibacterium 337 33.7 3.37 337 33.7 3.37 337
Prevotella dentalis 246 24.6 2.46 246 24.6 2.46 246
Tannerella forsythia 336 33.6 3.36 336 33.6 3.36 336
Eubacterium nodatum 242 24.2 2.42 242 24.2 2.42 242 24.2
Mogibacterium 243 24.3 2.43 243 24.3 2.43 243
Porphyromonas endodontalis 240 24.0 2.40 240 24.0 2.40 240 24.0
Treponema 238 23.8 2.38 238 23.8 2.38 238 23.8
Filifactor alocis 243 24.3 2.43 243 24.3 2.43 243 24.3
Treponema denticola 337 33.7 3.37 337 33.7 3.37 337 33.7
Treponema socranskii 238 23.8 2.38 238 23.8 2.38 238 23.8
Eubacterium saphenum 335 33.5 3.35 335 33.5 3.35 335 33.5
Haemophilus parainfluenzae 340 34.0 3.40 340 34.0 3.40 340
Oribacterium 326 32.6 3.26 326 32.6 3.26 326
Porphyromonas gingivalis 148 14.8 1.48 148 14.8 1.48 148 14.8
Mycoplasma 238 23.8 2.38 238 23.8 2.38 238 23.8
Total bacteria(All) 635 63.5 6.35 635 63.5 6.35 635 63.5
{단일 실시간 중합효소 연쇄반응(PCR) 최소검출한도}
균주 Ct값
(Plasmid DNA양)		 DNA copy값
Actinomyces 39.0 (33.1 ag) 1.0 x 101
Fretibacterium 38.2 (337 ag) 1.0 x 102
Prevotella dentalis 38.9 (246 ag) 1.0 x 102
Tannerella forsythia 37.1 (336 ag) 1.0 x 102
Eubacterium nodatum 36.9 (24.2 ag) 1.0 x 101
Mogibacterium 36.9 (243 ag) 1.0 x 102
Porphyromonas endodontalis 39.1 (24.0 ag) 1.0 x 101
Treponema 38.1 (23.8 ag) 1.0 x 101
Filifactor alocis 38.5 (24.3 ag) 1.0 x 101
Treponema denticola 37.8 (33.7 ag) 1.0 x 101
Treponema socranskii 39.5 (23.8 ag) 1.0 x 101
Eubacterium saphenum 38.8 (33.5 ag) 1.0 x 101
Haemophilus parainfluenzae 39.5 (340 ag) 1.0 x 102
Oribacterium 37.0 (326 ag) 1.0 x 102
Porphyromonas gingivalis 38 6 (14.8 ag) 1.0 x 101
Mycoplasma 38.0 (23.8 ag) 1.0 x 101
Tb(All) 33.6 (63.5 ag) 1.0 x 101
4.3 동시 다중 실시간 PCR(Multiplex Real-time PCR) 조건
Total bacteria를 포함한 총 17개의 균주에 대한 프라이머 및 프로브(총 5세트)를 혼합하여 단 한 번의 반응으로 여러 개의 균이 동시에 검출 가능한지 확인하기 위해 동시 다중 실시간 PCR 실험을 수행하였다. 다중 실시간 PCR의 조성물의 각 구성은 각 세트에 해당하는 균주(A세트 4종, B세트 4종, C세트 3종, D세트 4종, E세트 2종)의 정방향 및 역방향 프라이머와 프로브 혼합물 2㎕, 각 세트에 해당하는 균주 플라스미드의 DNA(A, B, D세트 8㎕, C세트 6㎕, E세트 4㎕)와 10㎕의 2X Taqman multiplex mastermix(Thermofisher, USA), 마지막으로 동일한 용량으로 맞추기 위한 3차 멸균수(C세트 2㎕, E세트 4㎕)를 포함하여 총 20㎕가 되도록 하였다(표 12 참조).
그 다음 96 웰의 플레이트에 분주하고, 실시간 중합 효소 연쇄반응을 실시하였다. 동시 다중 실시간 PCR의 조건은 단일 실시간 PCR과 동일하게 오염 방지 단계의 UDG 반응을 위해 50℃에서 2분간 반응시켰으며, 이후 UDG의 불활성화를 위해 95℃에서 10분간 유지하였다. PCR 증폭의 단계는 95℃에서 15초, 60℃에서 30초로 40회 반복하여 수행하였다(표 13 참조).
Figure PCTKR2021013288-appb-img-000002
{다중 실시간 중합효소 연쇄반응(PCR) 조건}
목적 단계별 온도 시간 사이클
UDG 반응 50 ℃ 2 min 1
UDG 불활성화 95 ℃ 10 min 1
증폭 95 ℃ 15 sec 40
60 ℃ 30 sec
4.4 동시 다중 실시간 PCR(Multiplex Real-time PCR)
상기 4.2를 통해 제작한 프라이머 및 프로브가 정성 및 정량적으로 균주를 검출하는 것을 확인하였으며, 이를 토대로 교차반응이 발생하지 않는 프라이머 및 프로브 5세트를 구성하여 상기 4.3과 같이 동시 다중 실시간 PCR을 진행하였다.
각 세트로 구성된 균주별 플라스미드 DNA 혼합물에 대하여 프라이머 세트 혼합물이 정상적으로 작동함을 확인하였다(도 18 내지 26 참조). 도 18은 다중 실시간 PCR을 나타내는 이미지이며, A세트가 도 18, 19를 나타내고, B세트가 도 20, 21, C세트는 도 22 및 도 23, D세트가 도 24, 도25, E세트는 도 26을 나타낸다.
또한 각 세트의 균주별 플라스미드 DNA에 대해 순차적으로 희석을 수행하였고, 형광 증폭 곡선의 결과에 나타난 시료의 Ct값(cycle threshold value)을 바탕으로 표준 곡선(standard curve)을 구축하였으며, 최소검출 한도를 확인하였다. 기울기는 -3.33에 가까우며 표준 곡선의 R2값은 약 0.99 정도로, 1에 매우 근접한 값으로 신뢰도가 매우 높았고(도 18 내지 26 참조), Total bacteria를 포함한 총 17종의 균주에 대하여 다중 실시간 PCR을 수행하였을 때, 모든 프라이머 및 프로브 혼합물에서 각 균이 101 ~ 102 copy number에서 검출됨을 확인할 수 있었다(표 14 참조).
{다중 실시간 중합효소 연쇄반응(PCR) 최소검출한도}
균주 Ct값
(Plasmid DNA양)		 DNA copy값
Actinomyces 38.3 (33.1 ag) 1.0 x 101
Fretibacterium 39.4 (33.7 ag) 1.0 x 101
Prevotella dentalis 36.8 (246 ag) 1.0 x 102
Tannerella forsythia 39.1 (33.6 ag) 1.0 x 101
Eubacterium nodatum 36.7 (24.2 ag) 1.0 x 101
Mogibacterium 38.4 (24.3 ag) 1.0 x 101
Porphyromonas endodontalis 38.0 (24.0 ag) 1.0 x 101
Treponema 38.3 (23.8 ag) 1.0 x 101
Filifactor alocis 36.9 (243 ag) 1.0 x 102
Treponema denticola 38.9 (33.7 ag) 1.0 x 101
Treponema socranskii 39.0 (23.8 ag) 1.0 x 101
Eubacterium saphenum 36.0 (33.5 ag) 1.0 x 101
Haemophilus parainfluenzae 38.2 (340 ag) 1.0 x 102
Oribacterium 38.9 (32.6 ag) 1.0 x 101
Porphyromonas gingivalis 37 1 (148 ag) 1.0 x 102
Mycoplasma 38.1 (23.8 ag) 1.0 x 101
Tb(All) 33.2 (63.5 ag) 1.0 x 101
결론적으로 임상 연구 샘플을 기반으로 차세대 염기서열분석(NGS)으로 치아우식증 관련 구강 마이크로바이옴 데이터를 생산하였고, 선정된 유해균 및 상재균에 대한 프라이머 및 프로브를 제작하였다. 이를 통해 TaqMan 동시 다중 실시간 PCR 기법을 이용하여서 한 반응(single reaction)에서 최대 4개의 타겟 균주를 증폭하여 검출할 수 있는 종-특이적 PCR 프라이머 및 프로브를 개발하였다.

Claims (7)

  1. 피검자의 구강 유래 시료에서, 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스(Actinomyces) 속 미생물; 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움(Fretibacterium) 속 미생물; 프레보텔라 덴탈리스(Prevotella dentalis); 타네렐라 포시티아(Tannerella forsythia); 유박테리움 노다튬(Eubacterium nodatum); 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움(Mogibacterium) 속 미생물; 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis); 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마(Treponema) 속 미생물; 필리팩터 알로시스(Filifactor alocis); 트레포네마 덴티콜라(Treponema denticola); 트레포네마 소크란스키이(Treponema socranskii); 유박테리움 사페눔(Eubacterium saphenum); 헤모필러스 파라인플루엔제(Haemophilus parainfluenzae); 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움(Oribacterium) 속 미생물; 포피로모나스 진지발리스(Porphyromonas gingivalis); 및 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마(Mycoplasma) 속 미생물;을 검출하는 한국인의 치주질환 진단을 위한 정보제공 방법.
  2. 제1항에 있어서,
    상기 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스 속 미생물의 검출을 위해 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR;
    상기 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움 속 미생물의 검출을 위해 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR;
    상기 프레보텔라 덴탈리스의 검출을 위해 서열번호 5의 프라이머, 서열번호 6의 프라이머 및 서열번호 37의 프로브를 사용한 PCR;
    상기 타네렐라 포시티아의 검출을 위해 서열번호 7의 프라이머, 서열번호 8의 프라이머 및 서열번호 38의 프로브를 사용한 PCR;
    상기 유박테리움 노다튬의 검출을 위해 서열번호 9의 프라이머, 서열번호 10의 프라이머 및 서열번호 39의 프로브를 사용한 PCR;
    상기 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움 속 미생물의 검출을 위해 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR;
    상기 포피로모나스 엔도돈탈리스의 검출을 위해 서열번호 13의 프라이머, 서열번호 14의 프라이머 및 서열번호 41의 프로브를 사용한 PCR;
    상기 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마 속 미생물의 검출을 위해 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR;
    상기 필리팩터 알로시스의 검출을 위해 서열번호 17의 프라이머, 서열번호 18의 프라이머 및 서열번호 43의 프로브를 사용한 PCR;
    상기 트레포네마 덴티콜라의 검출을 위해 서열번호 19의 프라이머, 서열번호 20의 프라이머 및 서열번호 44의 프로브를 사용한 PCR;
    상기 트레포네마 소크란스키이의 검출을 위해 서열번호 21의 프라이머, 서열번호 22의 프라이머 및 서열번호 45의 프로브를 사용한 PCR;
    상기 유박테리움 사페눔의 검출을 위해 서열번호 23의 프라이머, 서열번호 24의 프라이머 및 서열번호 46의 프로브를 사용한 PCR;
    상기 헤모필러스 파라인플루엔제의 검출을 위해 서열번호 25의 프라이머, 서열번호 26의 프라이머 및 서열번호 47의 프로브를 사용한 PCR;
    상기 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움 속 미생물의 검출을 위해 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR;
    상기 포피로모나스 진지발리스의 검출을 위해 서열번호 29의 프라이머, 서열번호 30의 프라이머 및 서열번호 49의 프로브를 사용한 PCR;
    상기 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마 속 미생물의 검출을 위해 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR;을 수행하는, 한국인의 치주질환 진단을 위한 정보제공 방법.
  3. 제2항에 있어서,
    상기 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 사용한 PCR로 검출되는 액티노마이세스 속 미생물의 검출을 위한 PCR; 상기 서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 사용한 PCR로 검출되는 프레티박테리움 속 미생물의 검출을 위한 PCR; 상기 프레보텔라 덴탈리스의 검출을 위한 PCR; 및 상기 타네렐라 포시티아의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하고,
    상기 유박테리움 노다튬의 검출을 위한 PCR; 상기 서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 사용한 PCR로 검출되는 모기박테리움 속 미생물의 검출을 위한 PCR; 상기 포피로모나스 엔도돈탈리스의 검출을 위한 PCR; 및 상기 서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 사용한 PCR로 검출되는 트레포네마 속 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하고,
    상기 필리팩터 알로시스의 검출을 위한 PCR; 상기 트레포네마 덴티콜라의 검출을 위한 PCR; 및 상기 트레포네마 소크란스키이의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하고,
    상기 유박테리움 사페눔의 검출을 위한 PCR; 상기 헤모필러스 파라인플루엔제의 검출을 위한 PCR; 상기 서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 사용한 PCR로 검출되는 오리박테리움 속 미생물의 검출을 위한 PCR; 및 상기 포피로모나스 진지발리스의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하는, 한국인의 치주질환 진단을 위한 정보제공 방법.
  4. 제3항에 있어서,
    그람 양성 미생물의 검출을 위해 서열번호 33의 프라이머, 서열번호 34의 프라이머 및 서열번호 51의 프로브를 사용한 PCR; 및
    그람 음성 미생물의 검출을 위해 서열번호 33의 프라이머, 서열번호 34의 프라이머 및 서열번호 52의 프로브를 사용한 PCR;을 더 수행하며,
    상기 서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 사용한 PCR로 검출되는 마이코플라즈마 속 미생물의 검출을 위한 PCR; 상기 그람 양성 미생물의 검출을 위한 PCR; 및 상기 그람 음성 미생물의 검출을 위한 PCR;을 하나의 반응액 내에서 수행하는, 한국인의 치주질환 진단을 위한 정보제공 방법.
  5. 서열번호 1의 프라이머, 서열번호 2의 프라이머 및 서열번호 35의 프로브를 포함하는 제1프라이머-프로브 세트;
    서열번호 3의 프라이머, 서열번호 4의 프라이머 및 서열번호 36의 프로브를 포함하는 제2프라이머-프로브 세트;
    서열번호 5의 프라이머, 서열번호 6의 프라이머 및 서열번호 37의 프로브를 포함하는 제3프라이머-프로브 세트;
    서열번호 7의 프라이머, 서열번호 8의 프라이머 및 서열번호 38의 프로브를 포함하는 제4프라이머-프로브 세트;
    서열번호 9의 프라이머, 서열번호 10의 프라이머 및 서열번호 39의 프로브를 포함하는 제5프라이머-프로브 세트;
    서열번호 11의 프라이머, 서열번호 12의 프라이머 및 서열번호 40의 프로브를 포함하는 제6프라이머-프로브 세트;
    서열번호 13의 프라이머, 서열번호 14의 프라이머 및 서열번호 41의 프로브를 포함하는 제7프라이머-프로브 세트;
    서열번호 15의 프라이머, 서열번호 16의 프라이머 및 서열번호 42의 프로브를 포함하는 제8프라이머-프로브 세트;
    서열번호 17의 프라이머, 서열번호 18의 프라이머 및 서열번호 43의 프로브를 포함하는 제9프라이머-프로브 세트;
    서열번호 19의 프라이머, 서열번호 20의 프라이머 및 서열번호 44의 프로브를 포함하는 제10프라이머-프로브 세트;
    서열번호 21의 프라이머, 서열번호 22의 프라이머 및 서열번호 45의 프로브를 포함하는 제11프라이머-프로브 세트;
    서열번호 23의 프라이머, 서열번호 24의 프라이머 및 서열번호 46의 프로브를 포함하는 제12프라이머-프로브 세트;
    서열번호 25의 프라이머, 서열번호 26의 프라이머 및 서열번호 47의 프로브를 포함하는 제13프라이머-프로브 세트;
    서열번호 27의 프라이머, 서열번호 28의 프라이머 및 서열번호 48의 프로브를 포함하는 제14프라이머-프로브 세트;
    서열번호 29의 프라이머, 서열번호 30의 프라이머 및 서열번호 49의 프로브를 포함하는 제15프라이머-프로브 세트; 및
    서열번호 31의 프라이머, 서열번호 32의 프라이머 및 서열번호 50의 프로브를 포함하는 제16프라이머-프로브 세트;를 포함하는 한국인의 치주질환 진단용 키트.
  6. 제5항에 있어서,
    상기 제1프라이머-프로브 세트, 제2프라이머-프로브 세트, 제3프라이머-프로브 세트 및 제4프라이머-프로브 세트를 하나의 조성물로 포함하고,
    상기 제5프라이머-프로브 세트, 제6프라이머-프로브 세트, 제7프라이머-프로브 세트 및 제8프라이머-프로브 세트를 하나의 조성물로 포함하고,
    상기 제9프라이머-프로브 세트, 제10프라이머-프로브 세트 및 제11프라이머-프로브 세트를 하나의 조성물로 포함하고,
    상기 제12프라이머-프로브 세트, 제13프라이머-프로브 세트, 제14프라이머-프로브 세트 및 제15프라이머-프로브 세트를 하나의 조성물로 포함하는, 한국인의 치주질환 진단용 키트.
  7. 제6항에 있어서,
    서열번호 33의 프라이머, 서열번호 34의 프라이머, 서열번호 51의 프로브 및 서열번호 52의 프로브를 포함하는 제17프라이머-프로브 세트;를 더 포함하며,
    상기 제16프라이머-프로브 세트 및 제17프라이머-프로브 세트를 하나의 조성물로 포함하는, 한국인의 치주질환 진단용 키트.
PCT/KR2021/013288 2020-11-30 2021-09-29 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트 WO2022114491A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0163917 2020-11-30
KR1020200163917A KR102448350B1 (ko) 2020-11-30 2020-11-30 치아 우식증의 진단을 위한 정보제공방법 및 키트

Publications (1)

Publication Number Publication Date
WO2022114491A1 true WO2022114491A1 (ko) 2022-06-02

Family

ID=81754703

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2021/013288 WO2022114491A1 (ko) 2020-11-30 2021-09-29 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트
PCT/KR2021/095144 WO2022114940A1 (ko) 2020-11-30 2021-12-28 치아 우식증의 진단을 위한 정보제공방법 및 키트

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/095144 WO2022114940A1 (ko) 2020-11-30 2021-12-28 치아 우식증의 진단을 위한 정보제공방법 및 키트

Country Status (2)

Country Link
KR (1) KR102448350B1 (ko)
WO (2) WO2022114491A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100061438A (ko) * 2007-07-04 2010-06-07 부산대학교 산학협력단 치주 질환 관련 세균의 검출 및 동정용 마이크로어레이 및 이를 이용한 세균 감염성 구강 질환 진단방법
KR20100074455A (ko) * 2008-12-24 2010-07-02 김연수 치주 질환 원인균 탐지용 프로브 및 이를 이용한 분석 장치
KR101306162B1 (ko) * 2011-03-12 2013-09-09 (주)에스엘에스 치주질환 진단용 키트
KR101385733B1 (ko) * 2011-03-29 2014-04-29 (주)바이오니아 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
KR20150129484A (ko) * 2014-05-12 2015-11-20 휴스텝스 주식회사 치주질환 원인균 검출용 프라이머 및 프로브, 치주질환 원인균 검출 방법 및 이의 용도

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2895108B2 (ja) * 1989-10-04 1999-05-24 水澤化学工業株式会社 塩素含有重合体用複合安定剤及びその製法
KR101562491B1 (ko) * 2014-10-31 2015-10-23 김성현 충치(치아우식) 원인균 동시 탐지를 위한 Multiplex real-time PCR 용 프라이머와 프로브 및 이의 용도
JP2016214101A (ja) 2015-05-15 2016-12-22 国立大学法人東北大学 口腔細菌の簡易迅速検査方法
KR101735028B1 (ko) * 2016-05-19 2017-05-12 김성현 실시간 중합효소 연쇄반응과 융해곡선 분석법을 이용한 충치(치아우식) 원인균의 정량 및 정성 검사 방법
KR101706070B1 (ko) * 2016-06-28 2017-02-13 (주) 와이디생명과학 멀티플렉스 실시간 pcr을 이용한 다수의 구강질환 원인 세균의 동시 검출용 조성물 및 이를 이용한 검출 방법
KR102215852B1 (ko) 2020-07-09 2021-02-15 부산대학교 산학협력단 치주 질환 원인균의 검출용 프라이머 세트 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100061438A (ko) * 2007-07-04 2010-06-07 부산대학교 산학협력단 치주 질환 관련 세균의 검출 및 동정용 마이크로어레이 및 이를 이용한 세균 감염성 구강 질환 진단방법
KR20100074455A (ko) * 2008-12-24 2010-07-02 김연수 치주 질환 원인균 탐지용 프로브 및 이를 이용한 분석 장치
KR101306162B1 (ko) * 2011-03-12 2013-09-09 (주)에스엘에스 치주질환 진단용 키트
KR101385733B1 (ko) * 2011-03-29 2014-04-29 (주)바이오니아 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
KR20150129484A (ko) * 2014-05-12 2015-11-20 휴스텝스 주식회사 치주질환 원인균 검출용 프라이머 및 프로브, 치주질환 원인균 검출 방법 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JEONG-HO YUN, JUNG-EUN PARK, DOO-IL KIM, SYNG-ILL LEE, SEONG-HO CHOI, KYOO-SUNG CHO, DAE-SIL LEE: "Identification of putative periodontal pathogens in Korean chronic periodontitis patients", JOURNAL OF PERIODONTAL & IMPLANT SCIENCE, vol. 38, no. 2, 1 January 2008 (2008-01-01), pages 143 - 152, XP055932466, DOI: 10.5051/jkape.2008.38.2.143 *

Also Published As

Publication number Publication date
WO2022114940A1 (ko) 2022-06-02
KR20220075628A (ko) 2022-06-08
KR102448350B1 (ko) 2022-09-28

Similar Documents

Publication Publication Date Title
Contreras et al. Importance of Dialister pneumosintes in human periodontitis
Barbosa-Ribeiro et al. Antimicrobial susceptibility and characterization of virulence genes of Enterococcus faecalis isolates from teeth with failure of the endodontic treatment
Genco et al. Use and interpretation of microbiological assaysin periodontal diseases
Khemaleelakul et al. Identification of bacteria in acute endodontic infections and their antimicrobial susceptibility
Rôças et al. Association of Enterococcus faecalis with different forms of periradicular diseases
Okada et al. PCR detection of 5 putative periodontal pathogens in dental plaque samples from children 2 to 12 years of age
Siqueira Jr et al. Molecular detection of black-pigmented bacteria in infections of endodontic origin
Dewhirst et al. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences
Mashima et al. Identification of Veillonella species in the tongue biofilm by using a novel one-step polymerase chain reaction method
Debelian et al. Anaerobic bacteremia and fungemia in patients undergoing endodontic therapy: an overview
Hardham et al. Transfer of Bacteroides splanchnicus to Odoribacter gen. nov. as Odoribacter splanchnicus comb. nov., and description of Odoribacter denticanis sp. nov., isolated from the crevicular spaces of canine periodontitis patients
Avila-Campos et al. Prevalence of putative periodontopathogens from periodontal patients and healthy subjects in São Paulo, SP, Brazil
Siqueira Jr et al. Catonella morbi and Granulicatella adiacens: new species in endodontic infections
Genco et al. The use of genomic DMA fingerprinting in studies of the epidemiology of bacteria in periodontitis
Cortelli et al. Detection of periodontal pathogens in newborns and children with mixed dentition
Mashima et al. Identification of Veillonella tobetsuensis in tongue biofilm by using a species-specific primer pair
Ozbek et al. Real-time polymerase chain reaction of “red complex”(Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola) in periradicular abscesses
Siqueira Jr et al. Dialister pneumosintes can be a suspected endodontic pathogen
Rôças et al. Characterization of Dialister species in infected root canals
Aleksandrowicz et al. Archaea Occurrence in the Subgingival Biofilm in Patients with Peri-implantitis and Periodontitis.
KR101794640B1 (ko) 구강 질환 관련 세균의 실시간 검출용 프라이머 및 프로브, 및 이를 이용한 리얼타임 pcr 방법
WO2019147080A1 (ko) 세균 메타게놈 분석을 통한 우울증 진단방법
WO2022114491A1 (ko) 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트
Rôças et al. Culture-independent detection of Eikenella corrodens and Veillonella parvula in primary endodontic infections
Hayashi et al. PCR detection of Capnocytophaga species in dental plaque samples from children aged 2 to 12 years

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21898318

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21898318

Country of ref document: EP

Kind code of ref document: A1