WO2022005201A1 - 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물 - Google Patents

티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물 Download PDF

Info

Publication number
WO2022005201A1
WO2022005201A1 PCT/KR2021/008259 KR2021008259W WO2022005201A1 WO 2022005201 A1 WO2022005201 A1 WO 2022005201A1 KR 2021008259 W KR2021008259 W KR 2021008259W WO 2022005201 A1 WO2022005201 A1 WO 2022005201A1
Authority
WO
WIPO (PCT)
Prior art keywords
tyrosine
nitration
protein
group
preventing
Prior art date
Application number
PCT/KR2021/008259
Other languages
English (en)
French (fr)
Inventor
김현준
강재순
백지형
정순웅
박상원
Original Assignee
경상국립대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상국립대학교산학협력단 filed Critical 경상국립대학교산학협력단
Priority to US18/013,412 priority Critical patent/US20230248681A1/en
Priority to CN202180047217.6A priority patent/CN115996645A/zh
Priority to JP2022581606A priority patent/JP2023532939A/ja
Priority to EP21832930.8A priority patent/EP4173494A4/en
Priority to CA3184258A priority patent/CA3184258A1/en
Publication of WO2022005201A1 publication Critical patent/WO2022005201A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/175—Amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/02—Acid
    • A23V2250/06—Amino acid
    • A23V2250/0652—Tyrosine

Definitions

  • the present invention relates to a composition for preventing, improving or treating a disease caused by nitration of tyrosine in a protein containing tyrosine as an active ingredient.
  • nitrate species such as nitric oxide. Therefore, when nitration of tyrosine among amino acids included in a protein occurs, it may cause structural and functional changes of the protein. Therefore, nitration of tyrosine can cause various diseases.
  • glutamine synthetase is an enzyme that synthesizes glutamine by using glutamic acid and ammonia in the living body, and is produced in various organs of the body and plays a role in the nitrogen balance of organs and the entire body.
  • glutamine synthetase is exposed to active nitrogen for reasons such as chronic stress, tyrosine is nitrated, and various diseases can occur by lowering the activity of glutamine synthetase.
  • Korean Patent Application Laid-Open No. 2020-0018488 discloses the use of glutamine synthetase for treating hyperammonemia
  • Korean Patent Publication No. 2020-0038481 discloses a composition for treating stress-related disorders.
  • a composition for preventing, improving or treating a disease caused by nitration of tyrosine in a protein containing tyrosine as an active ingredient of the present invention has not been disclosed.
  • the present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating diseases caused by nitration of tyrosine in a protein containing tyrosine as an active ingredient, and the active ingredient of the present invention Tyrosine not only reduces the N-tyr content in the glutamine synthetase produced by stress, but also enhances the activity of the glutamine synthetase with reduced activity, and restores the contents of glutamine, glutamic acid and ammonia in the brain to a normal state.
  • the present invention provides a health functional food composition for the prevention or improvement of diseases caused by nitration of tyrosine in protein containing tyrosine or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating diseases caused by nitration of tyrosine in a protein containing tyrosine or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a method for removing a nitro group from nitrated tyrosine by treating a protein containing nitrated tyrosine with tyrosine.
  • the present invention relates to a composition for preventing, improving or treating a disease caused by nitration of tyrosine in a protein containing tyrosine as an active ingredient.
  • glutamine synthetase did not change due to stress, the content of N-tyr in GS increased statistically and significantly, thereby confirming that the activity of GS was reduced.
  • GS with reduced free tyrosine In addition to enhancing the activity, it has the effect of restoring the glutamine, glutamic acid content (ratio) and ammonia amount in the brain to normal, insulin sensitivity enhancement in type 2 diabetes model, excitotoxicity and oxidative stress in epilepsy model. Inhibitory effect, cerebral infarction reduction and GS activity enhancement effect in stroke model, tyrosine nitration removal effect using human recombinant MnSOD, effect on acute renal failure and hyperammonemia.
  • CIS 1 shows the effect of chronic immobility stress (CIS)
  • A is the result of confirming the change in body weight and food intake during the experiment period
  • B is the change in the content of corticosterone in plasma and plasma and PFC The change in ROS/RNS content in (frontal lobe) was confirmed
  • C shows that there was no change in the GS content, but the N-Tyr content in the stress group increased statistically and significantly, and the GS activity was statistically significantly decreased.
  • Results (D) is the result of confirming the in vitro GS activity after treating the PFC tissue lysate with nitrogen peroxide and tyrosine.
  • TD tyrosine-diet
  • CIS chronic immobility stress
  • STR chronic immobility stress
  • TD chronic immobile stress
  • CIS chronic immobile stress
  • STR chronic immobile stress
  • A is an open field test (Open field test) results
  • B is tail suspension
  • C are the results of the sucrose preference test.
  • Figure 4 is a tyrosine-fed (TD) corticosterone (corticosterone) content (A) in the plasma of the chronic immobile stress (CIS) induction group (STR) and the amount of change in ROS / RNS in plasma and PFC DCF ( This is the result of confirming that the stress hormone and oxidative stress were reduced by TD through dichlorofluorescin (B, C).
  • TD tyrosine-diet
  • CIS chronic immobile stress
  • GS activity A
  • GS expression level B
  • nitration level of tyrosine contained in GS C is the result of checking.
  • Figure 6 is a tyrosine-diet (TD) chronic immobility stress (CIS) induction group (STR), glutamate, glutamine, tyrosine and GABA results confirmed in the PFC content.
  • TD tyrosine-diet
  • CIS chronic immobility stress
  • A is a western blot result for nitrotyrosine protein in PFC (frontal lobe) tissue
  • B is a western blot result for nitrotyrosine protein in liver tissue
  • C is a Western blot result for glutamine synthetase protein in PFC (frontal lobe) tissue
  • D is a Western blot result for glutamine synthetase, insulin receptor beta and phosphorylated insulin receptor beta protein in liver tissue.
  • FIG. 10 is a result of confirming the weight change (A), blood sugar (B) and feed intake (C) according to L-tyrosine feeding in type 2 diabetes model mice by a high-fat diet by period.
  • *** indicates that the blood glucose content of the high-fat diet group (HFD) compared to the general diet group (ND) increased statistically significantly, p ⁇ 0.001, and #, ## are L- compared to the high-fat diet group (HFD).
  • the blood glucose content of the tyrosine-containing diet group (HFD+L-Tyr) was statistically significantly decreased, with # being p ⁇ 0.05 and ## being p ⁇ 0.01.
  • FIG. 11 is a result of confirming the glucose tolerance of mice fed L-tyrosine diet in type 2 diabetes model mice by a high-fat diet.
  • A shows the blood glucose content over time
  • B shows the area under the curve (AUC) in (A).
  • ** and *** indicate that the blood glucose content of the high-fat diet group (HFD) increased statistically significantly compared to the general diet group (ND), ** denotes p ⁇ 0.01, *** denotes p ⁇ 0.001, and
  • # indicates that the blood glucose content of the L-tyrosine-containing diet group (HFD+L-Tyr) was statistically significantly decreased compared to the high-fat diet group (HFD), and p ⁇ 0.05.
  • FIG. 12 is a result confirming the insulin resistance of L-tyrosine-fed mice in type 2 diabetes model mice by a high-fat diet.
  • A shows the blood glucose content over time
  • B shows the area under the curve (AUC) in (A).
  • *, **, *** indicates that the blood glucose content of the high-fat diet group (HFD) compared to the general diet group (ND) increased statistically significantly, * is p ⁇ 0.05, ** is p ⁇ 0.01, and , *** is p ⁇ 0.001.
  • # indicates that the blood glucose content of the L-tyrosine-containing diet group (HFD+L-Tyr) was statistically significantly decreased compared to the high-fat diet group (HFD), and p ⁇ 0.05.
  • FIG. 13 is a result of confirming changes in fat accumulation in tissues (A) and changes in ROS/RNS content in plasma (B).
  • *** indicates that the tissue weight of HFD or HFD+Tyr compared to ND and the ROS/RNS content in plasma increased statistically significantly, p ⁇ 0.001, #, ## are the tissue weight of HFD+Tyr compared to HFD and The ROS/RNS content in plasma was statistically significantly decreased, with # being p ⁇ 0.05 and ## being p ⁇ 0.01.
  • 16 is a tissue immunochemical staining result obtained by analyzing the number of neurons in the hippocampal region (CA1(A), CA3(B)) and the activity of microglia in the same region by cyanoic acid. * indicates a decrease in the number of neurons compared to CTL or an increase in the activity of inflammation-inducing microglia, with p ⁇ 0.05, and #, indicating a significant decrease in microglia activity in the tyrosine-fed group, p ⁇ 0.05.
  • A gene expression level of NQO-1, which is an antioxidant
  • B CuZnSOD activity
  • C MnSOD activity
  • D ROS/RNS content
  • E Expression of nitrotyrosine protein in kidney tissue 24 hours after renal ischemia and reperfusion.
  • 21 is a result of measuring plasma creatinine as a kidney damage evaluation index. * and ** indicate that the expression levels of creatine (A), IL-1 ⁇ (B) and IL-6 (C) were increased statistically significantly compared to the Sham group, * is p ⁇ 0.05, ** is p ⁇ 0.01. # and ## indicate that the expression levels of creatine, IL-1 ⁇ and IL-6 were decreased compared to the CMC+IR group, where # is p ⁇ 0.05, and ## is p ⁇ 0.01.
  • the present invention relates to a health functional food composition for preventing or improving diseases caused by nitration of tyrosine in a protein containing tyrosine or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Nitration of tyrosine in the protein is tyrosine hydroxylase, manganese superoxide dismutase, Cu/Zn superoxide dismutase, insulin receptor beta subunit ( insulin receptor ⁇ subunit), annexin IV, glutamate dehydrogenase, 3- ⁇ -OH steroid dehydrogenase, glutathione S-transferase ), 3-ketoacyl CoA thiolase, catalase, Tau protein, mitochondria complex 1, alpha-synuclein, apolipoprotein -A1), amyloid- ⁇ (amyloid- ⁇ ) and NMDA receptor (NMDA receptor) nitration of tyrosine in any one protein selected from the preferred, but not limited thereto.
  • tyrosine in the protein Diseases caused by nitration of tyrosine in the protein are depression, anxiety disorder, stroke, epilepsy, glaucoma, diabetes mellitus, diabetic retina Diabetic retinopathy, seizure, hepaticencephalopathy, cognitive impairment, brain development impairment, cancer, Alzheimer disease, acute kidney damage ( Acute kidney injury) and hyperammonemia (Hyperammonemia) is preferably any one selected from, but is not limited thereto.
  • the nitration of tyrosine in the protein may occur in brain, liver, muscle, adipose tissue, kidney tissue, pancreas or lung, but is not limited thereto.
  • the amount of tyrosine to be administered as the active ingredient of the present invention is preferably administered in the amount shown in Table 1 below, but is not limited thereto.
  • the health functional food composition may be prepared by any one selected from pills, tablets, capsules, powders, powders, granules, candy, syrup and beverages, or by adding it as a component of food, a conventional method can be appropriately prepared according to
  • Examples of foods to which the active ingredient of the present invention can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, It may be in any one form selected from tea, drinks, alcoholic beverages, and vitamin complexes, and includes all health functional foods in a conventional sense.
  • the health functional food includes various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, It may contain a pH adjuster, a stabilizer, a preservative, glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like. In addition, it may contain the pulp for the production of natural fruit juices and vegetable beverages. These components may be used independently or in combination.
  • the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients.
  • the natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.
  • the present invention relates to a pharmaceutical composition for preventing or treating a disease caused by nitration of tyrosine in a protein containing tyrosine or a pharmaceutically acceptable salt thereof as an active ingredient.
  • a pharmaceutically acceptable carrier such as a tyrosine, a pharmaceutically acceptable carrier, excipient or diluent may be further included.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and when parenteral administration, it is preferable to select an external skin or intraperitoneal, rectal, intravenous, intramuscular or subcutaneous injection method, but is not limited thereto.
  • the pharmaceutical composition of the present invention may be prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • non-aqueous solvent and the suspending solvent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used.
  • base of the suppository witepsol, macrogol, Tween 61, cacao butter, laurin fat, glycerol, gelatin, etc. may be used.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type, severity, and drug activity of the patient. , can be determined according to factors including sensitivity to drug, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field.
  • the composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art.
  • the dosage of the composition of the present invention can be used in various ranges depending on the weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of the disease of the patient.
  • the present invention relates to a method for removing a nitro group from nitrated tyrosine by treating a protein containing nitrated tyrosine with tyrosine.
  • mice In the present invention, 28 7-week-old C57BL/6 male mice (Coatec, Korea) were bred under standard conditions (temperature 22-24 °C, humidity 50-70%, 12-hour light-dark cycle with lighting at 6 am), at this time, diet and free access to water. Animals used in the present invention were carried out according to the protocol (GNU-161128-M0068) approved by the Gyeongsang National University Animal Care and Use Committee (GNU IACUC) in accordance with the guidelines of the National Institutes of Health (NIH, Bechesda, MD, USA).
  • GNU-161128-M0068 approved by the Gyeongsang National University Animal Care and Use Committee (GNU IACUC) in accordance with the guidelines of the National Institutes of Health (NIH, Bechesda, MD, USA).
  • Brain blood and PFC samples were sampled from mice anesthetized with CO 2 gas, respectively.
  • Mouse blood was collected between 9 am and 11 am and collected in a vacuum vessel coated with K 3 EDTA.
  • Plasma was obtained by centrifugation at 500 ⁇ g at 4°C for 10 minutes, the PFC sample was weighed, the tissue was disrupted using a Bullet tissue disrupter, and centrifuged at 4°C at 12,000 rpm for 20 minutes. The obtained plasma and tissue lysate were stored at -80°C until use.
  • GS assay buffer 50 mM imidazole-HCl, pH 6.8, 50 mM L-glutamine, 25 mM hydroxylamine, 25 mM sodium arsenate), 2 mM MnCl 2 and 0.16 mM ADP.
  • a stop buffer solution 90 mM FeCl 3 , 1.8N HCl and 1.45% trichloroacetic acid
  • glutamine and hydroxylamine were synthesized from the reaction by GS.
  • ⁇ -glutamylhydroxamate was measured at 560 nm using a microplate reader.
  • IP-WB Western blot and immunoprecipitation (IP)-WB were used to measure the levels of GS and Tyr-nitration GS, respectively, and immunoprecipitation analysis of Tyr-nitration GS was performed with anti-3-nitrotyrosine antibody (ab61392, Abcam, Cambridge, UK). ) and Protein A/G plus agarose (Santa Cruz, Dallas, TX, USA) was used according to the manufacturer's protocol, and GS Western blot was performed using anti-GS (1:5000, Abcam). .
  • Example 1 Behavioral analysis according to chronic immobilization stress (CIS), glutamine synthetase (GS) activity change and nitration-tyrosine content confirmation in GS
  • the animal model was divided into two groups (normal group, stress group), and the stressed group was individually forced to mobilize in the restraint period for 2 hours (2-4 pm) every day and was given chronic immobility stress for 15 days, and weight change every other day. and feed intake were measured.
  • corticosterone was carried out according to the manufacturer's method using an ELISA kit (Cayman), and ROS/RNS was performed according to the manufacturer's method using the ROS/RNS assay kit (Cell Biolabs, San Diego, CA, USA). It was carried out according to
  • the body weight of the stressed group (STR) with chronic stress showed a tendency to decrease between 7 and 15 days, but the feed intake showed no difference. appeared to be almost absent, and corticosterone content and ROS/RNS also increased statistically significantly.
  • tyrosine was added to 10 ⁇ g of PFC (prefrontal cortex) tissue lysate, mixed and incubated on ice for 10 minutes, and nitric peroxide (PN) was added to a volume 10 times the volume of the tissue lysate. After mixing and incubation for 10 minutes, the in vitro GS activity was confirmed. As a result, it was confirmed that the GS activity also increased as the tyrosine concentration increased.
  • PFC prefrontal cortex
  • the animal model was divided into two groups (normal group, stress group), and the stressed group was individually forced to mobilize in the restraint period for 2 hours (2-4 pm) every day and was given chronic immobility stress for 15 days, and weight change every other day. and feed intake were measured.
  • the normal group and the stress group were reclassified into a nutritionally balanced general diet group and a diet supplemented with tyrosin (181.2 mg/kg) of the present invention and fed.
  • OFT open space test
  • mice were individually suspended in boxes with horizontal bars and their movements were tracked for 6 min to measure the duration of immobility.
  • SPT Sud Cell Preference Test
  • the resting time of the stress group (ND) was significantly increased (p ⁇ 0.05) compared to the normal group (CTL), and in contrast to this, the tyrosine-fed group was statistically significantly decreased (p ⁇ 0.05).
  • sucrose preference of the stress group was statistically significantly decreased compared to the normal group (p ⁇ 0.001), but the sucrose preference of the tyrosine diet group of the present invention compared to the general diet group of the stress group was statistically significant. increased (p ⁇ 0.01).
  • the expression level of glutamine synthetase (GS) was similar in both the general diet (ND) and tyrosine diet (TD) of the stress group compared to the control group, but the GS activity was decreased by stress, but the general diet group in the stress group
  • ND general diet
  • TD tyrosine diet
  • GS activity increased statistically and significantly
  • N-Tyr nonraion tyrosine
  • the content of N-Tyr was decreased statistically significantly (FIG. 5).
  • the content of amino acids (glutamate, glutamine, tyrosine) and GABA in PFC was quantified by liquid chromatography mass spectrometry (LC-MS/MS).
  • the PFC tissue was disrupted, and the supernatant of the tissue was diluted with an internal standard material (L-Glu-d5) and a mobile phase.
  • the diluted sample was aliquoted into 5 and injected into an LC-MS/MS system (Agilent 6460).
  • the column was a SeQuant ZIC ® -HILIC column (2.1 ⁇ 100 mm, 3.5 ⁇ m, 100 ⁇ ), and the mobile phase was separated by giving a concentration gradient using acetonitrile containing 0.1% formic acid.
  • Amino acid detection was performed using multiple reaction monitoring detection (Glu of m / z 148 ⁇ 84, Gln for m / z 147 ⁇ 84, GABA in the m / z 104 ⁇ 87 and the inner pyobun material m / z 153 ⁇ 88).
  • the general diet group of the stress group decreased the contents of glutamate, glutamine, tyrosine and GABA compared to the normal group, and in contrast, the tyrosine diet group had glutamic acid higher than the normal group level. It was confirmed that the content of salt, glutamine, tyrosine and GABA increased.
  • Example 4 Ammonia content change in PFC of chronic immobile stress (CIS) induction group (STR) fed with tyrosine-diet (TD)
  • the mouse PFC protein was treated with ONOO ⁇ to induce protein nitration, and the nitration inhibitory effect by tyrosine was confirmed.
  • FIG. 8 it was confirmed that the nitration of proteins was inhibited in a concentration-dependent manner of tyrosine, and the nitration inhibitory effect was similar to both L-tyrosine and D-tyrosine.
  • nitration inhibitory effect of tyrosine according to the present invention was analyzed using a mouse brain and liver tissue lysate.
  • Each of the prefrontal cortex (PFC) and liver tissues was collected and weighed from a mouse anesthetized with CO 2 gas, then the tissues were crushed using a tissue crusher, and centrifuged at 12,000 rpm at 4°C for 20 minutes. After separation, the supernatant was taken to obtain PFC and liver tissue lysate.
  • PN Peroxynitrite
  • glutamine Q
  • L-tyrosine L- Y
  • D-tyrosine D- Y
  • anti-nitrotyrosine antibody (1:1,000)
  • anti-glutamine synthetase antibody (1:5,000)
  • anti-insulin receptor beta antibody (1:1,000)
  • anti-phosphorylated insulin receptor beta antibody (1:1,000)
  • the body weight gradually increased, and it was confirmed that the body weight of the HFD and HFD+L-Tyr groups was heavier than the ND on the same day basis, and the body weight of the HFD and the HFD+L-Tyr group. Changes appeared at a similar level. There was almost no difference between groups in feed intake, and no difference according to period occurred. As for blood glucose, the blood glucose level of the HFD group increased significantly compared to the normal diet group (ND), and the HFD+L-Tyr group compared to the HFD group blood sugar was decreased statistically significantly.
  • a 40% D-glucose solution was prepared by dissolving D-glucose in 1x PBS. After measuring blood glucose in mice that had been fasted for 16 hours, a glucose solution was intraperitoneally injected according to Equation (1) in order to intraperitoneally inject 2 g of glucose per 1 kg of body weight.
  • Glucose injection amount ( ⁇ l) body weight (g) x 5
  • a mouse weighing 45 g was injected with 225 ⁇ l of a 40% glucose solution. After intraperitoneal injection of the glucose solution, blood glucose was measured at 30, 60, 90 and 120 minutes.
  • the blood glucose content of the high-fat diet group was statistically significantly increased compared to the normal diet group (ND), and in contrast to this, L-tyrosine (L-Tyr) of the present invention ) In the high-fat diet group (HFD+L-Tyr), the blood glucose content decreased.
  • Insulin was diluted in physiological saline to prepare a 0.15 U/ml solution. After measuring blood glucose in mice that had been fasted for 6 hours, insulin was intraperitoneally injected (0.75 U/weight (kg)). After intraperitoneal injection of insulin, blood glucose was measured at 15, 30, 60 and 90 minutes.
  • Insulin injection amount ( ⁇ l) body weight (g) ⁇ 5
  • the blood glucose content of the high-fat diet group was statistically significantly increased compared to the normal diet group (ND), and in contrast to this, L-tyrosine (L-Tyr) of the present invention ) In the high-fat diet group (HFD+L-Tyr), the blood glucose content decreased.
  • mice were anesthetized with Avertin, blood was collected through the heart, reacted with EDTA in a vacuum hemostat, and then centrifuged at 1,500 ⁇ g, 4° C. for 15 minutes to separate plasma.
  • PBS and 4% paraformaldehyde (PFA) were perfused through the heart to fix the tissue, and each tissue was extracted and stored in PFA.
  • the plasma active oxygen/nitrogen (ROS/RNS) concentration was measured by diluting the plasma three-fold in PBS, and then using the Oxiselect ROS/RNS assay kit (Cell Biolabs) according to the recommended experimental method.
  • tyrosine decreased the overall liver fat accumulation in the HFD animal model, and the amount of adipose tissue around the kidneys was reduced to a level with a statistical difference.
  • the plasma ROS/RNS level of the ROS/RNS level increased statistically significantly, in contrast to this, in the high-fat diet group (HFD+L-Tyr) supplemented with L-tyrosine (L-Tyr) of the present invention, the ROS/RNS level in the plasma was statistically It decreased significantly ( FIG. 13 ).
  • the excitotoxic inhibitory effect of tyrosine glutamate was confirmed using an epileptic seizure animal model in which seizures were induced with kaynic acid (KA).
  • the seizure level was confirmed by intraperitoneal injection of the same amount of cainic acid to animals fed mice with different amounts of tyrosine for 7 days.
  • mice Four-week-old ICR male mice were provided with a normal diet or a diet containing L-tyrosine for 1 week, and water and feed were freely available.
  • Kainic acid (KA, Abcam) was dissolved in physiological saline while heating in a hot water bath to prepare 9 mg/ml kainic acid solution, intraperitoneal injection of kainic acid solution (30 mg/kg), seizure level and symptoms for 2 hours was recorded. Seizure level judgment was applied according to the criteria in Table 2 below, and body weights were compared before and 24 hours after cainic acid injection.
  • mice that survived 24 hours after injection of cainic acid were excised or the brains were excised after tissue fixation by PFA perfusion.
  • seizure level level representative symptoms I squatting in a corner, stationary, or staring II Stretched body, tail straight and stiff, ears lying back, eyes protruding and red III Repetitive head tilting, sitting with front paws on stomach IV Running and jumping with intermittent convulsions, staying still and sitting and lying down with tonic-clonic seizures V Level V persistent seizures VI Intermittent convulsions of the body, not maintaining balance with the feet for long periods of time, usually death
  • RIPA buffer including proteinase/phosphatase inhibitor
  • tissue mass 100 ⁇ l of RIPA buffer (including proteinase/phosphatase inhibitor) per 10 mg of tissue mass was added to the hippocampus, and then ground using glass beads and a bullet blender for 1 minute. The supernatant was centrifuged at 12,000 ⁇ g, 4° C. for 15 minutes, and the supernatant was diluted 10-fold in PBS and used for ROS/RNS measurement. The ROS/RNS concentration was measured using the OxiSelect ROS/RNS assay kit (Cell Biolabs) according to the recommended experimental method.
  • hippocampal lysate 2 ⁇ l of hippocampal lysate was added to a 96-well plate, and 50 ⁇ l was adjusted by additionally adding 50 mM imidazole-HCl buffer (pH 6.8).
  • GS activity assay buffer 50 mM imidazole-HCl, pH6.8, 25 mM L-glutamine, 12.5 mM hydroxylamine, 12.5 mM sodium arsenate, 1 mM MnCl 2 and 0.08 mM ADP 50 ⁇ l was added and reacted at 37° C. for 30 to 60 minutes.
  • ⁇ -glutamylhydroxamate a standard material
  • 100 ⁇ l of a reaction stop solution 90 mM FeCl 3 , 1.8N HCl and 1.45% (w/v) trichloroacetic acid
  • absorbance was measured at a wavelength of 560 nm.
  • GS activity of each sample was obtained by comparison with the standard curve. GS activity is expressed as the amount of ⁇ -glutamylhydroxamate, which is the final product, and the unit is ⁇ M/min/ ⁇ g protein.
  • GS activity was decreased by kyinic acid, but increased over the control level in mice fed tyrosine.
  • PBS and PFA were perfused through the heart, and the brain was removed and fixed in PFA for more than 15 hours. After washing 3 times for 10 minutes with PBS, brain tissue sections were obtained with a thickness of 40 ⁇ m using a vibratome.
  • the primary antibody was (anti-NeuN (Millipore, MAB377, 1:500), anti-Iba1 (Wako, 019-19741, 1:200)) for more than 15 hours (IHC buffer containing 3% BSA).
  • Example 8 Cognitive impairment prevention effect of D-tyrosine in mouse chronic body detention stress model
  • mice 28 C57BL/6 male mice (7 weeks old) were divided into two groups and given a normal diet (AIN-93G) or a diet containing D-tyrosine (D-Tyr) (181 mg D-Tyr/kg AIN-93G) for 1 week. did Water and feed were allowed to be freely consumed, and body weight and food intake were measured twice a week.
  • AIN-93G normal diet
  • D-Tyr D-tyrosine
  • Chronic immobilization stress was applied under 200 lux lighting conditions for 2 hours a day from 8 weeks of age for 2 weeks.
  • Control group CTL
  • D-Tyr feeding control group CTL+D-Tyr
  • chronic stress group STR
  • D-Tyr feeding group chronic stress group STR+D-Tyr
  • Object recognition test ORT
  • object location testing long-term memory ability to compare the cognitive functions of the group fed with D-Tyr and the group fed with regular feed during the entire test period, including the adaptation period
  • OHT object location recognition test
  • ORT It consisted of three stages: habituation, affinity, and test. They were acclimatized to the test box for 10 minutes a day for two days, and on the third day, in the affinity phase, two identical objects were explored for 10 minutes. When placing the mouse in the test box, it was placed facing the wall where there were no objects. In the test phase on the 4th day, one of the two objects was replaced with a new object and the object was searched for 10 minutes, but the records for the first 5 minutes were used as data.
  • Object cognitive function index (DI) was calculated by the following formula (3).
  • DI (Description Index) [New object discovery time-Familiar object search time]/[New object search time + Familiar object search time]
  • OLT After 24 hours of ORT, the location of familiar objects was changed and they were asked to search for 5 minutes. In the same way as the object recognition function index (DI), the ratio of the time to search for an object whose location has been moved among the total object search time was calculated to calculate an object location recognition function index.
  • DI object recognition function index
  • mice 8-week-old C57BL/6 male mice were provided with a normal diet or a diet containing L-tyrosine for 1 week or more, and water and feed were allowed to be freely ingested.
  • L-Tyr AIN-93G with 905mg/kg L-Tyr
  • Endothelin-1 (Endothelin-1) was put in tertiary distilled water (2 ⁇ g/ ⁇ l), vortexed vigorously, and completely dissolved using ultrasound at 4° C. for about 10 minutes.
  • Endothelin-1 was injected into the motor cortex of the brain (focusing on bregma) through stereotaxic surgery. AP 1.5mm, ML -1.5mm, DV 1.8mm). It was injected at a rate of 0.3 ⁇ l per minute, and the needle was left for about 5 minutes after injection was completed so that endothelin-1 could be sufficiently absorbed into the tissue. The skin was restored to its original cage after suturing.
  • PBS and PFA were perfused through the heart, and the brain was removed and fixed in PFA for more than 15 hours. Washed 3 times for 10 minutes with PBS, cut a brain tissue section to a thickness of 40 ⁇ m with a vibratome, and 4 sections were fixed on a silane-coated glass slide at the injection point of endothelin-1. The dried sections were immersed in 0.1% crecyl violet solution for 5 minutes and then immersed in tertiary distilled water twice to wash the staining solution. After dehydration by immersion in 100% ethanol for 2-3 seconds, it was washed twice for 5 seconds in xylene. After the mount solution was applied, it was covered with a cover glass and dried. The stained section sample was observed with an optical microscope, and the area of the cerebral infarct area was calculated using the Image J program for the stored images.
  • ⁇ -glutamylhydroxamate (0.391-25.0 mM), a standard material, was added to the empty wells.
  • 100 ⁇ l of reaction stop solution (90 mM FeCl 3 , 1.8N HCl and 1.45% trichloroacetic acid) was added to the sample and standard material, and absorbance was measured at a wavelength of 560 nm.
  • GS activity was determined. It is expressed as the amount of ⁇ -glutamylhydroxamate, the final product of GS activity, and the unit is ⁇ M/min/ ⁇ g protein.
  • the infarct volume in the experimental group administered with endothelin increased significantly compared to the control group administered with saline, and tyrosine It was confirmed that the infarct volume decreased in the experimental group fed at a dose of 900 mg/kg (feed weight).
  • the GS activity of the tissue was decreased by endothelin-1 compared to the control group, it could be confirmed that the GS activity was maintained by the tyr diet ( FIG. 18 ).
  • SOD activity was measured using Thermofisher's SOD colorimetric activity kit. Human recombinant MnSOD within the range of standard SOD, peptide and peroxynitrite were mixed and reacted on ice for 10 minutes. 10 ⁇ l of the standard SOD or reaction mixture and 50 ⁇ l of the substrate solution provided in the kit were placed in a 96-well plate, and absorbance was measured at 450 nm. After putting 25 ⁇ l of xanthine oxidase provided in the kit and reacting at room temperature for 20 minutes, absorbance was measured at 450 nm. SOD activity was measured using the data obtained by subtracting the first measured absorbance from the second measured absorbance.
  • L-tyrosine (100 mg/kg) was suspended in 0.5% CMC (carboxymethyl cellulose). L-tyrosine or CMC preparation was orally administered once a day for 4 days, and renal ischemia was induced 30 minutes after oral administration on the 4th day. Renal ischemia was induced by incision of the abdomen and bilateral renal pedicles with forceps using Muller atraumatic vascular clamp. After ischemia for 25 minutes, the clamp was removed and reperfusion was performed. In the control group (Sham), all surgical procedures were performed identically except for induction of ischemia through forceps. At 24 hours after reperfusion, the animals were sacrificed, blood was collected from the heart, and tissues were extracted.
  • CMC carboxymethyl cellulose
  • the collected blood was centrifuged at 3,000 rpm for 15 minutes to separate plasma, and blood creatinine was measured using the Jaffe method.
  • the amount of creatinine was calculated as the difference between the absorbance measured by reacting a plasma sample with picric acid at a wavelength of 510 nm and the absorbance measured after the reaction was terminated with 60% acetic acid, and expressed in mg/dL.
  • the kidney tissue was homogenized in RIPA buffer and centrifuged at 16,000 ⁇ g, 4°C for 15 minutes, and then the supernatant was collected and protein was quantified by the BCA method. After electrophoresis by SDS-PAGE, it was transferred to a PVDF membrane and blocked with 5% nonfat dry milk. Thereafter, nitro-tyrosine and ⁇ -actin primary antibodies and corresponding secondary antibodies were reacted and analyzed in ChemiDoc XRS + system (Bio-Rad) by ECL method.
  • Oxidative stress caused by reactive oxygen species (ROS) or reactive nitrogen species (RNS) is a major mechanism of acute renal failure caused by renal ischemia and reperfusion injury.
  • ROS reactive oxygen species
  • RNS reactive nitrogen species
  • mice Male 13-week C57BL/6 mice (Coatec) were allowed to freely ingest water and feed in a sterile breeding room with constant temperature and humidity, (1) Control, (2) Carboxymethyl cellulose+azoxymethane treatment group ( CMC+AOM) and (3) L-tyrosine+AOM treatment group (L-Tyr+AOM) were divided into three experimental groups.
  • L-tyrosine or CMC preparation was orally administered once a day for 4 days, and AOM (100mg/kg, 100ml) was intraperitoneally injected 2 hours after oral administration on the 4th day.
  • AOM 100mg/kg, 100ml
  • 200 ml of physiological saline containing 0.5% glucose was intraperitoneally injected, and 4 hours later, the animals were sacrificed, blood was collected from the heart, and liver tissue was extracted.
  • the amount of ammonia in the blood was measured using PocketChem BA PA-4140 (Arkray, Japan), a measuring instrument for single-wavelength reflectometry. Put 20 ⁇ l of blood on the test paper, react it at room temperature for 3 minutes, insert it into the measuring device, measure the absorbance at 635 nm (LED) wavelength, and the results are expressed in ⁇ g/dl units.
  • ALT alanine aminotransferase
  • a blood indicator of hepatocellular injury was measured by centrifuging the collected blood at 3,000 rpm for 15 minutes to separate plasma and using ChemiLab GPT assay kit (IVD-LAB, Korea). Absorbance was measured at 340 nm wavelength of a spectrophotometer according to Kit's standard measurement method, and the results were expressed in U/L units.
  • the liver tissue was homogenized in RIPA buffer and centrifuged at 16,000 ⁇ g, 4°C for 15 minutes, and then the supernatant was collected and the amount of protein was quantified by the BCA method. After electrophoresis by SDS-PAGE, it was transferred to a PVDF membrane and blocked with 5% nonfat dry milk. Thereafter, nitro-tyrosine and ⁇ -actin primary antibodies and corresponding secondary antibodies were reacted and analyzed in ChemiDoc XRS + system (Bio-Rad) by ECL method.
  • Ammonia is a major metabolite of amino acids and nucleic acids, and the major enzymes of the urea cycle that convert ammonia to urea exist only in liver cells, and GS and SOD that lowers ammonia concentration and catalase that removes free radicals are also abundant in liver tissue. Because of its presence, the change in the concentration of ammonia in the blood vessels that pass through the liver to the brain is an important indicator for hepatic encephalopathy.
  • the CMC+AOM treatment group increased the blood ammonia concentration 6.7 times compared to the normal control group, and L-tyrosine administration statistically significantly inhibited the increase in blood ammonia caused by AOM.
  • damage to liver parenchyma causes blood release of ALT in the cytoplasm and increases its concentration, measuring the activity of this enzyme is a direct indicator of the extent of liver damage.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Urology & Nephrology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Confectionery (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Non-Alcoholic Beverages (AREA)
  • Medicinal Preparation (AREA)

Abstract

본 발명은 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다. 본 발명의 유효성분인 티로신이 저하된 GS 활성을 증진시킬 뿐만 아니라, 뇌에서의 글루타민, 글루탐산의 함량(비율) 및 암모니아의 양을 정상적인 상태로 회복시키는 효과가 있으며, 제2형 당뇨 모델에서 인슐린 민감도 증진, 간질발작 모델에서 흥분독성과 산화스트레스 억제 효과, 뇌졸중 모델에서 뇌경색 저감 및 GS 활성 증진 효과, 인간 재조합 MnSOD를 이용한 티로신의 니트로화 제거 효과 급성 신부전에서의 효과 및 고암모니아 혈증에 대한 효과가 있으므로, 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물 또는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 치료용 약학 조성물로서 유용하게 사용될 수 있다.

Description

티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물
본 발명은 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.
생체 내에서 ·NO 또는 ·NO 유도 대사물이 존재하는 상태에서 반응성 산소종의 과잉 수준은 과산화질소와 같은 질산성 종의 형성을 이끈다. 따라서 단백질에 포함된 아미노산 중 티로신의 니트레이션이 발생하게 되면 단백질의 구조 및 기능적 변화를 초래할 수 있다. 따라서 티로신의 니트레이션은 다양한 질병을 초래하는 원인이 될 수 있다.
일례로, 글루타민 합성 효소(glutamine synthetase, GS)는 생체에서 글루탐산과 암모니아를 이용하여 글루타민을 합성하는 효소로, 신체의 여러 기관에서 생성되며 기관 및 전 신체의 질소 균형에서 역할을 수행하고 있다. 만성 스트레스 등의 이유로 글루타민 합성 효소가 활성질소에 노출되면 티로신이 니트레이션 되며, 글루타민 합성 효소의 활성도를 저하시켜 다양한 질환을 일으킬 수 있다.
최근, 골격근에서의 글루타민 합성 효소의 과발현에 기초한 유전자 요법이 급성 고암모니아혈증의 치료를 위하여 제안되었으며, 이 치료요법의 근거는 일반적으로 간 질환 환자의 근육에서 결핍되는 글루타민 합성 효소를 대체하거나 증강시켜 근육에서 글루타민 합성 효소에 의한 암모니아의 제거를 증가시키는 것을 목표로 하는 것이다.
한편, 한국공개특허 제2020-0018488호에 고암모니아혈증을 치료하기 위한 글루타민 합성효소의 용도에 대하여 개시되어 있고, 한국공개특허 제2020-0038481호에 스트레스 관련 장애를 치료하기 위한 조성물이 개시되어 있으나, 본 발명의 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물에 대해 개시된 바 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명은 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물을 제공하고, 본 발명의 유효성분인 티로신이 스트레스에 의해 생성된 글루타민 합성 효소 내 N-tyr 함량을 감소시킬 뿐만 아니라, 활성이 저하된 글루타민 합성 효소의 활성을 증진시키며, 뇌에서의 글루타민, 글루탐산의 함량 및 암모니아 양을 정상적인 상태로 회복시키는 효과가 있다는 것을 확인하였고, 제2형 당뇨 모델에서 인슐린 민감도 증진, 간질발작 모델에서 흥분독성과 산화스트레스 억제 효과, 뇌졸중 모델에서 뇌경색 저감 및 GS 활성 증진 효과, 인간 재조합 MnSOD를 이용한 티로신의 니트로화 제거 효과 급성 신부전에서의 효과 및 고암모니아혈증에 대한 효과를 확인함으로써, 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명은 티로신 또는 식품학적으로 허용가능한 이의 염을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
또한, 본 발명은 티로신 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 니트로화(nitration) 티로신을 포함하는 단백질에 티로신을 처리하여 니트로화 티로신으로부터 니트로기를 제거하는 방법을 제공한다.
본 발명은 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다. 스트레스에 의해 글루타민 합성 효소의 발현량은 변화가 없으나, GS 내의 N-tyr의 함량은 통계적으로 유의미하게 증가하였으며, 그로 인해 GS의 활성이 저하됨을 확인하였고, 세포 기반 실험에서 유리 티로신이 저하된 GS 활성을 증진시킬 뿐만 아니라, 뇌에서의 글루타민, 글루탐산의 함량(비율) 및 암모니아 양을 정상적인 상태로 회복시키는 효과가 있고, 제2형 당뇨 모델에서 인슐린 민감도 증진, 간질발작 모델에서 흥분독성과 산화스트레스 억제 효과, 뇌졸중 모델에서 뇌경색 저감 및 GS 활성 증진 효과, 인간 재조합 MnSOD를 이용한 티로신의 니트로화 제거 효과 급성 신부전에서의 효과 및 고암모니아혈증에 대한 효과가 있다.
도 1은 만성 부동자세 스트레스(CIS)에 따른 효과를 확인한 것으로, (A)는 실험 기간 중의 체중 및 음식 섭취량 변화를 확인한 결과이고, (B)는 혈장 내 코르티코스테론의 함량 변화와 혈장 및 PFC(전전두엽)에서의 ROS/RNS 함량 변화를 확인한 것이며, (C)는 GS 함량은 변화가 없으나, 스트레스군의 N-Tyr 함량은 통계적으로 유의미하게 증가하였으며, GS 활성은 통계적으로 유의미하게 감소하였다는 결과이고, (D)는 PFC 조직 파쇄물에 과산화질소 및 티로신을 처리한 후, in vitro GS 활성을 확인한 결과이다. *, **, ***는 CTL에 대비하여 통계적으로 유의미한 차이가 있다는 것으로, *는 p<0.05이고, **는 p<0.01이며, ***는 p<0.001이다. #는 티로신을 처리하지 않은 군 대비 티로신을 처리한 군의 GS 활성이 통계적으로 유의미하게 증가했다는 것으로 p<0.05이다.
도 2는 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 체중 및 사료 섭취량을 확인한 결과이다. (A)는 일반 식이군(ND)과 티로신-식이군(TD)의 스케줄이고, (B)는 체중변화를 확인한 결과이며, (C)는 사료 섭취량을 확인한 결과이다.
도 3은 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 우울행동을 확인한 것으로, (A)는 열린 공간 시험(Open field test) 결과이고, (B)는 꼬리 현수 시험(tail suspension test) 및 (C)는 자당 선호도 시험(sucrose preference test) 결과이다.
도 4는 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 혈장에서 코르티코스테론(corticosterone)의 함량(A) 및 혈장 및 PFC에서의 ROS/RNS에 변화량을 DCF(dichlorofluorescin)를 통해 TD에 의해 스트레스 호르몬과 산화적 스트레스가 감소된 것을 확인한 결과이다(B, C).
도 5는 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 PFC에서, GS의 활성(A), GS의 발현량(B) 및 GS에 포함된 티로신의 nitration 레벨(C)을 확인한 결과이다.
도 6은 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의, PFC에서 글루탐산염, 글루타민, 티로신 및 GABA 함량을 확인한 결과이다.
도 7은 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 PFC에서 암모니아 함량을 확인한 결과이다.
도 8은 마우스 PFC 단백질에 ONOO-를 처리하여 단백질의 니트로화를 유도하고, 티로신에 의한 니트로화 억제 효과를 확인한 결과이다.
도 9는 본 발명에 따른 펩타이드의 니트로화 억제 효과를 확인한 것으로, A는 PFC(전전두엽) 조직 내 니트로티로신 단백질에 대한 웨스턴 블랏 결과이고, B는 간 조직 내 니트로티로신 단백질에 대한 웨스턴 블랏 결과이며, C는 PFC(전전두엽) 조직 내 글루타민 합성효소 단백질에 대한 웨스턴 블랏 결과이고, D는 간 조직 내 글루타민 합성효소, 인슐린 수용체 베타 및 인산화 인슐린 수용체 베타 단백질에 대한 웨스턴 블랏 결과이다.
도 10은 고지방식이에 의한 제2형 당뇨 모델 마우스에서 L-티로신의 섭식에 따른 체중변화(A), 혈당(B) 및 사료 섭식량(C)을 기간별로 확인한 결과이다. ***은 일반식이군(ND) 대비 고지방식이군(HFD)의 혈중 글루코스 함량이 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, #, ##은 고지방식이군(HFD) 대비 L-티로신 함유 식이군(HFD+L-Tyr)의 혈중 글루코스 함량이 통계적으로 유의미하게 감소하였다는 것으로, #은 p<0.05이고, ##은 p<0.01이다.
도 11은 고지방식이에 의한 제2형 당뇨 모델 마우스에서, L-티로신 식이한 마우스의 포도당 내당능을 확인한 결과이다. (A)는 시간 경과에 따른 혈액 내 글루코스 함량을 나타낸 것이고, (B)는 (A)에서 곡선아래면적(AUC)를 나타낸 것이다. **, ***은 일반식이군(ND) 대비 고지방식이군(HFD)의 혈중 글루코스 함량이 통계적으로 유의미하게 증가하였다는 것으로, **은 p<0.01이고, ***은 p<0.001이며, #은 고지방식이군(HFD) 대비 L-티로신 함유 식이군(HFD+L-Tyr)의 혈중 글루코스 함량이 통계적으로 유의미하게 감소하였다는 것으로, p<0.05이다.
도 12는 고지방식이에 의한 제2형 당뇨 모델 마우스에서, L-티로신 식이한 마우스의 인슐린 저항성을 확인한 결과이다. (A)는 시간 경과에 따른 혈액 내 글루코스 함량을 나타낸 것이고, (B)는 (A)에서 곡선아래면적(AUC)를 나타낸 것이다. *, **, ***은 일반식이군(ND) 대비 고지방식이군(HFD)의 혈중 글루코스 함량이 통계적으로 유의미하게 증가하였다는 것으로, *은 p<0.05이며, **은 p<0.01이고, ***은 p<0.001이다. #은 고지방식이군(HFD) 대비 L-티로신 함유 식이군(HFD+L-Tyr)의 혈중 글루코스 함량이 통계적으로 유의미하게 감소하였다는 것으로, p<0.05이다.
도 13은 조직내 지방 축적 변화(A) 및 혈장 내 ROS/RNS 함량 변화(B)를 확인한 결과이다. ***은 ND 대비 HFD 또는 HFD+Tyr의 조직 무게 및 혈장 내 ROS/RNS 함량이 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, #, ##은 HFD 대비 HFD+Tyr의 조직 무게 및 혈장 내 ROS/RNS 함량이 통계적으로 유의미하게 감소하였다는 것으로, #은 p<0.05이고, ##은 p<0.01이다.
도 14는 티로신 식이에 따른 발작 정도의 변화(A), 체중 변화(C) 및 생존율(D)를 확인한 결과이며, (B)는 (A)에서 곡선아래면적(AUC)를 나타낸 것이다. **, ***은 ND 대비 5x L-Tyr의 발작 수준이 통계적으로 유의하게 감소하였다는 것으로, **은 p<0.01이고, ***은 p<0.001이다. #은 CTL의 발작 전 대비 발작후의 체중이 증가했다는 것으로 p<0.05이다.
도 15는 카이닌산을 주사하여 생존한 마우스의 해마 조직에서 ROS/RNS 양적 변화(A) 및 GS 활성도를 분석한 결과이다. (A)에서 **, ***는 CTL 대비 ROS/RNS의 함량이 증가하였다는 것으로, **은 p<0.01이고, ***은 p<0.001이다. ##, ###은 KA 주사하고 일반식이한 ND군 대비 티로신 식이군의 ROS/RNS의 함량이 통계적으로 유의미하게 감소하였다는 것으로, ##은 p<0.01이고, ###은 p<0.001이다. (B)에서 *은 KA 주사하고 일반식이한 ND군 대비 티로신 식이군의 GS 활성이 통계적으로 유의미하게 증가하였다는 것으로, p<0.05이다.
도 16은 키아닌산에 의해 해마 영역(CA1(A), CA3(B))의 신경세포 수 및 동일한 부위의 미세아교세포(microglia) 활성도를 분석한 조직면역화학염색 결과이다. *은 CTL 대비 신경세포수가 감소하였거나 염증을 유도하는 미세아교세포의 활성이 증가하였다는 것으로 p<0.05이고, #은 티로신 식이군에서 유의미하게 미세아교세포 활성이 감소하였다는 것으로 p<0.05이다.
도 17은 만성 신체구금 스트레스 모델 마우스에서 D-티로신의 인지장애 예방 효과를 확인한 결과이다.
도 18은 엔도텔린-1(Endothelin-1)을 이용한 뇌졸중(stroke) 모델 마우스에서 L-티로신의 뇌경색(brain infarct) 저감 및 GS 활성 증진 효과를 확인한 결과이다.
도 19는 인간 재조합 MnSOD를 이용한 티로신의 denitration 효과를 확인한 결과이다. ***은 과산화질소(2.1mM PN)군 대비 티로신 투여군(L-Tyr, D-Tyr)의 Mn SOD 활성이 증가하였다는 것으로, p<0.001이다.
도 20은 급성 신부전에 대한 티로신의 효과를 확인한 결과로, (A) 항산화 작용인자인 NQO-1의 유전자 발현량, (B) CuZnSOD 활성, (C) MnSOD 활성, (D) ROS/RNS 함량 및 (E) 신장 허혈 및 재관류 24시간 후 신장조직에서 nitrotyrosine 단백질 발현량을 나타낸 것이다.
도 21은 신장손상 평가지표로서 혈장 크레아티닌을 측정한 결과이다. *, **은 Sham군 대비 통계적으로 유의미하게 크레아틴(creatine)(A), IL-1β(B) 및 IL-6(C)의 발현량이 증가하였다는 것으로, *은 p<0.05이고, **은 p<0.01이다. #, ##은 CMC+IR 군 대비 크레아틴(creatine), IL-1β 및 IL-6의 발현량이 감소하였다는 것으로, #은 p<0.05이고, ##은 p<0.01이다.
도 22는 간성뇌증(고암모니아혈증)에 대한 티로신의 효과를 확인한 결과이다. (A) 혈중 암모니아 함량, (B) 혈장내 ALT 및 (C) 니트로화된 단백질 함량을 확인한 웨스턴 블랏이다.
본 발명은 티로신 또는 식품학적으로 허용가능한 이의 염을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물에 관한 것이다.
상기 단백질 내 티로신의 니트로화는 티로신 수산화효소(tyrosine hydroxylase), 망간 슈퍼옥시드 디스무타아제(Mn Superoxide dismutase), Cu/Zn 슈퍼옥시드 디스무타아제(Mn Superoxide dismutase), 인슐린 수용체 베타 서브유닛(insulin receptor β subunit), 아넥신 IV(annexin IV), 글루탐산 탈수소효소(glutamate dehydrogenase), 3-α-OH 스테로이드 탈수소효소(3-α-OH steroid dehydrogenase), 글루타티온 S-전달효소(glutathione S-transferase), 3-케토아실 CoA 티올레이즈(3-ketoacyl CoA thiolase), 카탈라아제(catalase), Tau 단백질, 미토콘드리아 복합체 1(mitochondria complex 1), 알파-시누클레인(α-synuclein), 아포지단백-A1(apolipoprotein-A1), 아밀로이드-β(amyloid-β) 및 NMDA 수용체(NMDA receptor) 중에서 선택된 어느 하나의 단백질 내 티로신의 니트로화인 것이 바람직하지만 이에 한정하는 것은 아니다.
상기 단백질 내 티로신의 니트로화(nitration)에 의한 질환은 우울증(depressive disorder), 불안장애(anxiety disorder), 뇌졸중(stroke), 뇌전증(epilepsy), 녹내장(glaucoma), 당뇨병(diabets), 당뇨망막병증(diabetic retinopathy), 발작(seizure), 간성뇌증(hepaticencephalopathy), 인지기능장애(cognitive impairment), 뇌발달장애(brain development impairment), 암(cancer), 알츠하이머병(Alzheimer disease), 급성 신장 손상(Acute kidney injury) 및 고암모니아혈증(Hyperammonemia) 중에서 선택된 어느 하나인 것이 바람직하지만 이에 한정하지 않는다.
상기 단백질 내 티로신의 니트로화(nitration)는 뇌, 간, 근육, 지방조직, 신장조직, 췌장 또는 폐에서 발생할 수 있으며, 이에 한정하는 것은 아니다.
본 발명의 유효성분인 티로신을 투여하는 양은 하기 표 1에 개시한 양으로 투여하는 것이 바람직하지만, 이에 제한하는 것은 아니다.
질환별 투여량 및 식이기간
질환명 티로신 투여량(마우스 기준) 식이기간
사료 섭취량
우울증, 인지기능 180~1,000mg/식이kg 14~140mg/kg/day 4주
뇌전증 180-1,000mg/식이kg 14~140mg/kg/day 1주
뇌졸중 800~1000mg/식이kg 80~140mg/kg/day 1주
당뇨 180 mg/식이kg 14~28 mg/kg/day 15주
급성신장손상 100 mg/몸무게kg 100mg/kg 4일
간성뇌증(고암모니아혈증) 100 mg/몸무게kg 100mg/kg 4일
상기 건강기능식품 조성물은 환, 정제(tablet), 캡슐(capsule), 산제, 분말, 과립, 캔디, 시럽 및 음료 중에서 선택된 어느 하나로 제조하거나, 식품의 성분으로 첨가하여 제조될 수 있으며, 통상적인 방법에 따라 적절하게 제조될 수 있다.
본 발명의 유효성분을 첨가할 수 있는 식품의 일례로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 중에서 선택된 어느 하나의 형태일 수 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
상기 건강기능식품은 여러 가지 영양제, 비타민, 광물(전해질), 합성 및 천연 풍미제, 착색제 및 증진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 천연 과일 주스 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다.
본 발명의 건강기능식품 조성물은 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상기 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다.
또한, 본 발명은 티로신 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 치료용 약학 조성물에 관한 것이다.
상기 티로신 이외에 추가로 약제학적으로 허용가능한 담체, 부형제 또는 희석제를 더 포함할 수 있다. 본 발명의 약학 조성물은 경구 또는 비경구로 투여될 수 있으며, 비경구 투여 시 피부 외용 또는 복강 내, 직장, 정맥, 근육 또는 피하주사 방식을 선택하는 것이 바람직하지만 이에 한정하는 것은 아니다.
본 발명의 약학 조성물은 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성 용제 및 현탁 용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
본 발명에 따른 조성물은 약제학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약제학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도에 따라 그 범위가 다양하게 사용할 수 있다.
또한, 본 발명은 니트로화(nitration) 티로신을 포함하는 단백질에 티로신을 처리하여 니트로화 티로신으로부터 니트로기를 제거하는 방법에 관한 것이다.
이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다.
1. 동물 모델
본 발명에서는 7주령 C57BL/6 수컷 마우스 28마리(한국 코아텍)를 표준 조건(온도 22~24℃, 습도 50~70% 오전 6시에 점등되는 12시간 명암주기)으로 사육하였으며,이때 식이요법과 물을 자유롭게 섭취할 수 있도록 하였다. 본 발명에서 사용한 동물은 국립보건원(NIH, Bechesda, MD, USA) 지침에 따르는 경상대학교 동물보호 및 사용 위원회(GNU IACUC)로부터 승인 받은 프로토콜(GNU-161128-M0068)에 따라 실시하였다.
2. 혈장 및 전전두엽(prefrontal cortex; PFC) 시료 준비
뇌의 혈액과 PFC 시료는 각각 CO2 가스로 마취된 마우스로부터 샘플링하였다. 마우스 혈액은 오전 9시에서 11시 사이에 채취하여 K3EDTA로 코팅된 진공용기에 수집하였다. 혈장은 4℃에서 500×g로 10분 동안 원심분리하여 획득하였고, PFC 시료는 무게를 잰 후, Bullet 조직파쇄기를 이용하여 조직을 파쇄하고, 4℃에서 12,000rpm으로 20분 동안 원심분리하였다. 상기 획득한 혈장과 조직 파쇄물(lysate)는 사용하기 전까지 -80℃에서 보관하였다.
3. 코르티코스테론(corticosterone) 및 ROS/RNS(reactive oxygen species/reactive nitrogen species) 확인
10㎍의 파쇄물을 GS 어세이 완충용액(50mM의 이미다졸-HCl, pH 6.8, 50mM L-글루타민, 25mM의 히드록실아민, 25mM의 비산나트륨(sodium arsenate), 2mM의 MnCl2 및 0.16mM의 ADP) 50㎖에 혼합하여 37℃에서 1시간 동안 인큐베이션하였다.
혼합 후, 정지 완충용액(90mM의 FeCl3, 1.8N의 HCl 및 1.45% trichloroacetic acid) 50㎕를 첨가하여 반응을 정지시키고, GS에 의한 글루타민(glutamine) 및 히드록실아민(hydroxylamine) 반응으로부터 합성된 γ-글루타밀히드록사메이트(γ-glutamylhydroxamate)를 마이크로플레이트 리더를 이용하여 560nm에서 측정하였다.
웨스턴블랏 및 면역침강(IP)-WB을 이용하여 GS 및 Tyr-nitriation GS의 레벨을 각각 측정하였고, Tyr-nitriation GS의 면역침강 분석은 항-3-니트로티로신 항체(ab61392, Abcam, Cambridge, UK) 및 단백질A/G 플러스 아가로스(Santa Cruz, Dallas, TX, USA)를 이용하여 제조사의 프로토콜에 따라 실시하였고, GS의 웨스턴블랏은 항-GS(1:5000, Abcam)를 이용하여 실시하였다.
실시예 1. 만성 부동자세 스트레스(Chronic immobilization stress; CIS)에 따른 행동 분석, 글루타민 합성 효소(GS) 활성 변화 및 GS 내의 nitration-티로신의 함량 확인
동물모델은 두 그룹(정상군, 스트레스군)으로 나누어, 스트레스군은 매일 2시간(오후 2~4시)동안 개별적으로 구속기에 강제동원하여 만성적 부동자세 스트레스를 15일 동안 주었으며, 격일로 체중변화와 사료 섭취량을 측정하였다.
이후, 동물을 희생시켜 혈장 내 코르티코스테론(corticosterone) 함량 변화를 확인하였고, 혈장 및 PFC에서의 ROS/RNS를 확인하였다. 코르티코스테론의 함량은 ELISA 키트(Cayman)를 이용하여 제조사의 방법에 따라 실시하였고, ROS/RNS는 ROS/RNS 어세이 키트(Cell Biolabs, San Diego, CA, USA)를 이용하여 제조사의 방법에 따라 실시하였다.
그 결과 도 1에 개시한 바와 같이, 스트레스를 가하지 않은 대조군(CTL)에 비해 만성 스트레스를 가한 스트레스군(STR)의 체중은 7일에서 15일 사이 감소하는 경향을 보였으나, 사료 섭취량은 차이가 거의 없는 것으로 나타났고, 코르티코스테론 함량과 ROS/RNS도 통계적으로 유의미하게 증가하였다.
한편, 대조군 대비 스트레스군의 글루타민 합성효소(GS)의 발현량은 감소하지 않았으며, GS 내의 티로신이 nitration된 레벨이 통계적으로 유의미하게 증가하였을 뿐만 아니라, GS 활성이 통계적으로 유의미하게 감소한 것을 확인하였다.
또한, 10㎍의 PFC(prefrontal cortex) 조직 파쇄물에 0.0031~0.45mg/㎖의 티로신을 첨가하여 혼합하고 10분 동안 얼음에서 인큐베이션하고, 과산화질소(PN)를 상기 조직 파쇄물의 10배의 부피가 되도록 혼합한 후 10분동안 인큐베이션한 후 in vitro GS 활성을 확인한 결과, 티로신 농도의 증가에 따라 GS 활성도 증가하는 것을 확인하였다.
실시예 2. 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 체중 및 사료 섭취량 변화 확인
동물모델은 두 그룹(정상군, 스트레스군)으로 나누어, 스트레스군은 매일 2시간(오후 2~4시)동안 개별적으로 구속기에 강제동원하여 만성적 부동자세 스트레스를 15일 동안 주었으며, 격일로 체중변화와 사료 섭취량을 측정하였다.
상기 정상군 및 스트레스군은 영양 균형이 맞는 일반식이군과 본 발명의 티로신(tyrosin)이 보충(181.2mg/kg)된 식이군으로 다시 분류하여 급여하였다.
그 결과 도 2에 개시한 바와 같이, 티로신-식이 여부에 따른 체중의 변화 또는 사료섭취량의 차이는 없는 것으로 확인되었다.
이후, OFT(open field test), TST(tail suspension test) 및 SPT(sucrose preference test)를 포함하는 행동분석을 실시하였다.
OFT(열린 공간 시험)는 사각형 상자(60×60×20cm)에서 수행하였으며, 마우스를 상자의 중앙 영역(30×30cm)에 배치하고 그 동작을 5분 동안 추적하여 총 이동거리, 중앙지역에서의 지속시간, 중앙지역으로 진입시도 빈도수를 측정하였다.
TST(꼬리 현수 시험법)는 마우스를 수평막대가 있는 상자에서 개별적으로 매달고, 움직이지 않는 지속시간을 측정하기 위하여 6분 동안 움직임을 추적하였다.
SPT(자당 선호도 시험)는 48시간 동안 0.1M의 자당(sucrose) 및 물을 제공하여 습관을 들인 후, 24시간 동안 0.1M의 자당(sucrose) 및 물을 제공하지 않고, 이후, 6시간 동안 0.1M의 자당(sucrose) 및 물을 제공하고, 3시간동안 0.1M의 자당(sucrose) 및 물의 위치를 변경하였다.
이후, 자당 및 물의 소비량을 측정하고, 자당 선호들 총 소비량 대비 제공한 자당의 비율로 계산하였다.
그 결과 도 3에 개시한 바와 같이, 열린 공간 시험에서, 정상군(CTL) 대비 스트레스군(STR)군이 중앙지역에 머무르는 시간, 움직이는 거리, 중심으로 이동하는 횟수가 감소하였으나, 스트레스군 중에서 일반식이(ND)군에 비해 티로신-식이군(TD)의 중앙지역에 머무르는 시간, 움직이는 거리, 중심으로 이동하는 횟수가 증가한 것을 확인하였다.
또한, 꼬리 현수 시험(TST)에서 스트레스군의 일반식이군(ND)은 움직이지 않는 시간이 정상군(CTL)에 비해 통계적으로 유의미하게 증가하였으며(p<0.05), 이에 대비하여 티로신-식이군은 움직이지 않는 시간이 통계적으로 유의미하게 감소하였다(p<0.05).
또한, 자당 선호도 시험에서도, 스트레스군의 자당 선호도가 정상군에 비해 통계적으로 유의미하게 감소하였으나(p<0.001), 스트레스군의 일반식이군 대비 본 발명의 티로신 식이군의 자당 선호도는 통계적으로 유의미하게 증가하였다(p<0.01).
이후 동물을 희생시켜 확인한 혈장에서 코르티코스테론 함량을 확인한 결과, 도 4에 개시한 바와 같이, 스트레스에 의해 코르티코스테론 함량이 증가되었으나, 스트레스군의 일반식이군 대비 티로신 식이군에서는 코르티코스테론의 함량이 통계적으로 유의미하게 감소한 것을 확인하였고(#, p<0.05), 혈장과 PFC 조직에서 ROS/RNS을 확인한 결과, 스트레스군의 일반식이군 대비 티로신 식이군에서는 ROS/RNS가 통계적으로 유의미하게 감소한 것을 확인하였다(**: p<0.01, *: p<0.05).
한편, 대조군 대비 스트레스군의 일반식이(ND) 및 티로신 식이(TD) 둘다 글루타민 합성효소(GS)의 발현량은 유사하게 나타났으나, 스트레스에 의해 GS 활성은 감소되었으나, 스트레스군에서 일반식이군에 대비하여 티로신-식이군은 GS 활성이 통계적으로 유의미하게 증가하였으며, GS 내의 N-Tyr(nitraion 티로신)의 함량이 스트레스에 의해 통계적으로 유의미하게 증가하였으나, 티로신-식이군은 일반식이 스트레스군에 비해 통계적으로 유의미하게 N-Tyr의 함량이 감소하였다(도 5).
실시예 3. 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의, PFC에서 글루탐산염, 글루타민, 티로신 및 GABA 함량 확인
PFC에서 아미노산(글루탐산염, 글루타민, 티로신) 및 GABA의 함량을 액체 크로마토그래피 질량분석법(LC-MS/MS)으로 정량하였다.
우선 PFC 조직을 파쇄하여 조직의 상층액을 취해 내부 표준물질(L-Glu-d5)와 이동상으로 희석하였다. 희석한 시료를 5개로 분주하여 LC-MS/MS 시스템(Agilent 6460)에 주입하였다. 칼럼은 SeQuant ZIC®-HILIC 칼럼(2.1×100mm, 3.5μm, 100Å)을 사용하였고, 이동상은 0.1% 포름산을 포함하는 아세토니트릴(acetonitrile)을 사용하여 농도구배를 주어 분리하였다.
아미노산 검출은 복수 반응 감시 검출법을 이용하였다(Glu의 m/z 148→84, Gln의 m/z 147→84, GABA의 m/z 104→87 및 내부 표분물질의 m/z 153→88).
그 결과, 도 6에 개시한 바와 같이, PFC에서 스트레스군의 일반식이군은 정상군에 대비 글루탐산염, 글루타민, 티로신 및 가바의 함량이 감소하였고, 이에 대비 티로신 식이군은 정상군 수준 이상으로 글루탐산염, 글루타민, 티로신 및 가바의 함량이 증가한 것을 확인하였다.
실시예 4. 티로신-식이(TD)한 만성 부동자세 스트레스(CIS) 유도군(STR)의 PFC에서 암모니아 함량 변화
조직이 녹지 않도록 -20℃ 이하에서, PFC 조직 무게 측정한 후, 1.5㎖ 튜브에 조직 무게 10mg당 100㎕의 RIPA(proteinase inhibitor cocktail, PIC 포함)와 적당한 갯수의 유리 비드를 넣고 불렛 블렌더(bullet blender)를 이용하여 30초 동안 2번 조직을 파쇄하였다. 조직 파쇄물을 스핀다운(spin down)하여 새로운 1.5㎖ 튜브에 옮겨 1분 동안 초음파를 이용하여 조직 분쇄하였다. 12,000rpm에서 15분 동안 원심 분리 후, 상층액을 새로운 1.5㎖ 튜브로 옮기고, 시험에 사용하기 전까지 -80℃에서 보관하였다. 상기 과정에서 PFC 조직 무게 측정을 제외한 모든 과정은 4℃에서 실시하였다. 암모니아 어세이 키트(Ammonia assay kit: Sigma-Aldrich, Cat Num. AA0100)에서 제공되는 암모니아 표준용액(10㎍/㎖=588μM 제공)을 물로 희석하여 0(blank control), 0.2, 0.4, 0.6, 0.8, 1.0㎍/㎖로 제조하였고, PFC 조직 파쇄물은 PBS 완충용액으로 2배 희석하였다.
상기 암모니아 어세이 키트에서 제공하는 암모니아 어세이 시약 100㎕에 PBS 완충용액으로 2배 희석한 시료 10㎕(조직 5㎍에 상응)를 넣고 상온에서 5분 동안 인큐베이션하였다. 동시에 암모니아 어세이 시약 100㎕에 대하여, 표준용액 10㎕를 넣고, 상온에서 5분 동안 인큐베이션하였다. PFC 조직 파쇄물 완충용액(RIPA+PIC)에 의한 간섭 영향을 보정하기 위해 PBS 완충용액으로 2배 희석한 RIPA+PIC를 완충용액 블랭크 대조군으로 사용하였다. 5분 후에, 마이크로 리더기를 이용하여 340nm에서 흡광도를 측정하였다 (Ainitial).
L-글루탐산 탈수소효소(glutamate dehydrogenase) 용액 10㎕를 넣고, 상온에서 5분 동안 인큐베이션 후에 340nm에서 흡광도를 측정하였다(Afinal).
DA340nm(Afinal-Ainitial)를 구하고 표준의 경우, 블랭크 대조군의 DA340nm를, 시료의 경우에는 완충용액 블랭크 대조군의 DA340nm를 빼서 제외하였다.
표준의 결과값을 이용하여 선형회귀(linear regression)을 구하고, 이를 이용하여 샘플의 암모니아 농도를 계산하였다.
그 결과 도 7에 스트레스군의 일반식이한 경우, 정상군에 비해 암모니아 함량이 증가하였며, 이에 대비하여 본 발명의 티로신-식이한 군은 정상군과 유사한 수준으로 암모니아 함량이 감소한 것을 확인하였다.
실시예 5. in vitro 니트로화(nitration) 억제 효과 분석
마우스 PFC 단백질에 ONOO-를 처리하여 단백질의 니트로화를 유도하고, 티로신에 의한 니트로화 억제 효과를 확인하였다. 그 결과 도 8에 개시한 바와 같이 티로신의 농도 의존적으로 단백질들의 니트로화가 억제되는 것을 확인하였으며, 니트로화 억제 효과는 L-티로신 및 D-티로신 둘다 유사한 수준으로 나타났다.
또한, 본 발명에 따른 티로신의 니트로화 억제 효과를 마우스의 뇌와 간 조직 파쇄물(lysate)을 이용하여 분석하였다. CO2 가스로 마취된 마우스로부터 전전두엽(prefrontal cortex, PFC) 및 간(liver) 조직을 각각 채취하여 무게를 잰 후, 조직 파쇄기를 이용하여 조직을 파쇄하고, 4℃에서 12,000rpm으로 20분 동안 원심분리한 후 상등액을 취하여 PFC 및 간 조직 파쇄물(lysate)을 얻었다. 상기 조직 파쇄물에 단백질의 니트로화를 유도하는 퍼옥시니트리트(peroxynitrite, PN)를 첨가하고, 글루타민(Q), L-티로신(L-Y) 및 D-티로신(D-Y)를 2mM의 농도로 각각 첨가한 후 5초 동안 볼텍스(vortex)하여 혼합하고 얼음에서 10분 동안 반응시켰다. 이후, 항-니트로티로신 항체(1:1,000), 항-글루타민 합성효소 항체(1:5,000), 항-인슐린 수용체 베타 항체(1:1,000) 또는 항-인산화 인슐린 수용체 베타 항체(1:1,000)를 이용하여 웨스턴 블랏을 수행하였다.
그 결과, PN에 의해 PFC 및 간 조직 내 티로신 니트로화가 증가된 단백질들이 증가한 것을 확인하였고, 글루타민 합성효소(GS)와 인슐린 수용체 베타 서브유닛(IRb)이외의 여러 단백질의 니트로화가 증가된 것을 여러 밴드의 웨스턴 블랏 결과로 확인하였다. PN에 의해 티로신 니트로화가 증가된 단백질들은 티로신(Y)이 말단에 위치한 펩타이드 처리에 의해 니트로화가 감소한 것을 확인하였다(도 9A, 9B). PFC와 간 조직에서 각 처리군의 단백질 양의 차이가 없음을 GS와 IRb의 발현으로 확인하였다. 하지만, IRb는 PN에 니트로화가 되어 인산화된 형태가 감소된 것을 인산화-IRb(IRb-p)의 웨스턴 블랏으로 확인하였다(도 9C, 9D).
실시예 6. 고지방식이 제2형 당뇨 모델 마우스에서 L-티로신의 인슐린 민감도 증진 효과 확인
(1) 고지방식이 제2형 당뇨 모델 확립
3주령 C57BL/6 마우스 수컷 27마리를 1주일 동안 사육환경에 적응시킨 후, 3 그룹으로 나누어 각각 정상식이(ND, normal diet; 10kcal% fat, 열량 3.85 kcal/g), 고지방식이(HFD, high fat diet; 60 kcal% fat, 열량 5.24 kcal/g), L-티로신 (L-Tyr) 첨가 고지방식이(HFD+L-Tyr; 181mg의 L-티로신/kg 포함)를 제공하였으며, 물과 사료는 자유롭게 섭취할 수 있도록 하였다. 3개월 동안 2일마다 체중과 먹이섭취량을 측정하였고, 1주마다 혈당을 측정하였다.
그 결과 도 10에 개시한 바와 같이, 체중은 점진적으로 증가하였고, 동일자 기준으로, HFD 및 HFD+L-Tyr 그룹의 체중이 ND 보다 더 나가는 것으로 확인하였고, HFD 및 HFD+L-Tyr 그룹의 체중변화는 유사한 수준으로 나타났다. 사료 섭취량에는 그룹간 차이가 거의 없고, 기간에 따른 차이도 발생하지 않았으며, 혈당은 정상식이군(ND)에 비해 HFD 군의 혈당이 통계적으로 유의미하게 증가하였으며, HFD군 대비 HFD+L-Tyr 군의 혈당이 통계적으로 유의미하게 감소하였다.
(2) 포도당 내당능 검사
1× PBS에 D-글루코스를 용해시켜 40% D-글루코스 용액을 준비하였다. 16시간 금식한 마우스의 혈당을 측정한 후, 체중 1kg 당 2g의 글루코스를 복강 주사하기 위하여, 식(1)에 따라 글루코스 용액을 복강주사하였다.
식(1)
글루코스 주사량(㎕)=체중(g)×5
일례로, 체중 45g인 마우스에는 40% 글루코스 용액 225㎕를 주사하였다. 글루코스 용액을 복강주사한 후, 30, 60, 90 및 120분 시점에 혈당을 측정하였다.
그 결과, 도 11에 개시한 바와 같이 정상식이군(ND)에 대비하여 고지방식이군(HFD)의 혈액 내 글루코스 함량이 통계적으로 유의미하게 증가하였고, 이에 대비하여 본 발명의 L-티로신 (L-Tyr) 첨가 고지방식이군(HFD+L-Tyr)은 혈액 내 글루코스 함량이 감소하였다.
(3) 인슐린 저항성 시험
인슐린을 생리식염수에 희석하여 0.15 U/㎖ 용액을 준비하였다. 6시간 금식한 마우스의 혈당을 측정한 후, 인슐린을 복강주사하였다(0.75 U/체중(kg)). 인슐린을 복강주사한 후, 15, 30, 60 및 90분 시점에 혈당을 측정하였다.
식(2)
인슐린 주사량(㎕)=체중(g)×5
그 결과, 도 12에 개시한 바와 같이 정상식이군(ND)에 대비하여 고지방식이군(HFD)의 혈액 내 글루코스 함량이 통계적으로 유의미하게 증가하였고, 이에 대비하여 본 발명의 L-티로신 (L-Tyr) 첨가 고지방식이군(HFD+L-Tyr)은 혈액 내 글루코스 함량이 감소하였다.
(4) 조직내 지방 축적 변화 및 혈장 내 ROS/RNS 함량 변화 확인
아베르틴(Avertin)으로 마우스를 마취하고, 심장을 통해 혈액을 채취하여 진공 채혈기(vacutainer)의 EDTA와 반응시킨 후 1,500×g, 4℃에서 15분 동안 원심분리하여 혈장을 분리하였다. PBS와 4% 파라포름알데히드(paraformaldehyde; PFA)를 심장을 통해 관류하여 조직을 고정하고 각 조직을 적출하여 PFA에 보관하였다.
혈장 내 활성산소/질소(ROS/RNS) 농도는 혈장을 PBS에 3배 희석한 후, Oxiselect ROS/RNS 어세이 키트(Cell Biolabs)를 사용하여 권장 실험방법대로 측정하였다.
그 결과, HFD 동물 모델에서 티로신이 전반적인 간의 지방축적을 감소시켰고, 신장 주변 지방조직의 양은 통계적인 차이가 나는 수준으로 감소시킨 것을 확인하였고, 정상식이군(ND)에 대비하여 고지방식이군(HFD)의 혈장 내 ROS/RNS 레벨이 통계적으로 유의미하게 증가하였고, 이에 대비하여 본 발명의 L-티로신(L-Tyr) 첨가 고지방식이군(HFD+L-Tyr)은 혈장 내 ROS/RNS 레벨이 통계적으로 유의미하게 감소하였다(도 13).
실시예 7. 카이닌산(Kainic acid)으로 발작을 유발시킨 간질발작 모델 마우스에서 L-티로신의 흥분독성과 산화스트레스 억제 효과 확인
카이닌산(KA)으로 발작을 유발시킨 간질 발작 동물 모델을 이용하여 티로신의 글루타메이트의 흥분독성 억제 효과를 확인하였다. 마우스를 7일 동안 티로신의 양을 다르게 섭취시킨 동물에게 동일 양의 카이닌산을 복강주사하여 발작 정도를 확인하였다.
(1) 간질 발작
4주령 ICR 수컷 마우스에 1주 동안 정상식이 또는 L-티로신 함유 식이를 제공하였으며, 물과 사료는 자유롭게 섭취할 수 있게 하였다.
정상식이(ND): AIN-93G
1× L-Tyr: 181mg/kg의 L-Tyr을 포함한 AIN-93G
3× L-Tyr: 543mg/kg의 L-Tyr을 포함한 AIN-93G
5× L-Tyr: 905mg/kg의 L-Tyr을 포함한 AIN-93G
카이닌산(Kainic acid: KA, Abcam)를 중탕으로 가열하면서 생리식염수에 용해하여 9mg/㎖ 카이닌산 용액을 준비하였으며, 카이닌산 용액을 복강주사하고(30mg/kg), 2시간 동안 발작 레벨과 증상을 기록하였다. 발작 레벨 판단은 하기 표 2의 기준에 따라 적용하였으며, 카이닌산 주사 전과 24시간 후의 체중을 측정하여 비교하였다.
또한, 카이닌산을 주사하고 24시간 후 생존한 마우스의 뇌 생조직을 적출하거나 PFA 관류로 조직고정 후 뇌를 적출하였다.
발작 레벨에 따른 대표 증상
레벨 대표 증상
I 코너에 쭈그려 앉거나 고정자세, 응시
II 몸을 뻗고, 꼬리 곧고 뻣뻣, 귀가 뒤로 누움, 눈이 튀어나오고 붉음
III 반복적인 머리 까딱, 배에 앞발을 얹고 앉음
IV 간헐적인 경련으로 달리고 점프, 고요하게 있으며 강직간대 발작으로 앉고 누움
V 레벨 V 지속적으로 발작
VI 몸의 간헐적인 경련, 발을 이용해 균형 유지가 길지 않음, 대개 사망함
그 결과, 발작정도가 티로신 함량에 따라 차등적으로 경감 되는 것을 확인하였으며, 실험군 간의 체중변화는 없는 것으로 나타났다(도 14). 또한, 티로신을 섭식하지 않은 동물의 경우, 카이닌산에 의한 강한 발작 현상으로 120분을 넘기지 못하고 죽는 개체가 발생하였으나, 티로신의 섭식량에 따라 마우스가 죽는 현상도 개선되는 것을 확인하였으며, 900mg/kg(식이무게)의 티로신이 포함된 사료를 섭취한 마우스의 경우 모두 생존하였다.
(2) ROS/RNS 측정
뇌조직 중 해마를 조직 질량 10mg 당 RIPA buffer 100㎕ (proteinase/phosphatase inhibitor 포함)를 넣고 유리 비드 및 Bullet Blender를 이용하여 1분 동안 분쇄하였다. 12,000×g, 4℃에서 15분 동안 원심분리 상층액을 분리하고 PBS에 10배 희석하여 ROS/RNS 측정에 사용하였다. ROS/RNS 농도는 OxiSelect ROS/RNS 어세이 키트(Cell Biolabs)를 사용하여 권장 실험방법대로 측정하였다.
카이닌산을 주사하여 생존한 마우스의 해마 조직의 ROS/RNS 양적변화와 GS 활성도를 분석한 결과, ROS/RNS의 양이 카이닌산에 의해 증가되었지만 티로신을 섭식시킨 마우스에서는 대조군 수준으로 감소되었다(도 15).
(3) 글루타민 합성효소(GS) 활성 측정
96웰 플레이트에 해마 용해물 2㎕를 넣고, 50mM 이미다졸-HCl 완충용액(pH 6.8)를 추가로 넣어 50㎕를 맞추었다. GS 활성 어세이 완충용액(50mM imidazole-HCl, pH6.8, 25mM의 L-글루타민, 12.5mM의 히드록실아민, 12.5mM의 비산나트륨(sodium arsenate), 1mM의 MnCl2 및 0.08mM의 ADP) 50㎕를 넣고, 37℃에서 30~60분 동안 반응시켰다.
반응 종료 후, 빈 웰에 표준물질인 γ-글루타밀히드록삼메이트(γ-glutamylhydroxamate)를 0.391~25.0mM의 농도가 되도록 첨가하였다. 시료와 표준물질에 100㎕의 반응정지 용액(90mM의 FeCl3, 1.8N의 HCl 및 1.45%(w/v) 트리클로로아세트산(trichloroacetic acid)을 첨가하고, 560nm 파장에서 흡광도를 측정하였다.
표준곡선과의 비교를 통해 각 샘플의 GS 활성을 구하였다. GS 활성은 최종 생산물인 γ-글루타밀히드록삼메이트의 생성량으로 표현하고, 단위는 μM/min/㎍ protein이다.
그 결과 도 15에 개시한 바와 같이 GS 활성이 카이닌산에 의해 감소되었지만 티로신을 섭식시킨 마우스에서는 대조군 수준 이상으로 증가하였다.
(4) 조직면역염색(Immunohistochemistry, IHC)
PBS와 PFA를 심장을 통해 관류하고 뇌를 적출하여 PFA에 15시간 이상 후고정하였다. PBS로 10분 동안 3회 세척하고, 진동 마이크로톰(vibratome)으로 40㎛ 두께로 뇌조직 절편을 획득하였다.
3% 소 혈청 알부민(bovine serum albumin)을 용해시킨 IHC 완충용액(0.3% Triton X-100을 포함하는 PBS)에 상기 획득한 뇌 절편을 실온에서 1시간 동안 블로킹한 후, 4℃에서 1차 항체(anti-NeuN (Millipore, MAB377, 1:500), anti-Iba1 (Wako, 019-19741, 1:200))와 15시간 이상 반응시켰다(3% BSA를 포함하는 IHC 완충용액). IHC 완충용액으로 10분씩 3회 세척하고, 형광표지된 2차 항체(anti-Mouse IgG Alexa Fluor 488(Invitrogen, 1:1000), anti-Rabbit IgG AlexaFluor594 (Invitrogen, 1:000))와 실온에서 2시간 반응시켰다(3% BSA를 포함하는 IHC 완충용액). IHC 완충용액으로 10분씩 3회 세척하고, 실라인(silane) 코팅된 유리 슬라이드에 절편을 고정하였다. DAPI가 포함된 anti-fade 용액을 절편에 얹고 커버 유리를 덮어 말렸다. 형광현미경으로 촬영한 이미지의 신호밀도를 이미지 J 분석 프로그램을 이용하여 분석하였다.
키아닌산에 의해 유발된 발작 모델의 뇌조직을 검사한 결과, 키아닌산에 의해 해마 영역(CA1, CA3)의 신경세포 수가 감소되었으며, 동일한 부위의 미세아교세포(microglia) 활성도가 증가되었으나, 티로신을 섭취한 경우, 신경세포의 수가 유지되고, 염증반응에 의해 미세아교세포의 활성이 감소한 것을 확인하였다(도 16).
실시예 8. 만성 신체구금 스트레스 모델 마우스에서 D-티로신의 인지장애 예방 효과 확인
(1) 만성 신체 구금 스트레스 모델 준비
C57BL/6 수컷 마우스(7주령) 28마리를 두 그룹으로 나누어 정상식이(AIN-93G) 또는 D-티로신(D-Tyr) 포함 식이(181mg D-Tyr/kg AIN-93G)를 1주일 동안 제공하였다. 물과 사료는 자유롭게 섭취할 수 있게 하였으며, 1주에 두 번 체중과 먹이섭취량을 측정하였다.
8주령부터 2주 동안 하루 2시간씩 200lux 조명 조건에서 만성 신체 구금 스트레스(chronic immobilization stress, CIS)를 가하였다. 대조군(CTL), D-Tyr 섭식 대조군(CTL+D-Tyr), 만성스트레스군(STR), D-Tyr 섭식 만성스트레스군(STR+D-Tyr)으로 분류하고, 각 그룹 당 동물은 7마리로 구성하였다.
(2) 인지기능시험
2주 동안의 CIS 종료 후, 인지기능 시험을 실시하였다. 적응기간 포함, 전 시험 기간 동안 D-Tyr 함유 섭식을 제공한 그룹과 일반 사료 섭식군의 인지기능을 비교하기 위해, 장기 기억능력을 시험하는 사물 인지기능시험(object recognition test, ORT)과 사물 위치 인지기능시험(object location recognition test, OLT)을 수행하였다.
ORT: 적응(habituation), 친화(familiarization), 시험(test)의 세 단계로 구성하였다. 시험 상자에 하루 10분씩 이틀 동안 적응시키고, 3일째 친화 단계에는 두 개의 동일한 사물을 10분 동안 탐색하도록 하였다. 마우스를 시험 상자에 넣을 때는 물체가 없는 벽 쪽을 바라보게 넣었다. 4일 째 시험 단계에는 두 사물 중 하나를 새로운 사물로 교체하고 10분 동안 탐색하게 하되, 초반 5분 동안의 기록을 데이터로 사용하였다. 사물인지기능 지수(DI)는 하기 식(3)으로 산출하였다.
식 (3)
DI(Descrimination Index) =[신규 사물 탐색시간-친숙한 사물 탐색시간]/[신규 사물 탐색시간+친숙한 사물 탐색시간]
OLT: ORT 수행 24시간 후에 친숙한 사물의 위치를 변경하고 5분 동안 탐색하도록 하였다. 상기 사물인지기능 지수(DI)와 동일한 방법으로, 전체 사물 탐색 시간 중, 위치가 이동된 사물을 탐색하는 시간의 비율을 계산하여 사물 위치 인지기능 지수를 산출하였다.
만성스트레스 경도 인지장애 동물 모델을 이용하여 티로신의 인지기능 보호 효능을 확인하기 위해, 마우스에 티로신이 첨가된 사료를 제공하면서 만성스트레스(14일)를 가한 결과, 체중 및 사료섭취량은 티로신의 포함여부에 따른 차이가 나타나지 않았으며, ORT에서는 통계적으로 유의미한 차이를 확인할 수 없었고, OLT에서는 스트레스에 의해 저하된 인지기능이 티로신의 섭취에 의해 대조군 수준으로 유지해 주고 있다는 것을 확인하였다(도 17).
실시예 9. 엔도텔린-1(Endothelin-1)을 이용한 뇌졸중(stroke) 모델 마우스에서 L-티로신의 뇌경색(brain infarct)과 산화스트레스 저감 효과 확인
(1) 뇌졸중 모델 마우스 준비
8주령 C57BL/6 수컷 마우스에 1주일 이상 정상식이 또는 L-티로신 함유 식이를 제공하였고, 물과 사료는 자유롭게 섭취할 수 있게 하였다.
정상식이(ND): AIN-93G
L-Tyr: 905mg/kg L-Tyr을 포함한 AIN-93G
(2) 엔도텔린-1(Endothelin-1) 준비 및 정위 수술(stereotaxic surgery)
3차 증류수에 엔도텔린-1(Endothelin-1)을 넣고(2㎍/㎕) 강력하게 vortex 후, 4℃에서 약 10분 동안 초음파를 이용하여 완전하게 용해시켰다.
마취제 아버틴(avertin: 마우스 무게 25g당 0.5㎖)을 복강 주사하여 마우스를 마취시킨 후에, 정위 수술을 통해 2㎍의 엔도텔린-1(Endothelin-1)을 대뇌의 운동피질 영역(bregma를 중심으로 AP 1.5mm, ML -1.5mm, DV 1.8mm)에 주입하였다. 1분당 0.3㎕의 속도로 주입하였으며, 주입이 완료된 후 약 5분 동안 바늘을 그대로 두어 엔도텔린-1(Endothelin-1)이 충분히 조직에 흡수될 수 있도록 하였다. 피부를 봉합 후에 원래 케이지에서 회복시켰다.
(3) 조직염색
PBS와 PFA를 심장을 통해 관류하고 뇌를 적출하여 PFA에 15시간 이상 후고정하였다. PBS로 10분 동안 3회 워싱하고, vibratome으로 40㎛ 두께로 뇌조직 절편을 잘라내고 엔도텔린-1(Endothelin-1)을 주입한 지점에서 4장씩의 절편을 silane 코팅된 유리 슬라이드에 고정하였다. 건조된 절편은 0.1% crecyl violet 용액에 5분 동안 담근 후에 3차 증류수에 2번 담궈 염색액을 씻어냈다. 100% 에탄올올에 2~3초 담궈 탈수시킨 후에 자일렌에 5초 동안 2번 씻어냈다. Mount 용액을 도포 후에 커버글라스로 덮고 건조시켰다. 염색된 절편시료를 광학현미경으로 관찰하고, 저장된 이미지를 대상으로 이미지 J 프로그램을 이용하여 뇌경색 부위의 면적을 산출하였다.
(4) 글루타민 합성효소(GS) 활성 측정
96웰 플레이트에 대뇌 운동피질 lysate 2 ㎕를 넣고, 50 mM imidazol-HCl buffer (pH 6.8)를 추가로 넣어 50 ㎕를 맞추었다. GS 활성 assay buffer (50 mM imidazole-HCl, pH 6.8, 25 mM L-glutamine, 12.5 mM hydroxylamine, 12.5 mM sodium arsenate, 1 mM MnCl2 and 0.08 mM ADP) 50 ㎕를 넣고, 37°에서 30-60분 동안 반응시켰다.
반응 종료 후, 빈 웰에 표준물질인 γ-glutamylhydroxamate(0.391~25.0mM)를 넣었다. 시료와 표준물질에 100㎕의 반응정지 용액(90mM FeCl3, 1.8N HCl 및 1.45% 트리클로로아세트산(trichloroacetic acid))을 넣고 560nm 파장에서 흡광도를 측정하였고, 표준곡선과의 비교를 통해 각 시료의 GS 활성을 구하였다. GS 활성 최종 생산물인 γ-glutamylhydroxamate의 생성량으로 표현하고, 단위는 μM/min/㎍ protein이다.
엔도텔린-1(Endothelin-1)을 마우스 뇌의 motor cortex 에 주입하여 혈관성 뇌졸중을 유도한 실험결과, endothelin을 투여한 실험군에서는 saline을 투여한 대조군에 비해 경색 부피(infarct volume)가 급증하였고, 티로신을 900mg/kg(사료무게)의 용량으로 섭식시킨 실험군에서 infarct volume이 감소한 것을 확인하였다. 또한 조직의 GS 활성도가 대조군에 비해 엔도텔린-1(Endothelin-1)에 의해 감소되었으나, tyr 식이에 의해 GS의 활성이 유지되는 것을 확인할 수 있다(도 18).
실시예 10. 인간 재조합 MnSOD를 이용한 티로신의 denitration 효과 확인
1) 퍼옥시니트리트(Peroxynitrite) 정량
퍼옥시니트리트(Peroxynitrite)를 0.3M NaOH에 40배 희석하여 302nm에서 흡광도를 측정하고, 퍼옥시니트리트(Peroxynitrite)의 몰흡광계수(ε302 = 1670 M-1cm-1)를 이용하여 정량하였다.
2) SOD 활성 측정
SOD 활성 측정은 Thermofisher사의 SOD 비색반응 활성 키트를 이용하였다. 표준 SOD에 범위 내의 인간 재조합 MnSOD, 펩타이드와 퍼옥시니트리트를 혼합하고 얼음에서 10분 동안 반응시켰다. 표준 SOD 또는 반응시킨 혼합물 10㎕와 키트에서 제공하는 기질 용액 50㎕를 96웰 플레이트에 넣고 450nm에서 흡광도를 측정하였다. 키트에서 제공하는 잔틴산화효소 25㎕를 넣고 상온에서 20분 동안 반응시킨 후, 450nm에서 흡광도를 측정하였다. 2차 측정 흡광도에서 1차 측정 흡광도를 뺀 데이터를 이용하여 SOD 활성을 측정하였다.
그 결과, SOD는 생체 내의 활성 질소종에 의해 SOD 활성이 저하되었다. MnSOD의 활성도는 peroxynitrite의 의해 감소되나, 첨가한 Tyr (L-, D-form)에 SOD 활성이 유지되는 것을 확인하였다(도 19).
실시예 11. 급성 신부전에 대한 Tyr의 효과 확인
(1) 동물실험
23~25g의 웅성 C57BL/6 마우스(코아텍)를 온도와 습도가 일정하게 유지되는 무균 사육실에서 자유롭게 물과 사료를 섭취하도록 하고, 1) 대조군(Sham), 2) 조제용매 처치 신장 허혈 및 재관류 유발군(CMC+IR), 3) L-tyrosine처치 신장 허혈 및 재관류 유발군(L-Tyr+IR) 등 3개 실험군으로 나누었다.
L-티로신(100mg/kg)은 0.5% CMC(carboxymethyl cellulose)에 현탁하였다. L-티로신 또는 조제용매 CMC를 4일 동안 하루 1회 경구로 투여하였으며, 4일째 경구투여 30분 후 신장 허혈을 유발하였다. 신장 허혈은 복부를 절개하고 Muller atraumatic vascular clamp를 이용하여 양측 신혈관경(renal pedicle)을 겸자하여 유발하였으며, 25분 허혈 후 clamp를 제거하여 재관류하였다. 대조군(Sham)은 겸자를 통한 허혈 유발을 제외한 모든 수술과정을 동일하게 시행하였다. 재관류 후 24시간에 실험동물을 희생시켜 심장에서 혈액을 채취하고 조직을 적출하였다.
(2) 혈장 크레아티닌
채취한 혈액을 3,000rpm에서 15분 동안 원심분리하여 혈장을 분리하고 Jaffe법을 이용하여 혈중 크레아티닌을 측정하였다. Jaffe법은 510nm 파장에서 혈장 시료를 피크르산과 반응하여 측정한 흡광도와 60% 아세트산으로 반응을 종료시킨 후 측정한 흡광도의 차이로 크레아티닌 양을 계산하여 mg/㎗ 단위로 나타내었다.
(3)정량적 실시간 중합효소반응
Trizol 방법으로 신장 조직에서 total RNA를 추출하였고 Revert Aid 역전사 시스템(Thermofisher)을 사용하여 cDNA를 합성하였다. iQ SYBR Green Super mix(Bio-Rad)를 사용하여 CFX Connect Real-Time PCR 시스템(Bio-Rad)에서 정량적 PCR을 수행하였다. 하우스키핑 유전자로 GAPDH을 사용하였다. 실험에 사용한 프라이머는 표 3에 개시하였다.
유전자 방향 프라이머 서열(5' ->3') 서열번호
IL-1β Forward TCGCAGCAGCACATCAACAAGAG 1
Reverse GGTGCTCATGTCCTCATCCTGGA 2
IL-6 Forward CCAATTCATCTTGAAATCAC 3
Reverse GGAATGTCCACAAACTGATA 4
NQO-1 Forward ATGACATCACAGGTGAGCTGAAGG 5
Reverse CTCAAACCAGCCTTTCAGAATGGC 6
GAPDH Forward GTGGCAAAGTGGAGATTGTTG 7
Reverse TTGACTGTGCCGTTGAATTTG 8
(4) 웨스턴 블랏
신장 조직을 RIPA 완충용액에서 균질화하고 16,000×g, 4℃에서 15분 동안 원심분리한 후 상층액을 수집하여 BCA법으로 단백질을 정량하였다. SDS-PAGE로 전기영동한 후 PVDF 멤브레인에 이동시키고, 5% 탈지분유로 블로킹하였다. 이후 니트로-티로신 및 β-actin 1차 항체 및 상응하는 2차 항체를 반응시킨 후 ECL법으로 ChemiDoc XRS+ 시스템(Bio-Rad)에서 분석하였다.
ROS(Reactive oxygen species) 또는 RNS(reactive nitrogen species)에 의한 산화적 스트레스는 신장 허혈 및 재관류 손상에 의한 급성 신부전의 주요 기전이며, 항산화 인자의 증가는 신장 허혈 및 재관류 손상을 억제하는데 중요하다. 신장 허혈 및 재관류 24시간 후 신장 조직에서 항산화 작용인자인 NQO-1의 유전자 발현을 측정한 결과 L-티로신 투여는 NQO-1의 유전자 발현을 조제용매 투여군에 비해 통계적으로 유의하게 증가시켰다(#, p<0.01). 미토콘드리아에서 ROS/RNS의 함량도 IR에 의해 약 6배 이상 증가하였으나, Tyr에 의해 억제되어 있다는 것을 확인하였다. MnSOD와 Cu/Zn SOD 의 활성도가 IR에 의해 감소되었지만, Tyr에 의해 회복되는 것을 확인하였다. 신장 허혈 및 재관류 24시간 후 신장조직에서 nitrotyrosine 단백질이 sham군에 비해 증가하였으며, 이러한 증가는 L-tyrosine 투여에 의해 현저하게 감소하였다(도 20).
또한, 도 21에 개시한 바와 같이 신장손상 평가지표로서 혈장 크레아티닌을 측정한 결과, 혈장 크레아티닌은 신장 허혈 및 재관류 24시간 후 sham군에 비해 약 5.9배 증가하였으며, 이러한 증가는 L-tyrosine 투여에 의해 통계적으로 유의하게 억제되었고, 신장 허혈 및 재관류 손상에 따른 급성신부전의 주요 발병기전으로 염증반응을 확인하기 위해 신장 조직에서 염증성 사이토카인(IL-1b 및 IL-6)의 유전자 발현을 측정 결과에서는 신장 허혈 및 재관류 24시간 후 IL-1b 및 IL-6 유전자 발현이 sham군에 비해 증가하였으며, 이러한 증가는 L-tyrosine 투여에 의해 통계적으로 유의하게 억제되었다.
실시예 12. Azoxymethan을 이용한 간성뇌증(고암모니아혈증)에 대한 Tyr의 효능 실험
(1) 동물실험
웅성 13주 C57BL/6 마우스(코아텍)를 온도와 습도가 일정하게 유지되는 무균 사육실에서 자유롭게 물과 사료를 섭취하도록 하고, (1) 대조군(Control), (2)Carboxymethyl cellulose+azoxymethane 처치군(CMC+AOM), (3) L-티로신+AOM 처치군(L-Tyr+AOM) 등 3개 실험군으로 나누었다. L-티로신(100mg/kg)은 0.5% CMC(carboxymethyl cellulose)에 현탁하였다. L-티로신 또는 조제용매 CMC를 4일 동안 하루 1회 경구로 투여하였으며, 4일 째 경구투여 2시간 후 AOM(100mg/kg, 100㎖)를 복강으로 주사하였다. AOM 투여 후 12시간 뒤 탈수를 예방하기 위하여 0.5% 글루코스를 포함하는 생리식염수 200㎖를 복강주사하고 4시간 후 실험동물을 희생시켜 심장에서 혈액을 채취하고 간 조직을 적출하였다.
(2) 혈중 암모니아 분석
혈액 내 암모니아 양은 단일파장 반사측정법 분석용 측정기인 PocketChem BA PA-4140(Arkray, Japan)를 사용하여 측정하였다. 검사지에 혈액을 20㎕ 올려 실온에서 3분 동안 반응시키고 측정기에 삽입하여 635nm(LED) 파장에서 흡광도를 측정하여 결과를 ㎍/㎗ 단위로 나타내었다.
(3) 혈장 ALT 분석
간세포 손상의 혈액지표인 ALT(alanine aminotransferase)은 채취한 혈액을 3,000rpm에서 15분 동안 원심분리하여 혈장을 분리하고 ChemiLab GPT 어세이 키트(IVD-LAB, Korea)를 사용하여 측정하였다. Kit의 표준측정법에 따라 분광광도계의 340nm 파장에서 흡광도를 측정하여 결과를 U/L 단위로 나타내었다.
(4) Western blot
간 조직을 RIPA 완충용액에서 균질화하고 16,000×g, 4℃에서 15분 동안 원심분리한 후 상층액을 수집하여 BCA법으로 단백질 양을 정량하였다. SDS-PAGE로 전기영동한 후 PVDF 멤브레인에 이동시키고, 5% 탈지분유로 블로킹하였다. 이후 니트로-티로신 및 β-actin 1차 항체 및 상응하는 2차 항체를 반응시킨 후 ECL법으로 ChemiDoc XRS+ 시스템(Bio-Rad)에서 분석하였다.
암모니아는 아미노산과 핵산의 주 대사물이며, 암모니아를 요소로 전환시키는 요소회로의 주요 효소들이 간세포에만 존재하고, 암모니아를 농도를 낮춰주는 GS와 SOD, 활성산소를 제거하는 catalase등도 간 조직에 풍부하게 존재하기 때문에 간을 지나 뇌로 올라가는 혈관의 혈중 암모니아 농도 변화는 간성뇌증에 중요한 지표가 된다. AOM에 의한 급성 간성뇌증 모델에서 혈중 암모니아를 측정한 결과 CMC+AOM 처치군은 정상대조군에 비해 혈중 암모니아 농도가 6.7배 증가하였으며, L-tyrosine 투여는 AOM에 의한 혈중 암모니아 증가를 통계적으로 유의하게 억제하였다. 간 실질세포의 손상은 세포질에 존재하는 ALT의 혈중 유리를 유발하여 그 농도가 증가하므로 이 효소의 활성을 측정하는 것은 간 손상의 정도를 알 수 있는 직접적인 지표이다. AOM에 의한 급성 간성뇌증 모델에서 혈장 내 ALT를 측정한 결과 CMC+AOM 처치군은 혈장 ALT가 대조군에 비해 약 65배 증가하였으며, L-tyrosine 투여는 AOM에 의한 혈장 ALT 증가를 통계적으로 유의하게 억제하였다. AOM 투여 16시간 후 간 조직에서 nitrotyrosine 단백질이 대조군에 비해 증가하였으며, 이러한 증가는 L-tyrosine 투여에 의해 현저하게 감소하였으며, 이 결과는 Tyr이 간에 존재하는 단백질들의 nitration을 억제하여 간으로 유입된 암모니아를 제거할 수 있도록 해준다는 증거가 되었다(도 22).
[통계 처리]
본 발명의 모든 데이터는 평균±SEM으로 나타냈으며, Dunnetts Multiple Comparison Test를 이용한 일원 분산 분석(ANOVA) 또는 GraphPad 프리즘 5(GraphPad Software)를 이용한 스튜던트 t 검정(p<0.05)으로 통계 분석되었다.

Claims (8)

  1. 티로신 또는 식품학적으로 허용가능한 이의 염을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물.
  2. 제1항에 있어서, 상기 단백질 내 티로신의 니트로화는 티로신 수산화효소(tyrosine hydroxylase), 망간 슈퍼옥시드 디스무타아제(Mn Superoxide dismutase), Cu/Zn 슈퍼옥시드 디스무타아제(Mn Superoxide dismutase), 인슐린 수용체 베타 서브유닛(insulin receptor β subunit), 아넥신 IV(annexin IV), 글루탐산 탈수소효소(glutamate dehydrogenase), 3-α-OH 스테로이드 탈수소효소(3-α-OH steroid dehydrogenase), 글루타티온 S-전달효소(glutathione S-transferase), 3-케토아실 CoA 티올레이즈(3-ketoacyl CoA thiolase), 카탈라아제(catalase), Tau 단백질, 미토콘드리아 복합체 1(mitochondria complex 1), 알파-시누클레인(α-synuclein), 아포지단백-A1(apolipoprotein-A1), 아밀로이드-β(amyloid-β) 및 NMDA 수용체(NMDA receptor) 중에서 선택된 어느 하나의 단백질 내 티로신의 니트로화인 것을 특징으로 하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물.
  3. 제1항에 있어서, 상기 단백질 내 티로신의 니트로화(nitration)에 의한 질환은 우울증(depressive disorder), 불안장애(anxiety disorder), 뇌졸중(stroke), 뇌전증(epilepsy), 녹내장(glaucoma), 당뇨병(diabets), 당뇨망막병증(diabetic retinopathy), 발작(seizure), 간성뇌증(hepaticencephalopathy), 인지기능장애(cognitive impairment), 뇌발달장애(brain development impairment), 암(cancer), 알츠하이머병(Alzheimer disease), 급성 신장 손상(Acute kidney injury) 및 고암모니아혈증(Hyperammonemia) 중에서 선택된 어느 하나인 것을 특징으로 하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물.
  4. 제1항에 있어서, 상기 단백질 내 티로신의 니트로화(nitration)에 의한 질환은 뇌, 간, 근육, 지방조직, 신장조직, 췌장 또는 폐에서 발생하는 것을 특징으로 하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물.
  5. 제1항에 있어서, 상기 조성물은 환, 정제(tablet), 캡슐(capsule), 산제, 분말, 과립, 캔디, 시럽 및 음료 중에서 선택된 어느 하나의 제형으로 제조되는 것을 특징으로 하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 개선용 건강기능식품 조성물.
  6. 티로신 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 치료용 약학 조성물.
  7. 제6항에 있어서, 상기 티로신 이외에 추가로 담체, 부형제 또는 희석제를 더 포함하는 것을 특징으로 하는 단백질 내 티로신의 니트로화(nitration)에 의한 질환의 예방 또는 치료용 약학 조성물.
  8. 니트로화(nitration) 티로신을 포함하는 단백질에 티로신을 처리하여 니트로화 티로신으로부터 니트로기를 제거하는 방법.
PCT/KR2021/008259 2020-06-30 2021-06-30 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물 WO2022005201A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US18/013,412 US20230248681A1 (en) 2020-06-30 2021-06-30 Composition for preventing, ameliorating, or treating disease caused by nitration of tyrosine in proteins comprising tyrosine as effective component
CN202180047217.6A CN115996645A (zh) 2020-06-30 2021-06-30 包含酪氨酸作为有效成分的用于预防、改善或治疗由蛋白质中酪氨酸硝化引起的疾病的组合物
JP2022581606A JP2023532939A (ja) 2020-06-30 2021-06-30 チロシンを有効成分として含むタンパク質内のチロシンのニトロ化による疾患の予防、改善または治療用組成物
EP21832930.8A EP4173494A4 (en) 2020-06-30 2021-06-30 COMPOSITION FOR THE PREVENTION, IMPROVEMENT OR TREATMENT OF DISEASES CAUSED BY NITRATION OF TYROSINE IN A PROTEIN CONTAINING TYROSINE AS ACTIVE INGREDIENT
CA3184258A CA3184258A1 (en) 2020-06-30 2021-06-30 Composition for preventing, ameliorating, or treating diseases caused by nitration of tyrosine in protein, containing tyrosine as active ingredient

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200080308 2020-06-30
KR10-2020-0080308 2020-06-30

Publications (1)

Publication Number Publication Date
WO2022005201A1 true WO2022005201A1 (ko) 2022-01-06

Family

ID=79317633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/008259 WO2022005201A1 (ko) 2020-06-30 2021-06-30 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물

Country Status (7)

Country Link
US (1) US20230248681A1 (ko)
EP (1) EP4173494A4 (ko)
JP (1) JP2023532939A (ko)
KR (1) KR102686466B1 (ko)
CN (1) CN115996645A (ko)
CA (1) CA3184258A1 (ko)
WO (1) WO2022005201A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220120515A (ko) * 2021-02-23 2022-08-30 경상국립대학교산학협력단 티로신이 말단에 위치하는 펩타이드를 유효성분으로 함유하는 단백질의 니트로화에 의해 발생하는 질환의 예방, 개선 또는 치료용 조성물
KR20230128606A (ko) * 2022-02-28 2023-09-05 경상국립대학교산학협력단 티로신을 유효성분으로 함유하는 알츠하이머병의 예방, 개선 또는 치료용 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200018488A (ko) 2017-05-24 2020-02-19 토리스 게엠베하 고암모니아혈증을 치료하기 위한 글루타민 합성효소의 용도
KR20200038481A (ko) 2017-07-19 2020-04-13 호프만 테크놀로지스, 인크. 스트레스-관련 장애를 치료하기 위한 조성물
KR20200049359A (ko) * 2018-10-31 2020-05-08 중앙대학교 산학협력단 항산화 물질을 유효성분으로 포함하는 비스페놀 a에 의한 생식독성 완화용 조성물

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1070827A (zh) * 1992-10-26 1993-04-14 济南市中心医院 糖尿病最新治疗剂及其制法
KR100389243B1 (ko) * 2000-12-01 2003-06-27 제노마인(주) 퍼옥시나이트라이트에 대한 소거 활성을 갖는 식물 추출물및 이를 유효성분으로 하는 약학적 조성물
CN101084925B (zh) * 2007-06-22 2011-08-10 王蓓蕾 一种鹿茸母液的生产工艺
CN101332210A (zh) * 2007-06-25 2008-12-31 三菱制药（广州）有限公司 治疗肾病用复方氨基酸注射液
CN101332209B (zh) * 2007-06-25 2010-12-08 三菱制药（广州）有限公司 治疗肝性脑病的复方氨基酸注射液
KR101048657B1 (ko) * 2010-08-11 2011-07-12 월드웨이(주) 실크 아미노산 및 티로신을 유효성분으로 포함하는 뇌질환 예방 및 개선용 조성물
EP2601946A1 (en) * 2011-12-06 2013-06-12 Pécsi Tudomànyegyetem Treatment and prevention of diseases related to oxidative stress
US9447157B2 (en) * 2013-09-13 2016-09-20 Augusta University Research Institute, Inc. Nitration shielding peptides and methods of use thereof
JP6801894B2 (ja) * 2016-10-31 2020-12-16 国立大学法人東北大学 血中尿毒症物質の低減剤

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200018488A (ko) 2017-05-24 2020-02-19 토리스 게엠베하 고암모니아혈증을 치료하기 위한 글루타민 합성효소의 용도
KR20200038481A (ko) 2017-07-19 2020-04-13 호프만 테크놀로지스, 인크. 스트레스-관련 장애를 치료하기 위한 조성물
KR20200049359A (ko) * 2018-10-31 2020-05-08 중앙대학교 산학협력단 항산화 물질을 유효성분으로 포함하는 비스페놀 a에 의한 생식독성 완화용 조성물

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
GELENBERG ALAN J.: "Tyrosine for the treatment of depression", AM J PSYCHIATRY, vol. 137, no. 5, 1 May 1980 (1980-05-01), pages 622 - 623, XP055884536 *
KAYACAN YILDIRIM, CAN KISA EMIN, GHOJEBEIGLOO BABAK ELMI, KOCACAN SULEYMAN EMRE, AYYILDIZ MUSTAFA, AGAR ERDAL: "The effects of moderate running exercise and L‑tyrosine on penicillin‑induced epileptiform activity in rats", ACTA NEUROBIOLOGIAE EXPERIMENTALIS, vol. 79, 1 January 2019 (2019-01-01), pages 148 - 154, XP055884528, DOI: 10.21307/ane‑2019‑013 *
See also references of EP4173494A4
YAMORI YUKIO: "Prophylactic trials for stroke in stroke-prone SHR (SHRSP) (5) Mechanism of blood pressure reduction by tyrosine administration", JAPANESE HEART JOURNAL, vol. 21, no. 4, 1 January 1980 (1980-01-01), pages 576, XP055884530 *
YOUNG SIMON N.: "L-Tyrosine to alleviate the effects of stress?", JOURNAL OF PSYCHIATRY & NEUROSCIENCE, vol. 32, no. 3, 1 January 2007 (2007-01-01), pages 224, XP055884532 *

Also Published As

Publication number Publication date
EP4173494A1 (en) 2023-05-03
US20230248681A1 (en) 2023-08-10
CA3184258A1 (en) 2022-01-06
KR20220002151A (ko) 2022-01-06
JP2023532939A (ja) 2023-08-01
KR102686466B1 (ko) 2024-07-18
CN115996645A (zh) 2023-04-21
EP4173494A4 (en) 2024-07-03

Similar Documents

Publication Publication Date Title
WO2022005201A1 (ko) 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물
WO2016093599A1 (ko) 박테로이데스 에시디페시언스를 유효성분으로 포함하는, 대사성 질환 예방 또는 치료용 약학적 조성물
WO2020218720A1 (ko) 익모초 추출물 또는 레오누린을 함유하는 근육 질환 예방 또는 치료용 또는 근 기능 개선용 조성물
WO2019231150A1 (ko) 해국 추출물을 포함하는 근육 질환 예방, 개선 또는 치료용, 또는 근 기능 개선용 조성물
WO2016048005A2 (ko) 신규한 펜타디에노일 피페리딘 유도체 및 그의 용도
WO2020242113A1 (ko) 인디안구스베리 추출물과 새싹보리 추출물의 복합물(ib복합물)을 유효성분으로 포함하는 비만 및/또는 당뇨를 동반하는 대사증후군의 예방, 개선 치료용 조성물
WO2020106048A1 (ko) 퇴행성 신경질환의 예방 또는 치료용 약학 조성물
WO2020122391A1 (ko) 호모해링토닌을 유효성분으로 함유하는 세포노화 관련 질환 예방 또는 치료용 조성물
WO2010041908A2 (ko) 판두라틴 유도체 또는 보에센베르기아 판두라타 추출물의 신규한 용도
WO2020189911A1 (ko) 노르안하이드로이카리틴을 포함하는 심혈관 대사 질환의 예방 또는 치료용 조성물
WO2022182141A1 (ko) 티로신이 말단에 위치하는 펩타이드를 유효성분으로 함유하는 단백질의 니트로화에 의해 발생하는 질환의 예방, 개선 또는 치료용 조성물
WO2018043852A1 (ko) 우엉 뿌리 추출물을 유효성분으로 함유하는 당뇨합병증 예방 또는 치료용 약학조성물
WO2021033995A1 (ko) 초과 추출물을 함유하는 근육 감소 관련 질병의 예방, 개선, 또는 치료용 조성물
WO2016056769A1 (ko) 세룰레닌 또는 세룰레닌 유도체를 유효성분으로 함유하는 염증 질환 예방 또는 치료용 약학 조성물
WO2017014545A1 (ko) 멜라닌 응집 호르몬을 유효성분으로 포함하는 파킨슨병 치료 및 레보도파 부작용 억제용 약학 조성물
WO2021086101A1 (ko) 신규 화합물의 근위축성측색경화증 예방, 개선 또는 치료 용도
WO2018135738A1 (ko) 매트릭스 gla 단백질을 유효성분으로 함유하는 미오스타틴 활성 저해용 조성물
WO2022203395A1 (ko) 신규한 화합물 및 이를 포함하는 퇴행성 뇌질환 예방 또는 치료용 조성물
WO2022270760A1 (ko) 커큐민 유도체와 tgf-β 수용체 억제제의 병용투여를 통한 비알코올성 지방간염 치료 방법
WO2023282699A1 (ko) 마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물
WO2023140505A1 (ko) 할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물
WO2021075818A1 (ko) 항염증 활성을 갖는 남극 지의류 움빌리카리아 안타티카 추출물 및 이를 함유하는 조성물
WO2017192013A1 (ko) 팥을 포함하는 근 기능 개선 또는 운동수행능력 향상용 조성물
WO2022234888A1 (ko) 이미다졸린 유도체 화합물을 유효성분으로 포함하는 황반 변성 치료용 약학적 조성물
WO2024167295A1 (ko) 칸데사르탄 또는 아질사르탄을 포함하는 조성물의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21832930

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3184258

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022581606

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021832930

Country of ref document: EP

Effective date: 20230130