WO2023282699A1 - 마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물 - Google Patents

마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물 Download PDF

Info

Publication number
WO2023282699A1
WO2023282699A1 PCT/KR2022/009967 KR2022009967W WO2023282699A1 WO 2023282699 A1 WO2023282699 A1 WO 2023282699A1 KR 2022009967 W KR2022009967 W KR 2022009967W WO 2023282699 A1 WO2023282699 A1 WO 2023282699A1
Authority
WO
WIPO (PCT)
Prior art keywords
quince
extract
group
preventing
alcohol
Prior art date
Application number
PCT/KR2022/009967
Other languages
English (en)
French (fr)
Inventor
황명오
Original Assignee
주식회사 비엔지
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210090504A external-priority patent/KR102421111B1/ko
Priority claimed from KR1020210090506A external-priority patent/KR20230009739A/ko
Priority claimed from KR1020210090503A external-priority patent/KR102610157B1/ko
Priority claimed from US17/535,815 external-priority patent/US20230030099A1/en
Application filed by 주식회사 비엔지 filed Critical 주식회사 비엔지
Publication of WO2023282699A1 publication Critical patent/WO2023282699A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/73—Rosaceae (Rose family), e.g. strawberry, chokeberry, blackberry, pear or firethorn
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics

Definitions

  • the present invention is related to specific research, and the research is a study supported by the Ministry of SMEs and Startups' regional specialized industry development in 2022 (Task number: S3270049).
  • the number of obese people is rapidly increasing due to excessive energy accumulation in the body due to frequent intake of instant foods and a meat-oriented diet, and reduction of energy consumption due to lack of exercise.
  • Chlorogenic acid is one of the most consumed phenolic compounds in the human diet, and various studies have been conducted on the physiological activity of chlorogenic acid. Various physiological activities have been identified.
  • Anti-obesity drugs and metabolic disease treatments developed so far cause side effects by acting on sympathetic nerves or hormones, but there is a problem that the effect is insignificant in the case of herbal ingredients with few side effects.
  • the present inventors have repeatedly studied the anti-obesity effect of chlorogenic acid. As a result, the content of chlorogenic acid in the quince extract was confirmed, and the quince extract containing chlorogenic acid inhibited weight gain, improved lipid metabolism, improved obesity-related hormone levels, reduced blood sugar, and reduced blood cholesterol, etc., thereby confirming the present invention. completed.
  • One example provides a composition for weight and/or body fat reduction comprising a quince extract as an active ingredient.
  • Another example provides a composition for lowering blood sugar containing a quince extract as an active ingredient.
  • Another example provides a blood cholesterol lowering composition
  • a blood cholesterol lowering composition comprising a quince extract as an active ingredient.
  • Another example provides a composition for preventing, improving, and/or treating obesity comprising a quince extract as an active ingredient.
  • Another example provides a composition for preventing, improving, and/or treating metabolic diseases comprising a quince extract as an active ingredient.
  • the composition may be a pharmaceutical composition or a food composition (eg, health functional food).
  • Another example provides a weight loss method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of weight and/or body fat reduction.
  • Another example provides a blood glucose lowering method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need thereof.
  • Another example provides a blood cholesterol lowering method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need thereof.
  • Another example provides a method for preventing, improving, and/or treating obesity, comprising administering a quince extract to a subject in need of prevention, improvement, and/or treatment of obesity.
  • Another example provides a method for preventing, improving, and/or treating metabolic diseases, comprising administering a quince extract to a subject in need of such prevention, improvement, and/or treatment of metabolic diseases.
  • Another example provides the use of the quince extract for preventing, ameliorating, and/or treating obesity or for preparing a medicament or food for preventing, ameliorating, and/or treating obesity.
  • Another example provides the use of the quince extract for the prevention, improvement, and/or treatment of metabolic diseases, or the use of the quince extract for the production of pharmaceuticals or foods for the prevention, improvement, and/or treatment of metabolic diseases.
  • the quince extract administered with a high-fat diet effectively suppresses the increase in body weight and/or body fat and adipose tissue weight, blood sugar, blood cholesterol, blood insulin and leptin content induced by the high-fat diet, By confirming that the size increase is inhibited, anti-obesity, weight and / or body fat reduction, blood sugar reduction, blood cholesterol reduction, prevention, improvement, and / or treatment of metabolic diseases of the quince extract are provided.
  • one example provides a composition for weight and/or body fat reduction comprising a quince extract as an active ingredient.
  • Another example provides a composition for lowering blood sugar containing a quince extract as an active ingredient.
  • Another example provides a blood cholesterol lowering composition
  • a blood cholesterol lowering composition comprising a quince extract as an active ingredient.
  • Another example provides a composition for preventing, improving, and/or treating obesity comprising a quince extract as an active ingredient.
  • Another example provides a composition for preventing, improving, and/or treating metabolic diseases comprising a quince extract as an active ingredient.
  • the composition may be a pharmaceutical composition or a food composition (eg, health functional food).
  • Another example provides a method for reducing body weight and/or body fat comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of weight loss.
  • Another example provides a blood glucose lowering method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need thereof.
  • Another example provides a blood cholesterol lowering method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need thereof.
  • Another example provides a method for preventing, improving, and/or treating obesity, comprising administering a quince extract to a subject in need of prevention, improvement, and/or treatment of obesity.
  • Another example provides a method for preventing, improving, and/or treating metabolic diseases, comprising administering a quince extract to a subject in need of such prevention, improvement, and/or treatment of metabolic diseases.
  • a quince extract is provided as an active ingredient for reducing body weight and/or body fat, reducing blood sugar, reducing blood cholesterol, preventing, improving, and/or treating obesity and/or metabolic diseases.
  • Quince ( Cydonia oblonga ) is a fruit tree of the Rosaceae family, and is also called quince, Aiva, or European quince, and has a similar appearance to the fruit of quince and apple, but is distinguished from them.
  • Quince extract is all or part of quince (eg, at least one selected from the group consisting of fruits, seeds, pulp, peel, leaves, stems, roots, etc.) It may be a solvent extract extracted using.
  • the quince extract may be prepared by removing the quince juice after pressing the quince and extracting the remaining solid quince with an extraction solvent, but is not limited thereto.
  • quince juice means a liquid in the form of juice generated by pressing a quince fruit.
  • the extraction solvent may be at least one selected from the group consisting of water and straight-chain or branched-chain alcohol having 1 to 4 carbon atoms (eg, ethanol, fermented alcohol).
  • the extraction solvent may be at least one selected from the group consisting of water and an aqueous solution of straight-chain or branched-chain alcohol having 1 to 4 carbon atoms (e.g., aqueous ethanol solution, fermented alcohol), and the linear or branched-chain alcohol solution having 1 to 4 carbon atoms.
  • branched chain alcohol aqueous solution for example, 10 to 70 (v / v)%, 15 to 70 (v / v)%, 20 to 70 (v / v)%, 25 to 70 (v / v)%, 30 to 70 (v/v)%, 10 to 65 (v/v)%, 15 to 65 (v/v)%, 20 to 65 (v/v)%, 25 to 65 (v/v)%, 30 to 65 (v/v)%, 10 to 60 (v/v)%, 15 to 60 (v/v)%, 20 to 60 (v/v)%, 25 to 60 (v/v)%, 30 to 60 (v/v)%, 10 to 55 (v/v)%, 15 to 55 (v/v)%, 20 to 55 (v/v)%, 25 to 55 (v/v)%, 30 to 55 (v/v)%, 10 to 50 (v/v)%, 15 to 50 (v/v)%, 20 to 50 (v/v)%, 25 to 70
  • the amount of the extraction solvent used for the extraction is 1 to 10 times the volume of quince, 2 to 10 times, 3 to 10 times, 4 to 10 times, 1 to 9 times, 2 to 9 times, 3 to 9 times the volume, 4 to 9 times the volume, 1 to 8 times the volume, 2 to 8 times the volume, 3 to 8 times the volume, 4 to 8 times the volume, 1 to 7 times the volume, 2 to 7 times the volume, 3 to 7 times the volume It may be 4 to 7 times by volume, 1 to 6 times by volume, 2 to 6 times by volume, 3 to 6 times by volume, or 4 to 6 times by volume, but is not limited thereto.
  • the extraction time is, but is not limited to, 1 to 24 hours, 1 to 12 hours, 1 to 6 hours, 1 to 5 hours, 3 to 24 hours, 3 to 12 hours, 3 to 6 hours for sufficient extraction of active ingredients. time, 3 to 5 hours, 5 to 24 hours, 5 to 12 hours or 5 to 6 hours.
  • the extraction temperature is, but is not limited to, a temperature range selected from room temperature to the boiling point of the extraction solvent, for example, 50 to 100 ° C, 55 to 100 ° C, 60 to 100 ° C, 65 to 100 ° C, for effective extraction of active ingredients.
  • An extraction method for obtaining the extract may be selected from all known extraction methods commonly used in the art to which the present invention belongs. For example, conventionally used extraction methods such as reflux extraction, immersion extraction, heating extraction, cold precipitation, hot water extraction, ultrasonic extraction, filtration, pressurized extraction, supercritical extraction, and electrical extraction may be used.
  • conventionally used extraction methods such as reflux extraction, immersion extraction, heating extraction, cold precipitation, hot water extraction, ultrasonic extraction, filtration, pressurized extraction, supercritical extraction, and electrical extraction may be used.
  • the extraction may be performed once, or may be performed two or more times (eg, 2, 3, 4, or 5 times) with the same or different extraction solvents and/or conditions.
  • the extraction conditions such as the extraction solvent used in each extraction, the extraction time for each extraction, and the temperature may be adjusted identically or differently within the range described above, but are not limited thereto.
  • the extract is 10 to 100 brix, 20 to 100 brix, 30 to 100 brix, 40 to 100 brix, 50 to 100 brix, 60 to 100 brix, 70 to 100 brix, 80 to 100 brix, 90 to 100 brix 100 brix, 10 to 90 brix, 20 to 90 brix, 30 to 90 brix, 40 to 90 brix, 50 to 90 brix, 60 to 90 brix, 70 to 90 brix, 80 to 90 brix, 10 to 80 brix, 20 to 80 brix, 30 to 80 brix, 40 to 80 brix, 50 to 80 brix, 60 to 80 brix, 70 to 80 brix, 10 to 70 brix, 20 to 70 brix, 30 to 70 brix, 40 to 70 brix, 50 to It may have a sugar content of 70 brix or 60 to 70 brix, but is not limited thereto.
  • the quince extract is not only the solvent extract described above, but also the solvent extract is concentrated by a conventional method (eg, vacuum concentration, vacuum concentration, etc.), dried (eg, spray drying, freeze-drying, etc.), and / or pulverized (powdered) concentrates, dried substances, and/or pulverized substances.
  • a conventional method eg, vacuum concentration, vacuum concentration, etc.
  • dried eg, spray drying, freeze-drying, etc.
  • pulverized pulverized
  • the quince extract provided as an active ingredient in the present specification has a chlorogenic acid content measured by HPLC of 0.2 mg/g or more, 0.3 mg/g or more, based on the total weight of the extract (eg, concentrate weight).
  • One embodiment provides a pharmaceutical composition for reducing body weight and / or body fat containing a quince extract as an active ingredient.
  • Another example provides a pharmaceutical composition for lowering blood sugar containing a quince extract as an active ingredient.
  • Another example provides a pharmaceutical composition for lowering blood cholesterol containing a quince extract as an active ingredient.
  • Another example provides a pharmaceutical composition for preventing, improving, and/or treating obesity comprising a quince extract as an active ingredient.
  • Another example provides a pharmaceutical composition for preventing, improving, and/or treating metabolic diseases comprising a quince extract as an active ingredient.
  • Another example provides a weight loss method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of weight and/or body fat reduction.
  • Another example provides a blood glucose lowering method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need thereof.
  • Another example provides a blood cholesterol lowering method comprising administering a pharmaceutically effective amount of a quince extract to a subject in need thereof.
  • Another example provides a method for preventing, improving, and/or treating obesity, comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of prevention, improvement, and/or treatment of obesity.
  • Another embodiment provides a method for preventing, improving, and/or treating metabolic diseases, comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of such prevention, improvement, and/or treatment of metabolic diseases. .
  • a pharmaceutically effective amount of the quince extract can be used to (1) reduce body weight and/or body fat, (2) lower blood sugar, (3) lower blood cholesterol, and/or (4) prevent, improve, and/or prevent obesity and/or metabolic diseases.
  • the content of the quince extract is 1 to 400 mg/kg (body weight; BW), 50 to 400 mg/kg, 100 to 400 mg based on the body weight of the subject to be administered.
  • 150 to 400 mg/kg, 200 to 400 mg/kg, 1 to 300 mg/kg (body weight; BW), 50 to 300 mg/kg, 100 to 300 mg/kg, 150 to 300 mg/kg , 200 to 300 mg/kg, 1 to 200 mg/kg (body weight; BW), 50 to 200 mg/kg, 100 to 200 mg/kg, and 150 to 200 mg/kg may be administered, limited thereto. it is not going to be
  • a pharmaceutically effective amount of the quince extract can be used to (1) reduce body weight and/or body fat, (2) lower blood sugar, (3) lower blood cholesterol, and/or (4) prevent, improve, and/or prevent obesity and/or metabolic diseases.
  • the dose may be determined by calculating by applying a body conversion factor (0.08). Accordingly, in the step of administering to a human in need of prevention, improvement, and/or treatment of obesity and/or metabolic disease, the content of the quince extract is 0.0048 to 1.92 g based on 60 kg of the body weight of the human to be administered.
  • the quince extract was as described above.
  • the blood glucose lowering refers to a concept including a decrease in blood glucose concentration, a decrease in blood insulin content, a decrease in insulin resistance, and/or an increase in insulin sensitivity.
  • Insulin resistance can be calculated by Equation 2 of Example 6.3 below, and insulin sensitivity can be calculated by Equation 3 of Example 6.3 below.
  • the lowering of blood cholesterol means a decrease in total cholesterol content or low-density lipoprotein (LDL) cholesterol content in blood.
  • LDL low-density lipoprotein
  • the obesity refers to a state in which body fat is abnormally large, and refers to a state in which a large amount of calories are consumed but not consumed and stored in the form of fat in the body.
  • obesity may mean a state in which a body mass index (BMI; weight divided by height squared; kg/m 2 ) is about 25 kg/m 2 or more, but is not limited thereto.
  • BMI body mass index
  • the metabolic disease may be a general term for diseases that cause abnormalities in each organ as metabolites accumulate in the body or specific organs in the body due to disorders or functional abnormalities of hormones or internal organs involved in metabolism.
  • the metabolic disease may be a disease caused by the accumulation of one or more types selected from the group consisting of glucose, cholesterol, and triglycerides in blood or all of them.
  • the metabolic disease may be diabetes, hyperlipidemia, atherosclerosis, hyperinsulinemia or metabolic syndrome.
  • Diabetes mellitus is a kind of systemic metabolic disease caused by genetic or environmental factors. It is a disease caused by an absolute or relative lack of insulin in the body, and refers to a state in which blood sugar concentration is abnormally high.
  • diabetes may include all of type 1 diabetes, type 2 diabetes, and gestational diabetes, and in particular, may be type 2 diabetes related to insulin resistance.
  • Hyperlipidemia may refer to a condition in which more than necessary fat substances are present in the blood or cause inflammation. For example, hyperlipidemia can be diagnosed when fasting serum cholesterol is 220 mg/dl or more or triglyceride is 150 mg/dl or more, but is not limited thereto. Hyperlipidemia may refer to hypercholesterolemia, hypertriglyceridemia, or both.
  • Arteriosclerosis is a general term for diseases in which arterial blood vessels are narrowed for reasons such as the formation of blood clots in arteries. In the present specification, it may be related to high cholesterol and/or triglyceride content in blood.
  • Hyperinsulinemia refers to a state in which blood insulin levels are high, and is characterized by organic hyperinsulinemia caused by proliferation (adenoma, hypertrophy) of islets of Langerhans, and functional disorders caused by dysfunction of the autonomic nervous system and digestive system without islet adenoma. It can be divided into hyperinsulinemia.
  • Metabolic syndrome refers to a syndrome in which risk factors such as hyperlipidemia, hypertension, abnormal glucose metabolism, and obesity appear together. Metabolic syndrome is a disease presumed to be caused by insulin resistance.
  • 'treatment' includes improvement, alleviation or stabilization of a disease state or symptom, partial or complete recovery, prolongation of survival, reduction of disease extent, delay or alleviation of disease progression, and other beneficial treatment results.
  • 'Prevention' is used in the meaning of including all mechanisms and/or effects that prevent the occurrence of a specific disease by acting on a subject who does not have a specific disease, delay the onset of the specific disease, or reduce the incidence of the specific disease.
  • the content of the quince extract used as an active ingredient in the pharmaceutical composition provided herein can be appropriately adjusted depending on the type and purpose of use, the condition of the subject to be used, the type and severity of symptoms, etc., and the solid content (after removing the solvent from the extract)
  • Solid component 0.001 to 99.9% by weight, 0.001 to 90% by weight, 0.001 to 75% by weight, 0.001 to 50% by weight, 0.01 to 99.9% by weight, 0.01 to 90% by weight, 0.01 to 75% by weight, 0.01 to 0.01% by weight 50 wt%, 0.1 to 99.9 wt%, 0.1 to 90 wt%, 0.1 to 75 wt%, 0.1 to 50 wt%, 1 to 99.9 wt%, 1 to 90 wt%, 1 to 75 wt%, 1 to 50 wt% %, 5 to 99.9%, 5 to 90%, 5 to 75%, 5 to 50%, 10 to 99.9%, 10 to 90%, 10 to 75%, or 10 to 50%
  • the pharmaceutical composition or active ingredient, the quince extract is used in humans, primates such as monkeys, rodents such as mice, rats, rabbits, other mammals including dogs, cats, cows, pigs, sheep, horses, goats, chickens, etc. , birds including ducks and geese, reptiles including snakes, lizards, turtles, crocodiles, etc., amphibians, and vertebrates such as fish, etc., may be administered to an administration subject selected from various routes.
  • the method of administration of the pharmaceutical composition may be any method commonly used, for example, oral administration, or parenteral administration such as intravenous, intramuscular, subcutaneous, or intraperitoneal injection may be administered.
  • the pharmaceutical composition may be for oral administration, but is not limited thereto.
  • the pharmaceutical composition may be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, or parenteral formulations in the form of sterile injectable solutions according to conventional methods, respectively. there is.
  • the pharmaceutical composition is generally selected from the group consisting of pharmaceutically and / or physiologically acceptable carriers, excipients, diluents, etc., selected in consideration of the method of administration and standard pharmaceutical practice. It may be administered in combination with one or more selected adjuvants.
  • the pharmaceutically and/or physiologically acceptable carrier may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, It may contain at least one selected from the group consisting of cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. However, it is not limited thereto, and may be any carrier commonly used in the pharmaceutical field.
  • the pharmaceutically and / or physiologically acceptable diluent and / or excipient is from the group consisting of all fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, etc. commonly used in the appropriate formulation of pharmaceutical compositions. It may be one or more selected species.
  • the excipient is at least one material for formulation of such solid preparations, such as starch, calcium carbonate , sucrose, lactose, and may be one or more selected from the group consisting of gelatin.
  • lubricants such as magnesium styrate, talc, and the like may also be used.
  • formulation of liquid preparations for oral administration such as suspensions, internal solutions, emulsions, syrups, etc.
  • at least one selected from the group consisting of commonly used simple diluents such as water, liquid paraffin, etc.
  • Various excipients commonly used for example, wetting agents, sweeteners, aromatics, and / or preservatives may be included, but are not limited thereto.
  • the pharmaceutical composition may be in the form of a tablet containing starch or lactose, or in the form of a capsule containing suitable excipients, or in the form of an elixir or suspension containing a flavoring or coloring chemical, orally, orally. It can be administered intra- or sublingually.
  • Such liquid formulations may be prepared by suspending agents (e.g. methylcellulose, semi-synthetic glycerides such as Witepsol, or mixtures of Apricot kernel oil and PEG-6 esters or PEG-8 and caprylic/capric acid). It can be formulated with pharmaceutically acceptable excipients such as mixtures of glycerides), but is not limited thereto.
  • One example provides a food composition for weight and / or body fat reduction containing a quince extract as an active ingredient.
  • Another example provides a food composition for lowering blood sugar containing a quince extract as an active ingredient.
  • Another example provides a food composition for lowering blood cholesterol containing a quince extract as an active ingredient.
  • Another example provides a food composition for preventing and/or improving obesity comprising a quince extract as an active ingredient.
  • Another example provides a food composition for preventing and/or improving metabolic diseases comprising a quince extract as an active ingredient.
  • Another example is a food composition
  • a quince extract as an active ingredient for (1) weight and/or body fat reduction, (2) blood sugar lowering, (3) blood cholesterol lowering and/or (4) obesity and/or metabolic disease.
  • a method for weight loss comprising administering to a subject in need of prevention, improvement and/or treatment.
  • the food composition may be used for (1) reducing body weight and/or body fat, (2) lowering blood sugar, (3) lowering blood cholesterol, and/or (4) preventing, improving, and/or treating obesity and/or metabolic disease.
  • the content of the quince extract is 1 to 400 mg/kg (body weight; BW), 50 to 400 mg/kg, 100 to 400 mg/kg, 150 to 400 based on the body weight of the subject to be administered.
  • mg/kg, 200 to 400 mg/kg, 1 to 300 mg/kg (body weight; BW), 50 to 300 mg/kg, 100 to 300 mg/kg, 150 to 300 mg/kg, 200 to 300 mg/kg kg, 1 to 200 mg/kg (body weight; BW), 50 to 200 mg/kg, 100 to 200 mg/kg, and 150 to 200 mg/kg may be administered, but is not limited thereto.
  • the food composition may be used for (1) reducing body weight and/or body fat, (2) lowering blood sugar, (3) lowering blood cholesterol, and/or (4) preventing, improving, and/or treating obesity and/or metabolic disease.
  • the dosage may be determined by calculating by applying a body conversion factor (0.08). Accordingly, in the step of administering to a human in need of prevention, improvement, and/or treatment of obesity and/or metabolic disease, the content of the quince extract is 0.0048 to 1.92 g based on 60 kg of the body weight of the human to be administered.
  • the quince extract, lowering blood sugar, lowering blood cholesterol, and metabolic diseases are as described above.
  • the term "food” means an edible natural product or processed product containing one or more nutrients, and as a conventional meaning, various general foods, health functional foods, beverages, food additives, beverages It may be used to mean one or more selected from the group consisting of additives and the like.
  • the term “food composition” may refer to a combination of ingredients for preparing the food product. In one example, the food may mean health functional food.
  • the content of the quince extract in the food composition can be appropriately adjusted depending on the type of food use, purpose, etc., for example, 0.00001 to 99.9% by weight, 0.0001 to 99.9% by weight, 0.001 to 99.9% by weight, or 0.001% by weight based on the solid content. to 50% by weight, but is not limited thereto.
  • the administration 'subject' of the food composition is a human, primates such as monkeys, rodents such as mice, rats, rabbits, other mammals including dogs, cats, cows, pigs, sheep, horses, goats, chickens, ducks, Birds including geese, reptiles including snakes, lizards, turtles and crocodiles, amphibians, and vertebrates such as fish, cells, tissues, or cell cultures isolated from the objects.
  • the quince extract provided herein reduces or effectively suppresses the increase in body weight and / or body fat and adipose tissue weight, blood sugar, blood cholesterol, blood insulin and leptin, thereby reducing obesity and improving lipids. It further suggests that there is a preventive, therapeutic, and / or ameliorative effect on metabolic diseases, and future anti-obesity efficacy and / or a preventive, therapeutic, and / or ameliorative effect on metabolic diseases Possibility of development as a health functional material presents
  • FIG. 1a and 1b are graphs showing the results of analyzing the chlorogenic acid content in the quince extract by HPLC chromatography.
  • Figure 1a shows the chlorogenic acid standard form
  • Figure 1b shows the results of sample c (Table 4 in Example 2.2).
  • Figure 2 is a graph showing the weekly weight change according to the type of diet.
  • Group 1 is the control diet group
  • group 2 is the high-fat diet group
  • group 3 is the high-fat diet group administered with mdB-44.
  • 3 is a photograph of histological changes in epididymal adipose tissue observed using an optical microscope (Carl Zeiss).
  • Figure 4 is a graph showing the results of confirming the degree of adipocyte differentiation according to the extraction method of the quince extract.
  • mdB-44 refers to a quince extract that has undergone a quince pressing step
  • EE refers to a quince extract prepared without additional processing.
  • FIG. 5 is a graph showing the results of measuring the chlorogenic acid content in the extract according to the extraction method of the quince extract.
  • A means the chlorogenic acid content analysis result of EE
  • B means the chlorogenic acid content analysis result of mdB-44.
  • the chlorogenic acid (CGA) content of the quince extract prepared in Example 1 was analyzed using an LC-20A high-performance liquid chromatography (HPLC) system (Shimadzu, Japan). HPLC analysis conditions are shown in Table 1 (analysis conditions) and Table 2 (mobile phase gradient conditions) below.
  • sample name Content (mg/g) sample a 0.82 sample b 0.7 sample c 0.73
  • the chlorogenic acid content in the quince extract prepared in Example 1 was 0.82 mg/g for sample a, 0.7 mg/g for sample b, and 0.73 mg for sample c. /g, it was confirmed that the distribution was within the range of ⁇ 20% based on the case of sample c having an intermediate value of chlorogenic acid content.
  • the results show that the quince extract obtained in Example 1 contains chlorogenic acid in a certain range (e.g., 0.75 (mg/g) ⁇ 20%), and these results show that even after performing the extraction several times, the chlorogenic acid contained in the extract It shows that the acid content is in the same range.
  • the powdered quince extract (powder; hereinafter, 'mdB-44') prepared in Example 1 was used, and all animal experiments in the following examples were conducted under the approval of the Animal Experimentation Ethics Committee of Hallym University. It was performed according to regulations (Hallym 2019-67).
  • mice free of specific pathogens were purchased from Dooyeol Biotech Co., Ltd. and used. After a week of quarantine and adaptation, healthy animals without weight loss were selected and used in the experiment. Experimental animals were raised in a breeding environment set at a temperature of 23 ⁇ 3 ° C, relative humidity of 50 ⁇ 10%, ventilation frequency of 10 to 15 times / hour, lighting time of 12 hours (08:00 to 20:00), and illumination of 150 to 300 Lux. . During the adaptation period, the experimental animals were allowed to freely consume solid feed for experimental animals (Cargill Agripurina Co., Ltd.) and drinking water.
  • Control Diet (10 kcal% fat) Content of Each Composition
  • Control diet (CD) (10 kcal% fat) Calorie content of each composition
  • High-fat diet (HFD) (60 kcal% fat) Content of each composition
  • High Fat Diet (HFD) (60 kcal% fat) Calorie content of each composition (kcal) Casein, 80 Mesh 200 800 200 800 L-Cystine 3 12 3 12 Corn starch 315 1260 0 0 Maltodextrin 10 35 140 125 500 Sucrose 350 1400 68.8 275.2 Cellulose, BW200 50 0 50 0 Soybean oil 25 225 25 225 Lard* 20 180 245 2205 Mineral mix 10 0 10 0 Dicalcium phosphate 13 0 13 0 Calcium carbonate 5.5 0 5.5 0 Potassium citrate, 1H 2 O 16.5 0 16.5 0 Vitamin mix V10001 10 40 10 40 Choline bitartrate 2 0 2 0 Sum 1055.
  • Example 3.1 Drinking water was freely consumed during the entire test period, and the test substance of Example 3.1 was dissolved in drinking water at 200 mg per 1 kg of experimental animals and orally administered at a certain time for 8 weeks (Group 3).
  • Statistical processing in the following examples using the corresponding experimental animals was expressed as mean ⁇ standard error.
  • the collected results were analyzed using the GraphPad Prism 5.0 (GraphPad software) program. Student's t-test and one-way analysis of variance (ANOVA) were used to compare the difference between the test substance administration group and the control group. Only when p ⁇ 0.05 or more was judged statistically significant.
  • the body weights of the experimental animals prepared in Example 3 were measured at 0 and 8 weeks, and food intake was measured every 2 days for 8 weeks.
  • the daily food intake and daily energy intake were calculated by calculating the intake amount during the entire test period.
  • Food efficiency ratio (FER) was calculated by dividing the weight gain during the test period by the amount of food consumed during the same period as shown in Equation 1 below.
  • Dietary efficiency weight gain (g) / dietary intake (g)
  • the measured weight results and the resulting total weight gain and daily weight gain are shown in Table 7, and the dietary intake and dietary efficiency measured for 8 weeks are shown in Table 8, and in particular, the weight results are shown in FIG. 2 .
  • group 1 group 2 group 3 empirical diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 0 weeks 23.14 ⁇ 0.35 23.06 ⁇ 0.24 23.10 ⁇ 0.27 8 weeks 31.20 ⁇ 0.67 41.91 ⁇ 0.91 *** 36.45 ⁇ 0.91 ### Total weight gain (g) 8.1 ⁇ 0.7 18.9 ⁇ 0.9 *** 13.4 ⁇ 1.1 ## Daily weight gain (g/day) 0.146 ⁇ 0.013 0.343 ⁇ 0.016 *** 0.243 ⁇ 0.020 ##
  • group 1 group 2 group 3 empirical diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 Total dietary intake (g) 145.4 ⁇ 1.4 129.1 ⁇ 1.2 *** 112.7 ⁇ 1.5 ###
  • Daily dietary intake (g/day) 2.64 ⁇ 0.03 2.35 ⁇ 0.02 *** 2.05 ⁇ 0.03 ###
  • Daily energy intake (kcal/day) 10.18 ⁇ 0.10 12.30 ⁇ 0.11 *** 10.73 ⁇ 0.15 ###
  • Dietary efficiency (weight gain/diet intake) 0.055 ⁇ 0.005 0.146 ⁇ 0.007 *** 0.119 ⁇ 0.009 #
  • body composition components were measured using dual-energy X-ray absorptiometry (DEXA, PIXImusTM, GE Lunar) to evaluate body fat percentage, and the results are in the table 9.
  • the body fat percentage in the high-fat diet control group (Group 2) was 42.84 ⁇ 1.66% compared to 29.58 ⁇ 0.84% in the control group (Group 1), and the body fat percentage significantly increased compared to the high-fat diet control group (Group 2), mdB- 44
  • the percentage of body fat decreased significantly in the 200mg/kg BW group (Group 3).
  • the test animal was sacrificed. Before sacrifice, orbital blood was collected after anesthesia using an anesthetic prepared by diluting tribromoethanol with tert-amyl alcohol. The blood was placed in a serum separate tube (Becton Dickinson), left at room temperature for 30 minutes, and then centrifuged at 5,000 rpm for 10 minutes to separate the serum and stored at -70°C until analysis. After blood collection, the experimental animals were sacrificed, and white adipose tissue (epididymal fat, visceral fat, retro-abdominal fat, inguinal fat) was extracted, rinsed with cold physiological saline, and after removing excess water with filter paper, the weight was measured.
  • white adipose tissue epididymal fat, visceral fat, retro-abdominal fat, inguinal fat
  • Epididymal adipose tissue was divided into three parts, some were fixed in 4% paraformaldehyde (PFA), embedded in paraffin, and tissue staining was performed. Some of them were subjected to real-time RT-PCR after total RNA was isolated. After separation, Western blot was performed and stored at -70°C for future further analysis.
  • PFA paraformaldehyde
  • Example 6.1 The weight of the adipose tissue was measured in Example 6.1, and the results are shown in Table 10.
  • Body fat is divided into white adipose tissue and brown adipose tissue according to its shape or function.
  • White adipose tissue mainly stores surplus energy in the body as fat, brown adipose tissue produces heat, and the weight of white adipose increases. The more you do it, the more weight you gain.
  • the weights of epididymal fat, retroperitoneal fat, visceral fat, and inguinal fat, which are white adipose tissues, were all significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1).
  • group 3 to which the quince extract was administered showed a decrease in body fat in all tested items compared to the high-fat diet control group (group 2).
  • the glucose content in the blood collected in Example 6.1 was measured using a blood biochemical analyzer (KoneLab 20 XT, Thermo Fisher Scientific), and the insulin content was presented by the manufacturer using a measurement kit purchased from Millipore Corporation. It was measured according to one method.
  • insulin resistance is the most important factor in metabolic syndrome
  • measurement of blood insulin concentration is very useful for measuring insulin sensitivity and resistance
  • insulin resistance HOMA-IR
  • insulin resistance The sensitivity (QUICKI) was calculated.
  • Insulin resistance homeostatic model assessment for insulin resistance, HOMA-IR
  • insulin sensitivity quantitative insulin sensitivity check index, QUICKI
  • Insulin resistance [insulin (mU/L) ⁇ glucose (mg/dL)] / 405
  • Insulin sensitivity 1 / [log insulin (mU/L) + log glucose (mg/dL)]
  • TG triglyceride
  • CHOL total cholesterol
  • HDL-CHOL HDL-CHOL
  • Atherosclerosis index total cholesterol content / HDL-cholesterol content
  • group 1 group 2 group 3 empirical diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 TG (mg/dL) 77.1 ⁇ 3.3 90.4 ⁇ 3.4 * 77.3 ⁇ 3.2
  • CHOL (mg/dL) 165.7 ⁇ 8.4 188.4 ⁇ 4.7 * 171.8 ⁇ 5.3
  • # HDL-CHOL (mg/dL) 151.6 ⁇ 6.2 126.9 ⁇ 5.8 ** 150.9 ⁇ 6.1 # arteriosclerosis index 1.09 ⁇ 0.04 1.52 ⁇ 0.11 ** 1.15 ⁇ 0.04 ##
  • Blood triglyceride and blood total cholesterol contents were significantly increased in the high-fat control group (Group 2) compared to the control group (Group 1), whereas in Group 3 administered with mdB-44, there was a significant increase compared to Group 2. decreased, and blood triglyceride levels were measured very similarly to those of the control group (Group 1). Blood HDL-cholesterol content was significantly decreased in the high-fat diet control group (group 2) compared to the control diet group (group 1), whereas it was significantly increased in group 3 administered with mdB-44 compared to group 2, It was measured very similarly to the control group (group 1).
  • Adipose tissue is recognized as an endocrine organ that affects the metabolic process of the body by synthesizing and secreting various adipokines that play a very important physiological role as well as a place to store surplus energy.
  • Leptin one of the representative adipokines secreted from adipose tissue, is an important substance regulating energy intake and storage, insulin sensitivity, and metabolic rate.
  • Another major adipokine, adiponectin is known as an important hormone that increases fatty acid oxidation in muscle and prevents chronic diseases such as diabetes and metabolic syndrome through its role as an anti-inflammatory cytokine.
  • Example 6.1 The content of leptin and adiponectin in serum of the blood collected in Example 6.1 was measured using a measurement kit purchased from R&D Systems according to the method suggested by the manufacturer, and the results are shown in Table 13 below.
  • group 1 group 2 group 3 empirical diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 Adiponectin (ng/mL) 10.45 ⁇ 0.26 9.45 ⁇ 0.25 * 10.84 ⁇ 0.37 ##
  • Blood leptin content was significantly increased in the high-fat diet control group (Group 2) compared to the control group (Group 1), and significantly decreased in the mdB-44 administration group (Group 3) compared to Group 2.
  • Blood adiponectin content was significantly decreased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and compared to the high-fat diet control group (Group 2), mdB-44 administration group (Group 3) increased.
  • the increase in the size, number, and quantity of adipocytes in visceral adipose tissue has a positive correlation with the amount of leptin secretion, and a negative correlation with the amount of adiponectin secretion. It significantly reduced the increased leptin in the blood and increased the secretion of adiponectin, thereby exhibiting an anti-obesity effect.
  • tissue excised from the experimental animal in Example 6.1 was embedded in paraffin, and 5 ⁇ m tissue sections were prepared from the embedded tissues. After deparaffinization, tissues were hydrated by sequentially lowering the percentage of alcohol, starting with 100% alcohol to 0% alcohol (H 2 O). Subsequently, tissues were stained using Accustain® Hematoxylin and Eosin Stains (Sigma-Aldrich Co.) according to the method suggested by the manufacturer (hematocylin & eosin staining, H&E staining), and each tissue was examined using an optical microscope (Carl Zeiss). Histological changes were observed.
  • the size and number of adipocytes were measured using the AxioVision Imaging analysis system for epididymal adipose tissue pictures obtained by H&E staining.
  • the histological changes of the epididymal adipose tissue are shown in FIG. 3, and the number of cells according to the size of adipocytes in the measured adipose tissue is shown in Table 14.
  • the control group (group 1) had 161.0 ⁇ 7.1 cells with a size of ⁇ 80 ⁇ m, whereas the number of cells with a size of ⁇ 80 ⁇ m was 161.0 ⁇ 7.1.
  • the number of adipocytes >100 ⁇ m was not observed, confirming that the size of adipocytes was generally small.
  • the number of cells with a size of 100-120 ⁇ m in the high-fat diet control group (group 2) was 28.0 ⁇ 4.0, and the number of cells with a size >120 ⁇ m was 12.0 ⁇ 2.1, confirming that the size of the fat cells was large.
  • the number of cells by size of adipocytes in the test substance-administered group (Group 3) was compared. , the number of cells 100-120 ⁇ m in size was significantly decreased. The number of >120 ⁇ m adipocytes was not observed in the mdB-44 200mg/kg BW administered group (Group 3).
  • the total number of adipocytes compared to the same area was significantly reduced to 51.0 ⁇ 5.7 in the high-fat diet control group (Group 2) compared to 177.0 ⁇ 8.7 in the control group (Group 1), and the mdB-44 200mg/kg BW administration group (Group 2) 3) increased significantly.
  • the average fat globule size was 108.5 ⁇ 1.0 ⁇ m in the high-fat diet control group (Group 2) compared to 80.9 ⁇ 0.1 ⁇ m in the control group (Group 1), and the fat globule size significantly increased, mdB-44 200mg/kg In the BW-administered group (Group 3), the size of fat globules was significantly reduced to 88.3 ⁇ 0.4 ⁇ m (Group 3).
  • the administration of the quince extract not only exhibits an anti-obesity effect, but also has an effect of suppressing hypertrophy of white adipose tissue caused by a high-fat diet.
  • SREBPs include SREBP-1 and SREBP-2, among which SREBP-1 is rapidly induced in the early stage of preadipocyte differentiation, promotes adipocyte differentiation, and promotes fat metabolism by increasing the expression of genes related to fat metabolism. do.
  • C/EBP ⁇ is expressed by hormone induction (insulin, dexamethasone, etc.) in the early stage of adipocyte differentiation, and when C/EBP ⁇ is activated, the expression of C/EBP ⁇ and PPAR ⁇ , transcription factors of adipocytes, is induced in the late stage of differentiation.
  • C/EBP ⁇ has an effect by interacting with PPAR ⁇ .
  • C/EBP ⁇ increases before the expression of specific genes in adipose tissue to regulate energy homeostasis.
  • PPAR ⁇ is a major regulator of adipogenesis and is highly expressed in white adipose tissue.
  • C/EBP ⁇ and PPAR- ⁇ mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and compared to the high-fat diet control group (Group 2). It was significantly decreased in the mdB-44 200mg/kg BW administration group (Group 3).
  • Fatty acid synthase is an enzyme involved in the biosynthesis of fatty acids. When fatty acids are synthesized in the liver, they are converted to triglycerides and transport them to adipose tissue in the form of VLDL, circulating blood vessels. FAS mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and mdB-44 200mg/kg BW compared to the high-fat diet control group (Group 2) It was significantly decreased in the administration group (group 3).
  • aP2 is expressed in adipocytes and macrophages and is known to be involved in inflammation and metabolic reactions.
  • the aP2 mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and mdB-44 200mg/kg compared to the high-fat diet control group (Group 2).
  • aP2 mRNA expression was significantly decreased (Table 16).
  • CPT-1 (Carnitine palmitoyl transferase-1) is a rate-limiting step enzyme that imports fatty acids into mitochondria. In order for fatty acids to enter cells and be oxidized, membrane transferase is required. play a major role in its use. CPT-1 mRNA expression in epididymal adipose tissue was significantly decreased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and CPT-1 mRNA expression increased in the mdB-44 administration group (Group 3). High-fat diet was significantly increased compared to the control group (Group 2).
  • HSL hormone-sensitive lipase
  • HSL mRNA expression in epididymal adipose tissue was significantly decreased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1). Compared to the high-fat diet control group (Group 2), the HSL mRNA expression significantly increased in the mdB-44 200mg/kg BW group (Group 3) (Table 16).
  • ACC1 is mainly present in adipose tissue where fatty acid synthesis is important, and ACC2 is mainly present in oxidative tissues such as skeletal muscle and heart to regulate fatty acid synthesis and oxidation.
  • ACC1 mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and mdB-44 200mg/kg compared to the high-fat diet control group (Group 2)
  • ACL is an enzyme involved in the synthesis of cytosolic acetyl-CoA by converting citrate to acetyl-CoA, and is used in important biosynthetic pathways such as fatty acids and cholesterol.
  • ACL mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and mdB-44 200mg/kg compared to the high-fat diet control group (Group 2).
  • ACL mRNA expression was significantly decreased in the BW administration group (Group 3).
  • lysis buffer (Pierce® IP Lysis buffer, Thermo Scientific) was added to epididymal adipose tissue and then homogenized with a homogenizer. The homogenized solution was centrifuged at 12,000 rpm for 10 minutes, and the supernatant was taken to obtain epididymal adipose tissue lysates. The amount of protein in the tissue lysate was measured using the BCA protein assay kit (Thermo Scientific).
  • Protein 50 ⁇ g was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride membrane (Milipore). After blocking the membrane in 5% skim milk-TBST (20 mmol/L Tris HCl, pH 7.5, 150 mmol/L NaCl, 0.1% Tween 20) for 1 hour, each antibody to be measured was added to the temperature at 4°C. Stir for 16 hours or at room temperature for 1 hour. Antibody information used in the experiment is shown in Table 17.
  • HRP horseradish peroxidase
  • HRP horseradish peroxidase
  • AMP-activated protein kinase is a factor that improves insulin resistance.
  • Activated AMPK is known to activate ATP production pathways such as glycolysis and fatty acid oxidation while blocking ATP consumption pathways such as fat and cholesterol synthesis.
  • ACC acetyl-CoA carboxylase
  • the quince extract administered with the high-fat diet effectively suppressed the increase in body weight, liver and adipose tissue weight, blood cholesterol, blood insulin and leptin content induced by the high-fat diet, and It was confirmed that the size increase was inhibited.
  • quince has anti-obesity and lipid-improving effects on dietary obesity, and further has preventive, therapeutic, and/or ameliorative effects on metabolic diseases, and that it has future anti-obesity effects and/or preventive, It suggests the possibility of development as a health functional material having therapeutic and/or improving effects.
  • a quince extract (mdB-44) was prepared in substantially the same manner as in Example 1, and the quince fruit (LICORICE EXTRACT (Tashkent, Republic of Uzbekistan)) of Example 1 was prepared without additional processing.
  • 3T3-L1 cells which are preadipocytes derived from mice, were purchased from the Korea Cell Line Bank and used.
  • the 3T3-L1 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Welgene) with 10% bovine calf serum (BCS), 100 units/mL penicillin, and 100 ⁇ g/mL streptomycin added to the cell culture medium (complete DMEM culture medium) at 37°C. It was cultured in a humid CO 2 incubator (5% CO 2 /95% air).
  • DMEM Dulbecco's Modified Eagle's Medium
  • BCS bovine calf serum
  • streptomycin 100 ⁇ g/mL streptomycin added to the cell culture medium (complete DMEM culture medium) at 37°C. It was cultured in a humid CO 2 incubator (5% CO 2 /95% air).
  • the cell monolayer was washed with phosphate buffer saline (PBS, pH 7.4), and trypsin-2.65 mM EDTA was added to detach and subculture the cells, and the medium was changed every 2 days. .
  • PBS phosphate buffer saline
  • the 3T3-L1 cells cultured in Example 7-2 were dispensed into a 24-well plate at a concentration of 1 ⁇ 10 5 cells/well. After the cells reached a confluence state, the cell culture medium was sequentially exchanged with three types of differentiation induction medium (DM), and the cells were cultured to induce differentiation into adipocytes. Specifically, by exchanging the cell culture medium with a differentiation induction culture medium in which DMI (1 ⁇ M dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 5 ⁇ g/mL insulin) was added to DMEM medium containing 10% FBS, the cells were cultured for 2 days. stimulated differentiation.
  • DMI 1 ⁇ M dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 5 ⁇ g/mL insulin
  • the DMEM medium containing 10% FBS was replaced with a new differentiation induction culture medium supplemented with 5 ⁇ g/mL insulin, and differentiation was stimulated for another 2 days. After stimulating differentiation for a total of 4 days, the cells were maintained in DMEM medium containing 10% FBS for about 4 to 8 days to induce differentiation into adipocytes, and during this period, the cell culture medium was exchanged every 2 days.
  • Example 7-1 In order to investigate the effect of the quince extract (mdB-44) of Example 1 on adipocyte differentiation, the powdered quince prepared in Example 7-1 was added to the differentiation induction culture medium prepared in Example 7-2.
  • the extract (mdB-44) was added at a concentration of 200ug/ml
  • the ethanol extract (EE) prepared in Example 7-1 was separately added at a concentration of 200ug/ml.
  • a control group cultured and differentiated without adding the extract and a control group cultured and differentiated without the addition of the extract were prepared.
  • Example 7-4 Measurement of adipocyte differentiation (fat accumulation) (Oil red-O staining and quantification)
  • the differentiated cells were rinsed with Dulbecco's phosphate buffered saline (Welgene), and then 4% paraformaldehyde (Biosesang) was added. Cells were fixed at room temperature for 1 hour. After fixing the cells, they were stained with Oil Red O (Sigma-Aldrich) solution for 1-2 hours at room temperature. After visually observing the degree of staining of adipocytes, rinsing the cells with distilled water, observing the adipocytes through a microscope, and analyzing the degree of differentiation of adipocytes using the image J program, and the results are shown in FIG. 4 .
  • Dulbecco's phosphate buffered saline Welgene
  • 4% paraformaldehyde Biosesang
  • the quince extracts mdB-44 and EE prepared in Example 8-1 were analyzed for chlorogenic acid content in the extracts by HPLC analysis method in substantially the same manner as in Example 2, and the results are shown in FIG. 5 .
  • the chlorogenic acid in EE was measured to be 0.53 mg/g, and the chlorogenic acid in mdB-44 was measured to be 0.89 mg/g, extracted in the same way as mdB-44. It was confirmed that the chlorogenic acid content in the extract was measured to be higher.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Mycology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Botany (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Obesity (AREA)
  • Nutrition Science (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Epidemiology (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

마르멜로 (marmelo) 추출물을 유효성분으로 포함하고, 체중 및/또는 체지방 감소, 혈당 강하, 혈중 콜레스테롤 강하 등의 관련 질환을 예방, 개선 및/또는 치료에 사용할 수 있는 치료용 및/또는 식품 조성물 및 이의 제조방법에 관한 것이다.

Description

마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물
마르멜로 (marmelo) 추출물을 유효성분으로 포함하는 체중 및/또는 체지방 감소용 조성물, 혈당 강하용 조성물, 혈중 콜레스테롤 강하용 조성물 및/또는 비만 및/또는 대사성 질환의 예방, 개선, 및/또는 치료용 조성물에 관한 것이다.
[규칙 제91조에 의한 정정 07.10.2022]　
본 발명은 특정 연구와 관련된 것으로, 상기 연구는 2022년도 중소벤처기업부의 지역특화산업육성의 지원에 의한 연구이다 (과제번호: S3270049).
인스턴트 음식물의 잦은 섭취와 육식 위주의 식생활에 의하여 체내에 과다한 에너지 축적 유발 및 운동부족으로 인한 에너지 소모의 감소 등의 이유로 비만 인구의 빠른 증가를 보이고 있다.
이처럼, 체내에 과다하게 축적된 에너지는 비만뿐 아니라 다양한　질병　형태로 나타나는데, 비만, 당뇨병, 고지혈증, 대사증후군 (Metabolic syndrome) 등과 같은 질병을 포함한　대사성　질환이 대표적이다.
클로로겐산 (chlorogenic acid)은 인간의 식단에서 가장 많이 섭취되는 페놀 화합물 중 하나로 클로로겐산의 생리 활성에 대한 다양한 연구가 진행되었으며, 이러한 연구결과들에 의해 클로로겐산의 항산화, 항염증, 항당뇨, 항비만과 같은 다양한 생리 활성이 확인되었다.
지금까지 개발된 항비만제 및 대사성 질환의 치료제는 교감신경 또는 호르몬에 작용하여 부작용을 발생시키나, 부작용이 적은 생약 성분의 경우 그 효과가 미미하다는 문제가 있다.
이에, 부작용이 적으면서 효과가 우수한 약물의 개발이 요구된다.
상기와 같은 배경하에서, 본 발명자들은 클로로겐산의 항비만 효과에 대한 연구를 거듭하였다. 그 결과, 마르멜로 추출물 내 클로로겐산의 함유를 확인하였고, 클로로겐산을 포함하는 마르멜로 추출물의 체중 증가 억제, 지질대사 개선, 비만 관련 호르몬 수치 개선, 혈당 감소, 혈중 콜레스테롤 감소 등을 확인하여, 본 발명을 완성하였다.
일 예는 마르멜로 (marmelo) 추출물을 유효성분으로 포함하는 체중 및/또는 체지방 감소용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈당 강하용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈중 콜레스테롤 강하용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 비만의 예방, 개선, 및/또는 치료용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 대사성 질환의 예방, 개선, 및/또는 치료용 조성물을 제공한다.
상기 조성물은 약학적 조성물 또는 식품 조성물 (예컨대, 건강기능식품)일 수 있다.
다른 예는 마르멜로 추출물의 약학적 유효량을 체중 및/또는 체지방 감소를 필요로 하는 대상에게 투여하는 단계를 포함하는 체중 감소 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 혈당 강하를 필요로 하는 대상에게 투여하는 단계를 포함하는 혈당 강하 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 혈중 콜레스테롤 강하를 필요로 하는 대상에게 투여하는 단계를 포함하는 혈중 콜레스테롤 강하 방법을 제공한다.
다른 예는 마르멜로 추출물을 비만의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는, 비만의 예방, 개선, 및/또는 치료 방법을 제공한다.
다른 예는 마르멜로 추출물을 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는, 대사성 질환의 예방, 개선, 및/또는 치료 방법을 제공한다.
다른 예는 마르멜로 추출물의 비만의 예방, 개선, 및/또는 치료를 위한 용도 또는 비만의 예방, 개선, 및/또는 치료용 약제 또는 식품의 제조를 위한 용도를 제공한다.
다른 예는 마르멜로 추출물의 대사성 질환의 예방, 개선, 및/또는 치료를 위한 용도 또는 대사성 질환의 예방, 개선, 및/또는 치료용 약제 또는 식품의 제조를 위한 용도를 제공한다.
본 명세서에서는 고지방식이와 함께 투여한 마르멜로 추출물이 고지방식이에 의해 유도된 체중 및/또는 체지방 및 지방조직 무게, 혈당, 혈중 콜레스테롤, 혈중 insulin과 leptin 함량 증가를 효과적으로 억제하고, 지방세포의 크기 증가를 억제함을 확인하여, 마르멜로 추출물의 항비만, 체중 및/또는 체지방 감소, 혈당 감소, 혈중 콜레스테롤 감소, 대사성 질환의 예방, 개선, 및/또는 치료 용도를 제공한다.
이에, 일 예는 마르멜로 (marmelo) 추출물을 유효성분으로 포함하는 체중 및/또는 체지방 감소용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈당 강하용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈중 콜레스테롤 강하용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 비만의 예방, 개선, 및/또는 치료용 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 대사성 질환의 예방, 개선, 및/또는 치료용 조성물을 제공한다.
상기 조성물은 약학적 조성물 또는 식품 조성물 (예컨대, 건강기능식품)일 수 있다.
다른 예는 마르멜로 추출물의 약학적 유효량을 체중 감소를 필요로 하는 대상에게 투여하는 단계를 포함하는 체중 및/또는 체지방 감소 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 혈당 강하를 필요로 하는 대상에게 투여하는 단계를 포함하는 혈당 강하 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 혈중 콜레스테롤 강하를 필요로 하는 대상에게 투여하는 단계를 포함하는 혈중 콜레스테롤 강하 방법을 제공한다.
다른 예는 마르멜로 추출물을 비만의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는, 비만의 예방, 개선, 및/또는 치료 방법을 제공한다. 다른 예는 마르멜로 추출물을 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는, 대사성 질환의 예방, 개선, 및/또는 치료 방법을 제공한다.
이하, 본 출원을 보다 상세히 설명한다.
마르멜로 추출물
본 명세서에서, 체중 및/또는 체지방 감소, 혈당 감소, 혈중 콜레스테롤 감소, 비만 및/또는 대사성 질환의 예방, 개선, 및/또는 치료를 위한 유효성분으로서 마르멜로 추출물이 제공된다.
마르멜로 (Marmelo; Cydonia oblonga)는 장미과의 과일나무로서, 퀸스 (quince), 아이바 (Aiva) 또는 유럽모과라고도 불리며,　모과와　사과의 열매를 닮은 생김새를 갖지만 이들과 구별된다.
마르멜로 추출물은 마르멜로의 전부 또는 일부 (예컨대, 열매, 종자, 과육, 껍질, 잎, 줄기, 뿌리 등으로 이루어진 군에서 선택된 1종 이상)를 생약 그대로 또는 건조 및/또는 가열된 상태로 추출 용매를 이용하여 추출한 용매 추출물일 수 있다.
상기 마르멜로 추출물은 마르멜로 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태의 마르멜로를 추출 용매로 추출하여 제조될 수 있고, 이에 제한되는 것은 아니다.
본 명세서에서 “마르멜로 주스”는 마르멜로 열매를 압착하여 발생하는 즙 형태의 액체를 의미한다.
상기 추출 용매는 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올 (예컨대, 에탄올, 발효주정)로 이루어진 군에서 선택된 1종 이상일 수 있다. 일 구체예에서, 상기 추출 용매는 물, 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올 수용액 (예컨대, 에탄올 수용액, 발효주정)으로 이루어진 군에서 선택된 1종 이상일 수 있으며, 상기 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올 수용액은, 예컨대, 10 내지 70 (v/v)%, 15 내지 70 (v/v)%, 20 내지 70 (v/v)%, 25 내지 70 (v/v)%, 30 내지 70 (v/v)%, 10 내지 65 (v/v)%, 15 내지 65 (v/v)%, 20 내지 65 (v/v)%, 25 내지 65 (v/v)%, 30 내지 65 (v/v)%, 10 내지 60 (v/v)%, 15 내지 60 (v/v)%, 20 내지 60 (v/v)%, 25 내지 60 (v/v)%, 30 내지 60 (v/v)%, 10 내지 55 (v/v)%, 15 내지 55 (v/v)%, 20 내지 55 (v/v)%, 25 내지 55 (v/v)%, 30 내지 55 (v/v)%, 10 내지 50 (v/v)%, 15 내지 50 (v/v)%, 20 내지 50 (v/v)%, 25 내지 50 (v/v)% 또는 30 내지 50 (v/v)%의 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올 (예컨대, 에탄올, 주정, 발효주정)일 수 있다.
상기 추출에 사용되는 추출용매의 양은, 마르멜로의 1 내지 10 부피배, 2 내지 10 부피배, 3 내지 10 부피배, 4 내지 10 부피배, 1 내지 9 부피배, 2 내지 9 부피배, 3 내지 9 부피배, 4 내지 9 부피배, 1 내지 8 부피배, 2 내지 8 부피배, 3 내지 8 부피배, 4 내지 8 부피배, 1 내지 7 부피배, 2 내지 7 부피배, 3 내지 7 부피배, 4 내지 7 부피배, 1 내지 6 부피배, 2 내지 6 부피배, 3 내지 6 부피배 또는 4 내지 6 부피배일 수 있으나, 이에 제한되는 것은 아니다.
추출 시간은, 이에 한정되지 않지만, 유효성분의 충분한 추출을 위하여, 1 내지 24시간, 1 내지 12시간, 1 내지 6시간, 1 내지 5시간, 3 내지 24시간, 3 내지 12시간, 3 내지 6시간, 3 내지 5시간, 5 내지 24시간, 5 내지 12시간 또는 5 내지 6시간으로 할 수 있다. 추출 온도는, 이에 한정되지 않지만, 유효성분의 효과적인 추출을 위하여, 실온 내지 추출용매의 끓는점까지 중에서 선택된 온도 범위, 예컨대, 50 내지 100℃, 55 내지 100℃, 60 내지 100℃, 65 내지 100℃, 50 내지 95℃, 55 내지 95℃, 60 내지 95℃, 65 내지 95℃, 50 내지 90℃, 55 내지 90℃, 60 내지 90℃, 65 내지 90℃, 50 내지 85℃, 55 내지 85℃, 60 내지 85℃, 65 내지 85℃, 50 내지 80℃, 55 내지 80℃, 60 내지 80℃ 또는 65 내지 80℃로 할 수 있다.
상기 추출물을 얻기 위한 추출방법은 본 발명이 속하는 기술분야의 통상적으로 사용되는 모든 공지된 추출방법 중에서 선택된 것일 수 있다. 예를 들어, 환류추출법, 침지추출법, 가열 추출법, 냉침법, 열수 추출법, 초음파 추출법, 여과법, 가압추출법, 초임계 추출법, 전기적 추출법 등 통상적으로 사용되는 추출법을 사용할 수 있다.
상기 추출은 1회 수행되거나, 동일 또는 상이한 추출 용매 및/또는 조건으로 2회 이상 (예컨대, 2회, 3회, 4회, 또는 5회) 수행될 수 있다. 상기 추출이 2회 이상 진행되는 경우, 각 회에서 사용된 추출 용매, 각 회당 추출 시간, 온도 등의 추출 조건은 앞서 설명한 범위에서 동일하거나 상이하게 조절할 수 있으나, 이에 제한되는 것은 아니다.
일 구체예에서, 상기 추출물은 10 내지 100 brix, 20 내지 100 brix, 30 내지 100 brix, 40 내지 100 brix, 50 내지 100 brix, 60 내지 100 brix, 70 내지 100 brix, 80 내지 100 brix, 90 내지 100 brix, 10 내지 90 brix, 20 내지 90 brix, 30 내지 90 brix, 40 내지 90 brix, 50 내지 90 brix, 60 내지 90 brix, 70 내지 90 brix, 80 내지 90 brix, 10 내지 80 brix, 20 내지 80 brix, 30 내지 80 brix, 40 내지 80 brix, 50 내지 80 brix, 60 내지 80 brix, 70 내지 80 brix, 10 내지 70 brix, 20 내지 70 brix, 30 내지 70 brix, 40 내지 70 brix, 50 내지 70 brix 또는 60 내지 70 brix의 당도를 가질 수 있고, 이에 제한되는 것은 아니다.
본 명세서에서, 상기 마르멜로 추출물은 앞서 설명한 용매 추출물뿐 아니라, 상기 용매 추출물을 통상적인 방법으로 농축 (예컨대, 감압농축, 진공농축 등), 건조 (예컨대, 분무건조, 동결건조 등), 및/또는 분쇄 (분말화)한 농축물, 건조물, 및/또는 분쇄물을 포함할 수 있다.
본 명세서에서 유효성분으로 제공되는 마르멜로 추출물은, HPLC로 측정한 클로로겐산 (Chlorogenic acid) 함량이, 추출물 총 중량 (예컨대, 농축물 중량) 기준으로, 0.2mg/g 이상, 0.3mg/g 이상, 0.4mg/g 이상, 0.5mg/g 이상, 0.6mg/g 이상 또는 0.7mg/g 이상, 예를 들어, 0.2 내지 2 mg/g, 0.3 내지 2 mg/g, 0.4 내지 2 mg/g, 0.5 내지 2 mg/g, 0.6 내지 2 mg/g, 0.7 내지 2 mg/g, 0.8 내지 2 mg/g, 0.2 내지 1.5 mg/g, 0.3 내지 1.5 mg/g, 0.4 내지 1.5 mg/g, 0.5 내지 1.5 mg/g, 0.6 내지 1.5 mg/g, 0.7 내지 1.5 mg/g, 0.2 내지 1.2 mg/g, 0.3 내지 1.2 mg/g, 0.4 내지 1.2 mg/g, 0.5 내지 1.2 mg/g, 0.6 내지 1.2 mg/g, 0.7 내지 1.2 mg/g, 0.2 내지 1.0 mg/g, 0.3 내지 1.0 mg/g, 0.4 내지 1.0 mg/g, 0.5 내지 1.0 mg/g, 0.6 내지 1.0 mg/g, 0.7 내지 1.0 mg/g, 0.2 내지 0.8 mg/g, 0.3 내지 0.8 mg/g, 0.4 내지 0.8 mg/g, 0.5 내지 0.8 mg/g, 0.6 내지 0.8 mg/g 또는 0.7 내지 0.8 mg/g 일 수 있다.
의약 용도
일 예는 마르멜로 (marmelo) 추출물을 유효성분으로 포함하는 체중 및/또는 체지방 감소용 약학적 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈당 강하용 약학적 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈중 콜레스테롤 강하용 약학적 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 비만의 예방, 개선, 및/또는 치료용 약학적 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 대사성 질환의 예방, 개선, 및/또는 치료용 약학적 조성물을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 체중 및/또는 체지방 감소를 필요로 하는 대상에게 투여하는 단계를 포함하는 체중 감소 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 혈당 강하를 필요로 하는 대상에게 투여하는 단계를 포함하는 혈당 강하 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 혈중 콜레스테롤 강하를 필요로 하는 대상에게 투여하는 단계를 포함하는 혈중 콜레스테롤 강하 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 비만의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는, 비만의 예방, 개선, 및/또는 치료 방법을 제공한다.
다른 예는 마르멜로 추출물의 약학적 유효량을 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는, 대사성 질환의 예방, 개선, 및/또는 치료 방법을 제공한다.
상기 마르멜로 추출물의 약학적 유효량을 (1) 체중 및/또는 체지방 감소, (2) 혈당 강하, (3) 혈중 콜레스테롤 강하 및/또는 (4) 비만 및/또는 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계는 상기 마르멜로 추출물의 함량이 투여하는 대상의 체중 기준으로 1 내지 400 mg/kg (body weight; BW), 50 내지 400 mg/kg, 100 내지 400 mg/kg, 150 내지 400 mg/kg, 200 내지 400 mg/kg, 1 내지 300 mg/kg (body weight; BW), 50 내지 300 mg/kg, 100 내지 300 mg/kg, 150 내지 300 mg/kg, 200 내지 300 mg/kg, 1 내지 200 mg/kg (body weight; BW), 50 내지 200 mg/kg, 100 내지 200 mg/kg, 150 내지 200 mg/kg이 되도록 투여할 수 있고, 이에 제한되는 것은 아니다.
상기 마르멜로 추출물의 약학적 유효량을 (1) 체중 및/또는 체지방 감소, (2) 혈당 강하, (3) 혈중 콜레스테롤 강하 및/또는 (4) 비만 및/또는 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 대상에게 투여하는 단계에서 상기 대상이 인간인 경우, 인체전환계수 (0.08)를 적용하여 계산하여 투여량을 결정할 수 있다. 이에 따라, 상기 비만 및/또는 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 인간에게 투여하는 단계는 상기 마르멜로 추출물의 함량이 투여하는 인간의 체중 60kg을 기준으로, 0.0048 내지 1.92 g/일, 0.24 내지 1.92 g/일, 0.48 내지 1.92 g/일, 0.72 내지 1.92 g/일, 0.96 내지 1.92 g/일, 0.0048 내지 1.44 g/일, 0.24 내지 1.44 g/일, 0.48 내지 1.44 g/일, 0.72 내지 1.44 g/일, 0.96 내지 1.44 g/일, 0.0048 내지 0.96 g/일, 0.24 내지 0.96 g/일, 0.48 내지 0.96 g/일 또는 0.72 내지 0.96 g/일이 되도록 투여할 수 있고, 이에 제한되는 것은 아니다.
상기 마르멜로 추출물은 앞서 설명한 바와 같다.
상기 혈당 강하는 혈액 내 포도당 농도의 감소, 혈중 인슐린 함량 감소, 인슐린 저항성의 감소 및/또는 인슐린 민감성의 증가를 포함하는 개념을 의미한다. 인슐린 저항성은 하기 실시예 6.3의 수학식 2, 인슐린 민감성은 하기 실시예 6.3의 수학식 3으로 계산할 수 있다.
상기 혈중 콜레스테롤 강하는 혈액 내 총 콜레스테롤 함량 또는 LDL (저밀도지단백; low-density lipoprotein) 콜레스테롤 함량의 감소를 의미한다.
상기 비만은 체지방이 비정상적으로 많은 상태를 총괄하는 것으로, 많은 양의 칼로리를 섭취했지만 이를 소비하지 않아 체내에 지방이란 형태로 저장을 하고 있는 상태를 의미한다.
일 예에서, 비만은 체질량지수 (BMI; 체중을 신장의 제곱으로 나눈 값; kg/m2)가 약 25kg/m2 이상인 상태를 의미할 수 있으나, 이에 제한되는 것은 아니다.
상기 대사성 질환은 호르몬 또는 대사에 관여하는 체내 기관의 장애 또는 기능 이상에 의하여 대사 물질이 전신 또는 체내 특정 기관에 축적되면서 각 기관에 이상을 일으키는 질병을 총칭하는 것일 수 있다.
일 예에서, 상기 대사성 질환은 혈액, 또는 이들 모두에서의 포도당, 콜레스테롤, 중성지방으로 이루어진 군에서 선택된 1종 이상의 축적에 의하여 유발되는 질병일 수 있다. 예를 들어, 상기 대사성 질환은 당뇨병, 고지혈증, 동맥경화, 고인슐린혈증 또는 대사증후군일 수 있다.
당뇨병은 유전적 또는 환경적 요인으로 발병되는 전신적 대사질환의 일종으로, 체내에 인슐린의 절대적 또는 상대적인 부족으로 인하여 야기되는　질병으로 혈중의 당 농도가 비정상적으로 높아진 상태를 말한다. 본 명세서에서, 당뇨병은 제1형 당뇨병, 제2형 당뇨병, 및 임심성 당뇨병을 모두 포괄할 수 있으며, 특히 인슐린 저항성과 관련된 제2항 당뇨일 수 있다.
고지혈증은 필요 이상의 지방성분 물질이 혈액에 존재하거나 이로 인하여 염증을 일으키는 상태를 의미할 수 있다. 예컨대, 공복시 혈청 콜레스테롤이 220　mg/dl 이상이거나 중성지방이 150　mg/dl이상인 경우 고지혈증으로 진단할 수 있으나, 이에 제한되는 것은 아니다. 고지혈증은 고콜레스테롤혈증, 고중성지방혈증, 또는 이들 모두를 의미할 수 있다.
동맥경화는 동맥에 혈전이 생기는 등의 이유로 동맥의 혈관이 좁아지는 질병을 총칭하는 것으로, 본 명세서에서는 혈중 높은 콜레스테롤 및/또는 중성지방 함량과 관련된 것일 수 있다.
고인슐린혈증은 혈중 인슐린 수치가 높은 상태를 의미하고, 랑게르한스섬의 증식 (선종, 비대)에 의해 발생하는 기질적 고인슐린혈증, 랑게르한스섬 선종 등이 없이 자율신경, 소화기계의 기능장애에 의해 발생하는 기능적 고인슐린혈증으로 나뉠 수 있다.
대사증후군 (Metabolic syndrome)이란 고지혈증, 고혈압, 당대사 이상, 비만과 같은 위험인자가 함께 나타나는 증후군을 지칭한다.　대사증후군은 인슐린 저항성이 원인인 것으로 추정되는 질환으로　콜레스테롤,　혈압,　혈당치　중 2개 이상의 수치에 이상이 생기는 증상을 의미할 수 있다.
본 명세서에서, '치료'는 질병 상태 또는 증상의 개선, 경감 또는 안정화, 부분적 또는 완전한 회복, 생존의 연장, 질환 범위의 감소, 질병 진행의 지연 또는 완화, 기타 다른 이로운 치료 결과 등을 모두 포함하는 의미로 사용된다. '예방'은 특정 질병을 갖지 않는 대상에게 작용하여 상기 특정 질병이 발병하지 않도록 하거나, 그 발병 시기를 늦추거나, 발병 빈도를 낮추는 모든 기작 및/또는 효과를 포함하는 의미로 사용된다.
본 명세서에서 제공되는 약학적 조성물 내의 유효성분으로 사용된 마르멜로 추출물의 함량은 사용 형태 및 목적, 사용 대상의 상태, 증상의 종류 및 경중 등에 의하여 적절하게 조절할 수 있으며, 고형분 (추출물에서 용매를 제거한 고형성분) 중량 기준으로 0.001 내지 99.9 중량%, 0.001 내지 90 중량%, 0.001 내지 75 중량%, 0.001 내지 50 중량%, 0.01 내지 99.9 중량%, 0.01 내지 90 중량%, 0.01 내지 75 중량%, 0.01 내지 50 중량%, 0.1 내지 99.9 중량%, 0.1 내지 90 중량%, 0.1 내지 75 중량%, 0.1 내지 50 중량%, 1 내지 99.9 중량%, 1 내지 90 중량%, 1 내지 75 중량%, 1 내지 50 중량%, 5 내지 99.9 중량%, 5 내지 90 중량%, 5 내지 75 중량%, 5 내지 50 중량%, 10 내지 99.9 중량%, 10 내지 90 중량%, 10 내지 75 중량%, 또는 10 내지 50 중량% 일 수 있으나, 이에 한정되지 않는다.
상기 약학적 조성물 또는 유효성분인 마르멜로 추출물은 인간, 원숭이 등의 영장류, 마우스, 래트, 토끼 등의 설치류, 이외의 개, 고양이, 소, 돼지, 양, 말, 염소 등을 포함하는 포유류, 닭, 오리, 거위 등을 포함하는 조류, 뱀, 도마뱀, 거북, 악어 등을 포함하는 파충류, 양서류, 및 어류 등의 척추동물에서 선택된 투여 대상에 다양한 경로로 투여될 수 있다. 상기 약학적 조성물의 투여 방식은 통상적으로 사용되는 모든 방식일 수 있으며, 예컨대, 경구 투여, 또는 정맥, 근육, 피하, 또는 복강 주사 등의 비경구 투여의 경로로 투여될 수 있다. 일 예에서, 상기 약학적 조성물은 경구 투여를 위한 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 약학적 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 또는 멸균 주사용액의 형태의 비경구 제형 등으로 제형화하여 사용될 수 있다.
상기 약학적 조성물은 앞서 설명한 유효성분 이외에도, 일반적으로 투여방식과 표준 약제학적 관행 (Standard pharmaceutical practice)을 고려하여 선택된 약제학적 및/또는 생리학적으로 허용되는 담체, 부형제, 및 희석제 등으로 이루어진 군에서 선택된 1종 이상의 보조제와 혼합되어 투여될 수 있다. 예컨대, 상기 약제학적 및/또는 생리학적으로 허용되는 담체는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등으로 이루어진 군에서 선택된 1종 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니며, 약제학 분야에서 통상적으로 사용되는 모든 담체일 수 있다.
상기 약제학적 및/또는 생리학적으로 허용되는 희석제 및/또는 부형제는 약학적 조성물의 적절한 제제화에 통상적으로 사용되는 모든 충진제, 증량제, 결합제, 습윤제, 붕해제, 윤할제, 계면활성제 등으로 이루어진 군에서 선택된 1종 이상일 수 있다.
예컨대, 정제, 환제, 산제, 과립제, 또는 캡슐제 등의 경구투여를 위한 고형 제제의 경우, 상기 부형제는 이러한 고형 제제의 제제화를 위한 적어도 1종 이상의 물질, 예컨대, 전분, 칼슘카보네이트 (Calcium carbonate), 수크로스 (Sucrose), 락토오스 (Lactose), 젤라틴 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 이외에도, 마그네슘 스티레이트 탈크 등과 같은 윤활제들도 사용될 수 있다. 또한, 현탁제, 내용액제, 유제, 시럽제 등의 경구투여를 위한 액상제제의 제제화의 경우, 통상적으로 사용되는 단순희석제인 물, 리퀴드 파라핀 등으로 이루어진 군에서 선택된 1종 이상이 사용될 수 있고, 이외에, 통상적으로 사용되는 여러 가지 부형제, 예를 들면, 습윤제, 감미제, 방향제, 및/또는 보존제 등이 포함될 수 있으나, 이에 제한되는 것은 아니다.
예컨대, 상기 약학적 조성물은 전분 또는 락토오즈를 함유하는 정제 형태로, 또는 적절한 부형제를 함유하는 캡슐 형태로, 또는 맛을 내거나 색을 띄게 하는 화학 약품을 함유하는 엘릭시르 또는 현탁제 형태로 경구, 구강내 또는 혀밑 투여될 수 있다. 이러한 액체 제제는 현탁제 (예를 들면, 메틸셀룰로오즈, 위텝솔 (Witepsol)과 같은 반합성 글리세라이드 또는 행인유 (Apricot kernel oil)와 PEG-6 에스테르의 혼합물 또는 PEG-8과 카프릴릭/카프릭 글리세라이드의 혼합물과 같은 글리세라이드 혼합물)와 같은 약제학적으로 허용 가능한 첨가제와 함께 제형화 될 수 있으나, 이에 제한되는 것은 아니다.
식품 조성물
일 예는 마르멜로 (marmelo) 추출물을 유효성분으로 포함하는 체중 및/또는 체지방 감소용 식품 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈당 강하용 식품 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 혈중 콜레스테롤 강하용 식품 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 비만의 예방 및/또는 개선용 식품 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 대사성 질환의 예방 및/또는 개선용 식품 조성물을 제공한다.
다른 예는 마르멜로 추출물을 유효성분으로 포함하는 식품 조성물을 (1) 체중 및/또는 체지방 감소, (2) 혈당 강하, (3) 혈중 콜레스테롤 강하 및/또는 (4) 비만 및/또는 대사성 질환의 예방, 개선 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는 체중 감소 방법을 제공한다.
상기 식품 조성물을 (1) 체중 및/또는 체지방 감소, (2) 혈당 강하, (3) 혈중 콜레스테롤 강하 및/또는 (4) 비만 및/또는 대사성 질환의 예방, 개선 및/또는 치료를 필요로 하는 대상에게 투여하는 단계는 상기 마르멜로 추출물의 함량이 투여하는 대상의 체중 기준으로 1 내지 400 mg/kg (body weight; BW), 50 내지 400 mg/kg, 100 내지 400 mg/kg, 150 내지 400 mg/kg, 200 내지 400 mg/kg, 1 내지 300 mg/kg (body weight; BW), 50 내지 300 mg/kg, 100 내지 300 mg/kg, 150 내지 300 mg/kg, 200 내지 300 mg/kg, 1 내지 200 mg/kg (body weight; BW), 50 내지 200 mg/kg, 100 내지 200 mg/kg, 150 내지 200 mg/kg이 되도록 투여할 수 있고, 이에 제한되는 것은 아니다.
상기 식품 조성물을 (1) 체중 및/또는 체지방 감소, (2) 혈당 강하, (3) 혈중 콜레스테롤 강하 및/또는 (4) 비만 및/또는 대사성 질환의 예방, 개선 및/또는 치료를 필요로 하는 대상에게 투여하는 단계에서 상기 대상이 인간인 경우, 인체전환계수 (0.08)를 적용하여 계산하여 투여량을 결정할 수 있다. 이에 따라, 상기 비만 및/또는 대사성 질환의 예방, 개선, 및/또는 치료를 필요로 하는 인간에게 투여하는 단계는 상기 마르멜로 추출물의 함량이 투여하는 인간의 체중 60kg을 기준으로, 0.0048 내지 1.92 g/일, 0.24 내지 1.92 g/일, 0.48 내지 1.92 g/일, 0.72 내지 1.92 g/일, 0.96 내지 1.92 g/일, 0.0048 내지 1.44 g/일, 0.24 내지 1.44 g/일, 0.48 내지 1.44 g/일, 0.72 내지 1.44 g/일, 0.96 내지 1.44 g/일, 0.0048 내지 0.96 g/일, 0.24 내지 0.96 g/일, 0.48 내지 0.96 g/일 또는 0.72 내지 0.96 g/일이 되도록 투여할 수 있고, 이에 제한되는 것은 아니다.
상기 마르멜로 추출물, 혈당 강하, 혈중 콜레스테롤 강하, 및 대사성 질환은 앞서 설명한 바와 같다.
본 명세서에서 제공되는 식품 조성물에서, 용어 "식품"은 영양소를 한 가지 이상 함유하고 있는 식용의 천연물 또는 가공품을 의미하며, 통상적인 의미로서, 각종 일반 식품, 건강기능식품, 음료, 식품 첨가제, 음료 첨가제 등으로 이루어진 군에서 선택된 하나 이상을 의미하기 위하여 사용될 수 있다. 용어 "식품 조성물"은 상기 식품을 제조하기 위한 재료의 조합을 의미할 수 있다. 일 예에서, 상기 식품은 건강기능식품을 의미할 수 있다.
상기 식품 조성물 내의 상기 마르멜로 추출물의 함량은 식품사용 형태, 목적 등에 의하여 적절하게 조절할 수 있으며, 예컨대, 고형분 중량 기준으로 0.00001 내지 99.9 중량%, 0.0001 내지 99.9 중량%, 0.001 내지 99.9 중량%, 또는 0.001 내지 50 중량%일 수 있으나, 이에 한정되지 않는다.
상기 식품 조성물의 투여 '대상'은 인간, 원숭이 등의 영장류, 마우스, 래트, 토끼 등의 설치류, 이외의 개, 고양이, 소, 돼지, 양, 말, 염소 등을 포함하는 포유류, 닭, 오리, 거위 등을 포함하는 조류, 뱀, 도마뱀, 거북, 악어 등을 포함하는 파충류, 양서류, 및 어류 등의 척추동물 중에서 선택된 개체, 상기 개체로부터 분리된 세포, 조직, 또는 세포 배양물 등일 수 있다.
본 명세서에서 제공되는 마르멜로 추출물은 체중 및/또는 체지방 및 지방조직 무게, 혈당, 혈중 콜레스테롤, 혈중 insulin과 leptin를 감소시키거나 이의 증가를 효과적으로 억제함으로써 식이성 비만에 대한 항비만 효과 및 지질 개선 효과가 있고 더 나아가 대사성 질환에 예방, 치료, 및/또는 개선 효과가 있음을 제시하며, 향후 항비만 효능 및/또는 대사성 질환에 예방, 치료, 및/또는 개선 효과를 갖는 건강기능성 소재로의 개발 가능성을 제시한다.
도 1a 및 1b는 마르멜로 추출물 내 chlorogenic acid 함량을 HPLC 크로마토그래피로 분석한 결과를 보여주는 그래프이다. 도 1a는 chlorogenic acid 표준폼, 도 1b는 시료 c (실시예 2.2의 표 4)의 결과를 나타낸다.
도 2는 식이 종류에 따른 주별 체중 변화를 보여주는 그래프다. 그룹 1은 대조식이군, 그룹 2는 고지방식이군, 그룹 3은 mdB-44를 같이 투여한 고지방식군을 의미한다.
도 3은 부고환 지방조직의 조직학적 변화를 광학현미경 (Carl Zeiss)을 사용하여 관찰한 사진이다.
도 4는 마르멜로 추출물의 추출 방법에 따른 지방세포 분화 정도를 확인한 결과를 보여주는 그래프이다. mdB-44는 마르멜로 압착 단계 등을 거친 마르멜로 추출물, EE는 추가 공정 없이 제조된 마르멜로 추출물을 의미한다.
도 5는 마르멜로 추출물의 추출 방법에 따른 추출물 내 Chlorogenic acid 함량을 측정한 결과를 보여주는 그래프이다. (A)는 EE의 chlorogenic acid 함량 분석 결과, (B)는 mdB-44의 chlorogenic acid 함량 분석 결과를 의미한다.
이하, 본 발명을 실시예에 의하여 보다 구체적으로 설명하고자 한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 하기 실시예에 의하여 제한되는 것은 아니다.
실시예 1. 마르멜로 추출물의 준비
마르멜로 열매 (LICORICE EXTRACT (Tashkent, Republic of Uzbekistan))를 칭량하고 선별, 세척 및 이물을 제거하였다. 그 후 마르멜로를 압착기로 1 ~ 5 kg/cm2의 압력으로 압착하여 마르멜로 주스 (마르멜로 열매를 압착하여 발생하는 즙 형태의 액체)를 제거하고, 고형물을 분리하였다. 고형물은 4 ~ 6 부피배의 30 ~ 50 (v/v)% 주정으로 65 ~ 80℃ 에서 5 ~ 6시간동안 2회 추출하였다. 상기 추출물을 10μm 규격 필터로 여과하고, 진공 농축기 (vacuum evaporator) (EYELA, 도쿄, 일본)을 이용하여 65 brix 이상으로 진공 농축시켜 마르멜로 농축액을 수득하였다. 상기 농축액을 분무건조기를 통해 분말화 하였다. 상기와 같이 준비된 추출물 또는 분말 상태의 마르멜로 추출물을 하기 실시예에 사용하였다.
실시예 2. 마르멜로 추출물의 chlorogenic acid 함량 분석
2.1 HPLC 분석방법
상기 실시예 1에서 준비된 마르멜로 추출물의 chlorogenic acid (CGA) 함량을 LC-20A 고성능 액체 크로마토그래프 (high-performance liquid chromatography, HPLC) 시스템 (Shimadzu, 일본)을 사용하여 분석하였다. HPLC 분석 조건은 하기 표 1 (분석조건), 표 2 (이동상 기울기 조건 (gradient condition))에 나타내었다.
항목 (Items) 조건 (Conditions)
Column Capcell Pak C18 column (Shiseido, 5μm, 250ｘ4.6mm)
Column Temperature 40℃
Flow 1.4 mL/min
Detector Diode Array Detector(DAD) 330 nm
Injection Volumn 5 μL
Mobile Phase A : phosphoric acid : water = 0.5 : 99.5(v/v), B : phosphoric acid : AcN = 0.5 : 99.5(v/v)
Run time 40 min
시간 (Min) A 용매 (%) B 용매 (%)
0 95 5
7 95 5
27 70 30
28 10 90
30 10 90
31 95 5
40 95 5
Chlorogenic acid 표준품 5mg을 칭량하여 메탄올 50mL에 용해시켰다. 이 용액에서 5mL를 취하여 부피플라스크로 옮기고 5mL의 메탄올을 넣고 20mL의 증류수를 넣어 표준용액 원액으로 사용하였다. 원액의 용액을 표준원액으로 하여 단계별로 희석하여 검량선을 작성하여 chlorogenic acid 표준액을 만들었고 (최종농도: 0.00833, 0.00416, 0.00208, 0.00104, 0.01666 mg/mL), 해당 정보를 하기 표 3에 나타내었다. 또한, 상기 실시예 1의 분말 상태의 마르멜로 추출물 30 mg을 칭량하여 30% 메탄올 5mL를 넣어 용해시키고 0.45um 필터로 여과하여 시험용액으로 사용하였다 (최종농도 30mg/5mL) (마르멜로 추출물). 해당 정보를 하기 표 3에 나타내었다.
시료 전처리 농도 (Concentration)
Chlorogenic acid 표준액 0.00833, 0.00416, 0.00208, 0.00104, 0.01666 mg/mL in 30% MeOH
마르멜로 추출물 30mg/5mL in 30% MeOH (HPLC grade)
2.2 실험 결과
상기 2.1의 HPLC 분석 방법으로 실험을 3회 수행하였으며, 얻어진 값들을 표 4, 도 1a (chlorogenic acid 표준폼) 및 1b (시료 c)에 나타내었다.
검체명 함량 (mg/g)
시료 a 0.82
시료 b 0.7
시료 c 0.73
(상기 시료 a, b 및 c는 상기 실험을 3회 수행할 때, 각각 실험에서 사용된 마르멜로 추출물이 포함된 시험용액을 의미한다)
표 4, 도 1a 및 도 1b에 나타낸 바와 같이, 실시예 1에서 준비된 마르멜로 추출물 내 chlorogenic acid 함량은 시료 a의 경우 0.82mg/g, 시료 b의 경우 0.7mg/g, 시료 c의 경우 0.73mg/g인 것으로 나타나, chlorogenic acid 함량이 중간 값인 시료 c의 경우를 기준으로 ±20% 범위의 분포를 보이는 것으로 확인되었다. 상기 결과는 상기 실시예 1에서 얻어진 마르멜로 추출물은 일정 범위 (예컨대, 0.75(mg/g) ± 20%)의 chlorogenic acid을 포함하고, 이러한 결과는 추출을 여러 번 수행하여도 추출물에 포함된 chlorogenic acid 함량이 균등 범위임을 보여준다.
실시예 3. 시험물질 및 실험동물 준비
3.1 시험물질 준비 및 동물실험 승인
시험물질로 상기 실시예 1에서 준비된 분말 상태의 마르멜로 추출물 (분말; 이하, ‘mdB-44’)을 사용하였고, 하기 실시예에서의 모든 동물실험은 한림대학교 동물실험윤리위원회의 승인 아래 동물실험 규정에 따라 수행하였다 (Hallym 2019-67).
3.2 시험군 및 시험물질 투여
특정병원체 (specific pathogen free)가 없는 5주령, 수컷 C57BL/6 생쥐를 ㈜두열 바이오텍에서 구입하여 사용하였다. 1주일간의 검역 및 적응과정을 거친 뒤 체중 감소 없는 건강한 동물을 선별하여 실험에 사용하였다. 실험동물은 온도 23 ± 3℃, 상대습도 50 ± 10%, 환기회수 10~15회/시간, 조명시간 12시간 (08:00~20:00), 조도 150~300Lux로 설정된 사육환경에서 사육하였다. 적응 기간 실험동물은 실험동물 용 고형사료 ((주) 카길애그리퓨리나)와 음수를 자유 섭취 하도록 하였다. 1주간의 적응 기간을 거친 후 건강한 동물을 선별하여 난괴법 (randomized block design)에 의거하여 대조식이군 (CD) (그룹 1), 고지방식이 (HFD) 대조군 (그룹 2), 고지방식이 + 200mg/kg body weight (BW) mdB-44 (상기 실시예 3.1의 실험물질) 투여군 (그룹 3)으로 분류하였다. 시험 전 기간 동안 대조식이의 에너지 비율 (kcal%) (단백질 : 탄수화물 : 지방)은 20:70:10이고, 고지방식이의 에너지 비율 (kcal%) (단백질 : 탄수화물 : 지방)은 20:20:60이고, 두 식이 모두 Research Diets, Inc. (New Brunswick, NJ, USA)에서 구입하였다. 상기 대조식이군 및 고지방식이의 조성을 표 5에, 상기 실험 설계를 표 6에 나타내었다.
대조식이 (CD) (10 kcal% fat) 각 조성 함량 (g) 대조식이 (CD) (10 kcal% fat) 각 조성 칼로리 함량 (kcal) 고지방식이 (HFD) (60 kcal% fat) 각 조성 함량 (g) 고지방식이 (HFD) (60 kcal% fat) 각 조성 칼로리 함량 (kcal)
Casein, 80 Mesh 200 800 200 800
L-Cystine 3 12 3 12
Corn starch 315 1260 0 0
Maltodextrin 10 35 140 125 500
Sucrose 350 1400 68.8 275.2
Cellulose, BW200 50 0 50 0
Soybean oil 25 225 25 225
Lard* 20 180 245 2205
Mineral mix 10 0 10 0
Dicalcium phosphate 13 0 13 0
Calcium carbonate 5.5 0 5.5 0
Potassium citrate, 1H2O 16.5 0 16.5 0
Vitamin mix V10001 10 40 10 40
Choline bitartrate 2 0 2 0
합계 1055.05 4057 773.85 4057
(*Lard: 콜레스테롤을 0.95mg/g로 계산함)
그룹 1 그룹 2 그룹 3
대조군(정상) 음성대조군 실험군
실험식이 CD HFD HFD
시험물질(mg/kg BW) - - mdB-44 200
동물수(마리) 10 10 10
시험 전 기간 동안 음수는 자유로이 섭취하도록 하였고, 상기 실시예 3.1의 시험물질을 음수에 실험동물 1kg당 200mg을 녹여 8주동안 일정 시간에 경구 투여하였다 (그룹 3). 해당 실험동물을 이용한 하기 실시예에서 통계처리는 평균 ± 표준오차로 나타내었다. 수집된 결과는 GraphPad Prism 5.0 (GraphPad software) 프로그램을 이용하여 분석하였다. 시험물질 투여군과 대조군의 차이를 비교하기 위하여 Student’s t-test 및 one-way analysis variance (ANOVA)를 이용하였다. p < 0.05 이상일 때만 통계적으로 유의성 있는 것으로 판단하였다.
실시예 4. 체중 및 식이 섭취량 측정
상기 실시예 3에서 준비한 실험동물의 0주차 및 8주차의 체중을 측정하였고, 식이 섭취량은 8주 동안 2일 간격으로 측정하였다. 시험 전 기간 섭취한 양을 계산하여 1일 식이섭취량 및 1일 에너지섭취량을 산출하였다. 식이효율 (Food Efficiency Ratio, FER)은 시험기간 동안의 체중 증가량을 동일기간 섭취한 식이의 양으로 나누어 다음 수학식 1과 같이 계산하였다.
[수학식 1]
식이효율 = 체중 증가량 (g) / 식이 섭취량 (g)
측정한 체중 결과 및 그에 따른 총 체중 증가량 및 일일 체중 증가량을 표 7에, 8주 동안 측정한 식이 섭취량 및 식이효율을 표 8에 나타내었고, 특히 체중 결과를 도 2에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
0주 23.14 ± 0.35 23.06 ± 0.24 23.10 ± 0.27
8주 31.20 ± 0.67 41.91 ± 0.91*** 36.45 ± 0.91###
총 체중 증가량 (g) 8.1 ± 0.7 18.9 ± 0.9*** 13.4 ± 1.1##
일일 체중 증가량 (g/일) 0.146 ± 0.013 0.343 ± 0.016*** 0.243 ± 0.020##
(표 8의 결과는 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다;그룹 1 (정상 대조군); 그룹 2 (음성 대조군); 그룹 3: 실험군, (mdB-44 투여군)
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
총 식이섭취량 (g) 145.4 ± 1.4 129.1 ± 1.2*** 112.7 ± 1.5###
일일 식이섭취량 (g/day) 2.64 ± 0.03 2.35 ± 0.02*** 2.05 ± 0.03###
일일 에너지섭취량 (kcal/day) 10.18 ± 0.10 12.30 ± 0.11*** 10.73 ± 0.15###
식이효율 (체중증가량/식이섭취량) 0.055 ± 0.005 0.146 ± 0.007*** 0.119 ± 0.009#
(상기 수치는 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다)
상기 표 7 및 8에 나타난 바와 같이, 시험 기간 동안 모든 시험군의 실험동물은 지속적으로 체중이 증가하여 정상적인 체중 변화를 나타내었다. 대조식이군 (그룹 1)과 비교하여 고지방 식이 대조군 (그룹 2)의 체중은 유의적으로 더 증가하였다. 반면, 마르멜로 추출물을 투여한 시험군인 그룹 3에서는, 고지방식이 대조군 (그룹 2)과 비교하여, 고지방식이 공급에 의해 증가된 실험동물의 체중이 (체중 증가량) 유의적으로 감소하였다. 이를 통해, 고지방 식이를 하더라도 마르멜로 추출물을 병행하여 섭취하면 체중의 증가가 억제되는 것을 확인할 수 있었다.
또한, 마르멜로 추출물을 투여한 시험군인 그룹 3의 식이섭취량이 음성 대조군 (그룹 2) 대비 유의적으로 감소하였으나, 식이효율 (체중증가량/식이섭취량) 역시 감소하였고, 이는 식이섭취량의 감소만으로 체중이 감소한 것이 아니라는 것을 의미한다.
실시예 5. 체지방 (body fat) 측정
실시예 3.2의 실험동물 시험 종료 1일 전에 실험동물을 마취한 후 dual-energy X-ray absorptiometry (DEXA, PIXImusTM, GE Lunar)를 사용하여 체구성 성분을 측정하여 체지방률을 평가하였고, 그 결과를 표 9에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
Fat (%) 29.58 ± 0.84 42.84 ± 1.66*** 37.97 ± 1.46#
(상기 수치는 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다)
체지방률은 대조식이군 (그룹 1)의 29.58 ± 0.84%와 비교하여 고지방식이 대조군 (그룹 2)은 42.84 ± 1.66%로 체지방률이 현저히 증가하였고, 고지방식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 체지방률이 유의적으로 감소하였다.
실시예 6. 혈액 및 지방 분석
실시예 6.1 채혈 및 조직 적출
상기 실시예 3의 실험동물의 시험 종료 후 실험동물을 희생하였다. 희생 전 트리브로모에탄올 (tribromoethanol)을 tert-아밀알코올 (tert-amyl alcohol)로 희석하여 만든 마취제를 사용하여 마취한 후 안와채혈을 하였다. 혈액은 serum separate tube (Becton Dickinson)에 담아 30분간 실온에서 방치한 후 5,000 rpm에서 10분간 원심 분리하여 혈청을 분리하였고, 분석 전까지 -70℃에 보관하였다. 채혈 후 실험동물을 희생하여 백색지방조직 (부고환지방, 내장지방, 후복강지방, 서혜부지방)을 적출한 후 차가운 생리식염수로 헹구어 여과지로 여분의 물기를 제거한 후 무게를 측정하였다. 부고환 지방조직을 삼등분하여 일부는 4% paraformaldehyde (PFA)에 고정한 후 파라핀에 포매를 하여 조직염색을 수행하였고, 일부는 total RNA를 분리한 후 real-time RT-PCR을 수행하였으며, 일부는 단백질을 분리한 후 Western blot을 수행하였고, 향후 추가 분석을 위해 -70℃에 보관하였다.
6.2 조직 (지방조직) 무게 측정
상기 실시예 6.1에서 지방조직의 무게를 측정하였고 그 결과를 표 10에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
부고환지방 1.030 ± 0.070 2.471 ± 0.079*** 2.023 ± 0.109##
후복강지방 0.447 ± 0.037 1.184 ± 0.063*** 0.954 ± 0.074#
내장지방 0.603 ± 0.050 1.603 ± 0.114*** 0.975 ± 0.073###
서혜부지방 0.210 ± 0.031 0.544 ± 0.033*** 0.490 ± 0.052
백색지방 총 무게 2.29 ± 0.14 5.80 ± 0.21*** 4.44 ± 0.21###
(상기 수치는 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다)
체지방은 형태나 작용에 따라 백색지방조직과 갈색지방조직으로 구분 되며, 백색지방조직은 주로 체내 잉여 에너지를 지방으로 저장하고, 갈색지방조직은 열을 생산하는 기능을 하며, 백색지방의 중량이 증가할수록 체중이 증가한다. 백색 지방조직인 부고환지방, 후복강지방, 내장지방 및 서혜부지방의 무게는 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 모두 유의적으로 증가하였다. 반면, 마르멜로 추출물을 투여한 그룹 3은 고지방식이 대조군 (그룹 2)과 비교하여 시험된 모든 항목의 체지방이 감소하였다.
6.3 혈당 관련 수치 분석
상기 실시예 6.1에서 채혈한 혈액 내 포도당 (glucose)의 함량을 혈액생화학분석기 (KoneLab 20 XT, Thermo Fisher Scientific)를 이용하여 측정하였고, insulin 함량을 Millipore Corporation에서 구입한 측정 kit을 사용하여 제조사에서 제시한 방법에 따라 측정하였다.
인슐린 저항성은 대사증후군의 가장 핵심 요소이기 때문에, 혈중 인슐린 농도의 측정이 인슐린 감수성 및 저항성을 측정하는데 매우 유용하며, 본 연구에서도 혈중 인슐린 농도와 공복혈당을 이용하여 인슐린 저항성 (HOMA-IR)과 인슐린 민감성 (QUICKI)을 산출하였다. 인슐린저항성 (homeostatic model assessment for insulin resistance, HOMA-IR)과 인슐린민감성 (quantitative insulin sensitivity check index, QUICKI)을 공복혈당과 혈중 인슐린 함량을 이용하여 하기 수학식 2 및 3을 이용하여 계산하였고, 상기 측정 결과를 표 11에 나타내었다.
[수학식 2]
인슐린저항성 (HOMA-IR) = [insulin (mU/L) × glucose (mg/dL)] / 405
[수학식 3]
인슐린민감성 (QUICKI) = 1 / [log insulin (mU/L) + log glucose (mg/dL)]
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
Glucose (mg/dL) 149.0 ± 10.8 196.8 ± 7.8** 185.2 ± 7.5
Insulin (ng/mL) 2.62 ± 0.21 9.12 ± 0.97*** 5.67 ± 0.81#
HOMA-IR 22.9 ± 2.2 107.1 ± 12.4*** 62.3 ± 9.3##
QUICKI 0.253 ± 0.002 0.218 ± 0.004*** 0.230 ± 0.003#
Glucose는 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가하였고, 그룹 3에서는 고지방식이 대조군 (그룹 2)에 비해 감소하였다.
혈중 insulin 함량은 대조식이군 (그룹 1)의 2.62 ± 0.21ng/mL과 비교하여 고지방식이 대조군 (그룹 2)에서 9.12 ± 0.97ng/mL로 현저히 증가한 반면, mdB-44 투여군 (그룹 3)에서는 5.67 ± 0.81ng/mL로 고지방식이 대조군 대비 유의적으로 감소하였다.
인슐린 저항성은 대조식이군 (그룹 1)의 22.9 ± 2.2와 비교하여 고지방식이 대조군 (그룹 2)에서 107.1 ± 12.4로 현저히 증가한 반면, mdB-44 투여군 (그룹 3)에서 고지방식이 대조군 대비 감소하였다. 인슐린 민감성은 대조식이군 (그룹 1)의 0.253 ± 0.002와 비교하여 고지방식이 대조군 (그룹 2)에서 0.218 ± 0.004로 유의적으로 감소한 반면, mdB-44 투여군 (그룹 3)에서 고지방식이 대조군 대비 증가하였다. 이를 통해, 마르멜로 추출물 투여군의 경우 고지방식이로 인해 유발되는 인슐린 저항성을 억제하여 내당능 장애를 개선하고 있다는 것을 확인하였다.
6.4 지방 관련 수치 분석
상기 실시예 6.1에서 채혈한 혈액 내 중성지방 (triglyceride, TG), 총 콜레스테롤 (total cholesterol, CHOL), HDL-콜레스테롤 (HDL-CHOL) 함량을 혈액생화학분석기 (KoneLab 20 XT, Thermo Fisher Scientific)를 이용하여 측정하였고, 혈중 콜레스테롤 함량과 HDL-콜레스테롤 함량을 이용하여 동맥경화지수를 하기 수학식 4를 통해 계산하였다.
[수학식 4]
동맥경화지수 = 총 콜레스테롤 함량 / HDL-콜레스테롤 함량
상기 얻어진 결과를 표 12에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
TG (mg/dL) 77.1 ± 3.3 90.4 ± 3.4* 77.3 ± 3.2#
CHOL (mg/dL) 165.7 ± 8.4 188.4 ± 4.7* 171.8 ± 5.3#
HDL-CHOL (mg/dL) 151.6 ± 6.2 126.9 ± 5.8** 150.9 ± 6.1#
동맥경화지수 1.09 ± 0.04 1.52 ± 0.11** 1.15 ± 0.04##
일반적으로 고지방식이 섭취 시 지방산의 공급이 증가하여 혈중 중성지방, 총 콜레스테롤의 농도가 증가하는 반면, HDL-콜레스테롤의 혈중 농도는 감소하는 경향을 나타내는데, 이는 심혈관 및 관상 혈관질환의 원인이 된다.
혈중 중성지방 및 혈중 총콜레스테롤 함량은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가한 반면, mdB-44를 투여한 그룹 3에서는 그룹 2에 비해 유의적으로 감소하였고, 특히 혈중 중성지방 수치의 경우 대조식이군 (그룹 1)과 매우 유사하게 측정되었다. 혈중 HDL-콜레스테롤 함량은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 감소한 반면, mdB-44를 투여한 그룹 3에서는 그룹 2에 비해 유의적으로 증가하였고, 대조식이군 (그룹 1)과 매우 유사하게 측정되었다. 관상동맥질환 발생의 가장 유효한 예측인자인 동맥경화지수 (수학식 4 참조)를 혈중 콜레스테롤 함량과 HDL-콜레스테롤 함량을 이용하여 산출한 결과, 대조식이군 (그룹 1)의 1.09±0.04와 비교하여 고지방식이 대조군 (그룹 2)은 1.52±0.11로 유의하게 증가한 반면, mdB-44 200mg/kg BW 투여군 (그룹 3)에서 1.15 ± 0.04 (그룹 3)으로 그룹 2에 비해 유의적으로 감소하였다.
6.5 혈청 leptin 및 adiponection 함량 분석
지방조직은 잉여에너지를 저장하는 장소일 뿐 아니라 생리학적으로 매우 중요한 역할을 하는 다양한 adipokines을 합성 분비함으로써 전신의 대사과정에 영향을 미치는 내분비 기관으로 인식되고 있다. 지방조직에서 분비되는 대표적인 adipokines의 하나인 leptin은 에너지 섭취와 저장, 인슐린 민감도, 대사속도 등을 조절하는 중요한 물질로 비만의 경우 leptin의 분비량이 증가하는 것으로 알려져 있다. 또 다른 주요 adipokines인 adiponectin은 근육에서 지방산화를 증가시키는 동시에 항염증성 사이토카인의 역할을 통하여 당뇨병 및 대사증후군 등의 만성질환을 예방하는 중요 호르몬으로 알려져 있다.
상기 실시예 6.1에서 채혈한 혈액의 혈청 내 leptin 및 adiponectin 함량을 R&D Systems에서 구입한 측정 kit을 사용하였고, 제조사에서 제시한 방법에 따라 측정하였고, 그 결과를 하기 표 13에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
Adiponectin (ng/mL) 10.45 ± 0.26 9.45 ± 0.25* 10.84 ± 0.37##
Leptin (ng/mL) 21.14 ± 2.96 116.04 ± 9.49*** 69.53 ± 5.13###
혈중 leptin 함량은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 현저히 증가하였고, 이는 mdB-44 투여군 (그룹 3)에서 그룹 2에 비해 유의적으로 감소하였다. 혈중 adiponectin 함량은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 감소하였고, 고지방식이 대조군 (그룹 2)과 비교하여, mdB-44 투여군 (그룹 3)에서 증가하였다. 내장지방조직의 지방세포의 크기, 수, 및 양의 증가는 leptin의 분비량과 양의 상관관계가 있고, adiponectin 분비량은 음의 상관관계가 있다고 알려져 있는바, 상기 결과로 mdB-44 투여군은 비만 마우스에서 증가한 혈중 leptin을 유의적으로 감소시켰고, adiponectin 분비량을 증가시켜 항비만 효과를 나타냈다.
6.6 부고환 지방조직의 조직학적 분석
상기 실시예 6.1에서 실험동물에서 적출하여 고정된 부고환지방조직을 파라핀에 포매하고, 포매된 조직들로부터 5μm의 조직 절편을 제작하였다. 파라핀 제거 후, 100% 알코올에서 시작하여 0% 알코올 (H2O)까지 순차적으로 알코올의 %를 낮춰 조직을 수화하였다. 이후 Accustain® Hematoxylin and Eosin Stains (Sigma-Aldrich Co.)을 사용하여 제조회사가 제시한 방법에 따라 조직을 염색하였고 (hematocylin & eosin 염색, H&E 염색), 광학현미경 (Carl Zeiss)을 사용하여 각 조직의 조직학적 변화를 관찰하였다. 또한, H&E 염색하여 얻은 부고환 지방조직 사진을 AxioVision Imaging analysis System을 이용하여 지방세포 크기 및 세포수를 측정하였다. 상기 부고환 지방조직의 조직학적 변화를 도 3에 나타내었고, 상기 측정한 지방조직의 지방세포 크기에 따른 세포 수를 표 14에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
<80μm 161.0 ± 7.1 1.0 ± 1.0*** 41.7 ± 2.2###
80~100μm 16.0 ± 1.7 9.3 ± 1.5* 45.0 ± 3.5###
100~120μm 0.0 ± 0.0 28.0 ± 4.0* 12.7 ± 1.2#
>120μm 0.0 ± 0.0 12.7 ± 1.2** 0.0 ± 0.0##
동일 면적 지방 세포 수 177.0 ± 8.7 51.0 ± 5.7*** 99.3 ± 5.2##
평균 지방구 크기 (μm) 80.9 ± 0.1 108.5 ± 1.0*** 88.3 ± 0.4###
(상기 수치는 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다)
도 3에 나타난 바와 같이, 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)의 부고환 지방조직에서 지방세포의 크기가 현저히 증가하였으며, mdB-44 투여군 (그룹 3)에서는 지방세포 크기가 감소하는 경향을 나타내었다.
또한, 부고환 지방조직의 지방세포 크기에 따른 세포수를 측정한 결과를 보여주는 표 14에 나타난 바와 같이, 대조식이군 (그룹 1)은 지방세포 크기가 <80μm인 세포수가 161.0 ± 7.1개인 반면, 크기가 >100μm인 지방세포수는 관찰되지 않아 대체로 지방세포의 크기가 작음을 확인하였다. 고지방식이 대조군 (그룹 2)의 지방세포 크기가 100~120μm인 세포수는 28.0 ± 4.0개, 크기가 >120μm인 세포수는 12.0 ± 2.1개로 지방세포의 크기가 큰 것을 확인하였다. 고지방식이 대조군 (그룹 2)과 비교하여, 시험물질 투여군 (그룹 3)의 지방세포 크기 별 세포 수를 비교한 결과, 크기가 <80μm 인 것과 80~100μm 크기의 지방세포수는 유의적으로 증가하였고, 크기가 100~120 μm인 세포수는 유의적으로 감소하였다. >120μm 크기의 지방세포수는 mdB-44 200mg/kg BW 투여군 (그룹 3)에서는 관찰되지 않았다.
동일 면적 대비 총 지방세포수는 대조식이군 (그룹 1)의 177.0 ± 8.7개와 비교하여 고지방식이 대조군 (그룹 2)은 51.0 ± 5.7개로 유의적으로 감소하였고, mdB-44 200mg/kg BW 투여군 (그룹 3) 에서 유의적으로 증가하였다. 평균 지방 구 크기는 대조식이군 (그룹 1)의 80.9 ± 0.1μm와 비교하여 고지방식이 대조군 (그룹 2)은 108.5 ± 1.0 μm로 유의적으로 지방구 크기가 증가하고, mdB-44 200mg/kg BW 투여군 (그룹 3)은 88.3 ± 0.4μm (그룹 3)로 지방구 크기가 유의적으로 감소하였다.
상기 결과로부터 마르멜로 추출물 투여가 항비만 효과를 나타낼 뿐 아니라, 특히 고지방식이로 인해 유발되는 백색지방조직의 비대증을 억제하는 효과가 있다는 것을 확인할 수 있었다.
6.6 지방조직 내 에너지 대사 관련 유전자 mRNA 발현 분석
실시예 6.1에서 얻은 부고환지방조직에 TRIzol® Reagent (Thermo Fisher Scientific)을 사용하여 total RNA를 분리한 후, micro-volume spectrophotometer (BioSpec-nano, SHIMADZU)을 사용하여 정량하였고, OD260/280 값이 1.8 이상인 RNA를 실험에 사용하였다. Total RNA (2 μg)로부터 HyperScriptTM RT master mix kit (GeneAll Biotechnology)을 이용하여 cDNA를 얻은 후, Rotor-Gene 300 PCR (Corbett Research)와 Rotor-GeneTM SYBR Green kit (QIAGEN)를 사용하여 real-time PCR을 수행하였다. 실험에 사용한 primer 정보는 표 15에 나타내었다. 유 전자의 발현의 정량 분석은 Rotor-Gene 6000 Series System Software program (Corbett Research)을 이용하여 수행하였다.
mRNA 염기서열(5’ → 3’) Genebank No. 서열번호
C/EBPα-FOR primer TGGACAAGAACAGCAACGAGTAC XM_021168520.2 1
C/EBPα-REV primer GCAGTTGCCCATGGCCTTGAC XM_021168520.2 2
PPARγ-FOR primer CAAAACACCAGTGTGAATTA XM_021164279.2 3
PPARγ-REV primer ACCATGGTAATTTCTTGTGA XM_021164279.2 4
SREBP-1c-FOR primer CACTTCTGGAGACATCGCAAAC NM_011480.4 5
SREBP-1c-REV primer ATGGTAGACAACAGCCGCATC NM_011480.4 6
CPT1β-FOR primer GTGCTGGAGGTGGCTTTGGT NM_009948.2 7
CPT1β-REV primer TGCTTGACGGATGTGGTTCC NM_009948.2 8
FAS-FOR primer AGGGGTCGACCTGGTCCTCA NM_007988.3 9
FAS-REV primer GCCATGCCCAGAGGGTGGTT NM_007988.3 10
aP2-FOR primer GGATTTGGTCACCATCCGGT NM_024406.3 11
aP2-REV primer TTCACCTTCCTGTCGTCTGC NM_024406.3 12
HSL-FOR primer CCGTTCCTGCAGACTCTCTC XM_030242181.1 13
HSL-REV primer CCACGCAACTCTGGGTCTAT XM_030242181.1 14
GAPDH-FOR primer AGGTTGTCTCCTGCGACT XM_029478683.1 15
GAPDH-REV primer TGCTGTAGCCGTATTCATTGTCA XM_029478683.1 16
ACC1-FOR primer GGAGATGTACGCTGACCGAGAA AY451393.1 17
ACC1-REV primer ACCCGACGCATGGTTTTCA AY451393.1 18
ACL-FOR primer TGGATGCCACAGCTGACTAC BC056378.1 19
ACL-REV primer GGTTCAGCAAGGTCAGCTTC BC056378.1 20
시험물질이 부고환 지방조직의 지방합성, 분해 및 에너지 대사 관련 mRNA 발현에 미치는 영향을 분석하였고, 그 결과를 표 16에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질 (mg/kg BW) - - mdB-44 200
C/EBPα 1.00 ± 0.36 4.10 ± 0.05*** 2.20 ± 0.48##
PPARγ 1.00 ± 0.12 2.25 ± 0.20** 1.11 ± 0.06##
SREBP-1c 1.00 ± 0.12 2.41 ± 0.23** 1.51 ± 0.17#
CPT1 1.00 ± 0.19 0.37 ± 0.07* 2.28 ± 0.14###
FAS 1.00 ± 0.52 2.90 ± 0.39* 0.25 ± 0.10###
aP2 1.00 ± 0.11 1.98 ± 0.38* 0.94 ± 0.13#
HSL 1.00 ± 0.07 0.45 ± 0.04*** 0.78 ± 0.07##
ACC1 1.01 ± 0.08 3.66 ± 0.42*** 2.82 ± 0.35
ACL 0.96 ± 0.14 1.49 ± 0.15* 0.75 ± 0.16#
(상기 결과는 GAPDH 발현양 대비 각 물질의 발현양으로, (각 물질의 발현양 / GAPDH의 발현양)으로 계산하였고, 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다)
지방세포 유전자 조절부위에 전사활성 인자가 활성화되어야 지방전구세포에서 성숙한 지방세포로의 분화가 이루어지며, 지방세포의 분화를 조절하는 전사인자에는 SREBPs (sterol-regulatory element-bindingprotein), PPARs (Peroxisome Proliferator-Activated Receptor), C/EBPs (CCAAT/enhancer binding protein) 등이 있다. SREBPs는 SREBP-1과 SREBP-2가 있으며, 그 중 SREBP-1은 전구지방세포 분화 초기에 빠르게 유도되어 adipocyte 분화를 촉진시키고, 지방 대사에 관련된 유전자의 발현을 증가시켜 지방 대사를 촉진하는 역할을 한다.
표 16에 나타난 바와 같이, 부고환 지방조직에서 SREBP-1c mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가하였고, 고지방식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 유의적으로 감소하였다. 지방세포 분화 초기 호르몬 유도에 의해 (insulin, dexamethasone 등) C/EBPβ가 발현되고 C/EBPβ가 활성화되면 분화 후기에 지방세포의 전사인자인 C/EBPα와 PPARγ의 발현이 유도된다. C/EBPα는 PPARγ와 상호 작용하여 영향을 미치는데 C/EBPα는 adipose tissue의 특이적 유전자들의 발현 전에 증가하여 에너지 항상성을 조절하고 PPARγ는 adipogenesis의 주요 조절자로 백색지방조직에서 많이 발현된다. 부고환 지방조직에서 C/EBPα와 PPAR-γ mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가하였고, 고지방식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 유의적으로 감소하였다.
FAS (fatty acid synthase)는 fatty acid 생합성에 관여하는 효소로 지방산이 간에서 합성되면 중성지방으로 전환되어 VLDL의 형태로 혈관을 돌아다니며 지방조직에 중성지방을 전달하는 역할을 한다. 부고환 지방조직 내 FAS mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가하였고, 고지방 식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 유의적으로 감소하였다.
지방합성의 target gene으로 알려진 aP2는 지방세포와 대식세포에서 발현되며 염증과 대사반응에 관여하는 것으로 알려져 있다. 부고환 지방조직 내 aP2 mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가 하였고, 고지방식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 aP2 mRNA 발현이 유의적으로 감소하였다 (표 16).
CPT-1 (Carnitine palmitoyl transferase-1)은 지방산을 미토콘드리아 내부로 유입시키는 속도 제한 단계 효소로, 지방산이 세포 내로 유입되어 산화되기 위해서는 막 내부의 transferase를 필요로 하는데 CPT-1은 이러한 transferase의 하나로 지질 이용의 주요한 역할을 한다. 부고환 지방조직 내 CPT-1 mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 감소하였고, mdB-44 투여군 (그룹 3)에서 CPT-1 mRNA 발현이 고지방식이 대조군 (그룹 2)에 비해 유의적으로 증가하였다.
HSL (hormone-sensitive lipase)은 다양한 장기에 분포하지만 주로 지방조직에서 활성화되며, 에피네프린이나 글루카곤과 같은 호르몬 분비에 의해 활성형 HSL이 되며, 활성형 HSL은 지단백질의 중성지방을 한 개의 글리세롤과 세 개의 지방산으로 분해하는 작용을 한다. 부고환 지방조직 내 HSL mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 감소하였다. 고지방식이 대조군 (그룹 2)에 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 HSL mRNA 발현이 유의적으로 증가하였다 (표 16).
ACC1은 주로 지방산 합성이 중요한 지방 조직에 존재하고 ACC2는 주로 골격근 및 심장과 같은 산화 조직에 존재하여 지방산 합성 및 산화를 조절한다. 부고환 지방조직 내 ACC1 mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가하였고, 고지방식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 ACC1 mRNA 발현은 감소하였다
ACL은 citrate를 acetyl-CoA로 전환하여 세포질 acetyl-CoA의 합성에 관여하는 효소이며, 지방산 및 콜레스테롤과 같은 중요한 생합성 경로에 사용된다. 부고환 지방조직 내 ACL mRNA 발현은 대조식이군 (그룹 1)과 비교하여 고지방식이 대조군 (그룹 2)에서 유의적으로 증가 하였고, 고지방식이 대조군 (그룹 2)과 비교하여 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 ACL mRNA 발현이 유의적으로 감소하였다.
6.7 지방조직 내 단백질 발현 분석
부고환 지방조직 내 단백질 발현을 조사하기 위해 부고환지방에 lysis buffer (Pierce® IP Lysis buffer, Thermo Scientific)를 첨가한 후 homogenizer로 균질화하였다. 균질화한 용액을 12,000 rpm에서 10분간 원심분리한 후 상층액을 취해 부고환 지방조직 lysates 얻었다. 조직 lysate의 단백질 양은 BCA protein assay kit (Thermo Scientific)을 사용하여 측정하였다.
단백질 (50μg)을 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)로 분리한 후, polyvinylidene difluoride membrane (Milipore)에 이동시켰다. Membrane을 5% skim milk-TBST (20 mmol/L Tris·HCl, pH 7.5, 150 mmol/L NaCl, 0.1% Tween 20)에서 1시간 동안 blocking 한 후, 측정 하고자 하는 antibody를 각각 첨가하여 4℃에서 16시간 동안 또는 상온에서 1시간 동안 교반하였다. 실험에 사용한 antibody 정보는 표 17에 나타내었다. 그 후 horseradish peroxidase (HRP)-linked anti-rabbit IgG 또는 HRP-linked anti-mouse IgG를 첨가하여 1시간 교반하였고, 각 단백질 밴드는 LuminataTM Forte Western HRP Substrate (Millipore)를 사용하여 enhanced chemiluminscence 방법으로 가시화하였다. 단백질 발현 수준은 ImageQuantTM LAS 500 imaging systems (GE Healthcare Bio-Sciences AB)을 사용하여 정량하였다.
항체명 세부정보 제조회사
p-AMPK Phospho-AMPKα (Thr172) #2535 Cell Signaling Technology
AMPK AMPKα #2532 Cell Signaling Technology
β-actin Beta-actin #3700 Cell Signaling Technology
AMP-activated protein kinase (AMPK)는 인슐린 저항성을 개선하는 인자로서, 활성화된 AMPK는 지방과 콜레스테롤 합성과 같은 ATP 소비경로를 차단하면서, 당 분해나 지방산 산화와 같은 ATP 생성경로를 활성화시키는 것으로 알려져 있다. 특히 지질대사와 관련하여 단백질 인산화를 통해 acetyl-CoA carboxylase (ACC) 효소의 활성을 억제함으로써 지방산 산화 증가에 따른 체지방 감소에 중요한 역할을 하는 것으로 보고되고 있다.
시험물질이 부고환 지방조직 내 AMPK 활성에 미치는 영향을 조사하기 위해 부고환 지방조직 lysate를 사용하여 Western blot을 실시 및 정량하고 그 결과를 표 18에 나타내었다.
그룹 1 그룹 2 그룹 3
실험식이 CD HFD HFD
시험물질(mg/kg BW) - - mdB-44 200
p-AMPK/AMPK Ratio 1.00 ± 0.0 0.64 ± 0.04* 1.50 ± 0.22#
(상기 수치는 평균 ± 표준오차로 표시된 것이고, * p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001을 의미한다)
표 18에 나타난 바와 같이, p-AMPK/AMPK의 비율을 통해 AMPK 활성을 평가한 결과, 고지방식이 대조군 (그룹 2)에서 감소한 AMPK의 활성이 mdB-44 200mg/kg BW 투여군 (그룹 3)에서 유의적으로 증가하였다.
이상 확인된 바와 같이, 고지방식이와 함께 투여한 마르멜로 추출물이 고지방식이에 의해 유도된 체중, 간 및 지방조직 무게, 혈중 콜레스테롤, 혈중 insulin과 leptin 함량 증가를 효과적으로 억제함과, 지방세포의 크기 증가를 억제함을 확인하였다. 이는 마르멜로가 식이성 비만에 대한 항비만 효과 및 지질 개선 효과가 있고 더 나아가 대사성 질환에 예방, 치료, 및/또는 개선 효과가 있음을 제시하며, 향후 항비만 효능 및/또는 대사성 질환에 예방, 치료, 및/또는 개선 효과를 갖는 건강기능성 소재로의 개발 가능성을 제시한다.
실시예 7. 지방세포 분화 확인
실시예 7-1 마르멜로 추출물 준비
상기 실시예 1과 실질적으로 동일한 방법으로 마르멜로 추출물을 준비하고 (mdB-44), 추가적으로 상기 실시예 1의 마르멜로 열매 (LICORICE EXTRACT (Tashkent, Republic of Uzbekistan))에서 추가 공정 없이 상기 실시예 1에서 사용된 주정으로 실질적으로 동일한 환경에서 추출한 에탄올 추출물 (EE)을 비교군으로 준비하였다.
실시예 7-2 세포 배양
생쥐에서 유래한 지방전구세포인 3T3-L1 세포를 한국세포주은행에서 구입하여 사용하였다. 상기 3T3-L1 세포를 Dulbecco’s Modified Eagle’s Medium (DMEM, Welgene)에 10% bovine calf serum (BCS), 100 units/mL penicillin과 100μg/mL streptomycin을 첨가한 세포배양액 (complete DMEM 배양액)을 사용하여 37℃ 습윤한 CO2 배양기 (5% CO2/95% air)에서 배양하였다. 세포가 배양접시의 80% 정도 찼을 때, phosphate buffer saline (PBS, pH 7.4)으로 세포 단층을 씻어낸 후 trypsin-2.65 mM EDTA를 첨가하여 세포를 떼어내어 계대 배양하였고, 배지는 2일 마다 교환하였다.
실시예 7-3 세포 분화 유도 및 시험물질 처리
상기 실시예 7-2에서 배양한 3T3-L1 세포를 1 × 105 cells/well의 농도로 24-well plate에 분주하였다. 세포가 confluence한 상태에 도달한 후, 순차적으로 3종류의 분화유도배양액 (DM)으로 세포배양액을 교환하여 세포를 배양하여 지방세포로 분화를 유도하였다. 구체적으로, 10% FBS을 함유한 DMEM 배지에 DMI (1μM dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 5μg/mL insulin)를 첨가한 분화유도배양액으로 세포배양액을 교환하여 2일 동안 분화를 자극하였다. 2일 후, 10% FBS를 함유한 DMEM 배지에 5μg/mL insulin을 첨가한 새로운 분화유도배양액으로 교환하여 다시 2일 동안 분화를 자극하였다. 총 4일 동안 분화를 자극한 후, 세포를 10% FBS를 함유한 DMEM 배지에서 약 4 ~ 8일 동안 유지하여 지방세포로의 분화를 유도하였으며, 이 기간에는 세포배양액을 2일 마다 교환하였다.
상기 실시예 1의 마르멜로 추출물 (mdB-44)이 지방세포 분화에 미치는 영향을 조사하기 위해, 상기 실시예 7-2에서 준비한 분화유도배양액에 상기 실시예 7-1에서 준비한 분말 상태의 마르멜로 추출물 (mdB-44)을 200ug/ml의 농도로 첨가하였고, 상기 실시예 7-1에서 준비한 에탄올 추출물 (EE)을 별도로 200ug/ml의 농도로 첨가하였다. 또한, 추출물을 첨가하지 않고, 배양 및 분화를 시킨 대조군과 추출물을 첨가하지 않고 배양도 분화도 시키지 않은 대조군을 준비하였다.
실시예 7-4 지방세포 분화 (지방 축적) 측정 (Oil red-O 염색 및 정량)
상기 실시예 7-3과 실질적으로 동일한 방법으로 3T3-L1 세포 분화 유도하고 추출물을 처리한 후, 상기 분화가 유도된 세포를 Dulbecco’s phosphate buffered saline (Welgene)로 헹군 후 4% paraformaldehyde (Biosesang)를 넣어 1시간 동안 실온에서 세포를 고정시켰다. 세포를 고정시킨 후, Oil Red O (Sigma-Aldrich) 용액을 처리하여 1 ~ 2시간 동안 실온에서 염색하였다. 지방세포의 염색 정도를 눈으로 관찰한 후, 세포를 증류수로 헹구고 현미경을 통해 지방세포를 관찰하였고, 지방세포 분화정도를 image J 프로그램으로 분석하였고, 그 결과를 도 4에 나타내었다.
도 4에 나타낸 바와 같이, 본원 조성물의 방식으로 추출한 추출물 (mdB-44)의 지질 축적 억제 효과가 열매 자체를 에탄올로 추출한 추출물 (EE)보다 더 좋은 것을 확인하였다.
실시예 8. 마르멜로 추출물의 chlorogenic acid 함량 측정
실시예 8-1 마르멜로 추출물 준비
상기 실시예 7-1과 실질적으로 동일한 방법으로 두 가지 종류의 마르멜로 추출물 (mdB-44 및 EE)을 준비하였다.
실시예 8-2. 마르멜로 추출물의 chlorogenic acid 함량 분석
상기 실시예 8-1에서 준비한 마르멜로 추출물 mdB-44 및 EE를 상기 실시예 2와 실질적으로 동일하게 HPLC 분석 방법으로 추출물 내 chlorogenic acid 함량을 분석하였고, 그 결과를 도 5에 나타내었다.
도 5에 나타낸 바와 같이, EE 내 chlorogenic acid는 0.53 mg/g 포함되어 있는 것으로 측정되었고, mdB-44 내 chlorogenic acid는 0.89 mg/g 포함되어 있는 것으로 측정되어, mdB-44와 같은 방법으로 추출된 추출물 내 chlorogenic acid 함량이 더 높은 것으로 측정된 것을 확인하였다.

Claims (57)

  1. 마르멜로 (marmelo) 추출물을 포함하는, 비만 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 비만 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    비만 예방 또는 치료용 약학적 조성물.
  4. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 비만 예방 또는 치료용 약학적 조성물.
  5. 제2항 또는 제3항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 비만 예방 또는 치료용 약학적 조성물.
  6. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 비만 예방 또는 치료용 약학적 조성물.
  7. 제1항 내지 제3항 중 어느 한 항에 있어서, 체중 또는 체지방 감소 효과가 있는, 비만 예방 또는 치료용 약학적 조성물.
  8. 마르멜로 (marmelo) 추출물을 포함하는, 체중 또는 체지방 감소용 식품 조성물.
  9. 제8항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 체중 또는 체지방 감소용 식품 조성물.
  10. 제8항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    체중 또는 체지방 감소용 식품 조성물.
  11. 제8항 내지 제10항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 체중 또는 체지방 감소용 식품 조성물.
  12. 제9항 또는 제10항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 체중 또는 체지방 감소용 식품 조성물.
  13. 제8항 내지 제10항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 체중 또는 체지방 감소용 식품 조성물.
  14. 제8항 내지 제10항 중 어느 한 항에 있어서, 상기 식품은 건강기능식품인, 체중 또는 체지방 감소용 식품 조성물.
  15. 제8항 내지 제10항 중 어느 한 항에 있어서, 상기 식품은 비만 예방 또는 개선효과가 있는, 체중 또는 체지방 감소용 식품 조성물.
  16. 마르멜로 (marmelo) 추출물을 포함하는, 비만 예방 또는 개선용 식품 조성물.
  17. 제16항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 비만 예방 또는 개선용 식품 조성물.
  18. 제16항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    비만 예방 또는 개선용 식품 조성물.
  19. 제16항 내지 제18항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 비만 예방 또는 개선용 식품 조성물.
  20. 제17항 또는 제18항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 비만 예방 또는 개선용 식품 조성물.
  21. 제16항 내지 제18항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 비만 예방 또는 개선용 식품 조성물.
  22. 제16항 내지 제18항 중 어느 한 항에 있어서, 상기 식품은 건강기능식품인, 비만 예방 또는 개선용 식품 조성물.
  23. 제16항 내지 제18항 중 어느 한 항에 있어서, 상기 식품은 체중 또는 체지방 감소 효과가 있는, 비만 예방 또는 개선용 식품 조성물.
  24. 마르멜로 (marmelo) 추출물을 포함하는, 대사성 질환 예방 또는 치료용 약학적 조성물.
  25. 제24항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 대사성 질환 예방 또는 치료용 약학적 조성물.
  26. 제24항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    대사성 질환 예방 또는 치료용 약학적 조성물.
  27. 제24항 내지 제26항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 대사성 질환 예방 또는 치료용 약학적 조성물.
  28. 제25항 또는 제26항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 대사성 질환 예방 또는 치료용 약학적 조성물.
  29. 제24항 내지 제26항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 대사성 질환 예방 또는 치료용 약학적 조성물.
  30. 제24항 내지 제26항에 있어서, 상기 대사성 질환은 당뇨병, 고지혈증, 동맥경화, 고인슐린혈증 또는 대사증후군인, 대사성 질환 예방 또는 치료용 약학적 조성물.
  31. 제24항 내지 제26항에 있어서, 혈당 또는 혈중 콜레스테롤 강하 효과가 있는, 대사성 질환 예방 또는 치료용 약학적 조성물.
  32. 마르멜로 (marmelo) 추출물을 포함하는, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  33. 제32항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  34. 제32항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  35. 제32항 내지 제34항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  36. 제33항 또는 제34항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  37. 제32항 내지 제34항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  38. 제32항 내지 제34항에 있어서, 대사성 질환 예방 또는 치료 효과가 있는, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  39. 제38항에 있어서, 상기 대사성 질환은 당뇨병, 고지혈증, 동맥경화, 고인슐린혈증 또는 대사증후군인, 혈당 또는 혈중 콜레스테롤 강하용 약학적 조성물.
  40. 마르멜로 (marmelo) 추출물을 포함하는, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  41. 제40항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  42. 제40항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  43. 제40항 내지 제42항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  44. 제41항 또는 제42항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  45. 제40항 내지 제42항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  46. 제40항 내지 제42항 중 어느 한 항에 있어서, 상기 식품은 건강기능식품인, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  47. 제40항 내지 제42항 중 어느 한 항에 있어서, 대사성 질환 예방 또는 개선 효과가 있는, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  48. 제47항에 있어서, 상기 대사성 질환은 당뇨병, 고지혈증, 동맥경화, 고인슐린혈증 또는 대사증후군인, 혈당 또는 혈중 콜레스테롤 강하용 식품 조성물.
  49. 마르멜로 (marmelo) 추출물을 포함하는, 대사성 질환 예방 또는 개선용 식품 조성물.
  50. 제49항에 있어서, 상기 마르멜로 추출물은 마르멜로를 물 및 탄소수 1 내지 4의 직쇄 또는 분지쇄 알코올로 이루어진 군에서 선택된 1종 이상의 추출 용매로 추출한 추출물인, 대사성 질환 예방 또는 개선용 식품 조성물.
  51. 제49항에 있어서, 상기 마르멜로 추출물은
    마르멜로를 10 내지 70 (v/v)% 알코올로 추출한 추출물인,
    대사성 질환 예방 또는 개선용 식품 조성물.
  52. 제49항 내지 제51항 중 어느 한 항에 있어서, 상기 마르멜로는 압착 후 마르멜로 주스를 제거하고 남은 고형물 형태인, 대사성 질환 예방 또는 개선용 식품 조성물.
  53. 제50항 또는 제51항에 있어서, 상기 알코올 추출은 50 내지 100℃에서 알코올을 1 내지 10 부피배로 가하여, 1 내지 24시간동안 추출하는 것인, 대사성 질환 예방 또는 개선용 식품 조성물.
  54. 제49항 내지 제51항 중 어느 한 항에 있어서, 상기 추출물은 10 내지 100 brix의 당도를 가지는 것인, 대사성 질환 예방 또는 개선용 식품 조성물.
  55. 제49항 내지 제51항 중 어느 한 항에 있어서, 상기 식품은 건강기능식품인, 대사성 질환 예방 또는 개선용 식품 조성물.
  56. 제49항 내지 제51항 중 어느 한 항에 있어서, 혈당 또는 혈중 콜레스테롤 강하 효과가 있는, 대사성 질환 예방 또는 개선용 식품 조성물.
  57. 제49항 내지 제51항에 있어서, 상기 대사성 질환은 당뇨병, 고지혈증, 동맥경화, 고인슐린혈증 또는 대사증후군인, 대사성 질환 예방 또는 개선용 식품 조성물.
PCT/KR2022/009967 2021-07-09 2022-07-08 마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물 WO2023282699A1 (ko)

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
KR10-2021-0090506 2021-07-09
KR20210090505 2021-07-09
KR1020210090504A KR102421111B1 (ko) 2021-07-09 2021-07-09 마르멜로 추출물을 포함하는 체중 또는 체지방 감소용 식품 조성물
KR1020210090506A KR20230009739A (ko) 2021-07-09 2021-07-09 마르멜로 추출물을 포함하는 대사성 질환의 예방 또는 개선용 식품 조성물
KR10-2021-0090504 2021-07-09
KR1020210090503A KR102610157B1 (ko) 2021-07-09 2021-07-09 마르멜로 추출물을 포함하는 비만 예방 또는 치료용 약학적 조성물
KR10-2021-0090505 2021-07-09
KR10-2021-0090503 2021-07-09
US17/535,815 US20230030099A1 (en) 2021-07-09 2021-11-26 Pharmaceutical composition comprising marmelo extract for preventing or treating obesity
US17/535,815 2021-11-26

Publications (1)

Publication Number Publication Date
WO2023282699A1 true WO2023282699A1 (ko) 2023-01-12

Family

ID=84801784

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/009967 WO2023282699A1 (ko) 2021-07-09 2022-07-08 마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물

Country Status (1)

Country Link
WO (1) WO2023282699A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008088187A (ja) * 2007-12-10 2008-04-17 Kao Corp 脂質代謝改善剤

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008088187A (ja) * 2007-12-10 2008-04-17 Kao Corp 脂質代謝改善剤

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ASHRAF MUHAMMAD U., MUHAMMAD GULZAR, HUSSAIN MUHAMMAD A., BUKHARI SYED N. A.: "Cydonia oblonga M., A Medicinal Plant Rich in Phytonutrients for Pharmaceuticals", FRONTIERS IN PHARMACOLOGY, vol. 7, XP093022112, DOI: 10.3389/fphar.2016.00163 *
FATTOUCH SAMI, CABONI PIERLUIGI, CORONEO VALENTINA, TUBEROSO CARLO I. G., ANGIONI ALBERTO, DESSI SANDRO, MARZOUKI NEJIB, CABRAS PA: "Antimicrobial Activity of Tunisian Quince ( Cydonia oblonga Miller) Pulp and Peel Polyphenolic Extracts", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 55, no. 3, 1 February 2007 (2007-02-01), US , pages 963 - 969, XP093022117, ISSN: 0021-8561, DOI: 10.1021/jf062614e *
MAGALHAES, A.S. ; SILVA, B.M. ; PEREIRA, J.A. ; ANDRADE, P.B. ; VALENTAO, P. ; CARVALHO, M.: "Protective effect of quince (Cydonia oblonga Miller) fruit against oxidative hemolysis of human erythrocytes", FOOD AND CHEMICAL TOXICOLOGY, PERGAMON, GB, vol. 47, no. 6, 1 June 2009 (2009-06-01), GB , pages 1372 - 1377, XP026087069, ISSN: 0278-6915, DOI: 10.1016/j.fct.2009.03.017 *
SUT STEFANIA, DALL'ACQUA STEFANO, POLONIATO GABRIELE, MAGGI FILIPPO, MALAGOLI MARIO: "Preliminary evaluation of quince ( Cydonia oblonga Mill.) fruit as extraction source of antioxidant phytoconstituents for nutraceutical and functional food applications : Preliminary evaluation of quince ( Cydonia oblonga Mill.) fruit", JOURNAL OF THE SCIENCE OF FOOD AND AGRICULTURE, WILEY & SONS, CHICHESTER., GB, vol. 99, no. 3, 1 February 2019 (2019-02-01), GB , pages 1046 - 1054, XP093022108, ISSN: 0022-5142, DOI: 10.1002/jsfa.9271 *

Similar Documents

Publication Publication Date Title
WO2012124888A2 (en) Composition comprising the extract of herbal combination for preventing or treating diabetic peripheral neuropathy
WO2010087577A2 (ko) 스페니쉬 오레가노 추출물, 여름세이보리 추출물 또는 카바크롤의 대사성 질환 치료를 위한 용도
WO2011136573A2 (ko) 비만 치료 및 항산화 활성을 갖는 효모 가수분해물
WO2022005201A1 (ko) 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물
WO2016048005A2 (ko) 신규한 펜타디에노일 피페리딘 유도체 및 그의 용도
WO2023282699A1 (ko) 마르멜로 추출물을 포함하는 비만 예방, 치료 또는 개선용 또는 대사성 질환 예방, 치료 또는 개선용 조성물
WO2015064975A1 (en) Compositions comprising a viola herba extract, or an extract of viola herba, persicae semen, cinnamomi ramulus, and glycyrrhiza spp. for the prevention or treatment of lipid-related cardiovascular diseases and obesity
WO2010041908A2 (ko) 판두라틴 유도체 또는 보에센베르기아 판두라타 추출물의 신규한 용도
WO2023163318A1 (ko) 단쇄 지방산을 포함하는 발효 생성물 및 그의 과체중 개선, 예방 또는 치료 용도
WO2010090423A2 (en) Composition comprising combined crude drug extract for preventing and treating hyperlipidemia and diabetic hyperlipidemia
WO2021182894A1 (ko) 엘리오카퍼스 페티오라투스를 포함하는 심혈관 대사 질환의 예방 또는 치료용 조성물
WO2020130696A1 (ko) Cyp4a 저해 화합물을 유효성분으로 포함하는 대사질환의 예방 또는 치료용 조성물
WO2020106048A1 (ko) 퇴행성 신경질환의 예방 또는 치료용 약학 조성물
WO2015009047A1 (ko) 환삼덩굴 추출물을 포함하는 인슐린저항성 관련 질환의 예방 또는 치료용 조성물
WO2023055200A1 (ko) 커피체리 추출물을 포함하는 대사증후군의 예방, 개선 또는 치료용 조성물
KR102610157B1 (ko) 마르멜로 추출물을 포함하는 비만 예방 또는 치료용 약학적 조성물
WO2011081231A1 (ko) 호장근 부탄올 분획물 또는 에칠아세테이트 분획물을 이용한 비만 치료 및 예방용 조성물과 기능성 식품
WO2023191249A1 (ko) 포포나무 추출물을 포함하는 비만 또는 지질 대사 개선용 조성물
WO2023128636A1 (ko) 찔레나무 뿌리 추출물을 포함하는 비만 및 대사질환의 개선, 예방 또는 치료용 조성물
WO2024117763A1 (ko) 산사나무 뿌리 추출물을 유효성분으로 포함하는 지방간 또는 비만의 예방 또는 치료용 약학적 조성물
WO2024117697A1 (en) Food and pharmaceutical composition for treatment of fatty liver and inflammation by relieving endoplasmic reticulum stress
WO2023055079A1 (ko) 캐롭 추출물을 포함하는 대사증후군의 예방, 개선 또는 치료용 조성물
KR102421111B1 (ko) 마르멜로 추출물을 포함하는 체중 또는 체지방 감소용 식품 조성물
US20230030099A1 (en) Pharmaceutical composition comprising marmelo extract for preventing or treating obesity
WO2024090929A1 (ko) 결명 새싹 및 메밀 새싹을 포함하는 지방 축적 억제용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22838051

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE