WO2021261928A1 - 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법 - Google Patents

순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법 Download PDF

Info

Publication number
WO2021261928A1
WO2021261928A1 PCT/KR2021/007920 KR2021007920W WO2021261928A1 WO 2021261928 A1 WO2021261928 A1 WO 2021261928A1 KR 2021007920 W KR2021007920 W KR 2021007920W WO 2021261928 A1 WO2021261928 A1 WO 2021261928A1
Authority
WO
WIPO (PCT)
Prior art keywords
chain reaction
polymerase chain
gene
reverse primer
product
Prior art date
Application number
PCT/KR2021/007920
Other languages
English (en)
French (fr)
Inventor
이재훈
Original Assignee
(주)하임바이오텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)하임바이오텍 filed Critical (주)하임바이오텍
Priority to CN202180045225.7A priority Critical patent/CN115735008A/zh
Priority to US18/012,633 priority patent/US20230250471A1/en
Priority to EP21830294.1A priority patent/EP4170046A4/en
Priority to JP2022580308A priority patent/JP2023542064A/ja
Publication of WO2021261928A1 publication Critical patent/WO2021261928A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/101—Temperature
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/149—Sequential reactions

Definitions

  • the present invention relates to a composition for sequential polymerase chain reaction and a gene amplification method using the same, and more particularly, a template gene, a DNA polymerase, a dNTP, a first forward primer, a first reverse primer, a second reverse primer, and a third
  • a composition containing a reverse primer in one container the polymerase chain reaction can be continuously performed. It is possible to control each polymerase chain reaction according to the temperature, and to proceed sequentially in one container. It relates to a method capable of reducing the inflow of contaminants from the outside during gene amplification and increasing the yield of the gene polymerase chain reaction (PCR).
  • Molecular diagnosis is a field for diagnosing diseases by analyzing genes, and is currently showing the highest growth among in vitro diagnosis fields.
  • the new virus which is presumed to be caused by rapid environmental pollution and climate change, spreads greatly, the highest diagnostic accuracy among in vitro diagnostic fields is secured, and when a new virus emerges, it is possible to quickly check whether or not it is infected.
  • Much research on molecular diagnostics continues.
  • PCR polymerase chain reaction
  • a primer is designed by determining the region to be amplified from the gene, and determining the nucleotide sequence capable of complementary binding to the nucleotide sequence at the 3' end of the determined site.
  • nested PCR is a technique that can increase the specificity and sensitivity of PCR amplification, and is usually used to amplify low-purity DNA or RNA.
  • the first polymerase chain reaction is performed using the primer of the target gene as a continuous PCR by two types of primers, and the second primer that binds to the first PCR product is used. to perform a second polymerase chain reaction.
  • the nested PCR method is a method that amplifies with a first amplification primer and then amplifies by adding a second primer again.
  • Molecular diagnosis is a field for diagnosing diseases by analyzing genes, and is currently showing the highest growth among in vitro diagnosis fields.
  • the new virus which is presumed to be caused by rapid environmental pollution and climate change, spreads greatly, the highest diagnostic accuracy among in vitro diagnostic fields is secured, and when a new virus emerges, it is possible to quickly check whether or not it is infected.
  • Much research on molecular diagnostics continues.
  • PCR polymerase chain reaction
  • a primer is designed by determining the region to be amplified from the gene, and determining the nucleotide sequence capable of complementary binding to the nucleotide sequence at the 3' end of the determined site.
  • nested PCR is a technique that can increase the specificity and sensitivity of PCR amplification, and is usually used to amplify low-purity DNA or RNA.
  • the first polymerase chain reaction is performed using the primer of the target gene as a continuous PCR by two types of primers, and the second primer that binds to the first PCR product is used. to perform a second polymerase chain reaction.
  • the nested PCR method is a method that amplifies with a first amplification primer and then amplifies by adding a second primer again.
  • the present invention provides a composition comprising a template gene, DNA polymerase, dNTP, a first forward primer, a first reverse primer, a second reverse primer and a third reverse primer in one container. step; a first polymerase chain reaction; And it provides a method of performing a sequential polymerase chain reaction comprising a second polymerase chain reaction.
  • the first polymerase chain reaction comprises: a) a first denaturation step in which the double helix of the template gene is released; b) a first annealing step of binding the first forward primer and the first reverse primer to the template gene according to step a); and c) synthesizing the first product by cloning the template gene by the first forward primer and the second reverse primer combined in step b).
  • the second polymerase chain reaction d) a second denaturation step in which the double helix of the first product is unwound; e) a second annealing step of binding the first forward primer and the second reverse primer to the first product according to step d); f) synthesizing a second product by replicating the first product by the first forward primer and the second reverse primer combined in step e); and g) synthesizing a third product by binding the first forward primer to the second product, and synthesizing the final product by binding the third reverse primer to the third product.
  • the first polymerase chain reaction and the second polymerase chain reaction of the present invention may be adjusted according to temperature, and the temperature for performing step e) may be higher than the temperature for performing step b).
  • step e) may be performed at a temperature 5° C. to 30° C. higher than that of step b).
  • step e) when step b) is performed at a temperature of 40° C. or higher and less than 50° C., step e) is performed at a temperature of 50° C. or higher and 72° C. or lower, and step b) is 40° C.
  • step e) may be performed at a temperature of not less than 60°C and less than or equal to 72°C.
  • the second reverse primer may further include an arbitrary gene (adapter gene) sequence in addition to the sequence binding to the template gene.
  • the second reverse primer may further include an arbitrary gene sequence, so that the arbitrary gene sequence or a complementary sequence thereof may be included in the second product or the third product.
  • Any gene sequence included in the second reverse primer of the present invention is not particularly limited, but does not include a gene sequence complementary to the gene sequence of the first product, so it is preferable not to bind to the first product. .
  • the composition may further include a probe that binds to the third product.
  • the gene sequence of the third product to which the probe binds may be a gene sequence complementary to any gene sequence included in the second reverse primer or a partial sequence thereof.
  • the probe binds to a gene sequence complementary to the arbitrary gene sequence, thereby confirming the presence of the second product, that is, whether the second polymerase chain reaction is in progress.
  • composition for sequential polymerase chain reaction comprising a template gene, DNA polymerase, dNTP, a first forward primer, a first reverse primer, a second reverse primer, and a third reverse primer .
  • the present invention also provides a kit for sequential polymerase chain reaction comprising a template gene, a DNA polymerase, a dNTP, a first forward primer, a first reverse primer, a second reverse primer and a third reverse primer.
  • the kit for sequential polymerase chain reaction and the gene amplification method using the same according to the present invention omit the step of adding reactants, so the inflow of contaminants from the outside is small and the amplification time can be shortened. .
  • the sequential polymerase chain reaction (switching PCR) of the present invention is characterized by having high reproducibility even in the presence of a low concentration of a target gene (gene to be replicated in the PCR).
  • the sequential polymerase chain reaction according to the present invention has high reproducibility even when the concentration of the target gene is low by using the second polymerase chain reaction, the second reverse primer and the third reverse primer.
  • the concentration of the second reverse primer is lowered, but the concentration of the third reverse primer is increased to synthesize a larger amount of product in a faster time.
  • the kit for polymerase chain reaction according to the present invention has the advantage of high sensitivity by easily amplifying a small amount (low concentration) of a gene (template).
  • FIG. 1 is a schematic diagram of a sequential polymerase chain reaction according to an embodiment of the present invention.
  • FIG. 2 is a schematic diagram of a first polymerase chain reaction according to an embodiment of the present invention.
  • FIG. 3 is a flowchart of a sequential polymerase chain reaction according to an embodiment of the present invention.
  • FIG. 4 is a flowchart of a sequential polymerase chain reaction according to another embodiment of the present invention.
  • FIG. 5 is a graph showing the results of amplification of the T790M gene in a sequential polymerase chain reaction according to an embodiment of the present invention.
  • FIG. 6 is a graph showing the results of amplification of the T790M gene using a conventional polymerase chain reaction according to an embodiment.
  • FIG. 7 is a schematic diagram of sequential polymerase chain reaction steps according to another embodiment of the present invention.
  • FIG. 8 is a graph showing the results of amplification of the T790M gene using a conventional polymerase chain reaction according to another embodiment.
  • FIG. 9 is a schematic diagram of sequential polymerase chain reaction steps according to another embodiment of the present invention.
  • FIG. 10 is a graph showing the results of amplification of the T790M gene using a conventional polymerase chain reaction according to another embodiment of the present invention.
  • 11 is an electrophoretic image of sequential polymerase chain reaction products according to an embodiment of the present invention.
  • 'PCR polymerase chain reaction
  • RT-PCR Reverse transcriptase polymerase chain reaction
  • the sequential polymerase chain reaction of the present invention includes a process carried out by a method commonly used in the art.
  • the enzyme used in the sequential polymerase chain reaction of the present invention may include DNA Taq-polymerase having exonuclease activity, which is a first polymerase chain reaction and a second polymerase chain reaction. The same can be used in the reaction.
  • a 'primer' is a nucleic acid sequence having a short free 3' hydroxyl group to be replicated, and can form base pairs with a complementary template and is a starting point for copying the template gene. It refers to a short nucleic acid sequence that functions as The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required as well as the conditions of use of the primer, such as temperature and ionic strength.
  • the 'template gene' may include double-stranded DNA, single-stranded RNA, cDNA, or miRNA, and most preferably, the template gene is in the form of DNA.
  • the term 'product' refers to a gene synthesized according to a polymerase chain reaction.
  • composition' of a probe or primer may mean that the structure of the probe or primer is physically or chemically modified or destroyed.
  • one PCR step consists of three steps. After going through a thermal denaturation process (denaturation step) that separates genes using heat, lower the temperature to allow the primer to bind to the end of the sequence to be amplified (annealing step), and then raise the heat slightly to increase the gene A polymerization reaction (polymerization or extension, gene synthesis step) that synthesizes
  • the thermal denaturation step, the annealing step, and the gene synthesis step are sequentially performed, and it can be said that one cycle is performed when each step is performed once.
  • the first polymerase chain reaction of the present invention when a denaturation step at 95° C. for 15 seconds, annealing step at 65° C. for 30 seconds, and a gene synthesis step at 72° C. for 30 seconds, at this time the first polymerase It can be said that the chain reaction proceeded 1 cycle.
  • a composition comprising a template gene, DNA polymerase, dNTP, a first forward primer, a first reverse primer, a second reverse primer and a third reverse primer is prepared in one container to do; a first polymerase chain reaction step; and a second polymerase chain reaction step.
  • the first polymerase chain reaction step of the present invention comprises: a) a first denaturation step in which the double helix of the template gene is released; b) a first annealing step of binding the first forward primer and the first reverse primer to the template gene according to step a); and c) synthesizing the first product by cloning the template gene by the first forward primer and the second reverse primer combined in step b).
  • the second polymerase chain reaction step may include: d) a second denaturation step in which the double helix of the first product is released; e) a second annealing step of binding the first forward primer and the second reverse primer to the first product according to step d); f) synthesizing a second product by replicating the first product by the first forward primer and the second reverse primer combined in step e); and g) synthesizing a third product by binding the first forward primer to the second product, and synthesizing the final product by binding the third reverse primer to the third product.
  • the term 'container' includes all types of experimental tools capable of causing a polymerase chain reaction.
  • the present invention is characterized in that different polymerase chain reactions are continuously and independently performed in one vessel.
  • 'sequential polymerase chain reaction (hereinafter, 'switching PCR')' means a first polymerase chain reaction to amplify a template gene and a second polymerase chain reaction to amplify the product of the first polymerase chain reaction It refers to a reaction in which the reaction occurs continuously and sequentially, and the initiation of each polymerase chain reaction can be controlled by temperature.
  • the sequential polymerase chain reaction according to the present invention may further proceed to the third or fourth polymerase chain reaction or subsequent steps.
  • a separate reactant addition step is excluded between the first polymerase chain reaction and the second polymerase chain reaction, and the first polymerase chain reaction and the second polymerase chain reaction are performed in one container. It can proceed continuously or independently.
  • the intermediate step of adding reactants is omitted, thereby shortening the gene amplification time and preventing contamination from foreign substances.
  • the first polymerase chain reaction or the second polymerase chain reaction may be performed in several cycles, and a nested PCR technique may be used as a part of the sequential polymerase chain reaction of the present invention.
  • the present invention can amplify the gene in a short time even if the template gene (template) is present at a low concentration by going through a plurality of PCR steps.
  • the main purpose of the present invention is to amplify the amount of the template gene, and the first polymerase chain reaction and the second polymerization of the 'sequential polymerase chain reaction' according to the present invention
  • the enzymatic chain reaction can be performed several times to synthesize a large amount of the final gene (final product).
  • the genes synthesized in each step of the present invention are used or remain in the subsequent reaction.
  • 'forward' or 'reverse' indicating the direction of initiation of synthesis of primers means that the synthesis direction between each primer is different or identical, and 5'- >3' or 3'->5' does not specify the direction of gene synthesis. That is, although the gene synthesis direction of the primers according to the replication target gene may be different, the synthesis direction between the reverse primers is the same and is opposite to that of the forward primer.
  • the first forward primer and the first reverse primer may each replicate complementary template gene strands (first polymerase chain reaction). Thereafter, the first forward primer may bind to the second product synthesized by the first reverse primer, and the second reverse primer may bind to the second product synthesized by the first forward primer to replicate the gene strand (first 2 polymerase chain reaction). The first forward primer may bind to the second product synthesized by the second reverse primer to initiate the synthesis of the third product, and in this case, when an arbitrary gene sequence is further included in the second reverse primer, the first 3 In the product, a gene sequence complementary to any gene sequence may be further synthesized.
  • the third reverse primer may bind to the third product synthesized by the first forward primer to initiate synthesis of the final product.
  • the probe and the third reverse primer bind to the 'sequence complementary to any gene sequence' included in the third product, the probe separates from the third product and emits light according to the initiation of gene synthesis of the third reverse primer. .
  • the light emission by the probe is confirmed only when the third product is synthesized, it can be seen that the second polymerase chain reaction has progressed.
  • the first product or the second product of the present invention may be composed of a double-stranded, and each primer of the present invention binds to a gene sequence complementary to each gene, and the subsequent reaction proceeds. .
  • 'first forward primer' and 'first reverse primer' refer to primers that bind to a template gene and initiate replication of the template gene.
  • a first product is synthesized according to the initiation of template gene replication of the first forward primer and the first reverse primer.
  • the 'first reverse primer' is designed to bind only the template gene, but the 'first forward primer' binds not only to the template gene but also the first product, the second product, or the third product to initiate replication. .
  • the term 'second reverse primer' refers to a primer that binds to the first product, and the second reverse primer can also bind to the template strand, but the first polymerization is performed by controlling the activation temperature and the temperature of the first annealing step. It is designed so that it does not participate in the enzymatic chain reaction.
  • the template gene is DNA
  • the first forward primer binds to the complementary strand of the first product gene strand to which the second reverse primer binds to initiate replication of the first product gene.
  • the second reverse primer may further include an arbitrary gene (adapter gene) sequence not included in the first product or template gene, and the arbitrary gene may be located at the 5' end of the second reverse primer.
  • the second product synthesized by the second reverse primer may include any of the above gene sequences not included in the template gene.
  • the first forward primer may bind to the second product synthesized by the second reverse primer to initiate synthesis of the third product.
  • the 'third reverse primer' refers to a primer that binds to the third product.
  • the third reverse primer may bind to 'a gene sequence complementary to the arbitrary gene sequence' present in the 'third product'.
  • the third reverse primer is not involved in the first polymerase chain reaction since it binds to the 'gene sequence complementary to the arbitrary gene sequence'.
  • the present invention uses a second reverse primer and a third reverse primer including any gene.
  • the second reverse primer (preferably at the 5' end) may include any gene (adapter gene), and initiates the second polymerase chain reaction using the first product as a template.
  • the first forward primer can bind to the second product synthesized by the second reverse primer, whereby the third product including the 'gene complementary to the arbitrary gene (adapter gene)' it is synthesized
  • the third reverse primer binds to 'an arbitrary gene (adapter gene) and a complementary gene' included in the third product to initiate synthesis of the final product, and the concentration of the third reverse primer is high regardless of the point mutation. Since it is available in concentrations, more products can be produced.
  • the yield (PCR YIELD) problem in the conventional polymerase chain reaction used to detect point mutations generally, the amount of primer is used at a low concentration during PCR to detect point mutations, and the general annealing step
  • PCR YIELD is reduced by performing the annealing step at a temperature slightly higher than the temperature of It is possible to synthesize a larger amount of product in a shorter time.
  • the term 'design' of a primer means preparing a primer so that the primer can be activated or blocked under specific conditions (eg, temperature), and the primer design method commonly used in the art is can be used
  • the design method includes, but is not limited to, a method of controlling the length (mer) or sequence of a primer.
  • 'blocking' may mean that the primer is not annealed to the target gene (gene (template) to be replicated in the corresponding PCR).
  • FIG. 1 is a schematic diagram of a sequential polymerase chain reaction (switching PCR) according to an embodiment of the present invention.
  • a first primer may bind to a template gene and an induction primer may bind to a first product to synthesize a second product.
  • 1 is only a schematic representation of a first polymerase chain reaction and a second polymerase chain reaction step, and the first polymerase chain reaction and the second polymerase chain reaction do not proceed simultaneously.
  • each annealing step of the first polymerase chain reaction and the second polymerase chain reaction may have different temperatures, and preferably, the annealing step temperature of the second polymerase chain reaction is the temperature of the first polymerase chain reaction. higher than the annealing temperature.
  • the annealing step of the second polymerase chain reaction may be performed at a temperature 5° C. to 30° C. higher than the annealing step of the first polymerase chain reaction.
  • the temperature at which each primer is activated may be different from each other.
  • the activation temperature of the first forward primer is preferably designed in the widest range
  • the activation temperature of the second reverse primer and the third reverse primer is preferably designed to be higher than the activation temperature of the first reverse primer.
  • the activation temperature of the second reverse primer or the third reverse primer may be designed to be 5°C to 30°C higher than the activation temperature of the first reverse primer.
  • the annealing step of the first polymerase chain reaction according to the present invention may be performed at a temperature lower than 5° C. to 30° C. than the annealing step of the second polymerase chain reaction, and external addition of nucleic acids by initiation of gene synthesis of the first reverse primer degrading enzymes are activated. That is, in the first polymerase chain reaction, only the first product by the first forward primer and the first reverse primer can be synthesized.
  • the annealing step of the second polymerase chain reaction may be performed at a temperature of 5° C. to 30° C. higher than the annealing step of the first polymerase chain reaction, and due to the relatively high temperature, the reaction by the first reverse primer does not proceed.
  • the second reverse primer can bind to the first product, so that only the second polymerase chain reaction proceeds.
  • FIGS. 3 and 4 show a schematic diagram of a sequential polymerase chain reaction according to the present invention.
  • the first forward primer 20 and the first reverse primer 30 bind to the template gene strand 10 to initiate gene synthesis.
  • the first product 21 is synthesized according to the first polymerase chain reaction, and the first forward primer 20 and the second reverse primer 40 are coupled to the first product again to perform a second polymerase chain reaction .
  • the first reverse primer 30 is activated in the first polymerase chain reaction, but is not activated in the second polymerase chain reaction.
  • the first forward primer 20 and the second reverse primer 40 may bind to a first product according to the second polymerase chain reaction to synthesize a gene.
  • the second reverse primer 40 may further include any gene sequence in addition to the gene sequence binding to the first product (or the gene sequence binding to the template gene).
  • the second product synthesized by the second reverse primer further includes an arbitrary gene sequence in addition to the template gene.
  • the probe of the present invention can bind to any gene synthesized in the second product.
  • the probe may display a specific signal away from the second product, and the second polymerase chain reaction proceeds by identifying the signal it can be seen that
  • the first forward primer, the first reverse primer, the second reverse primer, the third reverse primer, and the probe may consist of sequences as shown in Table 1 below.
  • first forward primer GGGAGCCAATATTGTCTTTGTGTTC first reverse primer GTGCCGCCTGCTG second reverse primer (Example 1)
  • CTCCACCGTGCAGCTCATCA second reverse primer (Example 2)
  • CTCCACCGTGCAGCTCATCAC Third Reverse Primer TAGGCGGAATCGGTAGTAATCAA probe /56-FAM/ CAG TCT GAT /ZEN/ AAG CTA TCG G /3IABkFQ/
  • Template DNA (T790M) at 1/2 ⁇ l (experimental group 2), 1/4 ⁇ l (experimental group 3), 1/6 ⁇ l (experimental group 4), 1/8 ⁇ l (experimental group 5), and 1/10 ⁇ l (experimental group 6) concentrations was prepared, and the remaining conditions were tested in the same manner as in Experimental Example 1-1.
  • Results according to Examples 1-1 and 1-2 are shown in Tables 3 and 4 below.
  • 5 is a graph showing the results of amplification of the T790M gene in the sequential polymerase chain reaction (switching PCR) according to Examples 1-1 and 1-2 of the present invention.
  • Results according to Examples 1-3 and 1-4 are shown in Tables 6 and 7 below.
  • 6 is a graph showing the results of amplification of the T790M gene according to Examples 1-3 and 1-4 of the present invention.
  • the T790M gene shows Cq or Ct values of 18 to 24 cycles.
  • FIG. 6 Example 1 When the T790M gene is amplified according to the standard PCR method according to -3 and 1-4, it is amplified in 48 to 50 cycles. This is the same as the contents of Tables 3, 4, 6 and 7.
  • the sequential polymerase chain reaction (switching PCR) according to the present invention is amplified in the second polymerase chain reaction
  • the results of the sequential polymerase chain reaction (switching PCR) according to Examples 1-1 and 1-2 It can be seen that the T790M gene has a Cq or Ct value in 38 to 44 cycles (the first polymerase chain reaction occurs in 20 cycles).
  • the Cq or Ct value increased as the concentration of the template T790M gene was lowered, and the amplification cycle values of Examples 1-1 and 1-2 were the values of Examples 1-3 regardless of the concentration. and values of 1-4. Therefore, it can be seen that in the sequential polymerase chain reaction (switching PCR) method according to the present invention, the first polymerase chain reaction and the second polymerase chain reaction can be independently performed in one experimental apparatus.
  • Results according to Examples 2-1 and 2-2 are shown in Tables 8 and 9 below.
  • 7 is a graph showing the results of amplification of the T790M gene in the sequential polymerase chain reaction (switching PCR) according to Examples 2-1 and 2-2 of the present invention.
  • Results according to Examples 2-3 and 2-4 are shown in Tables 10 and 11 below. 8 is a graph showing the results of amplification of the T790M gene according to Examples 2-3 and 2-4 of the present invention.
  • the T790M gene shows Cq or Ct values of 18 to 24 cycles.
  • Example 2 When the T790M gene is amplified according to the standard PCR method according to -3 and 2-4, Cq or Ct values are shown in 48 to 60 cycles. This is the same as the contents of Tables 8, 9, 10 and 11.
  • the sequential polymerase chain reaction (switching PCR) according to the present invention is amplified in the second polymerase chain reaction
  • the results of the sequential polymerase chain reaction (switching PCR) according to Examples 2-1 and 2-2 It can be seen that the T790M gene represents a Cq or Ct value in 38 to 44 cycles (the first polymerase chain reaction occurs in 20 cycles).
  • the concentration of the T790M gene as a template the higher the Cq or Ct value, and the Cq or Ct value of Examples 2-1 and 2-2 in Example 2- It was lower than the values of 3 and 2-4.
  • the sequential polymerase chain reaction (switching PCR) method according to the present invention can increase the yield of the gene polymerase chain reaction (PCR), and obtain a highly reproducible polymerase chain reaction result even in the presence of a very low gene. It can be seen that there is
  • Results according to Examples 3-1 and 3-2 are shown in Table 12 below.
  • 9 is a graph showing the results of amplification of the T790M gene in the sequential polymerase chain reaction (switching PCR) according to Examples 3-1 and 3-2 of the present invention.
  • Results according to Examples 3-3 and 3-4 are shown in Table 13 below.
  • 10 is a graph showing the results of amplification of the T790M gene in the sequential polymerase chain reaction (switching PCR) according to Examples 3-3 and 3-4 of the present invention.
  • the T790M gene shows Cq or Ct values in 18 to 24 cycles, and with reference to FIG. 10 , Example 3
  • the T790M gene is amplified according to the standard PCR method according to -3 and 3-4, it has a Cq or Ct value in 48 to 60 cycles. This is the same as the contents of Tables 12 and 13.
  • the sequential polymerase chain reaction (switching PCR) according to the present invention is amplified even in the second polymerase chain reaction
  • the results of the sequential polymerase chain reaction (switching PCR) according to Examples 3-1 and 3-2 It can be seen that the T790M gene represents a Cq or Ct value in 38 to 44 cycles (the first polymerase chain reaction occurs in 20 cycles).
  • the concentration of the T790M gene as a template the higher the Cq or Ct value, and regardless of the concentration, the Cq or Ct value of Examples 3-1 and 3-2 was Example 3- It was lower than the values of 3 and 3-4. Therefore, the switching PCR method according to the present invention can shorten the gene amplification time, increase the yield of the gene polymerase chain reaction (PCR), and provide highly reproducible polymerase chain reaction results even in the presence of very low genes. know you can get it.
  • the sequential polymerase chain reaction (switching PCR) in Example 3-2 of the present invention showed a 100% detection rate at both concentrations of 1/8% (experimental group 5) and 1/10% (experimental group 6),
  • a detection rate of 75% at a concentration of 1/8%, a detection rate of 80% at a concentration of 1/10%, and a detection rate of less than 95% at both concentrations can be known That is, in the sequential polymerase chain reaction (Switching PCR) according to the present invention, amplification occurs easily even when the concentration of the template gene is low, so the sequential polymerase chain reaction (switching PCR) using the kit according to the present invention ) has a higher sensitivity.
  • the temperature was as shown in Table 15, and PCR was performed under the same conditions as in Example 4-1 for other experimental conditions.
  • the first polymerase chain reaction and the second polymerase chain reaction were performed at the temperature as shown in Table 16, and PCR was performed under the same conditions as in Example 4-1 for other experimental conditions.
  • the concentration of Template DNA (T790M) was set to 0, and PCR was performed under the same conditions as in Example 4-1 for other experimental conditions.
  • FIG. 11 is an electrophoretic image of a PCR product according to an embodiment of the present invention.
  • 1 is a result according to Example 4-1
  • 2 is a result according to Example 4-2
  • 3 is a result according to Example 4-3
  • 4 is a result according to Example 4-4. indicates.
  • fluorescence was exhibited at 110 bp
  • a band was exhibited around 131 bp
  • no band appeared.
  • the second reverse primer is not activated in the first polymerase chain reaction, so only the first product (110 bp) is formed, and in 2, the first reverse primer is inactivated due to a high temperature and the second product ( 131 bp) is synthesized.
  • the first polymerase chain reaction was performed for 10 cycles and the second polymerase chain reaction was performed for 30 cycles, so it can be confirmed that bands of genes proportional to the performed cycle coexist (110 bp, 131 bp).
  • primers that can be activated at the annealing temperature of each polymerase chain reaction are designed, and in the first polymerase chain reaction, the first forward primer and the first reverse primer, the second polymerization In the enzymatic chain reaction, it can be seen that the first forward primer and the second reverse primer were activated, and thus both the first product and the second product were formed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법에 관한 것으로, 상기 순차적 중합효소 연쇄 반응용 조성물은 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하여, 하나의 용기에서 순차적인 중합효소 연쇄반응을 일으킬 수 있다. 본 발명에 따른 순차적 중합효소 연쇄 반응은 종래 네스티드(nested) PCR과 달리 반응물 첨가 단계가 생략되는 바 외부로부터 오염물질의 유입이 적고, 유전자 중합효소 연쇄반응(PCR)의 수율을 높일 수 있으며, 매우 낮은 유전자가 존재하는 경우에도 재현성 높은 중합효소 연쇄반응 결과를 얻을 수 있다.

Description

순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법
본 발명은 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법에 관한 것으로, 보다 상세하게는 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 조성물을 하나의 용기에 준비하여, 중합효소 연쇄반응을 연속적으로 수행할 수 있는 방법으로, 온도에 따라 각각의 중합효소 연쇄반응의 조절이 가능하며, 하나의 용기에서 순차적으로 진행될 수 있는 바, 유전자 증폭 시 외부로부터 오염물질의 유입이 적고, 유전자 중합효소 연쇄반응(PCR)의 수율을 높일 수 있는 방법에 관한 것이다.
분자 진단은 유전자를 분석하여 질병을 진단하는 분야로, 현재 체외진단 분야 중 가장 높은 성장세를 보이고 있는 실정이다. 실제로, 급속한 환경 오염과 기후변화에 인한 것으로 추정되는 신종 바이러스가 크게 확산되면서, 체외진단 분야 중 가장 높은 진단의 정확도가 확보되고, 신종 바이러스가 출현하는 경우 신속하게 감염 여부를 확인할 수 있다는 이점이 있는 분자 진단에 대한 많은 연구가 계속되고 있다.
염기서열 또는 염기의 변이를 분석하기 위하여 여러 가지 방법들이 있으나 이 모든 방법들을 사용하기 이전에 기본적으로 많은 양의 유전자 시료를 수득하여야 한다. 현재 연구자들이 유전자 시료를 수득하기 위하여 가장 보편적으로 사용하는 방법은 DNA 중합효소를 이용한 중합 효소 연쇄반응(이하, "PCR"이라 함)이다. 상기 방법은 주형과 결합할 수 있는 프라이머를 설계하여 유전자의 원하는 부위만을 증폭시킬 수 있다. 유전자로부터 증폭하고자 하는 영역을 결정하고, 결정한 부위의 3' 말단의 염기서열과 상보적으로 결합할 수 있는 염기서열을 결정하여 프라이머를 설계한다.
PCR의 응용기법 중 네스티드(nested) PCR은 PCR 증폭의 특이성과 민감도를 증가시킬 수 있는 기법으로 대개 순도가 낮은 DNA나 RNA를 증폭하고자 할 때 이용한다. 이 방법은 2종류의 프라이머(primer)에 의해 연속적인 PCR로서 목적 유전자의 프라이머(primer)를 이용하여 제1 중합효소 연쇄 반응을 수행하고 첫 번째 PCR산물과 결합하는 2차 프라이머(primer)를 사용하여 제2 중합효소 연쇄 반응을 수행한다. 특히, 네스티드(nested) PCR방법은 첫 번째 증폭 프라이머(primer)로 증폭한 후 다시 2차 프라이머를 첨가하여 증폭하는 방법으로 민감도를 높이거나 특수한 목적의 증폭이 필요할 경우 많이 쓰이는 방법이다. 하지만, 네스티드(nested) PCR은 보통 두 번 다른 튜브를 써야 하기 때문에 실험자의 손이 많이 가고 불편하며, 증폭 산물을 다루는 도중 오염을 일으킬 수 있는 문제점이 있다. 기존의 PCR과 비교하여 외부로부터의 오염은 줄이되, 주형 유전자의 증폭시간을 줄이고 증폭량을 늘일 수 있고, 점 돌연변이를 검출하기 위해 이용되는 통상의 중합효소 연쇄반응에서의 수율(PCR YIELD) 문제(일반적으로, 점 돌연변이를 검출하기 위한 PCR 진행 시 프라이머의 양을 낮은 농도로 사용하고, 일반적인 어닐링 단계의 온도보다 조금 더 높은 온도로 어닐링 단계를 수행함으로써 PCR YIELD가 감소하는 문제가 있다.)를 해소할 수 있는 PCR 방법이 요구되는 실정이다.
분자 진단은 유전자를 분석하여 질병을 진단하는 분야로, 현재 체외진단 분야 중 가장 높은 성장세를 보이고 있는 실정이다. 실제로, 급속한 환경 오염과 기후변화에 인한 것으로 추정되는 신종 바이러스가 크게 확산되면서, 체외진단 분야 중 가장 높은 진단의 정확도가 확보되고, 신종 바이러스가 출현하는 경우 신속하게 감염 여부를 확인할 수 있다는 이점이 있는 분자 진단에 대한 많은 연구가 계속되고 있다.
염기서열 또는 염기의 변이를 분석하기 위하여 여러 가지 방법들이 있으나 이 모든 방법들을 사용하기 이전에 기본적으로 많은 양의 유전자 시료를 수득하여야 한다. 현재 연구자들이 유전자 시료를 수득하기 위하여 가장 보편적으로 사용하는 방법은 DNA 중합효소를 이용한 중합 효소 연쇄반응(이하, "PCR"이라 함)이다. 상기 방법은 주형과 결합할 수 있는 프라이머를 설계하여 유전자의 원하는 부위만을 증폭시킬 수 있다. 유전자로부터 증폭하고자 하는 영역을 결정하고, 결정한 부위의 3' 말단의 염기서열과 상보적으로 결합할 수 있는 염기서열을 결정하여 프라이머를 설계한다.
PCR의 응용기법 중 네스티드(nested) PCR은 PCR 증폭의 특이성과 민감도를 증가시킬 수 있는 기법으로 대개 순도가 낮은 DNA나 RNA를 증폭하고자 할 때 이용한다. 이 방법은 2종류의 프라이머(primer)에 의해 연속적인 PCR로서 목적 유전자의 프라이머(primer)를 이용하여 제1 중합효소 연쇄 반응을 수행하고 첫 번째 PCR산물과 결합하는 2차 프라이머(primer)를 사용하여 제2 중합효소 연쇄 반응을 수행한다. 특히, 네스티드(nested) PCR방법은 첫 번째 증폭 프라이머(primer)로 증폭한 후 다시 2차 프라이머를 첨가하여 증폭하는 방법으로 민감도를 높이거나 특수한 목적의 증폭이 필요할 경우 많이 쓰이는 방법이다. 하지만, 네스티드(nested) PCR은 보통 두 번 다른 튜브를 써야 하기 때문에 실험자의 손이 많이 가고 불편하며, 증폭 산물을 다루는 도중 오염을 일으킬 수 있는 문제점이 있다. 기존의 PCR과 비교하여 외부로부터의 오염은 줄이되, 주형 유전자의 증폭시간을 줄이고 증폭량을 늘일 수 있고, 점 돌연변이를 검출하기 위해 이용되는 통상의 중합효소 연쇄반응에서의 수율(PCR YIELD) 문제(일반적으로, 점 돌연변이를 검출하기 위한 PCR 진행 시 프라이머의 양을 낮은 농도로 사용하고, 일반적인 어닐링 단계의 온도보다 조금 더 높은 온도로 어닐링 단계를 수행함으로써 PCR YIELD가 감소하는 문제가 있다.)를 해소할 수 있는 PCR 방법이 요구되는 실정이다.
상술한 과제를 해결하기 위해, 본원 발명은 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 조성물을 하나의 용기에 준비하는 단계; 제1 중합효소 연쇄반응; 및 제2 중합효소 연쇄반응을 포함하는 순차적 중합효소 연쇄반응의 수행 방법을 제공한다.
본 발명의 일 실시예에 따르면 상기 제1 중합효소 연쇄반응은, a) 주형 유전자의 이중 나선이 풀어지는 제1 변성 단계; b) 상기 a) 단계에 따른 주형 유전자에 제1 정방향 프라이머 및 제1 역방향 프라이머가 결합하는 제1 어닐링 단계; 및 c) 상기 b) 단계에서 결합된 제1 정방향 프라이머 및 제2 역방향 프라이머에 의해 주형 유전자가 복제되어, 제1 산물이 합성되는 단계를 포함할 수 있다. 상기 제2 중합효소 연쇄반응은, d) 상기 제1 산물의 이중 나선이 풀어지는 제2 변성단계; e) 상기 d)단계에 따른 제1 산물에 제1 정방향 프라이머 및 제2 역방향 프라이머가 결합하는 제2 어닐링 단계; f) 상기 e) 단계에서 결합된 제1 정방향 프라이머 및 제2 역방향 프라이머에 의해 제1 산물이 복제되어 제2 산물이 합성되는 단계; 및 g) 상기 제2 산물에 제1 정방향 프라이머가 결합하여 제3 산물이 합성되고, 제3 산물에 제3 역방향 프라이머가 결합하여 최종 산물을 합성하는 단계를 포함할 수 있다.
본 발명의 상기 제1 중합효소 연쇄반응 및 제2 중합효소 연쇄반응은, 온도에 따라 조절될 수 있으며, 상기 e) 단계의 수행 온도는 b)단계의 수행 온도보다 높을 수 있다. 본 발명의 일 실시예에 따르면, 상기 e) 단계는 상기 b) 단계보다 5℃ 내지 30℃ 더 높은 온도에서 수행될 수 있다. 본 발명의 다른 실시예에 따르면 상기 b) 단계가 40℃ 이상 50℃미만의 온도에서 수행되는 경우, 상기 e) 단계는 50℃ 이상 72℃ 이하의 온도에서 수행되고, 상기 b) 단계가 40℃ 이상 60℃ 미만의 온도에서 수행되는 경우, 상기 e) 단계는 60℃ 이상 72℃이하의 온도에서 수행될 수 있다.
본 발명의 일 실시예에 따르면 상기 제2 역방향 프라이머는 주형 유전자와 결합하는 서열 외에 임의의 유전자(어댑터 유전자) 서열을 더 포함할 수 있다. 상기 제2 역방향 프라이머는 임의의 유전자 서열을 더 포함하여, 제2 산물 또는 제3 산물에 상기 임의의 유전자 서열 또는 이의 상보적인 서열이 포함될 수 있다.
본 발명의 상기 제2 역방향 프라이머에 포함되는 임의의 유전자 서열은, 특별히 제한되는 바는 없으나, 제1 산물의 유전자 서열과 상보적인 유전자 서열을 포함하지 않아 제1 산물과는 결합하지 않는 것이 바람직하다.
본 발명의 일 실시예에 따르면, 상기 조성물은 상기 제3 산물에 결합하는 프로브를 더 포함할 수 있다. 본 발명에서 상기 프로브가 결합하는 제3 산물의 유전자 서열은, 제2 역방향 프라이머에 포함된 임의의 유전자 서열과 상보적인 유전자 서열 또는 이의 일부 서열일 수 있다. 본 발명에서 상기 프로브는, 상기 임의의 유전자 서열과 상보적인 유전자 서열에 결합함으로써, 제2 산물의 존재 여부, 즉, 제2 중합효소 연쇄반응의 진행 여부를 확인할 수 있다.
본 발명의 일 실시예에 따르면, 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 순차적 중합효소 연쇄반응용 조성물을 제공한다.
본 발명은 또한 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 순차적 중합효소 연쇄반응용 키트를 제공한다.
본 발명에 따른 순차적 중합효소 연쇄 반응용 키트 및 이를 이용한 유전자 증폭 방법은 종래 네스티드(nested) PCR과 달리 반응물 첨가 단계가 생략되는 바 외부로부터 오염물질의 유입이 적고, 증폭 시간을 단축시킬 수 있다.
본 발명의 순차적 중합효소 연쇄반응(스위칭 PCR)은, 낮은 농도의 타겟 유전자(해당 PCR에서 복제 대상이 되는 유전자)가 존재하는 경우에도 높은 재현성을 갖는 특징이 있다.
예를들어 일반적인 103 copy RT-PCR의 경우 102 copy의 타겟 유전자(target template)가 존재할 때 비로소 재현성 있는 PCR 결과를 나타낸다. 반면 본 발명에 따른 순차적 중합효소 연쇄반응은, 제2 중합효소 연쇄반응, 제2 역반응 프라이머 및 제3 역방향 프라이머를 이용하여 타겟 유전자의 농도가 낮은 경우에도 높은 재현성을 갖게된다.
본 발명의 순차적 중합효소 연쇄반응 방법에 따르면, 제2 역방향 프라이머의 농도는 낮추되, 제3 역방향 프라이머의 농도는 높여 빠른 시간에 더 많은 양의 산물을 합성할 수 있는 바, 점 돌연변이를 검출하기 위해 이용되는 통상의 중합효소 연쇄반응에서의 수율(PCR YIELD) 문제의 해소할 수 있는 이점이 있다.
또한, 본 발명에 따른 중합효소 연쇄반응용 키트는 적은 양(낮은 농도)의 유전자(template)을 용이하게 증폭시켜 민감도가 높은 장점이 있다.
도 1은 본 발명의 일 실시예에 따른 순차적 중합효소 연쇄반응의 모식도이다.
도 2는 본 발명의 일 실시예에 따른 제1 중합효소 연쇄반응의 모식도이다.
도 3은 본 발명의 일 실시예에 따른 순차적 중합효소 연쇄반응의 순서도이다.
도 4는 본 발명의 다른 실시예에 따른 순차적 중합효소 연쇄반응의 순서도이다.
도 5는 본 발명의 일 실시예에 따른 순차적 중합효소 연쇄반응의 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
도 6은 일 실시예에 따라 통상적인 중합효소 연쇄반응을 이용하여 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
도 7은 본 발명의 다른 실시예에 따른 순차적 중합효소 연쇄반응 단계의 모식도이다.
도 8은 다른 실시예에 따라 통상적인 중합효소 연쇄반응을 이용하여 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
도 9는 본 발명의 또 다른 실시예에 따른 순차적 중합효소 연쇄반응 단계의 모식도이다.
도 10은 본 발명의 또 다른 실시예에 따라 통상적인 중합효소 연쇄반응을 이용하여 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
도 11은 본 발명의 일 실시예에 따른 순차적 중합효소 연쇄반응 산물의 전기영동 이미지이다.
이하, 본 발명의 바람직한 실시예를 상세히 설명한다. 본 발명의 이점 및 특징, 그리고 그것들을 달성하는 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 게시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있으며, 단지 본 실시예들은 본 발명의 게시가 완전하도록 하고, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다. 명세서 전체에 걸쳐 동일 참조 부호는 동일 구성 요소를 지칭한다.
다른 정의가 없다면, 본 명세서에서 사용되는 모든 용어(기술 및 과학적 용어를 포함)는 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 공통적으로 이해될 수 있는 의미로 사용될 수 있을 것이다. 또 일반적으로 사용되는 사전에 정의되어 있는 용어들은 명백하게 특별히 정의되어 있지 않는 한 이상적으로 또는 과도하게 해석되지 않는다. 본 명세서에서 사용된 용어는 실시예들을 설명하기 위한 것이며 본 발명을 제한하고자 하는 것은 아니다. 본 명세서에서, 단수형은 문구에서 특별히 언급하지 않는 한 복수형도 포함한다.
본 명세서에서, 'PCR(polymerase chain reaction)'은 검출을 원하는 특정 주형 유전자를 증폭하는 방법으로 중합효소 연쇄반응의 변형 방법으로 RNA를 대상으로 역전사효소를 이용하여 complementary DNA를 합성하고, 이를 주형으로 이용하여 중합효소 연쇄반응을 시행하는 역전사 중합효소 연쇄반응(reverse transcriptase polymerase chain reaction, RT-PCR)과 형광물질을 사용하여 DNA를 증폭시키면서 증폭산물을 동시에 검출하는 실시간 중합효소 연쇄반응 등을 포함한다.
본 명세서에서 특별한 언급이 없는 이상, 본 발명의 순차적 중합효소 연쇄반응은 당업계에서 통상적으로 이용되는 방법으로 진행되는 과정을 포함한다.
예를들어, 본 발명의 순차적 중합효소 연쇄반응에 이용되는 효소에는 핵산외부가수분해효소(exonuclease) 활성을 갖는 DNA Taq-polymerase가 포함될 수 있으며, 이는 제1 중합효소 연쇄반응과 제2 중합효소 연쇄반응에서 동일하게 사용될 수 있다.
본 발명에 있어서, '프라이머'는 복제하려는 짧은 자유 3'말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)과 염기 쌍을 형성할 수 있고 주형 유전자 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity) 뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.
본 명세서에서,'주형 유전자'는 이중가닥인 DNA, 단일 가닥인 RNA, cDNA, miRNA를 포함할 수 있고, 가장 바람직하게는 주형 유전자는 DNA 형태이다.
본 명세서에서 '산물' 이란 중합효소 연쇄반응에 따라 합성된 유전자를 의미한다.
본 명세서에서 프로브 또는 프라이머의'분해'란, 프로브 또는 프라이머의 구조가 물리적 또는 화학적으로 변형 또는 파괴되는 것을 의미할 수 있다.
보편적으로 알려진 중합효소 연쇄반응(PCR) 기술과 마찬가지로, 하나의 PCR 단계는 3 단계로 이루어진다. 열을 이용하여 유전자를 분리하는 열 변성 과정(denaturation 변성 단계)을 거친 후, 온도를 낮추어 프라이머(primer)가 증폭을 원하는 서열 말단에 결합(annealing, 어닐링 단계)하게 하고, 다시 열을 약간 올려서 유전자를 합성하는 중합 반응(polymerization or extension, 유전자 합성 단계)이 진행된다. 상기 열 변성 단계, 어닐링 단계 및 유전자 합성 단계는 순차적으로 진행되며, 각 단계가 한 번씩 진행된 것을 하나의 cycle이 진행되었다고 할 수 있다. 예를 들어, 본 발명의 제1 중합효소 연쇄 반응의 경우 95℃에서 15초 동안 변성 단계, 65℃에서 30초 동안 어닐링 단계, 72℃에서 30초 동안 유전자 합성 단계를 거친 경우 이때 제1 중합효소 연쇄 반응이 1cycle(회) 진행되었다고 할 수 있는 것이다.
본 발명의 '순차적 중합효소 연쇄반응'은, 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 조성물을 하나의 용기에 준비하는 단계; 제1 중합효소 연쇄반응 단계; 및 제2 중합효소 연쇄반응 단계를 포함할 수 있다.
본 발명의 상기 제1 중합효소 연쇄반응 단계는, a) 주형 유전자의 이중 나선이 풀어지는 제1 변성 단계; b) 상기 a) 단계에 따른 주형 유전자에 제1 정방향 프라이머 및 제1 역방향 프라이머가 결합하는 제1 어닐링 단계; 및 c) 상기 b) 단계에서 결합된 제1 정방향 프라이머 및 제2 역방향 프라이머에 의해 주형 유전자가 복제되어, 제1 산물이 합성되는 단계를 포함할 수 있다. 상기 제2 중합효소 연쇄반응 단계는, d) 상기 제1 산물의 이중 나선이 풀어지는 제2 변성단계; e) 상기 d)단계에 따른 제1 산물에 제1 정방향 프라이머 및 제2 역방향 프라이머가 결합하는 제2 어닐링 단계; f) 상기 e) 단계에서 결합된 제1 정방향 프라이머 및 제2 역방향 프라이머에 의해 제1 산물이 복제되어 제2 산물이 합성되는 단계; 및 g) 상기 제2 산물에 제1 정방향 프라이머가 결합하여 제3 산물이 합성되고, 제3 산물에 제3 역방향 프라이머가 결합하여 최종 산물을 합성하는 단계를 포함할 수 있다.
본 명세서에서 '용기'란, 중합효소 연쇄 반응을 일으킬 수 있는 모든 형태의 실험 도구를 포함한다. 본 발명은 하나의 용기 내에서 서로 다른 중합효소 연쇄반응이 연속적, 독립적으로 진행되는 것을 특징으로 한다.
본 명세서에서 '순차적 중합효소 연쇄반응 (이하'스위칭(switching) PCR')'이란, 주형 유전자를 증폭하는 제1 중합효소 연쇄반응 및 제1 중합효소 연쇄반응의 산물을 증폭하는 제2 중합효소 연쇄반응이 연속적, 순차적으로 일어나는 반응을 의미하며, 각각의 중합효소 연쇄 반응의 개시여부는 온도로 조절될 수 있다. 본 발명에 따른 순차적 중합효소 연쇄 반응은 제3, 제4 의 중합효소 연쇄반응 또는 그 이후의 단계까지 추가적으로 진행될 수 있다.
본 발명의 순차적 중합효소 연쇄 반응은 제1 중합효소 연쇄반응과 제2 중합효소 연쇄반응 사이에 별도의 반응물 첨가 단계가 제외되며 하나의 용기에서 제1 중합효소 연쇄반응과 제2 중합효소 연쇄반응이 연속적, 독립적으로 진행될 수 있다. 종래의 네스티드(nested PCR)반응과 달리, 본 발명에 따른 '순차적 중합효소 연쇄반응'은 반응물을 첨가하는 중간 단계가 생략되는 바 유전자 증폭 시간을 단축할 수 있고, 외부물질로부터 오염을 방지할 수 있다.
상기 제1 중합효소 연쇄 반응 또는 제2 중합효소 연쇄 반응은 여러 cycle이 진행될 수 있으며, 본 발명의 순차적 중합효소 연쇄 반응은 일부로써 네스티드(nested) PCR 기술이 이용될 수 있다. 본 발명은 다수의 PCR 단계를 거침으로써, 주형 유전자(template)가 낮은 농도로 존재하여도 빠른 시간 안에 유전자를 증폭할 수 있다.
통상적인 중합효소 연쇄반응(PCR)과 같이, 본 발명은 주형 유전자의 양을 증폭시키는 것을 주 목적으로 하며, 본 발명에 따른 '순차적 중합효소 연쇄 반응'의 제1 중합효소 연쇄 반응과 제2 중합효소 연쇄 반응은 수회 진행되어 다량의 최종 유전자(최종 산물)를 합성할 수 있다. 상술한 바와 같이 본 발명의 각 단계에서 합성된 유전자는 이후 반응에 이용되거나 잔존하게 된다.
본 발명에서 프라이머의 합성 개시 방향을 나타내는 '정방향' 또는 '역방향'은, 각 프라이머 간의 합성 방향이 상이함 또는 동일함을 의미하는 것이지, 복제 대상 유전자(예를들면 주형 유전자)에 따른 5'->3' 또는 3'->5'의 유전자 합성 방향을 특정하는 것은 아니다. 즉, 복제 대상 유전자에 따른 프라이머의 유전자 합성 방향은 달라질 수 있지만, 역방향 프라이머 간의 합성 방향은 동일하며, 정방향 프라이머와는 반대된다.
예를 들어, 주형 유전자가 이중가닥인 경우, 제1 정방향 프라이머 및 제1 역방향 프라이머는 각각 상보적인 주형 유전자 가닥을 복제할 수 있다 (제1 중합효소 연쇄반응). 이후, 제1 정방향 프라이머는 제1 역방향 프라이머에 의해 합성된 제2 산물에 결합하고, 제2 역방향 프라이머는 제1 정방향 프라이머에 의해 합성된 제2 산물에 결합하여 유전자 가닥을 복제할 수 있다(제2 중합효소 연쇄반응). 상기 제1 정방향 프라이머는 제2 역방향 프라이머에 의해 합성된 제2 산물에 결합하여, 제3 산물의 합성을 개시할 수 있으며, 이때 제2 역방향 프라이머에 임의의 유전자 서열이 추가로 포함된 경우, 제3 산물에는 임의의 유전자 서열에 상보적인 유전자 서열이 추가로 합성될 수 있다. 제3 역방향 프라이머는 제1 정방향 프라이머에 의해 합성된 제3 산물에 결합하여, 최종 산물의 합성을 개시할 수 있다. 이때, 제3 산물에 포함된 '임의의 유전자 서열과 상보적인 서열'에 프로브 및 제3 역방향 프라이머가 결합한다면, 제3 역방향 프라이머의 유전자 합성 개시에 따라 상기 프로브는 제3 산물에서 떨어지며 발광하게 된다. 이 경우 제3 산물이 합성되어야만 프로브에 의한 발광이 확인되므로, 제2 중합효소 연쇄반응이 진행되었음을 알 수 있는 것이다.
앞선 내용에서 알 수 있듯이, 본 발명의 제1 산물 또는 제2 산물은 이중가닥으로 구성될 수 있으며, 본 발명의 각 프라이머는 각각의 유전자와 상보적인 유전자 서열에 결합하여, 이후의 반응을 진행한다.
본 명세서에서 '제1 정방향 프라이머' 및 '제1 역방향 프라이머'는 주형 유전자에 결합하여 주형 유전자의 복제를 개시하는 프라이머를 의미한다. 제1 정방향 프라이머 및 제1 역방향 프라이머의 주형 유전자 복제 개시에 따라 제1 산물이 합성된다. 본 발명에서'제1 역방향 프라이머'는 주형 유전자에만 결합하도록 설계하나, '제1 정방향 프라이머'는 주형 유전자뿐만 아니라, 제1 산물, 제2 산물 또는 제3 산물에도 결합하여 복제를 개시할 수 있다.
본 명세서에서'제2 역방향 프라이머'는 상기 제1 산물에 결합하는 프라이머를 의미하며, 제2 역방향 프라이머는 주형 가닥에도 결합할 수 있으나, 활성 온도 및 제1 어닐링 단계의 온도를 조절하여 제1 중합효소 연쇄반응에는 관여하지 않도록 설계한다. 주형 유전자가 DNA인 경우, 제1 산물 역시 이중 가닥인 바, 제1 정방향 프라이머는 제2 역방향 프라이머가 결합하는 제1 산물 유전자 가닥의 상보적 가닥에 결합하여 제1 산물 유전자의 복제를 개시한다. 이때, 제2 역방향 프라이머는 제1 산물 또는 주형 유전자에 포함되지 않는 임의의 유전자(어댑터 유전자) 서열을 추가로 포함할 수 있으며, 상기 임의의 유전자는 제2 역방향 프라이머의 5'말단에 위치할 수 있다. 따라서, 제2 역방향 프라이머에 의해 합성된 제2 산물에는 주형 유전자에 포함되지 않은 상기 임의의 유전자 서열이 포함될 수 있다.
상기 제2 역방향 프라이머에 의해 합성된 제2 산물에는 제1 정방향 프라이머가 결합하여 제3 산물의 합성을 개시할 수 있다.
본 명세서에서 '제3 역방향 프라이머'는 상기 제3 산물에 결합하는 프라이머를 의미한다. 상기 제3 역방향 프라이머는 '제3 산물'에 존재하는 '상기 임의의 유전자 서열과 상보적인 유전자 서열'에 결합할 수 있다. 본 발명에 따르면, 제3 역방향 프라이머는 상기 '임의의 유전자 서열과 상보적인 유전자 서열'에 결합하는 것인 바, 제1 중합효소 연쇄반응에 관여하지 않는다.
중합효소 연쇄반응(PCR) 시, 주형 유전자의 점 돌연변이(point mutation)를 검출하기 위하여, 이용되는 프라이머의 농도를 감소시키는 것이 일반적이나, 이 경우 최종 생성되는 산물의 양(수율)이 감소하는 문제가 있다. 이와 같은 문제를 해소하기 위해, 본 발명은 임의의 유전자를 포함하는 제2 역방향 프라이머 및 제3 역방향 프라이머를 이용한다. 본 발명에서 제2 역방향 프라이머는 (바람직하게는 5'말단에) 임의의 유전자(어댑터 유전자)를 포함할 수 있으며, 제1 산물을 주형으로 하여 제2 중합효소 연쇄반응을 개시한다. 본 발명에 따르면, 상기 제2 역방향 프라이머에 의해 합성된 제2 산물에는 제1 정방향 프라이머가 결합할 수 있고, 이에 의해 상기 '임의의 유전자(어댑터 유전자)와 상보적인 유전자'를 포함하는 제3 산물이 합성된다. 제3 역방향 프라이머는 상기 제3 산물에 포함된 '임의의 유전자(어댑터 유전자)와 상보적인 유전자'에 결합하여 최종 산물의 합성을 개시하는 바, 제3 역방향 프라이머의 농도는 점 돌연변이와 상관없이 높은 농도로 이용할 수 있으므로, 더 많은 산물을 생성할 수 있는 것이다. 즉, 점 돌연변이를 검출하기 위해 이용되는 통상의 중합효소 연쇄반응에서의 수율(PCR YIELD) 문제(일반적으로, 점 돌연변이를 검출하기 위한 PCR 진행 시 프라이머의 양을 낮은 농도로 사용하고, 일반적인 어닐링 단계의 온도보다 조금 더 높은 온도로 어닐링 단계를 수행함으로써 PCR YIELD가 감소하는 문제가 있다.)를 해소하기 위해, 이용되는 제2 역방향 프라이머의 농도는 낮추되, 제3 역방향 프라이머의 농도는 높일 수 있으므로 빠른 시간에 더 많은 양의 산물을 합성할 수 있는 것이다.
본 명세서에서 프라이머의 '설계'란, 프라이머가 특정 조건(예를들면, 온도)에서 활성화되거나 블로킹(blocking)될 수 있도록 프라이머를 제조하는 것을 의미하며, 당업계에서 통상적으로 사용되는 프라이머 설계 방법이 이용될 수 있다. 상기 설계 방법에는 프라이머의 길이(mer) 또는 서열을 조절하는 방법이 포함되나, 이에 한정되는 것은 아니다.
본 명세서에서, '블로킹(blocking)'이란, 타겟 유전자(해당 PCR에서 복제 대상이 되는 유전자(template))에 프라이머가 어닐링되지 않는 것을 의미할 수 있다.
도 1은 본 발명의 일 실시예에 따른 순차적 중합효소 연쇄반응(스위칭 PCR) 의 모식도이다. 도 1을 참조하면, 제1 프라이머는 주형 유전자에, 유도 프라이머는 제1 산물에 결합하여 제2 산물을 합성할 수 있다. 도 1은 제1 중합효소 연쇄 반응과 제2 중합효소 연쇄 반응 단계를 하나의 모식도로 표현한 것일 뿐, 제1 중합효소 연쇄 반응과 제2 중합효소 연쇄 반응이 동시에 진행되는 것은 아니다.
본 발명에서, 제1 중합효소 연쇄 반응과 제2 중합효소 연쇄 반응의 각 어닐링 단계는 온도를 달리 할 수 있으며, 바람직하게는 제2 중합효소 연쇄 반응의 어닐링 단계 온도가 제1 중합효소 연쇄 반응의 어닐링 온도보다 높다. 예를 들어, 상기 제2 중합효소 연쇄 반응의 어닐링 단계는 상기 제1 중합효소 연쇄 반응의 어닐링 단계보다 5℃ 내지 30℃ 더 높은 온도에서 수행될 수 있다. 본 발명에 따르면, 각 프라이머가 활성화되는 온도는 서로 다를 수 있다. 이때, 제1 정방향 프라이머의 활성화 온도는 가장 넓은 범위로 설계되는 것이 바람직하며, 제2 역방향 프라이머 및 제3 역방향 프라이머의 활성화 온도는 제1 역방향 프라이머의 활성화 온도보다 높게 설계되는 것이 바람직하다. 예를들어, 제2 역방향 프라이머 또는 제3 역방향 프라이머의 활성화 온도는 제1 역방향 프라이머의 활성화 온도보다 5℃ 내지 30℃ 더 높게 설계될 수 있다.
본 발명에 따른 제1 중합효소 연쇄 반응의 어닐링 단계는 제2 중합효소 연쇄 반응의 어닐링 단계보다 5℃ 내지 30℃ 더 낮은 온도에서 진행될 수 있으며, 제1 역방향 프라이머의 유전자 합성 개시에 의해 핵산외부가수분해효소가 활성화된다. 즉, 제1 중합효소 연쇄 반응에서는 제1 정방향 프라이머 및 제1 역방향 프라이머에 의한 제1 산물만 합성할 수 있다. 제2 중합효소 연쇄 반응의 어닐링 단계는 제1 중합효소 연쇄 반응의 어닐링 단계보다 5℃ 내지 30℃ 더 높은 온도에서 진행될 수 있으며, 상대적으로 높은 온도에 의해, 제1 역방향 프라이머에 의한 반응은 진행되지 않는 반면, 제2 역방향 프라이머는 제1 산물에 결합할 수 있어, 제2 중합효소 연쇄 반응만이 진행된다.
구체적으로, 도 3 및 도 4는 본 발명에 따른 순차적 중합효소 연쇄 반응의 모식도를 나타낸다.
도 3에 따르면, 제1 중합효소 연쇄반응에서는 주형 유전자 가닥(10)에 제1 정방향 프라이머(20) 및 제1 역방향 프라이머(30)가 결합하여 유전자 합성을 개시한다. 제1 중합효소 연쇄반응에 따라 제1 산물(21)이 합성되며, 제1 산물에 다시 제1 정방향 프라이머(20) 및 제2 역방향 프라이머(40)가 결합하여 제2 중합효소 연쇄반응이 진행된다. 도 3을 참조하면, 제1 역방향 프라이머(30)는, 제1 중합효소 연쇄반응에서 활성화되지만, 제2 중합효소 연쇄반응에서는 활성화되지 않는다.
도 4를 참조하면, 제2 중합효소 연쇄 반응에 따른 제1 산물에 제1 정방향 프라이머(20) 및 제2 역방향 프라이머(40)가 결합하여 유전자를 합성할 수 있다. 이때, 제2 역방향 프라이머(40)는 제1 산물에 결합하는 유전자 서열(또는 주형 유전자에 결합하는 유전자 서열) 외에 임의의 유전자 서열을 더 포함할 수 있다. 제2 역방향 프라이머에 의해 합성되는 제2 산물은 주형 유전자 외에 임의의 유전자 서열을 더 포함하게 된다. 본 발명의 프로브는 제2 산물에 합성된 임의의 유전자에 결합할 수 있다. 제3 역방향 프라이머(50)가 제2 산물에 결합하여 유전자의 합성을 개시하는 경우, 상기 프로브는 제2 산물에서 떨어져 특정 시그널을 나타낼 수 있고, 해당 시그널을 파악하여 제2 중합효소 연쇄반응이 진행되었음을 알 수 있다.
본 발명의 일 실시예에 따르면, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머, 제3 역방향 프라이머 및 프로브는 하기 표 1과 같은 서열로 구성될 수 있다.
서열정보 (5'→3')
제1 정방향 프라이머 GGGAGCCAATATTGTCTTTGTGTTC
제1 역방향 프라이머 GTGCCGCCTGCTG
제2 역방향 프라이머
(예시 1)		 CTCCACCGTGCAGCTCATCA
제2 역방향 프라이머
(예시 2)		 TAGGCGGAATCGGTAGTAATCAA CAT CAGTCTGATAAGCTATCGG TAC CTCCACCGTGCAGCTCATCAC
제3 역방향 프라이머 TAGGCGGAATCGGTAGTAATCAA
프로브 /56-FAM/ CAG TCT GAT /ZEN/ AAG CTA TCG G /3IABkFQ/
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것일 뿐, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
[실시예 1]
<1-1> 기준 농도의 template를 이용한 switching PCR 반응
PCR 튜브에 qPCR Master mix 10 μl를 넣는다. 이후, Template DNA(T790M) 1 μl를 넣고, 10 uM 농도의 제1 정방향 프라이머 및 제1 역방향 프라이머를 각각 1 μl씩, 10 uM 농도의 제2 역방향 프라이머 1 ul, 제3 역방향 프라이머 1 ul, 프로브 0.5ul를 넣는다. 상기 튜브에 증류수 7μl를 더 넣은 후 파이펫팅(pipetting) 한다(이때 제조된 키트를 실험군 1이라 한다). 이후, PCR machine(Bio-Rad CFX96TM)의 well에 튜브를 넣고 하기 표 2와 같이 온도를 조절하여 제1 중합효소 연쇄 반응을 20회, 제2 중합효소 연쇄 반응을 40회 진행하였다.
온도 조건 시간 Cycle 횟수
95℃ 15분
95℃ 15초 제1 중합효소 연쇄 반응
20 회
65℃ 30초
72℃ 30초
95℃ 15초 제2 중합효소 연쇄 반응
40 회
71℃ 30초
72℃ 30초
<1-2> 희석된 농도의 template를 이용한 switching PCR 반응
Template DNA(T790M)를 1/2μl (실험군 2), 1/4μl (실험군 3), 1/6μl (실험군 4), 1/8μl (실험군 5), 1/10μl (실험군 6) 농도로 하여 실험군을 제조하였으며, 나머지 조건은 실험예 1-1과 동일하게 실험하였다.
실시예 1-1, 1-2에 따른 결과값은 하기 표 3 및 표 4와 같다. 도 5는 본 발명의 실시예 1-1, 1-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1%M
(3COPY)		 19.69 19.69 0.38
20.23
19.12
19.73
1/2% M
 21.22 21.43 0.64
21.05
20.47
21.47
21.51
21.78
21.13
20.92
20.21
21.06
21.99
20.45
22.59
21.60
22.17
21.75
21.87
22.15
21.79
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/4% M
 23.42 23.15 1.07
22.16
22.26
23.01
21.07
23.51
22.88
23.68
21.97
23.68
21.97
23.27
24.07
23.05
23.31
25.39
23.10
22.09
23.41
24.34
25.18
<1-3> 기준 농도의 template를 이용한 표준 PCR 반응
PCR 튜브에 qPCR Master mix 10 μl를 넣는다. 이후, Template DNA(T790M) 1 μl를 넣고, 10 uM 농도의 제1 정방향 프라이머 및 제1 역방향 프라이머를 각각 0.5 μl씩 넣는다. 상기 튜브에 증류수 7μl를 더 넣은 후 파이펫팅(pipetting) 한다(이때 제조된 키트를 대조군 1이라 한다). 이후, PCR machine(Bio-Rad CFX96TM)의 well에 튜브를 넣고 하기 표 5와 같이 온도를 조절하여 PCR을 60회 진행하였다.
온도 조건 시간 Cycle 횟수
95℃ 15분
95℃ 15초 PCR
60 회
71℃ 30초
72℃ 30초
<1-4> 희석된 농도의 template를 이용한 표준 PCR 반응
Template DNA(T790M)를 1/2μl (실험군 2), 1/4μl (실험군 3), 1/6μl (실험군 4), 1/8μl (실험군 5), 1/10μl (실험군 6) 농도로 하여 실험군을 제조하였으며, 나머지 조건은 실험예 2-1과 동일하게 실험하였다.
실시예 1-3, 1-4에 따른 결과값은 하기 표 6 및 7과 같다. 도 6은 본 발명의 실시예 1-3, 1-4에 따른 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1%M
(3COPY)		 46.36 46.13 0.54
45.60
45.75
46.79
1/2% M
 51.06 49.58 1.87
48.25
50.83
49.34
49.53
49.94
46.98
49.78
49.96
48.02
46.97
50.99
50.57
51.28
46.23
53.65
48.14
51.00
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/4% M
 52.59 51.51 1.32
51.53
51.16
51.66
51.22
51.81
51.35
52.10
48.10
50.26
50.99
50.31
50.58
53.42
50.96
52.23
53.52
53.35
도 5를 참조하면 실시예 1-1, 1-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 결과 T790M 유전자는 18 내지 24 cycle의 Cq 또는 Ct 값을 나타내며, 도 6를 참조하면 실시예 1-3, 1-4에 따른 표준 PCR 방법에 따라 T790M 유전자를 증폭시켰을 때, 48 내지 50 cycle에서 증폭된다. 이는 표 3, 4, 6 및 7의 내용과 같다. 본 발명에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)은 제2 중합효소 연쇄 반응에서 증폭이 되는 것을 감안하면, 실시예 1-1, 1-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 결과 T790M 유전자는 38 내지 44 cycle(제1 중합효소 연쇄 반응이 20cycle 일어남)에서 Cq 또는 Ct값을 갖음을 알 수 있다. 실시예 1-1 내지 1-4 모두, template인 T790M 유전자 농도가 낮을수록 Cq 또는 Ct 값이 증가하였으며, 농도와 상관없이 실시예 1-1 및 1-2의 증폭 cycle 값이 실시예 1-3 및 1-4의 값보다 낮았다. 따라서, 본 발명에 따른 순차적 중합효소 연쇄반응(스위칭 PCR) 방법은 하나의 실험 기구에서 제1 중합효소 연쇄 반응과 제2 중합효소 연쇄 반응을 독립적으로 진행할 수 있음을 알 수 있다.
[실시예 2]
<2-1> 기준 농도의 template를 이용한 switching PCR 반응
실시예 1-1과 동일한 조건으로 PCR을 진행하였다.
<2-2> 희석된 농도의 template를 이용한 switching PCR 반응
실시예 1-2와 동일한 조건으로 PCR을 진행하였다.
실시예 2-1, 2-2에 따른 결과값은 하기 표 8 및 표 9와 같다. 도 7는 본 발명의 실시예 2-1, 2-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/4% M 17.59 19.99 1.67
19.95
21.56
20.85
1/6% M 19.10 20.66 1.40
20.02
19.34
19.52
19.93
21.31
23.11
19.53
19.66
21.86
22.47
23.18
20.26
19.74
18.55
22.15
19.88
21.97
21.42
20.17
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/8% M 23.17 22.97 0.69
22.22
21.52
22.69
23.26
23.34
23.30
23.48
23.89
23.48
23.97
22.46
22.37
23.91
23.87
23.13
23.45
22.49
23.51
24.14
<2-3> 기준 농도의 template를 이용한 표준 PCR 반응
실시예 1-3과 동일한 조건으로 PCR을 진행하였다.
<2-4> 희석된 농도의 template를 이용한 표준 PCR 반응
실시예 1-4와 동일한 조건으로 PCR을 진행하였다.
실시예 2-3, 2-4에 따른 결과값은 하기 표 10 및 표 11과 같다. 도 8은 본 발명의 실시예 2-3, 2-4에 따른 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/4%M 51.16 51.04 1.31
52.26
49.19
51.53
1/6% M 54.55 50.22 2.08
52.15
55.60
48.52
48.80
50.73
49.31
50.34
48.27
49.07
49.55
50.57
50.70
48.60
48.13
47.81
51.44
51.51
48.52
50.30
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/8% M
 55.68 53.09 3.05
50.66
53.22
49.04
54.04
50.89
50.25
49.38
50.72
49.55
52.74
51.72
54.54
58.93
53.63
56.08
58.00
56.60
도 7을 참조하면 실시예 2-1, 2-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 결과 T790M 유전자는 18 내지 24 cycle의 Cq 또는 Ct값을 나타내며, 도 8을 참조하면 실시예 2-3, 2-4에 따른 표준 PCR 방법에 따라 T790M 유전자를 증폭시켰을 때, 48 내지 60 cycle에서 Cq 또는 Ct값을 나타낸다. 이는 표 8, 9, 10 및 11의 내용과 같다. 본 발명에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)은 제2 중합효소 연쇄 반응에서 증폭이 되는 것을 감안하면, 실시예 2-1, 2-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 결과 T790M 유전자는 38 내지 44 cycle(제1 중합효소 연쇄 반응이 20cycle 일어남)에서 Cq 또는 Ct값을 나타냄을 알 수 있다. 실시예 2-1 내지 2-4 모두, template인 T790M 유전자 농도가 낮을수록 Cq 또는 Ct값이 증가하였으며, 농도와 상관없이 실시예 2-1 및 2-2의 Cq 또는 Ct값이 실시예 2-3 및 2-4의 값보다 낮았다. 따라서, 본 발명에 따른 순차적 중합효소 연쇄반응(스위칭 PCR) 방법은 유전자 중합효소 연쇄반응(PCR)의 수율을 높일 수 있고, 매우 낮은 유전자가 존재하는 경우에도 재현성 높은 중합효소 연쇄반응 결과를 얻을 수 있음을 알 수 있다.
[실시예 3]
<3-1> 기준 농도의 template를 이용한 switching PCR 반응
실시예 1-1과 동일한 조건으로 PCR을 진행하였다.
<3-2> 희석된 농도의 template를 이용한 switching PCR 반응
실시예 1-2와 동일한 조건으로 PCR을 진행하였다.
실시예 3-1, 3-2에 따른 결과값은 하기 표 12와 같다. 도 9는 본 발명의 실시예 3-1, 3-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/2% M 17.87 17.93 0.08
17.99
1/4% M 18.12 18.76 0.90
19.39
1/6% M 22.22 21.69 0.75
21.16
1/8% M 23.73 25.11 2.01
28.07
24.01
24.65
1/10% M 26.65 25.89 1.31
23.84
27.14
25.49
23.44
26.05
27.03
26.11
25.94
27.18
<3-3> 기준 농도의 template를 이용한 표준 PCR 반응
실시예 1-3과 동일한 조건으로 PCR을 진행하였다.
<3-4> 희석된 농도의 template를 이용한 표준 PCR 반응
실시예 1-4와 동일한 조건으로 PCR을 진행하였다.
실시예 3-3, 3-4 따른 결과값은 하기 표 13과 같다. 도 10는 본 발명의 실시예 3-3, 3-4에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 T790M 유전자의 증폭 결과를 나타낸 그래프이다.
유전자 종류 농도 Cq (Cycle 횟수) Cq 평균 Cq 표준편차
PC
(T790M
Mutant standard)		 1/2% M 55.95 54.20 2.48
52.44
1/4% M 52.11 52.26 0.20
52.40
1/6% M 54.60 54.09 0.71
53.59
1/8% M - 56.84 1.72
58.19
54.90
57.43
1/10% M 53.89 56.35 1.72
56.70
57.61
-
54.18
55.64
56.17
58.49
-
58.11
도 9을 참조하면 실시예 3-1,3-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 결과 T790M 유전자는 18 내지 24 cycle에서 Cq 또는 Ct값을 나타내며, 도 10을 참조하면 실시예 3-3, 3-4에 따른 표준 PCR 방법에 따라 T790M 유전자를 증폭시켰을 때, 48 내지 60 cycle에서 Cq 또는 Ct값을 갖는다. 이는 표 12 및 13의 내용과 같다. 본 발명에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)은 제2 중합효소 연쇄 반응에서도 증폭이 되는 것을 감안하면, 실시예 3-1, 3-2에 따른 순차적 중합효소 연쇄반응(스위칭 PCR)의 결과 T790M 유전자는 38 내지 44 cycle(제1 중합효소 연쇄 반응이 20cycle 일어남)에서 Cq 또는 Ct값을 나타냄을 알 수 있다. 실시예 3-1 내지 3-4 모두, template인 T790M 유전자 농도가 낮을수록 Cq 또는 Ct값이 증가하였으며, 농도와 상관없이 실시예 3-1 및 3-2의 Cq 또는 Ct값은 실시예 3-3 및 3-4의 값보다 낮았다. 따라서, 본 발명에 따른 스위칭 PCR 방법은 유전자 증폭 시간을 단축시킬 수 있고, 유전자 중합효소 연쇄반응(PCR)의 수율을 높일 수 있으며, 매우 낮은 유전자가 존재하는 경우에도 재현성 높은 중합효소 연쇄반응 결과를 얻을 수 있다는 것을 알 수 있다.
또한, 본 발명의 실시예 3-2에서 순차적 중합효소 연쇄반응(스위칭 PCR)은 1/8%(실험군 5), 1/10%(실험군 6) 두 농도에서 모두 100% detection rate을 보여주었고, 실시예 3-4의 표준 PCR의 경우 1/8%의 농도에서는 75%의 detection rate를, 1/10%의 농도에서는 80%의 detection rate를 나타내 두 농도에서 모두 95% 미만의 detection rate가 나타남을 알 수 있다. 즉, 본 발명에 따른 순차적 중합효소 연쇄반응 (Switching PCR)은, 주형 유전자(template)의 농도가 낮은 경우에도 증폭이 용이하게 일어나는 바, 본 발명에 따른 키트를 이용한 순차적 중합효소 연쇄반응(스위칭 PCR)은 민감도가 더 높음을 알 수 있다.
[실시예 4]
<4-1> 기준 농도의 template를 이용한 표준 PCR 반응
PCR 튜브에 qPCR Master mix 10 μl를 넣는다. 이후, Template DNA(T790M) 1 00fg/μl를 넣고, 10 uM 농도의 제1 정방향 프라이머 및 제1 역방향 프라이머를 각각 0.5 μl씩, 10 uM 농도의 제2 역방향 프라이머 1 ul, 10 uM 농도의 제3 역방향 프라이머 1 ul 및 프로브 0.5ul를 넣는다. 상기 튜브에 증류수 7μl를 더 넣은 후 파이펫팅(pipetting) 한다. 이후, PCR machine(Bio-Rad CFX96TM)의 well에 튜브를 넣고 하기 표 14와 같이 온도를 조절하여 PCR을 40 cycle 진행하였다.
온도 조건 시간 Cycle 횟수
95℃ 15분
95℃ 15초 PCR
40 회(cycle)
63℃ 30초
72℃ 30초
<4-2> 기준 농도의 template를 이용한 표준 PCR 반응
온도를 하기 표 15와 같이하고, 다른 실험 조건은 실시예 4-1과 같은 조건으로 PCR을 진행하였다.
온도 조건 시간 Cycle 횟수
95℃ 15분
95℃ 15초 PCR
40 회(cycle)
71℃ 30초
72℃ 30초
<4-3> 기준 농도의 template를 이용한 표준 PCR 반응
온도를 하기 표 16과 같이하여 제1 중합효소 연쇄 반응 및 제2 중합효소 연쇄 반응을 진행하였으며, 다른 실험 조건은 실시예 4-1과 같은 조건으로 PCR을 진행하였다.
온도 조건 시간 Cycle 횟수
95℃ 15분
95℃ 15초 제1 중합효소 연쇄 반응
10 회
65℃ 30초
72℃ 30초
95℃ 15초 제2 중합효소 연쇄 반응
30 회
71℃ 30초
72℃ 30초
<4-4> 기준 농도의 template를 이용한 표준 PCR 반응
Template DNA(T790M)의 농도를 0으로 하고, 다른 실험 조건은 실시예 4-1과 같은 조건으로 PCR을 진행하였다.
도 11은, 본 발명의 일 실시예에 따른 PCR 산물의 전기영동 이미지이다. 도 11의 ①은 실시예 4-1에 따른 결과이며, ②는 실시예 4-2에 따른 결과를, ③은 실시예 4-3에 따른 결과를, ④는 실시예 4-4에 따른 결과를 나타낸다. 도 11을 참조하면, ①에서는 110bp에서 형광을 나타냈으며 ②에서는 131bp 부근에서 band를 나타냈고, ④ 에서는 band가 나타나지 않았다. 이를 기초로 ③을 판단해보면, 110bp에서 약하게, 131bp부근에서 강하게 band가 나타나 110bp, 131bp 크기의 산물을 모두 생성하였음을 알 수 있다. 즉, ① 및 ②에서는 각각 하나의 산물만 합성할 수 있음이, ③에서는 ①, ②의 산물 모두가 합성됨을 알 수 있다.
도 11의 상기 ①에서는 제1 중합효소 연쇄반응에서 제2 역방향 프라이머가 활성화되지 않아, 제1 산물 (110 bp)만이 형성되는 것이며, ②에서는 제1 역방향 프라이머가 높은 온도 때문에 비활성화되어 제2 산물(131 bp)만이 합성된다. 반면 도 11의 ③에서는 제1 중합효소 연쇄반응이 10 cycle, 제2 중합효소 연쇄반응이 30 cycle 동안 수행되었는 바, 수행된 cycle에 비례한 유전자의 band가 공존하는 것을 확인할 수 있다 (110 bp, 131 bp). 본 발명의 실시예인 4-3에 의하면, 각 중합효소 연쇄반응의 어닐링 온도에서 활성화될 수 있는 프라이머를 설계하여, 제1 중합효소 연쇄반응에서는 제1 정방향 프라이머 및 제1 역방향 프라이머가, 제2 중합효소 연쇄반응에서는 제1 정방향 프라이머 및 제2 역방향 프라이머가 활성화되었고, 이에 따라 제1 산물 및 제2 산물 모두가 형성되었음을 알 수 있다.
<도면 부호의 설명>
10: 주형 유전자
20: 제1 정방향 프라이머
21: 제1 산물
30: 제1 역방향 프라이머
40: 제2 역방향 프라이머
50: 제3 역방향 프라이머
60: 프로브
이상 본 발명의 실시예들을 설명하였지만, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명이 그 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다.

Claims (10)

  1. 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 조성물을 하나의 용기에 준비하는 단계; 제1 중합효소 연쇄반응 단계; 및 제2 중합효소 연쇄반응 단계를 포함하는 순차적 중합효소 연쇄반응에 있어서,
    상기 제1 중합효소 연쇄반응 단계는,
    a) 주형 유전자의 이중 나선이 풀어지는 제1 변성 단계;
    b) 상기 a) 단계에 따른 주형 유전자에 제1 정방향 프라이머 및 제1 역방향 프라이머가 결합하는 제1 어닐링 단계; 및
    c) 상기 b) 단계에서 결합된 제1 정방향 프라이머 및 제2 역방향 프라이머에 의해 주형 유전자가 복제되어, 제1 산물이 합성되는 단계를 포함하고,
    상기 제2 중합효소 연쇄반응 단계는,
    d) 상기 제1 산물의 이중 나선이 풀어지는 제2 변성단계;
    e) 상기 d)단계에 따른 제1 산물에 제1 정방향 프라이머 및 제2 역방향 프라이머가 결합하는 제2 어닐링 단계;
    f) 상기 e) 단계에서 결합된 제1 정방향 프라이머 및 제2 역방향 프라이머에 의해 제1 산물이 복제되어 제2 산물이 합성되는 단계; 및
    g) 상기 제2 산물에 제1 정방향 프라이머가 결합하여 제3 산물이 합성되고, 제3 산물에 제3 역방향 프라이머가 결합하여 최종 산물을 합성하는 단계를 포함하는, 순차적 중합효소 연쇄반응을 수행하는 방법.
  2. 제1 항에 있어서,
    상기 e) 단계는 상기 b) 단계보다 높은 온도에서 수행되며,
    상기 제2 역방향 프라이머는 상기 제1 역방향 프라이머 보다 높은 온도에서 활성화되도록 설계된 것인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  3. 제1 항에 있어서,
    상기 e) 단계는 상기 b) 단계보다 5℃ 내지 30℃ 더 높은 온도에서 수행되는 것인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  4. 제1 항에 있어서,
    상기 제1 중합효소 연쇄반응 및 제2 중합효소 연쇄반응은, 온도에 따라 조절되는 것인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  5. 제1 항에 있어서,
    상기 제2 역방향 프라이머는 주형 유전자와 상보적인 서열 외에 임의의 유전자 서열을 더 포함하는 것인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  6. 제5 항에 있어서,
    상기 임의의 유전자 서열과 상보적인 유전자 서열은 제2 산물에 포함되고,
    상기 제3 역방향 프라이머는 상기 제2 산물에 포함된 임의의 유전자 서열과 상보적인 유전자 서열에 결합하여 최종 산물을 힙성하는 것인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  7. 제1 항에 있어서,
    상기 조성물은 상기 제3 산물에 결합하는 프로브를 더 포함하고,
    상기 프로브가 결합하는 제3 산물의 유전자 서열은, 제2 역방향 프라이머에 포함된 임의의 유전자 서열과 상보적인 유전자 서열인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  8. 제7 항에 있어서,
    상기 프로브는 제3 역방향 프라이머에 의한 유전자 합성에 따라 분해되어 발광하는 것인, 순차적 중합효소 연쇄반응을 수행하는 방법.
  9. 제1 항의 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 순차적 중합효소 연쇄반응용 조성물.
  10. 제1 항의 주형 유전자, DNA 중합효소, dNTP, 제1 정방향 프라이머, 제1 역방향 프라이머, 제2 역방향 프라이머 및 제3 역방향 프라이머를 포함하는 순차적 중합효소 연쇄반응용 키트.
PCT/KR2021/007920 2020-06-23 2021-06-23 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법 WO2021261928A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN202180045225.7A CN115735008A (zh) 2020-06-23 2021-06-23 连续聚合酶链式反应用组合物及利用其的基因扩增方法
US18/012,633 US20230250471A1 (en) 2020-06-23 2021-06-23 Composition for sequential polymerase chain reaction, and gene amplification method using same
EP21830294.1A EP4170046A4 (en) 2020-06-23 2021-06-23 COMPOSITION FOR SEQUENTIAL POLYMERASE CHAIN REACTION, AND GENE AMPLIFICATION METHOD USING SAME
JP2022580308A JP2023542064A (ja) 2020-06-23 2021-06-23 逐次ポリメラーゼ連鎖反応用組成物及びそれを用いた遺伝子増幅方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0076683 2020-06-23
KR20200076683 2020-06-23
KR10-2021-0081843 2021-06-23
KR1020210081843A KR102475713B1 (ko) 2020-06-23 2021-06-23 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법

Publications (1)

Publication Number Publication Date
WO2021261928A1 true WO2021261928A1 (ko) 2021-12-30

Family

ID=77923327

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007920 WO2021261928A1 (ko) 2020-06-23 2021-06-23 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법

Country Status (6)

Country Link
US (1) US20230250471A1 (ko)
EP (1) EP4170046A4 (ko)
JP (1) JP2023542064A (ko)
KR (1) KR102475713B1 (ko)
CN (1) CN115735008A (ko)
WO (1) WO2021261928A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060088132A (ko) * 2006-06-12 2006-08-03 주식회사 씨젠 기지의 서열에 인접한 미지의 ｄｎａ 서열을 증폭하는 방법
KR20160053214A (ko) * 2014-10-31 2016-05-13 경북대학교 산학협력단 돼지 생식기 호흡기 증후군 바이러스의 진단용 조성물 및 이를 이용한 진단 방법
US20170051355A1 (en) * 2010-05-18 2017-02-23 Natera, Inc. Highly multiplex pcr methods and compositions
KR20200068738A (ko) * 2017-11-29 2020-06-15 주식회사 파나진 표적핵산 증폭방법 및 표적핵산 증폭용 조성물

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001274635A1 (en) * 2000-11-10 2002-05-21 Amicogen, Inc. Method for generating recombinant dna library using unidirectional single-stranded dna fragments
KR101785687B1 (ko) 2016-07-20 2017-10-17 (주)다이오진 다중 증폭 이중 시그널 증폭에 의한 타겟 핵산 서열의 검출 방법
EP3601598B1 (en) * 2017-03-23 2022-08-03 University of Washington Methods for targeted nucleic acid sequence enrichment with applications to error corrected nucleic acid sequencing

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060088132A (ko) * 2006-06-12 2006-08-03 주식회사 씨젠 기지의 서열에 인접한 미지의 ｄｎａ 서열을 증폭하는 방법
US20170051355A1 (en) * 2010-05-18 2017-02-23 Natera, Inc. Highly multiplex pcr methods and compositions
KR20160053214A (ko) * 2014-10-31 2016-05-13 경북대학교 산학협력단 돼지 생식기 호흡기 증후군 바이러스의 진단용 조성물 및 이를 이용한 진단 방법
KR20200068738A (ko) * 2017-11-29 2020-06-15 주식회사 파나진 표적핵산 증폭방법 및 표적핵산 증폭용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KALENDAR RUSLAN, SHUSTOV ALEXANDR V., SEPPÄNEN MERVI M., SCHULMAN ALAN H., STODDARD FREDERICK L.: "Palindromic sequence-targeted (PST) PCR: a rapid and efficient method for high-throughput gene characterization and genome walking", SCIENTIFIC REPORTS, vol. 9, no. 1, 1 December 2019 (2019-12-01), XP055885585, DOI: 10.1038/s41598-019-54168-0 *
See also references of EP4170046A4 *

Also Published As

Publication number Publication date
KR102475713B1 (ko) 2022-12-08
JP2023542064A (ja) 2023-10-05
EP4170046A1 (en) 2023-04-26
US20230250471A1 (en) 2023-08-10
KR20210117223A (ko) 2021-09-28
CN115735008A (zh) 2023-03-03
EP4170046A4 (en) 2024-07-24

Similar Documents

Publication Publication Date Title
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
WO2017095128A1 (ko) 등온 핵산 증폭을 위한 리포터 염료, 퀀처가 포함되는 등온 기반 이중 기능성 올리고뉴클레오타이드 및 이를 이용한 핵산 증폭과 측정 방법
WO2017122897A1 (ko) 참돔 이리도바이러스병 원인바이러스의 검출용 유전자 마커, 및 이를 이용한 원인바이러스의 검출 방법
WO2010147372A2 (ko) 말라리아 원충 검출용 프라이머, 탐침 및 이를 이용한 검출방법
WO2017082503A1 (ko) Bcr/abl 음성 골수증식종양 관련 유전자변이 다중검출용 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법
WO2022010238A1 (ko) 특정 인공 뉴클레오타이드 서열을 이용한 위양성 판단용 조성물 및 이를 이용한 위양성 판단 방법
WO2021261928A1 (ko) 순차적 중합효소 연쇄 반응용 조성물 및 이를 이용한 유전자 증폭 방법
WO2024080483A1 (ko) Crispr-cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법
WO2021162228A1 (ko) Hiv-1 약제 내성 분석을 위한 프라이머 세트, 이를 포함하는 키트, 및 이를 이용한 분석 방법
WO2022031046A1 (ko) Dcas9/grna 복합체 기반의 표적 rna 검출 방법
WO2018194437A2 (ko) 표적 점 돌연변이 유전자 검출을 위한 핵산 분자 템플레이트 및 이를 이용한 유전자 검사방법
WO2016190654A1 (ko) 상보적 염기서열과 미스-매치된 염기서열 그리고 reporter와 quencher를 포함하는 이중 기능성 올리고뉴클레오타이드 및 이를 이용한 핵산 증폭 및 측정 방법
WO2021177773A2 (ko) Sars-cov-2 진단용 조성물, 키트 및 이를 이용한 sars-cov-2의 진단방법
WO2023106868A1 (ko) 단일가닥 생성 방법 및 이를 이용한 변이 검출 방법
WO2012002597A1 (ko) Β형 간염 바이러스 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 β형 간염 바이러스 진단 방법
WO2020101194A1 (ko) 카바페넴아제 생성 장내세균 진단을 위한 루프 매개 등온증폭 반응용 프라이머 세트 및 이의 용도
WO2022050721A1 (ko) Hla 유전자 증폭용 조성물 및 이의 용도
WO2021225424A1 (ko) 코로나바이러스-19 검출용 조성물 및 이의 검출용 키트
CN115747340A (zh) 一种用于检测人slco1b1基因分型的方法
WO2019225791A1 (ko) 패혈증-유발 그람 음성균 검출용 mlpa 프로브 및 그 용도
WO2022071737A1 (ko) Sars-cov-2의 rna 표준물질 및 이를 이용한 코로나19바이러스(sars-cov-2) 감염 진단 정보의 제공방법
WO2011142646A9 (ko) 인유두종바이러스 검출 및 유전형 확인 방법
WO2012060596A2 (en) Apparatus and method for detecting multiplex target nucleic acids in real time
WO2022149969A1 (ko) 루프구조매개 등온증폭 산물의 전사를 위한 변형 프라이머 구조 및 이의 용도
WO2024101758A1 (ko) 연장 매개 자가 접힘을 이용한 새로운 핵산 등온 증폭 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21830294

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022580308

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021830294

Country of ref document: EP

Effective date: 20230123