WO2024080483A1 - Crispr-cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법 - Google Patents

Crispr-cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법 Download PDF

Info

Publication number
WO2024080483A1
WO2024080483A1 PCT/KR2023/008318 KR2023008318W WO2024080483A1 WO 2024080483 A1 WO2024080483 A1 WO 2024080483A1 KR 2023008318 W KR2023008318 W KR 2023008318W WO 2024080483 A1 WO2024080483 A1 WO 2024080483A1
Authority
WO
WIPO (PCT)
Prior art keywords
listeria monocytogenes
composition
primer pair
amplification
crispr
Prior art date
Application number
PCT/KR2023/008318
Other languages
English (en)
French (fr)
Inventor
이상용
박영민
이상윤
이효율
김상구
Original Assignee
주식회사 풀무원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 풀무원 filed Critical 주식회사 풀무원
Publication of WO2024080483A1 publication Critical patent/WO2024080483A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present invention relates to a CRISPR-Cas-based composition for detecting Listeria monocytogenes and a method for detecting Listeria monocytogenes using the same. More specifically, it relates to a method for specifically amplifying Listeria monocytogenes by isothermal amplification. It relates to a composition for detecting Listeria monocytogenes comprising a primer pair, guide RNA, and CRISPR-Cas protein, and a detection method using the same.
  • Listeriosis is caused by infection with Listeria monocytogenes and is one of the most important zoonotic diseases.
  • Listeria monocytogenes causes encephalitis, abortion, neonatal sepsis, and central nervous system infections in both humans and animals. Additionally, Listeria monocytogenes is generally found in soil, sewage, spoiled vegetables or dairy products, is relatively resistant to heat, and can grow even at refrigerator temperatures, causing food poisoning through refrigerated and stored foods.
  • infection through the intestinal tract after ingestion of contaminated food is the most important route of infection.
  • infection begins with Listeria bacteria passing through the intestinal mucosa. They pass through the stomach and enter the intestines even during the process of being partially killed. When they arrive at the intestinal tract, if they survive the antibiotic effect of bile, they attach to the intestinal mucosa and invade the intestines. You can do it.
  • the Listeria genus is divided into seven species: Listeria monocytogenes , Listeria ivanovii , Listeria seeligeri , Listeria innocua , Listeria welshimeri , Listeria grayi , and Listeria murrayi .
  • the pathogenic bacteria are Listeria monocytogenes and Listeria ivanovii .
  • Listeria monocytogenes is pathogenic in both humans and animals, but Listeria Ivanovi is known to infect only hoofed animals such as cows and sheep. Other species require decaying nutrients such as soil or rotting vegetables.
  • the standard culture method is typically used as a method to detect Listeria monocytogenes from various sources.
  • this method has the disadvantage of being time-consuming and requiring intensive labor to process a large amount of samples at the same time. Additionally, this method has the disadvantage that it is difficult to distinguish only Listeria monocytogenes among Listeria species in a Listeria-selective medium.
  • PCR Polymerase Chain Reaction
  • real-time PCR methods which are gene-based detection methods in combination with existing standard culture methods, are being applied to various fields.
  • This is a technique that can detect causative bacteria by amplifying bacteria-specific genes. It has the advantage of being able to determine results simply and quickly when compared to standard culture methods.
  • electrophoresis on an agar gel is required to confirm the amplification product. Not only is there the inconvenience of having to go through the process, but there are also concerns about inhibition of the gene amplification reaction by ingredients of food samples such as milk and meat.
  • the present inventor has conducted extensive research to solve the above-mentioned problems and develop a method that can very quickly and accurately detect Listeria monocytogenes in food or biological samples.
  • the nucleotide sequences of SEQ ID NOs. 1 and 2 were used.
  • the present invention was completed after discovering that Listeria monocytogenes could be detected with very high sensitivity and specificity through a gene-editing reaction using a pair of primers and optionally guide RNA and CRISPR-Cas protein.
  • the purpose of the present invention is to provide a primer pair for detecting Listeria monocytogenes including a forward primer consisting of the base sequence of SEQ ID NO: 1 and a reverse primer consisting of the base sequence of SEQ ID NO: 2.
  • Another object of the present invention is to provide a composition for detecting Listeria monocytogenes containing the primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease.
  • Another object of the present invention is to provide a composition for detecting Listeria monocytogenes consisting of the primer pair of SEQ ID NOs: 1 and 2, guide RNA, and endonuclease.
  • Another object of the present invention is to provide a composition for detecting Listeria monocytogenes , which essentially consists of the primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease.
  • Another object of the present invention is to provide a kit for detecting Listeria monocytogenes containing the composition.
  • Another object of the present invention is to provide a method for detecting Listeria monocytogenes comprising the following steps:
  • Another object of the present invention is to provide the use of the primer pair, guide RNA, and endonuclease of SEQ ID NOs: 1 and 2 for preparing a composition for detecting Listeria monocytogenes .
  • the present invention provides a primer pair for detecting Listeria monocytogenes including a forward primer consisting of the base sequence of SEQ ID NO: 1 and a reverse primer consisting of the base sequence of SEQ ID NO: 2. to provide.
  • the present invention provides a composition for detecting Listeria monocytogenes comprising the primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease. do.
  • the present invention provides a composition for detecting Listeria monocytogenes consisting of a primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease. do.
  • the present invention provides a composition for detecting Listeria monocytogenes, which essentially consists of the primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease. provides.
  • the present invention provides a kit for detecting Listeria monocytogenes including the composition.
  • the present invention provides a Listeria monocytogenes detection method comprising the following steps:
  • the present invention provides a primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease to prepare a composition for detecting Listeria monocytogenes. Provides a purpose.
  • the present invention provides a primer pair for detecting Listeria monocytogenes including a forward primer consisting of the base sequence of SEQ ID NO: 1 and a reverse primer consisting of the base sequence of SEQ ID NO: 2.
  • the term "primer” is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary template of Listeria monocytogenes nucleic acid, and the template A short nucleic acid sequence that serves as a starting point for strand copying.
  • the primer pair can specifically amplify the genes of Listeria monocytogenes, including serotypes 1/2a, 1/2b, 1/2c and 4b.
  • the amplification may be performed by any method used in the art to amplify an amplification target (gene, etc.), for example, by recombinase polymerase amplification (RPA). , but is not limited to this.
  • RPA recombinase polymerase amplification
  • the amplification product may be, for example, an amplicon, but is not limited thereto.
  • RPA Recombinase Polymerase Amplification
  • Recombinase Polymerase Amplification is a method that uses bacteriophage T4 recombinase to dissociate double strands of DNA and simultaneously amplifies specific DNA using DNA polymerase and specific primers.
  • DNA of a specific nucleotide sequence can be amplified using a target template and a pair of primers (oligonucleotide), but unlike PCR, the DNA of a specific base sequence can be amplified within a certain temperature range (37°C - 42°C). It has the advantage of being able to cause an amplification reaction under isothermal conditions.
  • RPA has been developed to produce amplification products very quickly, and this, along with the advantage of isothermal conditions, is widely recognized, and RPA is being applied in various ways to detect specific pathogens through specific gene amplification.
  • the length of the RPA amplification product not exceed 500 nt (nucleotides), and is generally 100 to 250 nt. It has the length of the amplification product between.
  • the primer length for RPA is recommended to be at least 30 nucleotides and is generally 32 to 35 nt. Length is mainly used.
  • it is not sensitive to the ratio of GC in the sequence (GC%) and Tm (melting temperature) value, so RPA primers can converge to GC% (20-70%) and Tm (50-100°C) (Analyst , 2019, 144, 31).
  • the present invention also provides a composition for detecting Listeria monocytogenes comprising the primer pair of SEQ ID NOs: 1 and 2, a guide RNA, and an endonuclease.
  • the guide RNA may be crRNA or gRNA.
  • crRNA is called CRISPR RNA.
  • gRNA refers to guide RNA.
  • crRNA and gRNA may be single strand RNA.
  • crRNA can bind to tracrRNA to activate CRISPR-related proteins, and crRNA can be used in combination with tracrRNA.
  • the crRNA may have a sequence complementary to a gene sequence that exists specifically in Listeria monocytogenes.
  • gRNA can also bind to a gene sequence that is specific to Listeria monocytogenes and cause CRISPR-related proteins to be active.
  • the crRNA or gRNA may be RNA composed of 15 to 40 nucleic acids.
  • crRNA or gRNA may be composed of 23 nucleic acids. Additionally, the crRNA or gRNA may contain additional sequences on the 3' side to render CRISPR-related proteins active, such as Cas9, Cas12, or Cas13. In one embodiment, the gRNA may be characterized as consisting of SEQ ID NO: 3 or a base sequence complementary thereto.
  • the endonuclease may be a CRISPR-related protein.
  • CRISPR-related protein is an enzyme that can recognize and cleave nucleic acids such as DNA or RNA when they are double-stranded or single-stranded (dsDNA/RNA and ssDNA/RNA). Specifically, they can recognize double-stranded or single-stranded nucleic acids bound to crRNA or gRNA and cleave them.
  • the endonuclease in the present invention may be one in which the endonuclease function is activated by recognizing that gRNA is bound to the target site. Additionally, as the endonuclease function is activated, it may have exonuclease activity that can non-specifically cleave double-stranded and/or single-stranded DNA and/or RNA. Additionally, once activated, CRISPR-related proteins such as Cas12a may exhibit non-specific exonuclease activity. In this case, DNA and RNA can be cut non-specifically.
  • composition of one embodiment of the present invention binds crRNA or gRNA to a specific target site of Listeria monocytogenes, more specifically, the lmo0161 gene, and cleaves the reporter by a non-specific nuclease activated by this.
  • Listeria monocytogenes can be detected by emission of a fluorescent substance bound to a reporter.
  • CRISPR-related protein is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, CsMT2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, It may be any one selected from the group consisting of Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15,
  • the composition may further include a reporter gene.
  • the reporter gene is preferably coupled to a fluorescent substance, and the fluorescent substance is FAM, TET, JOE, YAKYE, HEX, CY3, ATTO550, TAM, ROX, TxRed, CY35, LC610, LC640, ATTO647N, It may be selected from the group consisting of CY5, VIC, evergreen dye, and ATTO680, but is not limited thereto.
  • the composition may be used in a method for detecting Listeria monocytogenes by an isothermal amplification reaction and a subsequent CRISPR gene editing reaction.
  • the guide RNA binds complementary to the target site and is activated by an endonuclease, preferably a CRISPR-related protein. This activates and cuts the sequence of the reporter gene. As a result, the fluorescent substance bound to the reporter gene emits light, and through this, Listeria monocytogenes can be detected.
  • an endonuclease preferably a CRISPR-related protein.
  • the present invention also provides a kit for detecting Listeria monocytogenes comprising the composition.
  • the kit may be a kit containing the essential elements required to perform Listeria monocytogenes detection, in addition to the composition, test tubes or other suitable containers, reaction buffer (pH and magnesium concentration may vary), deoxynucleotides (dNTPs) , enzymes such as Taq-polymerase, DNase, RNAse inhibitors, DEPC-water, and sterilized water.
  • reaction buffer pH and magnesium concentration may vary
  • dNTPs deoxynucleotides
  • enzymes such as Taq-polymerase, DNase, RNAse inhibitors, DEPC-water, and sterilized water.
  • the present invention also provides a method for detecting Listeria monocytogenes comprising the following steps:
  • the present invention provides a method of diagnosing and treating listeriosis in a specimen comprising the following steps:
  • step (iv) diagnosing listeriosis when the amplification product of step (iii) is detected.
  • step (v) the disease is treated by administering therapeutic drugs such as antibiotics such as ampicillin, gentamicin, tetracycline, or aminoglucoside to the specimen diagnosed with the disease in step (iv), or by means such as surgery. This is the step.
  • therapeutic drugs such as antibiotics such as ampicillin, gentamicin, tetracycline, or aminoglucoside
  • the "treatment” of the present invention refers generically to listeriosis or improving the symptoms of listeriosis, which may include curing, substantially preventing, or improving the condition of the disease, and can prevent the disease from occurring. This includes, but is not limited to, relieving, curing, or preventing one or most of the symptoms that arise.
  • the “specimen” refers to a substance or organism used for testing, inspection, analysis, etc., and the type is not particularly limited, but may be a food or biological sample in which the presence or absence of Listeria monocytogenes is suspected.
  • the biological sample may include, but is not limited to, tissue, cells, whole blood, serum, plasma, cerebrospinal fluid, colostrum, joint fluid, saliva, feces, cell culture supernatant, etc.
  • DNA isolation of gDNA can be performed according to a common method known in the art, and if the starting material is mRNA, it can be synthesized into cDNA using reverse transcriptase.
  • the DNA isolation is not particularly limited as long as it is a method of typically separating genomic DNA (gDNA) from a sample.
  • commercially available DNA isolation kits such as Qiagen's DNeasy mini kit can be used.
  • the “amplification” may be one selected from the group consisting of PCR, RT-PCR, and isothermal amplification, and is preferably an isothermal amplification method.
  • the "Isothermal amplification” refers to a method of amplifying a target nucleic acid sequence (template) under constant reaction temperature conditions, including recombinase polymerase amplification (RPA) and loop-mediated amplification (loop-mediated amplification).
  • -mediated isothermal amplification (LAMP) helicase-dependent amplification (HDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), strand displacement amplification, SDA), nucleic acid sequence-based amplification (NASBA), and preferably recombinase polymerase amplification (RPA).
  • Detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto.
  • capillary electrophoresis can be performed.
  • Capillary electrophoresis can be performed using, for example, the ABi Sequencer.
  • gel electrophoresis can be performed, and gel electrophoresis can use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product.
  • the fluorescence measurement method is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3, and then the target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorometer. can do.
  • the radioactivity measurement method involves adding a radioactive isotope such as 32P or 35S to the PCR reaction solution when performing PCR to label the amplification product, and then using a radioactivity measurement device, such as a Geiger counter or liquid scintillation counter ( Radioactivity can be measured using a liquid scintillation counter.
  • a radioactivity measurement device such as a Geiger counter or liquid scintillation counter ( Radioactivity can be measured using a liquid scintillation counter.
  • the RPA amplification product can be obtained and separated by a method such as agarose gel electrophoresis, and the length corresponding to the DNA polymerized by the primer set used, specifically, 230 bp. Listeria monocytogenes can be detected by confirming the presence of DNA.
  • the step (b) may be followed by an additional step of mixing the amplification product with a composition containing a guide RNA, an endonuclease, and a reporter gene.
  • the presence of the Listeria monocytogenes can be confirmed by detecting the fluorescence reaction of the reporter gene according to the gene editing reaction by the guide RNA and endonuclease.
  • composition containing the primer pair and guide RNA provided by the present invention can specifically detect Listeria monocytogenes
  • its use can be used to detect Listeria monocytogenes in biological samples (e.g., saliva, feces, blood, urine, etc.) to be diagnosed. Since monocytogenes can be detected quickly and accurately, diseases caused by Listeria monocytogenes infection, specifically food poisoning and listeriosis, can be diagnosed very quickly and accurately.
  • diagnosis includes determining whether an object currently has a specific disease or disorder, or determining the prognosis of an object suffering from a specific disease or condition.
  • the present invention provides the use of the primer pair of SEQ ID NOs: 1 and 2, guide RNA, and endonuclease to prepare a composition for detecting Listeria monocytogenes .
  • the term “comprising” is used in the same sense as “including” or “characterized by,” and specifically refers to the composition or method according to the present invention. It does not exclude additional components or method steps that have not been used. Additionally, the term “consisting of” means excluding additional elements, steps, or ingredients that are not separately stated.
  • the term “essentially consisting of” means that, in the scope of a composition or method, it may include substances or steps that do not substantially affect its basic characteristics in addition to the described substances or steps.
  • Listeria monocytogenes in a specimen can be quickly detected with very high sensitivity and specificity.
  • Figure 1 is a schematic diagram briefly showing the gRNA selection process for detecting Listeria monocytogenes.
  • Figure 2 is a diagram showing the results of Listeria monocytogenes gene amplification reaction using a combination of RPA primer pairs specific to the target gene of the selected gRNA.
  • Figure 3 is a diagram showing the results of detection of four Listeria monocytogenes serotypes and Listeria innocua using selected gRNA and primer pairs, endonuclease (CRISPR-Cas12a), and reporter genes.
  • Figure 4 is a table listing the types of bacteria used to evaluate detection specificity using selected gRNA and primer pairs, endonuclease (CRISPR-Cas12a), and reporter genes.
  • Figure 5 shows the results of evaluating detection specificity using selected gRNA and primer pairs, endonuclease (CRISPR-Cas12a), and reporter genes.
  • Figure 6 shows the results of evaluating detection sensitivity using one final selected gRNA and primer pair, endonuclease (CRISPR-Cas12a), and reporter gene.
  • Example 1 Primary selection of gRNA for detection of Listeria monocytogenes
  • cpf1 Cas12a
  • TTTN T-rich PAM
  • Listeria monocytogenes ref. Targeting the genome (NC_003210), approximately 80,000 gRNA candidates were found, and among these, Listeria monocytogenes clinical outbreak was narrowed down to approximately 4,000 through filtering that simultaneously covers 4 serotypes of more than 95%, and gRNAs with a serotype matching rate of rank 1 (serotype 3 or A sequence complementary to this was selected ( Figure 1).
  • Example 3 Detection experiment of Listeria monocytogenes using RPA primer, gRNA, and CRISPR-Cas12a
  • Extracts of six types of standard strains shown in FIG. 3 were amplified using the RPA primer pair confirmed to exhibit the best response in Example 2.
  • a reaction was performed using gRNA and CRISPR-Cas12a according to Example 1 above using the amplified amplicon, and detailed reaction conditions are shown in Table 1 below.
  • the mixture dispensed by applying the protocol was measured every minute through an isothermal fluorescence detector at 37°C, and the results are shown in Figure 3.
  • the Listeria monocytogenes detection reaction using the primer pair selected in Example 2 and the gRNA designed in Example 1 was confirmed to have a fast detection rate and a high fluorescence value.
  • the detection reaction using gRNA, RPA primer pair, and CRISPR-Cas12a according to the present invention was confirmed to specifically detect only Listeria monocytogenes .
  • an amplicon for the Listeria monocytogenes standard strain (NCCP 14714) was obtained through PCR using the RPA primer pair, Standard plasmid DNA was produced with the corresponding amplicon ( Figure 6).
  • the completed plasmid DNA was serially diluted at molar concentration and copy level to 1 fM, 500 aM, 100 aM, 10 aM, 1 aM, 10 4 copies, 10 3 copies, 10 2 copies, 10 copies, and 1 copy, respectively.
  • detection sensitivity was evaluated using RPA primer pair, gRNA, and CRISPR-Cas12a, and the results are shown in Figure 6.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 CRISPR-Cas 기반의 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법에 관한 것으로, 보다 상세하게는 등온증폭에 의해 리스테리아 모노사이토제네스를 특이적으로 증폭할 수 있는 프라이머쌍, 가이드 RNA 및 CRISPR-Cas 단백질을 포함하는 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 검출방법에 관한 것이다.

Description

CRISPR-CAS 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법
본 출원은 2022년 10월 14일에 출원된 대한민국 제10-2022-0132701호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 CRISPR-Cas 기반의 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법에 관한 것으로, 보다 상세하게는 등온증폭에 의해 리스테리아 모노사이토제네스를 특이적으로 증폭할 수 있는 프라이머쌍, 가이드 RNA 및 CRISPR-Cas 단백질을 포함하는 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 검출방법에 관한 것이다.
리스테리아증(listeriosis)은 리스테리아 모노사이토제네스(Listeria monocytogenes)에 의한 감염에 의해 야기되는 것으로, 가장 중요한 동물매개 감염질병(zoonotic diseases)의 하나이다. 리스테리아 모노사이토제네스는 인간과 동물 모두에서 뇌염, 낙태, 신생아 패혈증 및 중추신경계 감염의 원인이 된다. 또한, 리스테리아 모노사이토제네스는 일반적으로 토양, 오물, 상한 야채나 낙농제품에서 발견되며, 열에 비교적 저항성이 강하고, 냉장고의 온도에서도 성장할 수 있어 냉장, 저장 식품을 통해 식중독을 발생시킨다.
사람의 경우에는 감염동물과의 접촉이나 오염된 공기의 흡입 등 다른 경로가 간혹 보고된 것도 있지만 오염된 식품의 섭취 후 장관을 통한 감염이 가장 중요한 감염의 통로가 된다. 대부분의 경우에 리스테리아균은 장점막을 통과하는 것으로 감염이 시작되며 위장을 통과하여 일부 사멸되는 과정 중에도 장으로 나가게 되고 장관에 도착했을 때 담즙의 항생제 효과에도 살아남게 되면 장관 점막에 부착하게 되고 안으로 침입할 수 있게 된다.
리스테리아속은 Listeria monocytogenes, Listeria ivanovii, Listeria seeligeri, Listeria innocua, Listeria welshimeri, Listeria grayi, Listeria murrayi의 7개의 종으로 나누어져 있다. 그 중 병원성이 있는 균은 리스테리아 모노사이토제네스(Listeria monocytogenes)와 리스테리아 이바노비(Listeria ivanovii)이다. 리스테리아 모노사이토제네스는 사람과 동물에서 모두 병원성이 있지만, 리스테리아 이바노비는 소와 양 등 발굽이 있는 동물에서만 감염된다고 알려져 있다. 다른 종은 흙이나 부패한 채소 등 부패된 영양분을 필요로 한다.
다양한 기원으로부터 리스테리아 모노사이토제네스를 검출하기 위한 방법으로 표준배양법이 대표적으로 사용되고 있다. 그러나 이 방법은 시간이 많이 소요되며, 동시에 많은 양의 시료를 처리하는데 집약적인 노동력이 필요한 단점이 있다. 또한, 상기 방법은 리스테리아-선택적인 배지에서 리스테리아 종 중 리스테리아 모노사이토제네스만을 구분하기가 어렵다는 단점이 있다.
최근 기존의 표준배양법과 병용하여 유전자 기반의 검출법인 PCR(Polymerase Chain Reaction)법 및 실시간(real-time) PCR법 등이 여러 분야에 응용되고 있다. 이는 균 특이 유전자를 증폭함으로써 원인균을 검출할 수 있는 기법으로 표준배양법과 비교하였을 때 간단하고 신속하게 결과를 판정할 수 있는 장점이 있으나, PCR의 경우 증폭산물을 확인하기 위하여 한천 겔 상에서 전기영동 과정을 거쳐야 하는 번거로움이 있을 뿐만 아니라, 우유 및 식육 등 식품 시료 성분에 의한 유전자 증폭반응의 저해가 우려되기도 한다.
이에, 본 발명자는 전술한 문제를 해결하고 식품 또는 생물학적 시료에서 리스테리아 모노사이토제네스를 매우 신속하고 정확하게 검출할 수 있는 방법을 개발하기 위해 예의 연구를 거듭한 결과, 서열번호 1 및 2의 염기서열로 이루어진 프라이머쌍과, 선택적으로 가이드 RNA 및 CRISPR-Cas 단백질을 이용한 유전자 가위 반응을 통해 매우 높은 민감도와 특이도로 리스테리아 모노사이토제네스를 검출할 수 있음을 발견하고 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 프라이머쌍을 제공하는 것이다.
본 발명의 다른 목적은 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공하는 것이다.
또한, 본 발명의 다른 목적은 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제로 이루어진 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공하는 것이다.
또한, 본 발명의 다른 목적은 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제로 필수적으로 이루어진 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 조성물을 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 키트를 제공하는 것이다.
본 발명의 다른 목적은 하기 단계를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출방법을 제공하는 것이다:
(a) 검체로부터 DNA를 분리하는 단계;
(b) 상기 DNA를 상기 프라이머쌍을 이용하여 증폭하는 단계; 및
(c) 상기 증폭산물을 검출하는 단계.
본 발명의 다른 목적은 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제조하기 위한 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제의 용도를 제공하는 것이다.
그러나, 전술한 바와 같은 본 발명의 과제는 예시적인 것으로, 이에 의해 본 발명의 범위가 제한되는 것은 아니다. 또한, 본 발명의 다른 목적 및 이점은 하기 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
전술한 본 발명의 목적을 달성하기 위하여 본 발명은 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 프라이머쌍을 제공한다.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공한다.
또한, 본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제로 이루어진 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공한다.
또한, 본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제로 필수적으로 이루어진 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공한다.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 조성물을 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 키트를 제공한다.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 하기 단계를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출방법을 제공한다:
(a) 검체로부터 DNA를 분리하는 단계;
(b) 상기 DNA를 상기 프라이머쌍을 이용하여 증폭하는 단계; 및
(c) 상기 증폭산물을 검출하는 단계.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제조하기 위한 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제의 용도를 제공한다.
다른 정의가 없는 한, 본 명세서에 사용된 모든 기술적 및 과학적 용어는 당업자들에 의해 통상적으로 이해되는 동일한 의미를 가진다. 다음의 참고문헌은 본 발명의 명세서에 사용된 여러 용어들의 일반적인 정의를 갖는 기술의 하나를 제공한다; Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOTY (2th ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walkered., 1988); 및 Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY.
이하 본 발명을 상세히 설명한다.
본 발명은 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 프라이머쌍을 제공한다.
[서열번호 1]
TTACTCGTAGCCATTTCAGCGAGCGGCTTAAT
[서열번호 2]
CTTCTTGGCGTCGAGGCATTTATTTCTGGTAT
본 발명에서 용어 "프라이머"는 짧은 자유 3 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 리스테리아 모노사이토제네스 핵산의 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고, 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다.
상기 프라이머쌍은 혈청형 1/2a, 1/2b, 1/2c 및 4b를 포함한 리스테리아 모노사이토제네스의 유전자를 특이적으로 증폭할 수 있다.
상기 증폭은 당업계에서 증폭 대상(유전자 등)을 증폭하기 위하여 이용되는 어떠한 방법에 의해서도 수행될 수 있고, 예를 들어, 재조합-중합효소 증폭법(Recombinase polymerase amplification; RPA)에 의해 수행될 수 있으나, 이에 제한되는 것은 아니다.
상기 증폭산물은 예를 들어, 앰플리콘(amplicon)일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 용어 "재조합효소-중합효소 증폭법(Recombinase Polymerase Amplification; RPA)"은 DNA 및 RNA 증폭을 확인할 수 있는 기술을 의미하며, 기존 PCR 과는 다르게 DNA 결합 단백질과 재조합효소(recombinase)를 이용하여 빠르고 정확하게 타겟 서열(target sequence)을 증폭시킬 수 있는 기술이다. RPA는 기존의 PCR 방법과 유사하나, 일정한 온도에서 온도변화 없이 특정 유전자의 증폭이 가능하기 때문에 반응 시간을 단축할 수 있고, 특수한 장비가 필요치 않아서 검사 단가가 저렴하고, 운반성이 뛰어나 현장검사가 가능할 수 있다는 장점을 가진다. 재조합효소-중합효소 증폭법(Recombinase Polymerase Amplification; RPA)은 박테리오파지 T4 재조합효소를 이용하여 DNA 이중가닥의 해리를 일으키고 동시에 DNA 중합효소와 특정 primer들을 사용하여 특정DNA를 증폭해내는 방법이다. 이는 PCR의 경우와 같이 표적 기질(target template)과 한 쌍의 프라이머(oligonucleotide)를 사용하여 특정 염기서열의 DNA를 증폭시킬 수 있으나, PCR의 경우와 달리 일정 온도(37℃ - 42℃)의 범위에서 등온조건으로 증폭반응을 일으킬 수 있는 장점이 있다. 현재 RPA는 매우 빠르게 증폭산물을 만들 수 있도록 발전되었으며, 이는 등온조건의 장점과 함께 널리 인식되어 특이 유전자 증폭을 통한 특정병원체의 검출법에 다양하게 RPA가 응용되고 있다.
RPA 증폭산물의 길이는 500 nt(nucleotides)를 넘지 않는 것을 권장하고 있으며 일반적으로 100~250 nt. 사이의 증폭산물의 길이를 가진다. RPA의 프라이머 길이는 PCR과는 다르게 최소 30 nucleotides의 길이를 권장하며 일반적으로 32~35 nt. 길이를 주로 사용한다. 또한 PCR처럼 서열 상 GC의 비율(GC%)과 Tm(melting temperature)값에 민감하지 않음으로 RPA의 primer는 GC%(20~70%), Tm(50~100℃)에 수렴하면 된다(Analyst, 2019, 144, 31).
본 발명은 또한 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제공한다.
본 발명에서 상기 가이드 RNA는 crRNA 또는 gRNA 일 수 있다. crRNA는 CRISPR RNA라 불리운다. 또한, gRNA는 가이드 RNA를 지칭한다. crRNA 및 gRNA는 단일 가닥 RNA(single strand RNA) 일 수 있다. 또한, crRNA는 tracrRNA와 결합하여 크리스퍼 연관 단백질을 작동하게 할 수 있으며, crRNA는 tracrRNA와 결합된 형태로 이용될 수 있다. 이때, crRNA는 리스테리아 모노사이토제네스에 특이적으로 존재하는 유전자 서열에 상보적인 서열을 가질 수 있다. 또한, gRNA도 리스테리아 모노사이토제네스에 특이적으로 존재하는 유전자 서열과 결합하여 크리스퍼 연관 단백질이 활성을 나타내게 할 수 있다. 상기 crRNA 또는 gRNA는 15 내지 40개의 핵산으로 구성된 RNA 일 수 있다. 일 구체예로 crRNA 또는 gRNA는 23개의 핵산으로 구성될 수 있다. 또한, crRNA 또는 gRNA는 Cas9, Cas12 또는 Cas13과 같은 크리스퍼 연관 단백질이 활성을 갖게 하기 위해 3'에 추가적인 서열을 포함할 수 있다. 일 실시예로 상기 gRNA는 서열번호 3 또는 이와 상보적인 염기서열로 이루어진 것을 특징으로 할 수 있다.
[서열번호 3]
UUAUAUAGUUCUAGUUUGAUCUUG
본 발명에서 상기 엔도뉴클레아제는 CRISPR 연관 단백질일 수 있다. 본 발명에서 사용된 용어, CRISPR 연관 단백질은 DNA 또는 RNA와 같은 핵산이 이중 가닥 혹은 단일 가닥을 가질 경우(dsDNA/RNA 및 ssDNA/RNA) 이를 인식하여 절단할 수 있는 효소이다. 구체적으로, 이들은 crRNA 또는 gRNA와 결합된 이중가닥 혹은 단일가닥 핵산을 인식하여 이를 절단할 수 있다.
본 발명에서 상기 엔도뉴클레아제의 일 구체예는, gRNA가 표적 부위와 결합된 것을 인식하여 엔도뉴클레아제 기능이 활성화되는 것일 수 있다. 또한, 엔도뉴클레아제 기능이 활성화됨에 따라, 이중가닥 및/또는 단일가닥 DNA 및/또는 RNA를 비특이적 절단할 수 있는 엑소뉴클레아제 활성을 가지는 것일 수 있다. 또한, Cas12a와 같은 크리스퍼 연관 단백질은 일단 활성화되면, 비특이적 엑소뉴클레아제 활성이 나타날 수 있다. 이러한 경우 DNA 및 RNA를 비특이적으로 절단할 수 있다.
따라서, 본 발명의 일 구체예의 조성물은 리스테리아 모노사이토제네스의 특정 표적 부위, 보다 구체적으로는 lmo0161 유전자에 crRNA 또는 gRNA가 결합되고, 이에 의해 활성화되는 비특이적 뉴클레아제에 의해 리포터(Reporter)가 절단됨으로써 리포터에 결합된 형광물질의 발광에 의해 리스테리아 모노사이토제네스가 검출될 수 있다.
구체적으로, 상기 CRISPR 연관 단백질의 일 구체예는 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, CsMT2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3 및 Csf4로 이루어진 군에서 선택되는 어느 하나일 수 있고, 바람직하게는 Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, Cas13a, Cas13b, Cas13c 및 Cas13d로 이루어진 군에서 선택된 어느 하나일 수 있고, 보다 더 바람직하게는 Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h 및 Cas12i로 이루어진 군에서 선택된 어느 하나일 수 있고, 가장 바람직하게는 Cas12a(Cpf1)일 수 있다.
본 발명의 일 양태에서, 상기 조성물은 리포터 유전자 (Reporter gene)를 추가로 포함하는 것을 특징으로 할 수 있다.
본 발명에서 상기 상기 리포터 유전자는 형광물질과 결합되어 있는 것이 바람직하며, 상기 형광물질은 FAM, TET, JOE, YAKYE, HEX, CY3, ATTO550, TAM, ROX, TxRed, CY35, LC610, LC640, ATTO647N, CY5, VIC, evergreen dye 및 ATTO680 로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 양태에서 상기 조성물은 등온 증폭 반응 및 이와 연속되는 크리스퍼 유전자 가위 반응에 의해 리스테리아 모노사이토제네스를 검출하는 방법에 사용되는 것을 특징으로 할 수 있다.
구체적으로, 상기 서열번호 1 및 2의 염기서열로 이루어진 프라이머쌍을 통해 증폭된 증폭산물 내에 표적 부위가 존재한다면 가이드 RNA가 표적부위와 상보적으로 결합하고 엔도뉴클레아제, 바람직하게는 CRISPR 연관 단백질이 활성화되어 리포터 유전자의 서열을 자른다. 그 결과 리포터 유전자에 결합된 형광물질이 발광을 하게 되고 이를 통해 리스테리아 모노사이토제네스를 검출할 수 있다.
본 발명은 또한 상기 조성물을 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 키트를 제공한다.
상기 키트는 리스테리아 모노사이토제네스 검출을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있고, 상기 조성물 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPCwater) 및 멸균수 등을 포함할 수 있다.
본 발명은 또한 하기 단계를 포함하는 리스테리아 모노사이토제네스 검출방법을 제공한다:
(a) 검체로부터 DNA를 분리하는 단계;
(b) 상기 DNA를 상기 프라이머쌍을 이용하여 증폭하는 단계; 및
(c) 상기 증폭산물을 검출하는 단계.
하나의 실시양태에서, 본 발명은 하기 단계를 포함하는 검체의 리스테리아증(listeriosis)을 진단 및 치료하는 방법을 제공한다:
(i) 검체로부터 DNA를 분리하는 단계;
(ii) 상기 DNA를 상기 프라이머쌍을 이용하여 증폭하는 단계;
(iii) 상기 증폭산물을 검출하는 단계;
(iv) 상기 (iii) 단계의 증폭산물이 검출되는 경우 리스테리아증으로 진단하는 단계; 및
(v) 상기 진단된 검체에 리스테리아증을 치료하기 위한 치료 약물을 투여하거나 수술을 통해 상기 질환을 치료하는 단계.
상기 (i) 내지 (v) 단계를 포함하는 방법들은, 전술한 (a) 내지 (d) 단계를 포함하는 방법에 준하여 이해된다.
상기 (v) 단계는 상기 (iv) 단계에서 질환이 진단된 검체에 앰피실린, 젠타마이신, 테트라사이클린 또는 아미노글루코사이드 등의 항생제와 같은 치료 약물 투여, 수술 등의 수단을 통해 상기 질환의 치료를 수행하는 단계이다.
본 발명의 상기 "치료"는 리스테리아증 또는 리스테리아증의 증상을 개선시키는 것을 포괄적으로 지칭하고, 이는 상기 질환을 치유하거나, 실질적으로 예방하거나, 또는 상태를 개선시키는 것을 포함할 수 있으며, 상기 질환으로부터 비롯된 한 가지 증상 또는 대부분의 증상을 완화시키거나, 치유하거나 예방하는 것을 포함하나, 이에 제한되는 것은 아니다.
본 발명에서 상기 "검체"는 시험, 검사, 분석 등에 쓰는 물질이나 생물을 말하는 것으로서 그 종류가 특별히 제한되지 않으나, 리스테리아 모노사이토제네스의 존재 유무가 의심되는 식품 또는 생물학적 시료일 수 있다.
본 발명에서 상기 생물학적 시료는 조직, 세포, 전혈, 혈청, 혈장, 뇌척수액, 초유, 관절액, 타액, 분변, 세포 배양 상등액 등을 포함할 수 있으나, 이에 제한되는 것은 아니다.
검체로부터 DNA를 수득하는 것은 통상의 알려진 DNA 수득 방법을 이용할 수 있다. 출발물질이 gDNA인 경우 gDNA의 분리는 당업계에 공지된 통상의 방법에 따라 실시될 수 있으며, 출발물질이 mRNA인 경우에는 역전사효소를 이용하여 cDNA로 합성될 수도 있다. 예를 들어, 상기 DNA 분리는 통상적으로 시료에서 제노믹 DNA(Genomic DNA, gDNA)를 분리하는 방법이라면 특별히 제한하지 않는다. 예를 들면, 퀴아젠(Qiagen)사의 DNeasy mini kit 등의 상업적으로 판매되는 DNA 분리 키트 등을 이용할 수 있다.
본 발명에서 상기 "증폭"은 PCR, RT-PCR, 등온증폭법으로 이루어진 군에서 선택되는 하나일 수 있으며, 바람직하게는 등온증폭법일 수 있다.
상기 "등온증폭법(Isothermal amplification)"은 일정한 반응온도 조건하에서 목적으로 삼는 핵산배열(주형)을 증폭시키는 방법을 말하는 것으로서, 재조합효소 중합효소 증폭(recombinase polymerase amplification, RPA), 루프 매개 증폭(loop-mediated isothermal amplification, LAMP), 헬리카제-종속 증폭(helicasedependent amplification, HDA), 회전환 증폭(rolling circle amplification, RCA), 다중치환증폭(multiple displacement amplification, MDA), 가닥 치환 증폭(strand displacement amplification, SDA), 핵산 서열-기재 증폭(nucleic acid sequence-based amplification, NASBA) 중 어느 하나일 수 있으며, 바람직하게는 재조합효소 중합효소 증폭(recombinase polymerase amplification, RPA)일 수 있다.
상기 증폭산물의 검출은 모세관 전기영동, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다.
증폭 산물을 검출하는 방법 중의 하나로서, 예를 들어, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다. 또한, RPA 증폭산물을 수득하여 아가로오스 겔 전기영동(agarose gel electrophoresis) 등의 방법으로 분리할 수 있으며, 사용된 프라이머 세트에 의해 중합된 DNA에 해당하는 길이, 구체적으로는 230 bp의 길이를 갖는 DNA의 존재를 확인하여 리스테리아 모노사이토제네스를 검출할 수 있다.
본 발명의 일 양태에서, 상기 (b) 단계 이후에 상기 증폭산물을 가이드 RNA, 엔도뉴클레아제 및 리포터 유전자를 포함하는 조성물과 혼합하는 단계를 추가로 수행하는 것을 특징으로 할 수 있다.
이 경우, 상기 리스테리아 모노사이토제네스는 상기 가이드 RNA 및 엔도뉴클레아제에 의한 유전자 가위 반응에 따라 상기 리포터 유전자의 형광 반응을 검출함으로써 그 존재 여부가 확인될 수 있다.
본 발명이 제공하는 프라이머쌍 및 가이드 RNA를 포함하는 조성물은 리스테리아 모노사이토제네스를 특이적으로 검출할 수 있으므로, 이를 이용하면 진단하고자 하는 생물학적 시료(예컨대, 타액, 분변, 혈액, 소변 등) 내 리스테리아 모노사이토제네스를 신속하고 정확하게 검출할 수 있어, 리스테리아 모노사이토제네스 감염에 의해 유발되는 질환들, 구체적으로는 식중독, 리스테리아증(listeriosis) 등을 매우 빠르고 정확하게 진단할 수 있다.
본 명세서에서 사용하는 용어 "진단"은 한 객체가 특정 질병 또는 질환을 현재 가지고 있는 지 여부를 판정하는 것, 또는 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)를 판정하는 것을 포함한다.
또한, 본 발명은 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제조하기 위한 상기 서열번호 1 및 2의 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제의 용도를 제공한다.
본 명세서에서 용어 “을 포함하는(comprising)”이란 “함유하는(including)” 또는 “특징으로 하는(characterized by)”과 동일한 의미로 사용되며, 본 발명에 따른 조성물 또는 방법에 있어서, 구체적으로 언급되지 않은 추가적인 구성 성분 또는 방법의 단계 등을 배제하지 않는다. 또한 용어 “로 이루어지는(consisting of)”이란 별도로 기재되지 않은 추가적인 요소, 단계 또는 성분 등을 제외하는 것을 의미한다. 용어 “필수적으로 이루어지는(essentially consisting of)”이란 조성물 또는 방법의 범위에 있어서, 기재된 물질 또는 단계와 더불어 이의 기본적인 특성에 실질적으로 영향을 미치지 않는 물질 또는 단계 등을 포함할 수 있는 것을 의미한다.
본 발명이 제공하는 프라이머쌍, 또는 상기 프라이머쌍 및 가이드 RNA를 이용하면 검체 내 리스테리아 모노사이토제네스를 매우 높은 민감도와 특이도로 신속하게 검출할 수 있다.
도 1은 리스테리아 모노사이토제네스 검출을 위한 gRNA 선별 과정을 간략하게 나타낸 모식도이다.
도 2는 선별된 gRNA의 대상 유전자에 특이적인 RPA 프라이머쌍 조합을 이용하여 리스테리아 모노사이토제네스 유전자 증폭반응을 수행한 결과를 나타낸 도면이다.
도 3은 선별된 gRNA 및 프라이머쌍, 그리고 엔도뉴클레아제(CRISPR-Cas12a) 및 리포터 유전자를 이용하여 리스테리아 모노사이토제네스 4개 혈청형 및 리스테리아 이노쿠아를 검출한 결과를 나타낸 도면이다.
도 4는 선별된 gRNA 및 프라이머쌍, 그리고 엔도뉴클레아제(CRISPR-Cas12a) 및 리포터 유전자를 이용하여 검출 특이도를 평가하는데 사용한 균 종류를 나열한 표이다.
도 5는 선별된 gRNA 및 프라이머쌍, 그리고 엔도뉴클레아제(CRISPR-Cas12a) 및 리포터 유전자를 이용하여 검출 특이도를 평가한 결과이다.
도 6은 최종 선발된 1종의 gRNA 및 프라이머쌍, 그리고 엔도뉴클레아제(CRISPR-Cas12a) 및 리포터 유전자를 이용하여 검출 민감도를 평가한 결과이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 이에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1: Listeria monocytogenes 검출을 위한 gRNA 1차 선발
CRISPR 유전자 가위기술을 이용한 진단 분야 연구의 핵심은, 적용 Cas 단백질과 gRNA로서, 본 연구에서는 dsDNA에 활성을 갖는 cpf1(Cas12a)을 선정했고, 해당 protein은 목적 target 내 T-rich PAM(TTTN)을 요구하는 것으로 알려져 있다.
Bioinformatics를 통해, Listeria monocytogenes ref. genome (NC_003210) 대상, 약 80,000개의 gRNA candidates finding 했고 이중, Listeria monocytogenes 임상 outbreak 95% 이상의 4개 serotype을 동시에 cover하는 filtering을 통해 약 4,000개로 좁힌 뒤, serotype matching 율 rank 1의 gRNA(서얼변호 3 또는 이와 상보적인 서열)를 선정하였다(도 1).
실시예 2: RPA 프라이머 디자인
상기 실시예 1에서 선발된 선정된 gRNA 대상, 최적의 RPA primer design 을 위해 forward/reverse 각 5 region, 25조합(도 2)을 선정해 Listeria monocytogenes 표준균주(NCCP 14714) 대상 RPA primer validation을 실행해 반응이 가장 우수한 조합의 프라이머쌍(Forward: 서열번호 1, Reverse: 서열번호 2)을 완성하였다(도 2).
실시예 3: RPA 프라이머, gRNA 및 CRISPR-Cas12a를 이용한 Listeria monocytogenes의 검출 실험
상기 실시예 2에서 가장 우수한 반응을 나타내는 것으로 확인된 RPA 프라이머쌍을 사용해 도 3에 표시된 6종의 표준균주 추출물을 증폭하였다. 증폭된 amplicon을 사용해 상기 실시예 1에 따른 gRNA 및 CRISPR-Cas12a를 적용한 반응을 진행했고, 세부 반응조건은 아래 표 1에 나타내었다. 해당 protocol을 적용하여 분주된 혼합물은 37℃ 등온 형광 검출기를 통해 1분 단위로 측정하였고 이에 대한 결과를 도 3에 나타내었다.
Figure PCTKR2023008318-appb-img-000001
도 3에 나타낸 바와 같이, 상기 실시예 2에서 선발된 프라이머쌍 및 상기 실시예 1에서 디자인한 gRNA를 이용한 Listeria monocytogenes 검출 반응은 검출 속도가 빠르며 높은 형광값을 나타내는 것으로 확인되었다.
실시예 4: RPA 프라이머 및 gRNA의 검출 특이도 평가
상기 실시예 1 및 2에서 제작된 gRNA 및 RPA primer쌍이 Listeria monocytogenes 만을 특이적으로 검출할 수 있는지 검증하기 위해, Listeria monocytogenes 외 36종의 표준균주(도 4)에 대하여 DNA추출을 실시한 후, 상기 실시예 2에서 제작된 RPA 프라이머쌍을 적용해 증폭을 진행한 뒤 상기 실시예 1에서 제작된 gRNA 및 CRISPR-Cas12a를 적용해 표 1의 protocol에 따라 반응 혼합물을 제조한 뒤 37도씨 등온 증폭반응을 수행하여 end-point(60분)에서 형광을 관찰하였다.
도 5에 나타낸 바와 같이, 본 발명에 따른 gRNA, RPA 프라이머쌍 및 CRISPR-Cas12a를 이용한 검출반응은 Listeria monocytogenes만을 특이적으로 검출하는 것으로 확인되었다.
실시예 5: RPA 프라이머 및 gRNA의 검출 민감도 평가
상기 실시예 1 및 2에서 제작된 gRNA 및 RPA primer쌍의 Listeria monocytogenes에 대한 민감도를 검증하기 위해, 상기 RPA 프라이머쌍을 적용한 PCR을 통해 Listeria monocytogenes 표준균주(NCCP 14714)에 대한 amplicon을 확보한 후, 해당 amplicon으로 표준 플라스미드 DNA를 제작하였다(도 6). 제작이 완료된 플라스미드 DNA를 몰농도와 copy 수준으로 각각 1 fM, 500 aM, 100 aM, 10 aM, 1 aM 과 104 copies, 103 copies, 102 copies, 10 copies, 1 copy 로 연속 희석해 각 샘플을 확보한 후 RPA 프라이머쌍, gRNA 및 CRISPR-Cas12a를 이용해 검출 민감도 평가를 진행하였고 이에 대한 결과를 도 6에 나타내었다.
도 6에 나타낸 바와 같이, 1 am(10-18 molar), 1 copy 수준의 높은 감도로 검출이 가능한 것을 확인하였다.
본 발명이 제공하는 프라이머쌍, 또는 상기 프라이머쌍 및 가이드 RNA를 이용하면 검체 내 리스테리아 모노사이토제네스를 매우 높은 민감도와 특이도로 신속하게 검출할 수 있어 산업상 이용가능성이 매우 높다.

Claims (17)

  1. 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머를 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 프라이머쌍.
  2. 제1항에 있어서, 상기 프라이머쌍은 재조합효소-중합효소 증폭(Recombinase polymerase amplification; RPA) 반응용인 것을 특징으로 하는 프라이머쌍.
  3. 제1항에 따른 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물.
  4. 제3항에 있어서, 상기 가이드 RNA는 서열번호 3의 염기서열로 이루어진 것을 특징으로 하는 조성물.
  5. 제3항에 있어서, 상기 엔도뉴클레아제는 CRISPR 연관 단백질인 것을 특징으로 하는 조성물.
  6. 제5항에 있어서, 상기 CRISPR 연관 단백질은 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, CsMT2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3 및 Csf4로 이루어진 군에서 선택되는 것을 특징으로 하는 조성물.
  7. 제3항에 있어서, 상기 조성물은 리포터 유전자 (Reporter gene)를 추가로 포함하는 것을 특징으로 하는 조성물.
  8. 제7항에 있어서, 상기 리포터 유전자는 형광물질과 결합되어 있는 것을 특징으로 하는 조성물.
  9. 제8항에 있어서, 상기 형광물질은 FAM, TET, JOE, YAKYE, HEX, CY3, ATTO550, TAM, ROX, TxRed, CY35, LC610, LC640, ATTO647N, CY5, VIC, evergreen dye 및 ATTO680 로 이루어진 군에서 선택된 하나 이상의 것임을 특징으로 하는 조성물.
  10. 제3항에 있어서, 상기 조성물은 등온 증폭 반응 및 이와 연속되는 크리스퍼 유전자 가위 반응에 의해 리스테리아 모노사이토제네스(Listeria monocytogenes)를 검출하는 것을 특징으로 하는 조성물.
  11. 제3항의 조성물을 포함하는 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 키트.
  12. 하기 단계를 포함하는 리스테리아 모노사이토제네스 검출방법:
    (a) 검체로부터 DNA를 분리하는 단계;
    (b) 상기 DNA를 제1항에 따른 프라이머쌍을 이용하여 증폭하는 단계; 및
    (c) 상기 증폭산물을 검출하는 단계.
  13. 제12항에 있어서, 상기 증폭은 등온증폭인 것을 특징으로 하는 검출방법.
  14. 제13항에 있어서, 상기 등온증폭은 RPA(Recombinase polymerase amplification) 인 것을 특징으로 하는 검출방법.
  15. 제12항에 있어서, 상기 (b) 단계 이후에 상기 증폭산물을 가이드 RNA, 엔도뉴클레아제 및 리포터 유전자를 포함하는 조성물과 혼합하는 단계를 추가로 수행하는 것을 특징으로 하는 검출방법.
  16. 제12항에 있어서, 상기 검체는 식품 또는 생물학적 시료인 것을 특징으로 하는 검출방법.
  17. 리스테리아 모노사이토제네스(Listeria monocytogenes) 검출용 조성물을 제조하기 위한 제1항에 따른 프라이머쌍, 가이드 RNA(guide RNA) 및 엔도뉴클레아제의 용도.
PCT/KR2023/008318 2022-10-14 2023-06-15 Crispr-cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법 WO2024080483A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220132701A KR102576803B1 (ko) 2022-10-14 2022-10-14 CRISPR-Cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법
KR10-2022-0132701 2022-10-14

Publications (1)

Publication Number Publication Date
WO2024080483A1 true WO2024080483A1 (ko) 2024-04-18

Family

ID=88019557

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/008318 WO2024080483A1 (ko) 2022-10-14 2023-06-15 Crispr-cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법

Country Status (2)

Country Link
KR (1) KR102576803B1 (ko)
WO (1) WO2024080483A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117568514A (zh) * 2023-11-29 2024-02-20 南京微测生物科技有限公司 一种基于劣势pam一锅法检测单增李斯特菌的方法及试剂盒

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190140918A (ko) * 2017-03-15 2019-12-20 더 브로드 인스티튜트, 인코퍼레이티드 바이러스 검출을 위한 crispr 이펙터 시스템 기반 진단
KR20200062198A (ko) * 2017-09-09 2020-06-03 더 브로드 인스티튜트, 인코퍼레이티드 다중-이펙터 crispr 기반 진단 시스템
KR20210024009A (ko) * 2018-06-26 2021-03-04 더 브로드 인스티튜트, 인코퍼레이티드 Crispr/cas 및 트랜스포사제 기반 증폭 조성물, 시스템 및 방법
CN113462795A (zh) * 2021-05-31 2021-10-01 浙江大学 一种用于快速检测单核细胞增生李斯特菌的联合检测方法及其系统和应用
JP2022518294A (ja) * 2019-01-29 2022-03-14 ラボラトリー コーポレイション オブ アメリカ ホールディングス 感染性因子を使用するＬｉｓｔｅｒｉａの迅速検出のための方法およびシステム

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190140918A (ko) * 2017-03-15 2019-12-20 더 브로드 인스티튜트, 인코퍼레이티드 바이러스 검출을 위한 crispr 이펙터 시스템 기반 진단
KR20200062198A (ko) * 2017-09-09 2020-06-03 더 브로드 인스티튜트, 인코퍼레이티드 다중-이펙터 crispr 기반 진단 시스템
KR20210024009A (ko) * 2018-06-26 2021-03-04 더 브로드 인스티튜트, 인코퍼레이티드 Crispr/cas 및 트랜스포사제 기반 증폭 조성물, 시스템 및 방법
JP2022518294A (ja) * 2019-01-29 2022-03-14 ラボラトリー コーポレイション オブ アメリカ ホールディングス 感染性因子を使用するＬｉｓｔｅｒｉａの迅速検出のための方法およびシステム
CN113462795A (zh) * 2021-05-31 2021-10-01 浙江大学 一种用于快速检测单核细胞增生李斯特菌的联合检测方法及其系统和应用

Also Published As

Publication number Publication date
KR102576803B1 (ko) 2023-09-12

Similar Documents

Publication Publication Date Title
WO2015126078A1 (ko) 핵산과 신호 프로브의 비대칭 등온증폭을 이용한 핵산의 검출방법
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
WO2024080483A1 (ko) Crispr-cas 기반의 리스테리아 모노사이토제네스 검출용 조성물 및 이를 이용한 리스테리아 모노사이토제네스 검출방법
WO2019151764A1 (ko) 구제역 바이러스 7가지 혈청형 진단용 프라이머 세트 및 이의 용도
Li et al. Differentiation of Helicobacter pylori strains directly from gastric biopsy specimens by PCR-based restriction fragment length polymorphism analysis without culture
EP1012328A2 (en) Dna-sequence-based diagnosis of mastitis from a milk sample
WO2017099445A1 (ko) 어류 에드와드 감염증과 연쇄구균 감염증 원인세균의 판별 및 검출용 유전자 마커, 및 이를 이용한 원인세균의 판별 및 검출 방법
WO2022005255A2 (ko) Pna 프로브를 이용한 코로나바이러스감염증-19을 일으키는 sars-cov-2 및 살베코바이러스의 동시 진단방법 및 진단용 키트
US6355435B1 (en) Methods for detecting and enumerating Campylobacter jejuni in environmental samples and for identifying antibiotic-resistant strains
WO2021162228A1 (ko) Hiv-1 약제 내성 분석을 위한 프라이머 세트, 이를 포함하는 키트, 및 이를 이용한 분석 방법
US20100248238A1 (en) Detection Of Bacteria Belonging to the Genus Campylobacter By Targeting Cytolethal Distending Toxin
WO2019225791A1 (ko) 패혈증-유발 그람 음성균 검출용 mlpa 프로브 및 그 용도
WO2020101194A1 (ko) 카바페넴아제 생성 장내세균 진단을 위한 루프 매개 등온증폭 반응용 프라이머 세트 및 이의 용도
LISBY et al. Search for Mycobacterium paratuberculosis DNA in tissue from patients with sarcoidosis by enzymatic gene amplification
WO2023163458A1 (ko) Crispr-cas 기반의 살모넬라균 검출용 조성물 및 이를 이용한 살모넬라균 검출방법
WO2020171596A1 (ko) 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2018062859A1 (ko) 소형 rna 또는 소형 rna와 연관된 단백질을 탐지하는 방법
KR101299627B1 (ko) 식중독 세균 동시 검출용 프라이머 및 이의 용도
WO2021225424A1 (ko) 코로나바이러스-19 검출용 조성물 및 이의 검출용 키트
WO2021141179A1 (ko) 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법
WO2012002598A1 (ko) 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법
WO2022163967A1 (ko) 라임병 진단용 조성물 및 이를 포함하는 키트
KR100248909B1 (ko) 중합효소 연쇄반응을 이용한 대장균 o157:h7의 다종 유전자 동시검출방법
KR101846952B1 (ko) 리스테리아 모노사이토제니스, 장출혈성 대장균, 가스괴저균의 동시 검출을 위한 프라이머 세트 및 이를 포함하는 중합효소연쇄반응 키트
WO2021201462A1 (ko) 돼지 내인성 레트로 바이러스 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 돼지 내인성 레트로 바이러스 유전자 검출 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23877414

Country of ref document: EP

Kind code of ref document: A1