WO2021251790A1 - 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도 - Google Patents

항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도 Download PDF

Info

Publication number
WO2021251790A1
WO2021251790A1 PCT/KR2021/007325 KR2021007325W WO2021251790A1 WO 2021251790 A1 WO2021251790 A1 WO 2021251790A1 KR 2021007325 W KR2021007325 W KR 2021007325W WO 2021251790 A1 WO2021251790 A1 WO 2021251790A1
Authority
WO
WIPO (PCT)
Prior art keywords
deoxycholic acid
peptide conjugate
peptide
obesity
fat
Prior art date
Application number
PCT/KR2021/007325
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
김선수
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to BR112022025040A priority Critical patent/BR112022025040A2/pt
Priority to CN202180042033.0A priority patent/CN115867321A/zh
Priority to JP2022575916A priority patent/JP7498804B2/ja
Priority to EP21821658.8A priority patent/EP4166162A4/en
Priority to MX2022016048A priority patent/MX2022016048A/es
Publication of WO2021251790A1 publication Critical patent/WO2021251790A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/575—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/63—Steroids; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/06—Preparations for care of the skin for countering cellulitis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/57—Compounds covalently linked to a(n inert) carrier molecule, e.g. conjugates, pro-fragrances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/91—Injection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/92—Oral administration

Definitions

  • the present invention relates to a deoxycholic acid-peptide conjugate having a structure in which deoxycholic acid and a peptide are chemically bonded, and uses thereof.
  • Obesity refers to a state in which adipose tissue is excessively present in the body by accumulating excess energy as body fat when energy consumption cannot be balanced with food intake.
  • Obesity is not only a risk factor for various diseases such as cardiovascular disease and diabetes, but is also recognized as an independent disease. Therefore, partial obesity has a direct impact on health and quality of life, and also causes psychological atrophy and social maladaptation of individuals in terms of aesthetics.
  • the treatment of partial obesity can be largely divided into surgical treatment and non-surgical treatment.
  • Surgical surgery may have side effects such as uneven skin surface and side effects of anesthesia.
  • Non-surgical treatment includes lipolysis needles, ultrasound, high-frequency treatment, drug injection methods such as mesotherapy, massage methods, gas injection methods, and the like.
  • deoxycholic acid is one of the secondary bile acids, which is a metabolic byproduct of intestinal bacteria, and it has been confirmed that it induces an inflammatory action in adipose tissue and kills adipocytes (Rotunda et al., Dermatol Surg 30(7):1001-8). (2004)), has been approved by the FDA and is used as a component of lipolytic injection.
  • deoxycholic acid may cause erythema, edema, bruising, hematoma, and pain at the site of administration as a side effect, and an organic solvent is added to solubilize deoxycholic acid due to its low solubility in water. There is a limit that can cause side effects such as dermatitis and dry skin.
  • the present inventors were studying to develop a method for increasing anti-obesity activity while minimizing the side effects caused by deoxycholic acid, while the novel peptide synthesized by the present inventors was chemically combined with deoxycholic acid. It was confirmed that the oxycholic acid-peptide conjugate has high water solubility and significantly improved anti-obesity activity compared to the use of a single substance, and thus the present invention has been completed.
  • One object of the present invention is to provide a deoxycholic acid-peptide conjugate with improved solubility in water and improved lipogenesis inhibitory activity and lipolytic activity compared to a single substance.
  • Another object of the present invention is to provide a composition for use in inhibiting fat production or promoting fat breakdown.
  • Another object of the present invention is to provide a method for inhibiting lipogenesis or promoting lipolysis.
  • Another object of the present invention is to provide a deoxycholic acid-peptide conjugate for use in inhibiting lipogenesis or promoting lipolysis.
  • Another object of the present invention is to provide a composition for preventing, treating, or improving obesity or obesity-related diseases.
  • Another object of the present invention is to provide a method for preventing or treating obesity or obesity-related diseases.
  • Another object of the present invention is to provide a deoxycholic acid-peptide conjugate for use in the prevention or treatment of obesity or obesity-related diseases.
  • one aspect of the present invention provides a deoxycholic acid-peptide conjugate in which a peptide and deoxycholic acid composed of the amino acid sequence of SEQ ID NO: 1 are combined.
  • Another aspect of the present invention provides a composition for use in inhibiting lipogenesis or accelerating decomposition of fat, comprising a deoxycholic acid-peptide conjugate as an active ingredient.
  • Another aspect of the present invention provides a method for inhibiting lipogenesis or promoting lipolysis, comprising administering the deoxycholic acid-peptide conjugate of claim 1 to a subject.
  • Another aspect of the present invention provides a deoxycholic acid-peptide conjugate for use in inhibiting lipogenesis or promoting lipolysis.
  • Another aspect of the present invention provides a composition for preventing, treating or improving obesity or obesity-related diseases comprising a deoxycholic acid-peptide conjugate as an active ingredient.
  • Another aspect of the present invention provides a method for preventing or treating obesity or obesity-related diseases, comprising administering the deoxycholic acid-peptide conjugate of claim 1 to an individual.
  • Another aspect of the present invention provides a deoxycholic acid-peptide conjugate for use in the prevention or treatment of obesity or obesity-related diseases.
  • the deoxycholic acid-peptide conjugate according to the present invention inhibits the production and accumulation of lipids in adipocytes and has an effect of decomposing fat, and thus can be used for preventing, improving or treating obesity.
  • Figure 2 is a photograph showing the result of confirming the solubility of deoxycholic acid and deoxycholic acid-peptide conjugate in water.
  • 3A is a view showing the results of confirming the effect of inhibiting the differentiation of adipocytes and the accumulation of intracellular fat due to the deoxycholic acid-peptide conjugate through intracellular fat staining.
  • Figure 3b is a diagram showing the result of confirming the increased fat accumulation inhibitory effect of the deoxycholic acid-peptide conjugate through intracellular fat staining.
  • Figure 4a is a view showing the result of confirming the effect of promoting intracellular lipolysis due to the deoxycholic acid-peptide conjugate by the amount of glycerol released from adipocytes.
  • Figure 4b is a view showing the result of confirming the effect of promoting intracellular lipolysis due to the deoxycholic acid-peptide conjugate by reducing the size of adipocytes in adipose tissue.
  • Figure 4c is a view showing the result of confirming the increased lipolytic effect of the deoxycholic acid-peptide conjugate by the amount of glycerol released in adipocytes.
  • 5 is a view showing the result confirming that the expression of adiponectin and leptin genes related to intracellular fat metabolism is increased due to the deoxycholic acid-peptide conjugate.
  • Figure 6a is a diagram showing the result of confirming that the expression of AMPKa1, HSL, and PGCLa, which are lipolysis-related cell signaling pathway genes, increased due to the deoxycholic acid-peptide conjugate in adipocytes.
  • Figure 6b is a view showing the result of confirming that the expression of HSL and PLIN, which are genes of lipolysis-related cell signaling pathways, due to the deoxycholic acid-peptide conjugate in adipose tissue.
  • ACC ⁇ , FAS and PPAR ⁇ are genes related to adipogenesis-related cell signaling pathways, decreased due to the deoxycholic acid-peptide conjugate in adipose tissue.
  • UCP1, PRDM and Cidea which are thermogenesis genes of brown adipocytes, are increased in adipose tissue.
  • 9 is a view showing the result of confirming that the expression of IL-15 gene related to the inhibition of lipid accumulation in muscle cells is increased.
  • One aspect of the present invention provides a peptide comprising the amino acid sequence of SEQ ID NO: 1 and an active substance in which an active substance is bound to the peptide-peptide conjugate.
  • the synthesis of the peptide of the present invention can be performed, for example, using a device or using a genetic engineering technique.
  • the desired peptide can be synthesized by the Fmoc solid-phase method in an automatic peptide synthesizer.
  • the peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention was synthesized and identified using the Fmoc solid-phase method, and was selected by verifying the efficacy of the identified peptide.
  • peptides having anti-obesity activity were selected through validation of the adipogenesis inhibitory effect and the lipolytic effect.
  • the active substance-peptide conjugate of the present invention can be prepared by combining the peptide selected through the above process and the active substance.
  • the active substance was selected by verifying the efficacy of the active substance-peptide conjugates prepared by chemically binding the peptide.
  • the term 'peptide' refers to a linear molecule consisting of amino acid residues, and specifically, the peptide of the present invention may include the amino acid sequence shown in SEQ ID NO: 1.
  • the 'peptide' may be variants or fragments of amino acids having different sequences by deletion, insertion, substitution, or a combination of amino acid residues within the range that does not affect the function.
  • Amino acid exchanges that do not entirely alter the activity of the peptide are known in the art. In some cases, it may be transformed into phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like. Accordingly, the present invention includes a peptide having an amino acid sequence substantially identical to the peptide comprising the amino acid sequence of SEQ ID NO: 1, and a variant or active fragment thereof.
  • the substantially identical protein is 75% or more, preferably 80% or more, such as 85% or more, 90% or more, 95% or more, 98% or more, or 99% or more sequence homology to the amino acid sequence of SEQ ID NO: 1 It means an amino acid sequence having a
  • the peptide of the present invention may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence prepared for a specific purpose to increase the half-life or peptide stability.
  • a protecting group may be attached to the -terminus or C-terminus.
  • the protecting group may be an acetyl group, a fluorenyl methoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, or polyethylene glycol (PEG). If there is an ingredient, it may be included without limitation.
  • the 'stability' is used to include not only stability in vivo , which protects the peptide of the present invention from attack by in vivo protein cleaving enzymes, but also storage stability (eg, storage stability at room temperature).
  • the 'active substance' may be bile acid, specifically cholic acid, 5 ⁇ -cholanic acid, chenodeoxycholic acid, glycocholic acid, tau A bile acid selected from the group including taurocholic acid, deoxycholic acid, lithocholic acid, 7-oxo-lithocholic acid, and the like can be preferably used.
  • the active material may be deoxycholic acid.
  • the 'deoxycholic acid' of the present invention is a compound having an IUPAC name of 3,12-dihydroxycholan-24-oic acid and a molecular weight of 392.58. In general, it is a type of bile acid that breaks down fat, destroys fat cells, and is used in injections for improving submandibular fat.
  • the structure of deoxycholic acid is as shown in Formula 1 below.
  • the active substance in the active substance-peptide conjugate of the present invention is deoxycholic acid
  • the peptide bound to deoxycholic acid was named 'deoxycholic acid-peptide conjugate (DA-peptide conjugate)'.
  • the present invention provides a deoxycholic acid-peptide conjugate in which deoxycholic acid is bound to a peptide consisting of the amino acid sequence of SEQ ID NO: 1.
  • the deoxycholic acid may bind to the N-terminus, C-terminus or the side chain of the peptide. Specifically, the carboxyl group of deoxycholic acid may form a peptide bond with the N-terminus of the peptide.
  • deoxycholic acid-peptide conjugate may be represented by the following formula (2).
  • the deoxycholic acid-peptide conjugate is administered into adipocytes and adipose tissue to inhibit the signal transduction pathway of adipogenesis, thereby inhibiting the production and accumulation of fat, thereby preventing, improving or treating obesity.
  • the deoxycholic acid-peptide conjugate of the present invention activates a signal transduction pathway for lipolysis, promotes the breakdown of fat in adipocytes and adipose tissue, and reduces the size of adipocytes, thereby preventing, improving or treating obesity. .
  • the deoxycholic acid-peptide conjugate of the present invention has high solubility in water, and has a significantly improved fat accumulation inhibitory effect and lipolysis effect compared to deoxycholic acid or peptide alone, so that the amount of deoxycholic acid can be lowered. It is possible to prevent the side effects caused by the high-dose use of deoxycholic acid.
  • the deoxycholic acid-peptide conjugate having the above activity can be used as an active ingredient in a composition for preventing, treating, or improving obesity or obesity-related diseases.
  • compositions for preventing, treating or improving obesity or obesity-related diseases comprising a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are bonded do.
  • compositions for inhibiting lipogenesis or promoting lipolysis comprising a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are bound.
  • the present invention provides a method for inhibiting lipogenesis or promoting lipolysis, comprising administering to an individual a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are combined.
  • the present invention provides a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are combined for use in suppressing adipogenesis or promoting lipolysis.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating obesity or obesity-related diseases, comprising a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are bonded. .
  • the present invention provides a method for preventing or treating obesity or obesity-related diseases, comprising administering to an individual a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are combined. .
  • the present invention provides a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are combined for use in the prevention or treatment of obesity or obesity-related diseases.
  • 'obesity' refers to a condition or disease in which body fat is excessively accumulated in the body due to energy imbalance, and the deoxycholic acid-peptide conjugate of the present invention contains a fat oxidation promoting gene and the genes not only significantly increases the expression of the protein encoded by By getting out of the state with, it is possible to prevent or treat the obesity.
  • 'prevention or treatment of obesity' may mean reducing the deposition of fat, and the 'precipitation of fat' is, for example, obesity, fat redistribution syndrome, lower eyelid fat hernia, lipoma, Dercum's disease, lipodystrophy, It may refer to a condition selected from the group consisting of visceral hyperlipidemia, breast enlargement, severe obesity, diffuse body fat around the flanks and arms, and fat deposition associated with cellulite.
  • the 'obesity-related disease' is a disease that can be caused by a state of having excessive body fat due to energy imbalance, and prevents, alleviates, or reduces symptoms resulting from the obesity-related disease through the prevention or treatment of obesity can be improved
  • the obesity-related diseases include hypertension, diabetes, increased plasma insulin concentration, insulin resistance, hyperlipidemia, metabolic syndrome, insulin resistance syndrome, obesity-related gastroesophageal reflux, arteriosclerosis, hypercholesterolemia, hyperuric acidemia, lower back pain , cardiac hypertrophy and left ventricular hypertrophy, lipodystrophy, nonalcoholic steatohepatitis, cardiovascular disease, polycystic ovary syndrome, and the like.
  • the composition for preventing or treating obesity or obesity-related diseases of the present invention is an oral formulation such as powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, external preparation, suppository, and sterile injection, respectively, according to a conventional method. It may be formulated and used in the form of a solution, and may include suitable carriers, excipients or diluents commonly used in the preparation of pharmaceutical compositions for formulation.
  • the pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl, which are commonly used in formulation. pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.
  • the pharmaceutical composition may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components.
  • the pharmaceutical composition may be administered orally or parenterally (eg, intramuscularly, intravenously, intraperitoneally, subcutaneously, intradermally, or locally applied) according to a desired method, and the dosage may vary depending on the patient's condition and although it varies depending on body weight, disease severity, drug form, administration route and time, it may be appropriately selected by those skilled in the art.
  • parenterally eg, intramuscularly, intravenously, intraperitoneally, subcutaneously, intradermally, or locally applied
  • the pharmaceutical composition of the present invention when used as an injection preparation, it can be used for removing localized fat deposits.
  • the localized fat may be localized to a target site selected from the group consisting of abdomen, under the eyes, under the chin, under the arms, buttocks, thighs, calves, back, thighs, and bra lines.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • a 'pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, and drug activity of the patient; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.
  • the pharmaceutical composition may be administered as an individual therapeutic agent or may be administered in combination with other anti-obesity agents, and may be administered simultaneously, separately, or sequentially with the conventional therapeutic agent, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the effective amount of the pharmaceutical composition may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient into the body, inactivation rate, excretion rate, disease type, and drugs used in combination, the route of administration, the severity of obesity, It may be increased or decreased according to gender, weight, age, etc., for example, the pharmaceutical composition may be administered per 1 kg of the patient's body weight per day, about 0.0001 ⁇ g to 500mg, preferably 0.01 ⁇ g to 100mg.
  • the deoxycholic acid-peptide conjugate of the present invention when administered to adipocytes or adipose tissue, the fat accumulation inhibitory effect and the lipolytic effect are significantly increased compared to the case where deoxycholic acid or the peptide is administered alone. confirmed to be. Therefore, when the deoxycholic acid-peptide conjugate is used, it is possible to achieve a reduction in the amount of use due to a synergistic effect, and through this, safety can be secured using a minimum amount of deoxycholic acid, and the side effects caused by deoxycholic acid can be minimized.
  • the 'subject' may be an individual requiring administration of the deoxycholic acid-peptide conjugate of the present application, and the individual requiring the administration is diagnosed with obesity or obesity-related disease It may include individuals who have received, obesity or obesity-related symptoms, as well as individuals wishing to administer the disease or symptom to prevent or improve health.
  • the 'administration' means providing a predetermined substance to the patient by any suitable method, and the route of administration of the deoxycholic acid-peptide conjugate of the present invention is oral or through any general route as long as it can reach the target tissue. It may be administered parenterally. In addition, the deoxycholic acid-peptide conjugate may be administered by any device capable of transporting the active substance to a target cell.
  • the present invention provides a quasi-drug composition for preventing or improving obesity, comprising a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are bonded.
  • the deoxycholic acid-peptide conjugate may be added as it is or used together with other quasi-drug ingredients, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the quasi-drug composition of the present invention may be a disinfectant cleaner, toothpaste, shower foam, Gagreen, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment or filter filler.
  • the present invention provides a cosmetic composition for preventing or improving obesity, comprising a deoxycholic acid-peptide conjugate in which a peptide comprising the amino acid sequence of SEQ ID NO: 1 and deoxycholic acid are bonded.
  • the cosmetic composition may be prepared in any formulation conventionally prepared in the art, for example, a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, It may be formulated as oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto.
  • the cosmetic composition is a flexible lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair conditioner , hair conditioner, hairspray, hair aerosol, pomade, solution such as gel, sol gel, emulsion, oil, wax, aerosol, etc. may be prepared in various forms, but is not limited thereto.
  • the cosmetic composition of the present invention may include other additives such as excipients and carriers in addition to the pentapeptide composed of the amino acid sequence of KFLIK, and it is possible to apply and blend as many common ingredients as necessary in general skin cosmetics.
  • the dosage form of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or oxidation as a carrier component Zinc or the like may be used.
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon , propellants such as propane/butane or dimethyl ether, but are not limited thereto.
  • a solvent, solubilizer or emulsifier may be used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl Benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used.
  • a liquid diluent such as water, ethanol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethyl sorbitol ester, polyoxyethylene sorbitan ester, etc. , microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.
  • the formulation of the cosmetic composition is surfactant-containing cleansing
  • Amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative or ethoxylated glycerol fatty acid ester, etc. can be used.
  • the Trolox-peptide conjugate of the present invention may be mixed with base ingredients such as thickeners, surfactants, viscosity modifiers, moisturizers, pH adjusters, preservatives, essential oils, etc. have.
  • CDE may be used as the thickener
  • LES as an anionic surfactant
  • coco betaine as an amphoteric surfactant
  • Poly Quarter may be used as the viscosity modifier
  • the moisturizer may include Glycerin may be used
  • citric acid and sodium hydroxide may be used as the pH adjusting agent.
  • Grapefruit extract and the like may be used as the preservative, and in addition, essential oils such as cedarwood, peppermint, and rosemary, silk amino acids, pentaol, or vitamin E may be added.
  • the ingredients included in the cosmetic composition include, as active ingredients, ingredients commonly used in cosmetic compositions, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and It may further include conventional adjuvants such as perfume, but is not limited thereto.
  • the deoxycholic acid-peptide conjugate of the present invention inhibits the differentiation of preadipocytes into adipocytes, suppresses the accumulation of lipids in adipocytes, and promotes the breakdown of fat, thereby preventing obesity or obesity-related diseases. It can be used as a raw material for a pharmaceutical or cosmetic composition for the purpose of preventing, improving or treating.
  • the peptide of the present invention was synthesized by a known method, and the amino acid sequence of the novel peptide used in the present invention is 'Lys Phe Leu Ile Lys (SEQ ID NO: 1)', and a peptide containing the amino acid sequence of SEQ ID NO: 1 by a molecular weight measuring instrument As a result of measuring the molecular weight of , it was confirmed that the molecular weight corresponds to 647.4 Da.
  • the deoxycholic acid-peptide resin was filtered, washed, and dried in a vacuum oven. Then, 20 L of diethyl ether was added for crystallization, followed by filtration and separation and purification to prepare a deoxycholic acid-peptide conjugate.
  • 3T3-L1 cells which are preadipocytes, were purchased from the American Cell Line Bank (ATCC) and used in the experiment.
  • 3T3-L1 is a cell line widely used to study the metabolic process of adipocytes, and the more the cells are differentiated, the more active the accumulation of fat in adipocytes leads to obesity. Therefore, when the cell is treated with a substance thought to have an anti-obesity effect, it can be seen that the less the cell differentiation, the greater the anti-obesity effect.
  • Preadipocytes 3T3-L1 were cultured in DMEM containing 2% fetal bovine serum (FBS) at 37° C. and 5% CO 2 conditions.
  • 3T3-L1 preadipocytes were seeded in a 12-well plate at a density of 1 X 10 5 cells/well, and then maintained for 2 more days when 100% confluency reached.
  • Preadipocytes were cultured for 2 days in DMEM medium (hereinafter referred to as 'differentiation medium') containing differentiation components (including 10 ⁇ g/ml insulin, 0.1 ⁇ M dexamethasone and 0.5 mM IBMX) and 10% FBS. Differentiation of the prisoners was induced.
  • DMEM medium hereinafter referred to as 'differentiation medium'
  • differentiation components including 10 ⁇ g/ml insulin, 0.1 ⁇ M dexamethasone and 0.5 mM IBMX
  • 'culture medium' 10% FBS DMEM containing 1 ug/ml insulin
  • 'culture medium' 10% FBS DMEM containing 1 ug/ml insulin
  • the culture medium was replaced with 10% FBS DMEM every 2 days.
  • deoxycholic acid-peptide conjugate at a concentration of 1 ⁇ M and 10 ⁇ M depending on the purpose of the experiment, and the degree of adipocyte differentiation was observed on the 7th day, when the differentiation was completed without treatment. did.
  • Adipose tissue was collected from the abdomen of 9-week-old BL/6 mice, placed in a 100 mm X 15 mm culture dish, and cultured overnight in a culture medium. The adipose tissue was divided to have the same weight and transferred to a 24-well plate, and then used in the following experimental examples.
  • the deoxycholic acid-peptide conjugate of the present invention has improved water solubility compared to the case in which deoxycholic acid is present alone by binding the peptide to deoxycholic acid.
  • Oil Red O staining was performed to confirm that the deoxycholic acid-peptide conjugate of the present invention has the effect of inhibiting the accumulation of fat in adipocytes.
  • the degree of differentiation of adipocytes induced in Preparation Example 1 was first confirmed through a microscope through Oil Red O staining, and the degree of adipocyte staining was measured by measuring absorbance with a spectrophotometer at a wavelength of 510 nm to accumulate in cells. The amount of fat was calculated.
  • deoxycholic acid-peptide conjugate can inhibit lipid accumulation in adipocytes by inhibiting adipocyte differentiation and adipogenesis.
  • Triglycerides stored in adipose tissue are decomposed into fatty acids and glycerol for energy production or cell signaling. Therefore, the decomposition effect of triglycerides accumulated in adipose tissue was confirmed by measuring the release amount of free glycerol.
  • white adipose tissue Fat pad
  • a high-fat diet Rost Diet with 60% Kcal Fat, Research Diets, USA
  • 400 mg of adipose tissue per well was placed in a 12-well plate, followed by a culture medium ( It was stabilized by culturing in DMEM media (serum free) for 48 hours.
  • peptide conjugates were treated at concentrations of 1 ⁇ M, 10 ⁇ M, and 100 ⁇ M, and TNF ⁇ as a positive control was treated with 20 nM, and after culturing for 48 hours, the supernatant was obtained and a glycerol colorimetric assay kit (Cayman chemical, USA) was used to measure the amount of glycerol.
  • the deoxycholic acid-peptide conjugate of the present invention has an activity of decomposing triglycerides accumulated in adipose tissue.
  • H&E staining was performed on the adipose tissue obtained in Preparation Example 2 to confirm the size of adipocytes.
  • adipose tissue was cut, attached to a paraffin slide, and dried at 50°C.
  • the dried adipose tissue-attached slides were placed in xylene 1, 2, and 3 for 5 minutes each, and paraffin was removed. Then, it was put in 100% ethanol for 2 minutes, and then sequentially put in 90%, 80% and 70% ethanol for re-hydration.
  • the rehydrated slides were stained with hematoxylin solution, washed, and then stained with eosin Y. After that, they were sequentially put in 90%, 80%, and 70% ethanol, and then put in xylene 3, 2, and 1, and then sealed with a xylene-based mounting medium to prevent air bubbles from entering the tissue. It was dried after mounting. Thereafter, the dried slides were observed under an optical microscope.
  • DNA complementary to RNA was obtained using TOPScriptTM RT DryMIX (enzynomics, Korea), and then polymerase chian reaction (PCR) was performed using TOPsimpleTM DryMIX-nTaq (enzynomics, Korea). did Then, the PCR product was loaded on a 1.5% agarose gel to compare the mRNA expression levels of the growth factors.
  • the GAPDH gene was used as an internal control, and the primers used in the experiment are described in [Table 1].
  • adipocytes obtained in Preparation Example 1 were treated with the deoxycholic acid-peptide conjugate of the present invention at 1 uM and 10 uM, and cultured for 1 hour, 3 hours, and 6 hours. After recovering the cells and performing a polymerase chain reaction in the method described in Experimental Example 4-1, the expression product was loaded on an agarose gel to confirm the mRNA expression level of fat metabolism-related genes.
  • the deoxycholic acid-peptide conjugate of the present invention has the effect of inhibiting the accumulation of fat or promoting the decomposition of fat by promoting the metabolism of fat required for energy generation.
  • adipocytes in order to determine whether the deoxycholic acid-peptide conjugate has an active effect on the lipolysis promoting cell signaling pathway, mRNA expression level of genes related to fatty acid oxidation promotion and lipolysis promotion was confirmed.
  • the differentiated adipocytes obtained in Preparation Example 1 were treated with the deoxycholic acid-peptide conjugate at concentrations of 1 ⁇ M and 10 ⁇ M, and then cultured for 24 hours. After recovering the cells and performing the polymerase chain reaction in the method described in Experimental Example 4-1, the expression product was loaded on an agarose gel to confirm the mRNA expression level of the lipolysis promoting cell signaling pathway related genes.
  • the deoxycholic acid-peptide conjugate according to the present invention increases the expression of genes related to the decomposition of fat or the promotion of oxidation of fatty acids so as to decompose fat very effectively.
  • the adipose tissue obtained in Preparation Example 2 was treated with 1 ⁇ M, 10 ⁇ M of deoxycholic acid-peptide conjugate and 1 ⁇ M of CL316243 (Sigma, USA), a positive control, and cultured for 72 hours. After recovering the cells and performing the polymerase chain reaction in the method described in Experimental Example 4-1, the expression product was loaded on an agarose gel to determine the mRNA expression level of genes related to the promotion of fatty acid oxidation and lipolysis. Confirmed.
  • the deoxycholic acid-peptide conjugate according to the present invention increases the expression of genes related to the decomposition of fat or the promotion of oxidation of fatty acids so as to decompose fat very effectively.
  • adipose tissue in order to confirm whether the deoxycholic acid-peptide conjugate has an effect of inhibiting adipogenesis, the mRNA expression level of genes related to adipogenesis was checked.
  • the adipose tissue obtained in Preparation Example 2 was treated with 1 ⁇ M, 10 ⁇ M of deoxycholic acid-peptide conjugate, and 1 ⁇ M of CL 316,243 (Sigma, USA) as a positive control, and further cultured for 72 hours. After recovering the cells and performing a polymerase chain reaction in the method described in Experimental Example 4-1, the expression product was loaded on an agarose gel to check the mRNA expression level of genes related to adipogenesis.
  • the deoxycholic acid-peptide conjugate according to the present invention has an effect of preventing or treating obesity by inhibiting lipogenesis.
  • the deoxycholic acid-peptide conjugate of the present invention has the effect of preventing or treating obesity, the mRNA expression level of genes related to thermogenesis of brown adipocytes was checked.
  • the adipose tissue obtained in Preparation Example 2 was treated with 1 ⁇ M, 10 ⁇ M of deoxycholic acid-peptide conjugate, and 1 ⁇ M of CL 316,243 (Sigma, USA) as a positive control, and further cultured for 72 hours.
  • the expression product was loaded on an agarose gel to check the mRNA expression level of genes related to adipogenesis.
  • GAPDH was used as an internal control, and the primers used in the experiment are described in [Table 2] below.
  • IL-15 is a myokine whose expression level is increased by muscle axis during resistance exercise and is known to play a key role in the interaction between muscle and adipose tissue, and exhibits anti-obesity effects by inhibiting lipid accumulation.
  • mouse source cells C2C12 cells
  • DMEM fetal bovine serum
  • DMEM fetal bovine serum
  • the deoxycholic acid-peptide conjugate according to the present invention has an effect of preventing or treating obesity by increasing the expression of the IL-15 gene having a lipolytic function and increased expression by exercise.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Birds (AREA)
  • Dermatology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Botany (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Steroid Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Cosmetics (AREA)

Abstract

본 발명은 지질 생성을 억제하고, 지방 분해를 촉진함으로써 항비만 활성을 갖는 디옥시콜산-펩타이드 결합체와 상기 결합체를 유효성분으로 포함하는 비만의 예방, 개선 또는 치료 용도에 관한 것이다.

Description

항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도
본 발명은 디옥시콜산(Deoxycholic acid)과 펩타이드가 화학적으로 결합된 구조를 갖는 디옥시콜산-펩타이드 결합체 및 이의 용도에 관한 것이다.
비만은 음식물로 섭취한 에너지 소비와 균형을 이루지 못하는 경우, 잉여의 에너지가 체지방으로 축적됨으로써 체내에 지방 조직이 과다하게 존재하는 상태를 의미한다. 비만은 심혈관 질환, 당뇨병 등 각종 질환의 위험 인자일 뿐만 아니라, 하나의 독립된 질병으로 인식되고 있는데 복부 등의 특정 부위에 과도하게 지방이 침착된 부분비만 역시 이들 질환과 밀접한 관계가 있다. 따라서 부분비만은 건강과 삶의 질에 직접적인 영향을 주고, 미용적 측면에서도 개인의 심리적 위축과 사회적 부적응을 초래한다.
이러한 부분비만의 치료는 크게 수술적 치료와 비수술적 치료로 나눌 수 있는데, 외과적 수술은 피부 표면의 불균일, 마취 부작용 등의 부작용이 나타날 수 있다. 비수술적 치료는 지방분해침, 초음파, 고주파 치료, 메조테라피와 같은 약물 주입 방식, 마사지 방식, 가스 주입 방식 등이 다양하게 사용되고 있다.
한편, 디옥시콜산은 장내 박테리아의 대사 부산물인 2차 담즙산 중 하나로, 지방조직에 염증 작용을 유발시켜 지방세포를 사멸시키는 것으로 확인되었고(Rotunda et al., Dermatol Surg 30(7):1001-8(2004)), FDA 승인을 받아 지방용해 주사의 성분으로 사용되고 있다. 그러나, 디옥시콜산은 국소투여시 부작용으로 투여부위에 홍반, 부종, 멍, 혈종, 고통을 동반할 수 있고, 물에 대한 용해도가 낮아 데옥시콜산을 가용화하기 위해 유기 용매를 첨가하고 있으나, 이는 피부염과 피부건조와 같은 부작용을 유발할 수 있는 한계가 있다.
이러한 배경 하에서 본 발명자들은 디옥시콜산에 의한 부작용을 최소화하면서 항비만 활성을 높일 수 있는 방법을 개발하기 위해 연구하던 중, 본 발명자들에 의해 합성된 신규 펩타이드와 디옥시콜산이 화학적으로 결합된 디옥시콜산-펩타이드 결합체가 물에 대한 용해도가 높고, 단독 물질 사용 대비 현저하게 향상된 항비만 활성을 가짐을 확인하고 본 발명을 완성하였다.
본 발명의 일 목적은 물에 대한 용해도가 향상되고, 단독 물질 대비 지방 생성 억제 활성 및 지방 분해 활성이 향상된 디옥시콜산-펩타이드 결합체를 제공하는 것이다.
본 발명의 다른 일 목적은 지방 생성의 억제 또는 지방의 분해를 촉진하기 위한 용도의 조성물을 제공하는 것이다.
본 발명의 또 다른 일 목적은 지방 생성 억제 또는 지방 분해 촉진 방법을 제공하는 것이다.
본 발명의 또 다른 일 목적은 지방 생성 억제 또는 지방 분해 촉진에 사용하기 위한 디옥시콜산-펩타이드 결합체를 제공하는 것이다.
본 발명의 또 다른 일 목적은 비만 또는 비만 관련 질환의 예방, 치료, 또는 개선용 조성물을 제공하는 것이다.
본 발명의 또 다른 일 목적은 비만 또는 비만 관련 질환의 예방 또는 치료 방법을 제공한다.
본 발명의 또 다른 일 목적은 비만 또는 비만 관련 질환의 예방 또는 치료에 사용하기 위한 디옥시콜산-펩타이드 결합체를 제공하는 것이다.
이를 위하여, 본 발명의 일 측면은 서열번호 1의 아미노산 서열로 구성된 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 제공한다.
본 발명의 다른 측면은 디옥시콜산-펩타이드 결합체를 유효성분으로 포함하는 지방 생성의 억제 또는 지방의 분해를 촉진하기 위한 용도의 조성물을 제공한다.
본 발명의 또 다른 측면은 개체에 청구항 1의 디옥시콜산-펩타이드 결합체를 투여하는 단계를 포함하는 지방 생성 억제 또는 지방 분해 촉진 방법을 제공한다.
본 발명의 또 다른 측면은 지방 생성 억제 또는 지방 분해 촉진에 사용하기 위한 디옥시콜산-펩타이드 결합체를 제공한다.
본 발명의 또 다른 측면은 디옥시콜산-펩타이드 결합체를 유효성분으로 포함하는 비만 또는 비만 관련 질환의 예방, 치료 또는 개선용 조성물을 제공한다.
본 발명의 또 다른 측면은 개체에 청구항 1의 디옥시콜산-펩타이드 결합체를 투여하는 단계를 포함하는 비만 또는 비만 관련 질환의 예방 또는 치료 방법을 제공한다.
본 발명의 또 다른 측면은 비만 또는 비만 관련 질환의 예방 또는 치료에 사용하기 위한 디옥시콜산-펩타이드 결합체를 제공한다.
본 발명에 따른 디옥시콜산-펩타이드 결합체는 지방세포에서 지질의 생성 및 축적을 억제하고, 지방을 분해하는 효과를 가지는 바, 비만을 예방, 개선 또는 치료하는 용도로 사용될 수 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 본 발명의 서열번호 1의 펩타이드와 디옥시콜산의 결합체에 대한 NMR 분석 데이터를 나타낸 것이다.
도 2는 디옥시콜산과 디옥시콜산-펩타이드 결합체의 물에 대한 용해도를 확인한 결과를 나타내는 사진이다.
도 3a는 디옥시콜산-펩타이드 결합체로 인해 지방세포의 분화 및 세포 내 지방 축적이 억제된 효과를 세포 내 지방 염색을 통해 확인한 결과를 나타내는 도면이다.
도 3b는 디옥시콜산-펩타이드 결합체의 상승된 지방 축적 억제 효과를 세포 내 지방 염색을 통해 확인한 결과를 나타내는 도면이다.
도 4a는 디옥시콜산-펩타이드 결합체로 인해 세포 내 지방 분해가 촉진된 효과를 지방세포 내에서 유리된 글리세롤 방출량으로 확인한 결과를 나타내는 도면이다.
도 4b는 디옥시콜산-펩타이드 결합체로 인해 세포 내 지방 분해가 촉진된 효과를 지방조직 내에서 지방세포의 크기 감소로 확인한 결과를 나타내는 도면이다.
도 4c는 디옥시콜산-펩타이드 결합체의 상승된 지방 분해 효과를 지방세포 내에서 유리된 글리세롤 방출량으로 확인한 결과를 나타내는 도면이다.
도 5는 디옥시콜산-펩타이드 결합체로 인해 세포 내 지방 대사와 관련된 아디포넥틴 및 렙틴 유전자의 발현이 증가되었음을 확인한 결과를 나타낸 도면이다.
도 6a는 지방세포에서 디옥시콜산-펩타이드 결합체로 인해 지방 분해 관련 세포신호전달 경로 유전자인 AMPKa1, HSL 및 PGCLa의 발현이 증가되었음을 확인한 결과를 나타내는 도면이다.
도 6b는 지방조직에서 디옥시콜산-펩타이드 결합체로 인해 지방 분해 관련 세포신호전달 경로 유전자인 HSL 및 PLIN의 발현이 증가되었음을 확인한 결과를 나타내는 도면이다.
도 7은 지방조직에서 디옥시콜산-펩타이드 결합체로 인해 지방 생성 관련 세포신호전달 경로 유전자인 ACCα, FAS 및 PPARγ의 발현이 감소되었음을 확인한 결과를 나타내는 도면이다.
도 8은 지방조직에서 갈색지방세포의 열 생성 유전자인 UCP1, PRDM 및 Cidea이 발현이 증가되었음을 확인한 결과를 나타내는 도면이다.
도 9는 근육세포에서 지질축적 억제와 관련된 IL-15 유전자의 발현이 증가되었음을 확인한 결과를 나타내는 도면이다.
이하, 본 발명을 상세히 설명한다.
본 발명의 일 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드 및 상기 펩타이드에 활성물질이 결합된 활성물질-펩타이드 결합체를 제공한다.
본 발명의 펩타이드의 합성은 예를 들어 기기를 이용하거나 유전공학 기법을 이용하여 수행할 수 있다. 기기를 이용하여 합성하는 경우, 자동 펩타이드 합성기에서 원하는 펩타이드를 Fmoc 고체상(Fmoc solid-phase) 방법으로 합성할 수 있다.
구체적인 일 실시예에서, 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드는 Fmoc 고체상(Fmoc solid-phase) 방법을 이용하여 합성 및 동정하였고, 동정된 펩타이드의 효능을 검증하는 것에 의해 선별되었다.
구체적인 일 실시예에서, 동정된 펩타이드의 효능을 검증하기 위해, 지방 생성 억제 효과 및 지방 분해 효과에 대한 유효성 검증을 통해 항비만 활성을 가지는 펩타이드를 선별하였다.
나아가, 본 발명의 활성물질-펩타이드 결합체는 위의 과정을 통해 선별된 펩타이드와 활성물질을 결합시켜 제조할 수 있다. 구체적인 일 실시예에서, 상기 활성물질은 펩타이드와 화학적으로 결합시켜 제조한 활성물질-펩타이드 결합체들의 효능을 검증하는 것에 의해 선별되었다.
본 명세서에서, 용어 '펩타이드'란 아미노산 잔기로 이루어진 선형의 분자를 의미하며, 구체적으로 본 발명의 펩타이드는 서열번호 1로 표시되는 아미노산 서열을 포함할 수 있다.
상기 '펩타이드'는 기능에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해서 상이한 서열을 가지는 아미노산의 변이체들, 또는 단편들일 수 있다. 상기 펩타이드의 활성을 전체적으로 변경시키지 않는 아미노산 교환은 본 기술 분야에 공지되어 있다. 경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation) 등으로 변형될 수 있다. 따라서, 본 발명은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 실질적으로 동일한 아미노산 서열을 갖는 펩타이드 및 이의 변이체 또는 이의 활성 단편을 포함한다. 상기 실질적으로 동일한 단백질이란 상기 서열번호 1의 아미노산 서열과 75% 이상, 바람직하게는 80% 이상, 예컨대, 85% 이상, 90% 이상, 95% 이상, 98% 이상, 또는 99% 이상의 서열 상동성을 갖는 아미노산 서열을 의미하나 이에 한정되지 않으며, 75% 이상의 아미노산 서열의 상동성을 가지며 동일한 활성을 가진다면 본 발명의 범위에 포함된다. 또한, 본 발명의 펩타이드는 표적화 서열, 태그(tag), 표지된 잔기, 반감기 또는 펩타이드 안정성을 증가시키기 위한 특정 목적으로 제조된 아미노산 서열을 추가적으로 포함할 수 있다.
또한, 보다 나은 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 본 발명의 펩타이드의 N-말단 또는 C-말단에 보호기가 결합되어 있을 수 있다. 예컨대, 상기 보호기는 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜(PEG)일 수 있으나, 펩타이드의 개질, 특히 펩타이드의 안정성 증진시킬 수 있는 성분이라면, 제한없이 포함할 수 있다. 상기 '안정성'은 생체 내 단백질 절단 효소의 공격으로부터 본 발명의 펩타이드를 보호하는 생체내(in vivo)에서의 안정성뿐만 아니라, 저장안정성(예컨대, 상온 저장 안정성)도 포함하는 의미로 사용된다.
본 명세서에서, 상기 '활성물질'은 담즙산 일 수 있고, 구체적으로 콜산(cholic acid), 5β-콜산(5β-cholanic acid), 체노디옥시콜산(chenodeoxycholic acid), 글리코콜산(glycocholic acid), 타우로콜산(taurocholic acid), 디옥시콜산(deoxycholic acid), 리쏘콜산(lithocholic acid), 7-옥소-리소콜산(7-oxo-lithocholic acid) 등을 포함하는 군으로부터 선택되는 담즙산이 바람직하게 사용될 수 있으며, 보다 구체적으로 상기 활성물질은 디옥시콜산 일 수 있다.
본 발명의 상기 '디옥시콜산'은 IUPAC 명칭이 3,12-디하이드록시콜란-24-오익산으로, 분자량이 392.58인 화합물이다. 일반적으로 담즙산의 일종으로 지방을 분해하고 지방세포를 파괴시키며 턱밑 지방 개선 주사제에 사용되고 있다. 디옥시콜산의 구조는 하기 화학식 1과 같다.
[화학식 1]
Figure PCTKR2021007325-appb-I000001
본 발명의 활성물질-펩타이드 결합체에서 활성물질이 디옥시콜산인 경우, 디옥시콜산과 결합된 펩타이드를 '디옥시콜산-펩타이드 결합체(Deoxycholic acid-peptide conjugate, DA-peptide conjugate)'로 명명하였다.
구체적으로, 본 발명은 서열번호 1의 아미노산 서열로 구성된 펩타이드에 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 제공한다.
상기 디옥시콜산은 펩타이드의 N-말단, C-말단 또는 곁사슬에 결합할 수 있다. 구체적으로 상기 디옥시콜산의 카르복시기는 펩타이드의 N-말단과 펩타이드 결합을 할 수 있다.
상기 디옥시콜산-펩타이드 결합체의 일구현예는 하기 화학식 2로 표시되는 것일 수 있다.
[화학식 2]
Figure PCTKR2021007325-appb-I000002
본 발명의 구체적인 실시예에서, 상기 디옥시콜산-펩타이드 결합체는 지방세포 및 지방조직 내에 투여되어 지방 생성의 신호전달경로를 억제하여 지방의 생성 및 축적을 억제하므로 비만을 예방, 개선 또는 치료할 수 있다.
또한, 본 발명의 디옥시콜산-펩타이드 결합체는 지방 분해의 신호전달경로를 활성화하여 지방세포 및 지방 조직에서 지방의 분해를 촉진하고, 지방세포의 크기를 감소시키므로 비만을 예방, 개선 또는 치료할 수 있다.
또한, 본 발명의 디옥시콜산-펩타이드 결합체는 물에 대한 높은 용해도를 가지며, 디옥시콜산 또는 펩타이드 단독 물질 대비 현저하게 향상된 지방 축적 억제 효과 및 지방 분해 효과를 가지므로, 디옥시콜산의 사용량을 낮출 수 있고 이를 통해 디옥시콜산의 고용량 사용으로 인한 부작용을 방지할 수 있다.
따라서, 상기와 같은 활성을 갖는 디옥시콜산-펩타이드 결합체는 비만 또는 비만 관련 질환의 예방, 치료, 또는 개선을 위한 조성물의 유효성분으로 이용될 수 있다.
이에, 본 발명의 다른 일 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 포함하는 비만 또는 비만 관련 질환의 예방, 치료 또는 개선용 조성물을 제공한다.
본 발명의 또 다른 일 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 포함하는 지방 생성 억제용 또는 지방 분해 촉진용 조성물을 제공한다.
또한, 본 발명은 개체에 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 투여하는 단계를 포함하는 지방 생성 억제 또는 지방 분해 촉진 방법을 제공한다.
또한, 본 발명은 지방 생성 억제 또는 지방 분해 촉진에 사용하기 위한 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 제공한다.
본 발명의 또 다른 일 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 포함하는 비만 또는 비만 관련 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 개체에 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 투여하는 단계를 포함하는 비만 또는 비만 관련 질환의 예방 또는 치료방법을 제공한다.
또한, 본 발명은 비만 또는 비만 관련 질환의 예방 또는 치료에 사용하기 위한 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 제공한다.
본 명세서에서 '비만'은 에너지 불균형에 의하여 체내에 체지방이 과도하게 축적된 상태(condition) 또는 질환(disease)를 의미하며, 본 발명의 디옥시콜산-펩타이드 결합체는 지방 산화 촉진 유전자와 상기 유전자들에 의해 암호화되는 단백질과, 지방 분해 촉진 유전자와 상기 유전자들에 의해 코딩되는 단백질의 발현을 현저하게 증가시킬 뿐 아니라, 지방세포 축적에 관여하는 유전자의 발현을 감소시켜, 에너지 불균형을 조절하거나 과다한 체지방을 가진 상태를 벗어나도록 함으로써, 상기 비만을 예방 또는 치료할 수 있다.
본 명세서에서 '비만 예방 또는 치료'는 지방의 침적을 감소시키는 것을 의미할 수 있으며, 상기 '지방의 침적'은 예를 들어 비만, 지방 재분배 증후군, 하안검 지방 헤르니아, 지방종, 데르컴병, 지방이상증, 내장 지방과다증, 유방 확대증, 고도비만증, 옆구리 및 팔 주변의 확산된 신체 지방, 및 셀룰라이트와 관련된 지방 침적으로 구성된 군에서 선택된 상태를 의미할 수 있다.
또한, 본 명세서에서 상기 '비만 관련 질환'은 에너지 불균형에 의하여 과다한 체지방을 가진 상태로 인해 유발될 수 있는 질환으로, 비만의 예방 또는 치료를 통해 상기 비만 관련 질환으로부터 발생하는 증상을 예방, 완화 또는 개선시킬 수 있다. 구체적으로, 상기 비만 관련 질환은 고혈압, 당뇨, 증가된 혈장 인슐린 농도, 인슐린 내성, 고지혈증, 대사 증후군, 인슐린 내성 증후군, 비만관련 위식도 역류, 동맥경화증, 과콜레스테롤 혈증, 요산과다혈증, 하부등 통증, 심장비대 및 좌심실 비대, 지방이영양증, 비알콜성 지방간염, 심혈관 질환, 다낭성 난소 증후군 등 일 수 있다.
본 발명의 비만 또는 비만 관련 질환의 예방 또는 치료용 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구제 제형, 외용제, 좌제, 및 멸균 주사용액 형태로 제형화되어 사용할 수 있고, 제형화를 위하여 약학 조성물의 제조에 통상적으로 사용되는 적절한 담체, 부형제 또는 희석제를 포함할 수 있다.
상기 약학적으로 허용되는 담체는 제제시 통상적으로 이용되는 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아, 고무, 인산칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세 결정성 셀룰로스, 폴리비닐 피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등을 포함할 수 있다.
상기 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 더 포함할 수 있다.
상기 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구투여(예를 들어, 근육 내, 정맥 내, 복강 내, 피하, 피내, 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명의 약학적 조성물을 주사용 제제로 사용할 경우 국소화된 지방 침적을 제거하기 위한 용도로 사용할 수 있다.
상기 국소화된 지방은 복부, 눈 밑, 턱 밑, 팔 밑, 엉덩이, 허벅지, 종아리, 등, 넓적다리, 브라라인으로 구성된 군에서 선택된 대상 부위에 국소화된 것일 수 있다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서 '약학적으로 유효한 양'은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 상기 약학적 조성물은 개별 치료제로 투여하거나 다른 비만 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 동시에, 별도로, 또는 순차적으로 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
상기 약학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성율, 배설 속도, 질병 종류, 병용되는 약물에 따라 달라질 수 있으며, 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라 증감될 수 있으며, 예를 들어 상기 약학적 조성물을 1일당 환자 체중 1㎏ 당 약 0.0001㎍ 내지 500mg, 바람직하게는 0.01㎍ 내지 100mg 투여할 수 있다.
구체적인 실시예에서, 본 발명의 디옥시콜산-펩타이드 결합체를 지방세포 또는 지방조직에 투여하면 디옥시콜산 또는 펩타이드를 단독으로 투여한 경우와 비교하였을 때 지방 축적 억제 효과 및 지방 분해 효과가 현저하게 상승되는 것을 확인하였다. 이에, 디옥시콜산-펩타이드 결합체를 사용하면 시너지 효과에 의한 사용량 감소를 이룰 수 있고, 이를 통해 최소량의 디옥시콜산을 이용하여 안전성을 확보할 수 있으며, 디옥시콜산에 의한 부작용을 최소화 할 수 있다.상기‘개체(subject)'는 본원의 디옥시콜산-펩타이드 결합체의 투여를 필요로 하는 개체(subject in need thereof)일 수 있으며, 상기 투여를 필요로 하는 개체는 비만 또는 비만 관련 질환에 대해 진단을 받은 개체, 비만 또는 비만 관련 증상이 발현된 개체뿐만 아니라 상기 질환이나 증상의 발현을 예방하거나 건강 개선을 위해 투여를 희망하는 개체를 포함하는 것일 수 있다.
상기 '투여'는 임의의 적절한 방법으로 환자에게 소정의 물질을 제공하는 것을 의미하며, 본 발명의 디옥시콜산-펩타이드 결합체의 투여 경로는 목적 조직에 도달할 수 있는 한 일반적인 모든 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 디옥시콜산-펩타이드 결합체는 활성물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
다른 측면에서, 본 발명은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 포함하는, 비만의 예방 또는 개선용 의약외품 조성물을 제공한다.
상기 펩타이드, 디옥시콜산 및 비만의 구체적인 내용은 전술한 바와 같다.
본 발명의 조성물을 의약외품 조성물로 사용할 경우, 상기 디옥시콜산-펩타이드 결합체를 그대로 첨가하거나 다른 의약외품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 본 발명의 일 구현예에 따르면 본 발명의 의약외품 조성물은 소독청결제, 치약, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제 또는 필터충진제일 수 있다.
또 다른 측면에서, 본 발명은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체를 포함하는, 비만의 예방 또는 개선용 화장료 조성물을 제공한다.
상기 펩타이드, 디옥시콜산 및 비만의 구체적인 내용은 전술한 바와 같다.
상기 화장료 조성물은 본 기술분야에서 통상적으로 제조되는 임의의 제형으로 제조될 수 있고, 예를 들면, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화 될 수 있으나 이에 제한되는 것은 아니다.
상기 화장료 조성물은 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이, 파우더, 헤어토닉, 헤어크림, 헤어로션, 헤어샴푸, 헤어린스, 헤어컨디셔너, 헤어스프레이, 헤어 에어졸, 포마드, 젤 등과 같은 용액, 솔젤, 에멀젼, 오일, 왁스, 에어졸 등의 다양한 형태로 제조될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 화장료 조성물은 KFLIK의 아미노산 서열로 구성되는 펜타펩타이드에 더하여 부형제, 담체 등 기타 첨가제를 포함할 수 있으며 일반 피부 화장료에 배합되는 보통의 성분을 필요한 만큼 적용 배합하는 것이 가능하다.
상기 화장료 조성물의 제형의 형태가 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀루로오스 유도체, 폴리에틸렌글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
상기 화장료 조성물의 제형의 형태가 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토오스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 사용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체가 포함될 수 있으나 이에 제한되는 것은 아니다.
상기 화장료 조성물의 제형의 형태가 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용될 수 있고, 예를 들면 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜 또는 소르비탄의 지방산 에스테르 등이 이용될 수 있다.
상기 화장료 조성물의 제형의 형태가 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르 등과 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
상기 화장료 조성물의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
상기 화장료 조성물의 제형이 헤어샴푸인 경우에는 본 발명의 트롤록스-펩타이드 결합체에 증점제, 계면활성제, 점도 조절제, 보습제, pH 조절제, 방부제, 에센셜 오일 등과 같이 샴푸를 조성하기 위한 베이스 성분들이 혼합될 수 있다. 상기 증점제로는 CDE가 사용될 수 있고, 상기 계면활성제로는 음이온 계면활성제인 LES와, 양쪽성 계면활성제인 코코 베타인이 사용될 수 있고, 상기 점도조절제로는 폴리 쿼터가 사용될 수 있으며, 상기 보습제로는 글리세린이 사용될 수 있고, 상기 pH 조절제로는 구연산, 수산화나트륨이 사용될 수 있다. 상기 방부제로는 자몽 추출물 등이 사용될 수 있고, 이 외에도 시더우드, 페퍼민트, 로즈마리 등의 에센셜 오일과 실크 아미노산, 펜타올 또는 비타민 E가 첨가될 수 있다.
상기 화장료 조성물에 포함되는 성분은 유효 성분으로서 본 발명의 상기 트롤록스-펩타이드 결합체와 담체 성분 이외에 화장료 조성물에 통상적으로 사용되는 성분들, 예를 들면 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 등을 더 포함할 수 있으나, 이에 제한되는 것은 아니다.
상술한 바와 같이, 본 발명의 디옥시콜산-펩타이드 결합체는 지방전구세포에서 지방세포로의 분화를 억제하고 지방세포 내 지질 축적을 억제하며, 지방의 분해를 촉진하는 효과가 있으므로 비만 또는 비만 관련 질환을 예방, 개선 또는 치료하는 목적으로 하는 의약품 또는 화장료 조성물의 원료로 사용될 수 있다.
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
[실시예 1]
서열번호 1의 아미노산 서열을 포함하는 펩타이드 합성
본 발명의 펩타이드를 공지의 방법으로 합성하였으며, 본 발명에서 사용한 신규 펩타이드의 아미노산 서열은 'Lys Phe Leu Ile Lys (서열번호 1)' 이며, 분자량 측정기로 상기 서열번호 1의 아미노산 서열을 포함하는 펩타이드의 분자량을 측정한 결과, 그 분자량은 647.4 Da에 해당함을 확인하였다.
[실시예 2]
디옥시콜산-펩타이드 결합체의 제조
펩타이드 반응기에 서열번호 1의 펩타이드(500 mmol)와 디메틸포름아마이드(Dimethylformamide, DMF) 1,000 mL를 넣고, 디옥시콜산 (Deoxycholic acid) 393 g (1,000 mmol, 2 equiv.), 1-HOBt 135 g (1000 mmol, 2 equiv.), HBTU 379 g (1000 mmol, 2 equiv.)에 DMF 500ml를 투입하여 상온에서 30분간 반응시켰다. 이후, 디이소프로필에틸아민(DIPEA) 261 mL (194 g, 1500 mmol, 3 equiv.)를 더 첨가하여 상온에서 1시간 동안 반응시켰다. 반응이 마무리 된 후 디옥시콜산-펩타이드 레진을 여과하여 세척 후, 진공오븐에서 건조하였다. 그 후 디에틸에테르 20 L를 첨가하여 결정화 시킨 뒤, 여과 및 분리 정제하여 디옥시콜산-펩타이드 결합체를 제조하였다.
분자량 측정기를 이용하여 디옥시콜산-펩타이드 결합체의 분자량을 측정한 결과, 그 분자량이 1022.4 Da에 해당함을 확인하였다. 또한, 생성된 디옥시콜산-펩타이드 결합체를 1H-NMR로 분석한 결과를 [도 1]에 나타내었다. 상기 1H-NMR로 분석 스펙트럼에서 디옥시콜산의 피크 외에도, 펩타이드의 피크가 나타난 것으로부터 디옥시콜산-펩타이드 결합체가 합성되었음을 명확하게 확인할 수 있었다.
[준비예 1]
지방전구세포의 준비 및 지방세포로의 분화 유도
지방전구세포인 3T3-L1 세포를 미국세포주은행(ATCC)으로부터 구매하여 실험에 사용하였다. 3T3-L1은 지방세포의 대사과정을 연구하는 데에 널리 이용되는 세포주로서, 상기 세포의 분화가 활발할수록 지방세포 내의 지방 축적이 활발하여 비만을 유도하게 된다. 따라서, 항비만 효과를 가질 것으로 생각되는 물질을 상기 세포에 처리하였을 때, 세포의 분화가 적을수록 항비만 효과가 큰 물질인 것으로 볼 수 있다.
지방전구세포인 3T3-L1을 2% 우 태아 혈청(FBS)가 포함된 DMEM에서37℃, 5% CO2의 조건에서 배양하였다. 3T3-L1 지방전구세포를 1 X 105 세포/웰의 밀도로 12-웰 플레이트에 분주한 후, 100% confluency 시점이 되자 2일 동안 더 유지시켰다. 지방전구세포는 분화 성분(10 μg/ml 인슐린, 0.1 μM 덱타메타손 및 0.5 mM IBMX 포함) 및 10 % FBS가 포함되어 있는 DMEM 배지(이하 '분화 배지'라 함)에서 2일 동안 배양시켜 지방세포로의 분화를 유도하였다. 배양 48시간 후, 1 ug/ml 인슐린이 함유된 10% FBS DMEM(이하, '배양 배지'라 함)으로 이틀 동안 배양하였다. 그 후 2일 마다 10% FBS DMEM 배양액으로 교체하였다. 지방세포 분화를 유도하는 동안 실험 목적에 따라 디옥시콜산-펩타이드 결합체를 1 μM 및 10 μM의 농도로 각 배양액에 처리하거나, 처리하지 않았고 분화가 완성되는 시점인 7일째에 지방세포 분화 정도를 관찰하였다.
[준비예 2]
지방조직(adipose tissue)의 채취 및 배양
9주령 BL/6 마우스의 복부에서 지방조직을 채취한 뒤, 100 mm X 15 mm 배양 접시에 넣고, 배양 배지에서 밤새 배양하였다. 상기 지방조직은 동일한 중량을 가지도록 분할 하여 24-웰 플레이트에 옮긴 뒤, 이하 실험예에서 사용하였다.
[실험예 1]
디옥시콜산-펩타이드 결합체의 용해도 확인
상기 실시예 2에서 제조된 디옥시콜산-펩타이드 결합체와 디옥시콜산의 용해도를 육안으로 관찰하여 비교하였다.
구체적으로 디옥시콜산-펩타이드 결합체와 디옥시콜산이 각각 1 mg이 담긴 E. 튜브에 증류수를 90 μL를 넣고 용해 여부를 확인하였다.
그 결과, [도 2]에 나타난 바와 같이, 디옥시콜산은 물에 거의 용해되지 않은것과 대조적으로, 본 발명의 디옥시콜산-펩타이드 결합체는 모두 물에 완전하게 용해되었음을 확인하였다.
상기 결과를 통해 본 발명의 디옥시콜산-펩타이드 결합체는 디옥시콜산에 펩타이드가 결합됨으로써, 디옥시콜산이 단독으로 존재하는 경우에 비하여 수용해도가 향상됨을 알 수 있다.
[실험예 2]
디옥시콜산-펩타이드 결합체의 지방 축적 억제 효과
2-1. 오일 레드 O 염색 및 분석
본 발명의 디옥시콜산-펩타이드 결합체가 지방세포 내 지방의 축적을 억제하는 효과가 있는지 확인하기 위해 오일 레드 O 염색을 실시하였다.
구체적으로, 상기 준비예 1에서 유도한 지방세포의 분화 정도를 오일 레드 O 염색을 통해 1차적으로 현미경을 통해 확인하였고, 지방세포 염색 정도는 510 nm 파장에서 분광광도계로 흡광도를 측정하여 세포에 축적된 지방의 정도를 계산하였다. β3 아드레날린성 수용체 작용제 (β3 adrenergic receptor aonist)인 CL316243 또는 TNF-α를 처리한 군을 양성 대조군으로 하였다.
그 결과, [도 3a]에 나타난 바와 같이, 디옥시콜산-펩타이드 결합체를 1 μM 처리한 경우 양성대조군과 동등한 수준으로 지방세포 내 지방의 염색이 감소되었다.
이를 통해 디옥시콜산-펩타이드 결합체는 지방세포로의 분화와 지방 생성을 억제함으로써 지방세포 내 지질 축적을 억제할 수 있음을 알 수 있다.
2-2. 디옥시콜산-펩타이드에 의한 상승적 지방 축적 억제 효과 확인
디옥시콜산-펩타이드 결합체를 처리한 경우와 디옥시콜산 또는 서열번호 1의 펩타이드를 단독으로 처리한 경우 지방 축적 억제 효과를 비교하기 위하여, 상기 실험예 1-1과 동일한 방법으로 지방세포의 분화 정도 및 지질 축적의 정도를 측정하였다. TNF-α를 처리한 군을 양성 대조군으로 하였다.
그 결과, [도 3b]에 나타난 바와 같이 서열번호 1의 펩타이드 및 디옥시콜산을 각각 1 μM 처리한 경우 지질 축적량이 각각 89%, 93%였으나, 동일한 농도로 디옥시콜산-펩타이드 결합체를 처리한 경우 지질 축적량이 78%인 것을 확인하였다.
이를 통해, 서열번호 1의 펩타이드 또는 디옥시콜산을 단독으로 처리하는 경우보다 동일 농도의 디옥시콜산-펩타이드 결합체를 처리하는 경우 지방세포로의 분화 및 지방 축적의 억제 정도가 큰 폭으로 상승하는 것을 알 수 있으며, 디옥시콜산-펩타이드 결합체를 적은 양으로 사용하여도 단독 화합물의 효과와 동등 수준 이상의 효과를 나타낼 수 있음을 알 수 있다.
[실험예 3]
디옥시콜산-펩타이드 결합체의 지방 분해 효과
3-1. 지방조직에서 지방분해 산물인 글리세롤의 양 측정
지방조직 내에 저장된 중성지방은 에너지 생산 또는 세포신호전달 등을 위하여 지방산과 글리세롤로 분해된다. 따라서 유리 글리세롤의 방출량 측정을 통해 지방조직에 축적된 중성지방의 분해 효과를 확인하였다.
구체적으로, 고지방식이(Rodent Diet with 60% Kcal Fat, Research Diets, USA)를 투여한 암컷 마우스에서 백색지방조직인 Fat pad를 분리하여 12-웰 플레이트에 웰당 400mg씩 지방 조직을 넣은 후 배양 배지(DMEM media serum free)에서 48시간 배양하여 안정화 하였다. 배양 시 펩타이드 결합체를 1 μM, 10 μM, 100 μM의 농도로 처리하였고, 양성대조군으로 TNFα를 20 nM 처리하여, 48시간 동안 배양한 후 상층액을 얻어 글리세롤 컬러리메트릭 어세이 키트(Cayman chemical, USA) 를 이용하여 글리세롤의 양을 측정하였다.
그 결과, [도 4a]에 나타난 바와 같이, 대조군에 비하여 디옥시콜산-펩타이드 결합체를 처리한 경우, 지방이 분해되면서 나온 글리세롤의 양이 디옥시콜산-펩타이드 결합체의 농도 의존적으로 증가하는 것을 확인하였다.
이를 통해, 본 발명의 디옥시콜산-펩타이드 결합체는 지방조직에 축적된 중성지방을 분해하는 활성이 있음을 알 수 있다.
3-2. 지방조직에서 지방 세포의 크기 감소 확인
디옥시콜산-펩타이드 결합체에 의한 지방조직 내 지방 분해 효과를 확인하기 위하여, 준비예 2에서 확보한 지방조직에 대해 H&E 염색을 수행하여 지방 세포의 크기를 확인하였다.
구체적으로, 지방조직을 절단하여 파라핀 슬라이드에 부착하고, 50℃에서 건조시켰다. 건조된 지방 조직이 부착된 슬라이드를 자일렌 1, 2, 및 3에 각각 5분씩 넣고, 파라핀을 제거하였다. 그 뒤 100% 에탄올에 2분 동안 넣고, 90%, 80% 및 70% 에탄올에 순차적으로 넣어 재수화(re-hydration) 시켰다. 재수화된 슬라이드는 헤마톡실린 용액에 넣어 염색하고, 세척한 다음 에오신 Y를 이용하여 염색하였다. 그 뒤, 90%, 80% 및 70% 에탄올에 순차적으로 넣어준 뒤 자일렌 3, 2, 1에 넣은 뒤 자일렌 기반의 마운팅 배지(Xylene-based mounting medium)로 조직에 기포가 들어가지 않게 봉입(mounting) 해준 뒤 건조하였다. 그 후 건조된 슬라이드를 광학 현미경으로 관찰하였다.
그 결과, [도 4b]에 나타난 바와 같이, 지방조직에 디옥시콜산-펩타이드 결합체를 처리하였을 때, 대조군 대비 지방 세포의 크기가 작아지는 것을 확인하였다.
이를 통해, 본 발명의 디옥시콜산-펩타이드 결합체에 의해 세포 내 축적되었던 지방이 분해되었음을 알 수 있다.
3-3. 디옥시콜산-펩타이드 결합체의 상승적 지방 분해 효과 확인
디옥시콜산-펩타이드 결합체를 처리한 경우와 디옥시콜산 또는 서열번호 1의 펩타이드를 단독으로 처리한 경우 지방 분해 효과를 비교하기 위하여, 상기 실험예 3-1과 동일한 방법으로 지방조직에서 방출된 글리세롤의 양을 측정하였다. TNF-α를 처리한 군을 양성 대조군으로 하였다.
그 결과, [도 4c]에 나타난 바와 같이 서열번호 1의 펩타이드 및 디옥시콜산을 각각 1 μM 처리한 경우 글리세롤 방출량이 각각 106%, 116%였으나, 동일한 농도로 디옥시콜산-펩타이드 결합체를 처리한 경우 글리세롤 방출량이 175%인 것을 확인하였다.
이로부터, 서열번호 1의 펩타이드 또는 디옥시콜산을 단독으로 처리하는 경우에 비하여, 동일 농도의 디옥시콜산-펩타이드 결합체를 처리하는 경우 지방 분해에 따른 글리세롤의 방출량이 큰 폭으로 상승하는 것을 알 수 있으며, 디옥시콜산-펩타이드 결합체를 적은 양으로 사용하여도 단독 화합물의 효과와 동등 수준 이상의 효과를 나타낼 수 있음을 알 수 있다.
[실험예 4]
지방 생성 및 분해 관련 유전자들의 발현 변화 확인
4-1. RT-PCR 분석
준비예 1에서 얻은 지방세포 또는 준비예 2에서 얻은 지방조직에 본 발명의 디옥시콜산-펩타이드 결합체를 처리하여 배양한 다음 세포를 회수하여 트리졸(Thermo Fisher Scientific, USA)로 RNA를 추출하였다. 추출한 RNA는 TOPScript™ RT DryMIX (enzynomics, Korea)를 이용하여 RNA에 상보적인 DNA를 얻은 후, TOPsimple ™ DryMIX-nTaq (enzynomics, Korea)을 이용하여 중합효소 연쇄반응 (Polymerase chian reaction, PCR)을 실시하였다. 그 후, 1.5% 아가로스겔에 PCR 산물을 로딩하여 상기 성장인자들의 mRNA 발현 정도를 비교하였다. 내부 대조군으로 GAPDH 유전자를 사용하였고, 실험에 사용한 프라이머는 [표 1]에 기재하였다.
유전자 프라이머 서열(5'->3') 서열번호
Leptin F GGATCAGGTTTTGTGGTGCT 2
R TTGTGGCCCATAAAGTCCTC 3
Adiponectin F TCCTGCTTTGGTCCCTCCAC 4
R TCTCCAGCCCCACACTGAAC 5
AMPKα F TCACCGGACATAAAGTGGCT 6
R TGATGATGTGAGGGTGCCTG 7
HSL F GGACACACACACACCTG 8
R CCCTTTCGCAGCAACTTTAG 9
PDE3b F TGATTGACCCAAGCCTTCCC 10
R TCTTACCACTGCTGCGATCC 11
PGCLa F ATGTGCAGCCAAGACTCTGTA 12
R CGCTACACCACTTCAATCCAC 13
PLIN F AAGGATCCTGCACCTCACAC 14
R CCTCTGCTGAAGGGTTATCG 15
ACCα F ACCTTACTGCCATCCCATGTGCTA 16
R GTGCCTGATGATCGCACGAACAAA 17
FAS F TGCTGGCACTACAGAATGC 18
R AACAGCCTCAGAGCGACAAT 19
PPARγ F ATGGGTGAAACTCTGGGAGA 20
R GAGCTGATTCCGAAGTTGGT 21
GAPDH F GTGATGGCATGGACTGTGGT 22
R GGAGCCAAAAGGGTCATCAT 23
4-2. 지방세포를 이용한 지방대사 관련 유전자의 발현 증가 확인
디옥시콜산-펩타이드 결합체가 지방대사를 촉진하는지 확인하기 위하여, 지방대사와 관련된 아디포넥틴과 렙틴 유전자의 mRNA 발현 정도를 확인하였다.
구체적으로, 준비예 1을 통해 얻은 지방세포에 본 발명의 디옥시콜산-펩타이드 결합체를 1uM, 10uM로 처리하였으며 1시간, 3시간, 6시간 배양하였다. 세포를 회수하여 실험예 4-1에 기재된 방법으로 중합효소연쇄반응을 수행한 후 발현 산물을 아가로스겔에 로딩하여 지방대사 관련 유전자들의 mRNA 발현 정도를 확인하였다.
그 결과, [도 5]에 나타난 바와 같이, 지방대사 관련 단백질인 렙틴과 아디포넥틴 유전자의 발현이 디옥시콜산-펩타이드 결합체의 처리에 의해 증가되는 것을 확인하였다.
이를 통해, 본 발명의 디옥시콜산-펩타이드 결합체가 에너지 생성에 필요한 지방의 대사를 촉진함으로써 지방의 축적을 억제하거나, 지방의 분해를 촉진하는 효과가 있음을 알 수 있다.
4-3. 지방세포를 이용한 지방분해 관련 유전자의 발현 증가 확인
지방세포에서, 상기 디옥시콜산-펩타이드 결합체가 지방 분해 촉진 세포신호전달 경로의 활성 효과를 가지는지 여부를 확인하기 위하여, 지방산 산화(Fatty acid oxidation) 촉진 및 지방 분해 촉진과 관련된 유전자의 mRNA 발현 정도를 확인하였다.
구체적으로, 상기 준비예 1을 통해 얻은 분화된 지방세포에 디옥시콜산-펩타이드 결합체를 1 μM, 10 μM의 농도로 처리한 후, 24시간 동안 배양하였다. 세포를 회수하여 실험예 4-1에 기재된 방법으로 중합효소연쇄반응을 수행한 후 발현 산물을 아가로스겔에 로딩하여 지방 분해 촉진 세포신호전달경로 관련 유전자들의 mRNA 발현 정도를 확인하였다.
그 결과, [도 6a]에 나타난 바와 같이 디옥시콜산-펩타이드 결합체를 처리한 후 지방 분해 마커인 HSL의 발현이 증가하였으며, 지방대사 관련 상위 신호전달 인자인 AMPKa1 과 그 하위 인자인 PGC1a 의 발현이 증가하였다.
이를 통해 본 발명에 따른 디옥시콜산-펩타이드 결합체는 지방을 매우 효과적으로 분해할 수 있도록 지방의 분해나 지방산의 산화 촉진과 관련된 유전자의 발현을 증가시키는 것을 알 수 있다.
4-4. 지방조직을 이용한 지방 분해 유전자의 발현 증가 확인
지방조직에서, 상기 디옥시콜산-펩타이드 결합체가 지방 분해 촉진 세포신호전달 경로의 활성 효과를 가지는지 여부를 확인하기 위하여, 지방산 산화(Fatty acid oxidation) 촉진 및 지방 분해 촉진과 관련된 유전자의 mRNA 발현 정도를 확인하였다.
구체적으로, 준비예 2를 통해 얻은 지방조직에 1μM, 10 μM의 디옥시콜산-펩타이드 결합체와 양성 대조군인 CL316243 (Sigma, USA) 1μM을 처리하고 72시간 동안 배양하였다. 세포를 회수하여 실험예 4-1에 기재된 방법으로 중합효소연쇄반응을 수행한 후 발현 산물을 아가로스겔에 로딩하여 지방산 산화(Fatty acid oxidation) 촉진 및 지방 분해 촉진과 관련된 유전자의 mRNA 발현 정도를 확인하였다.
그 결과, [도 6b]에 나타난 바와 같이 디옥시콜산-펩타이드 결합체를 처리한 후 지방 관련 유전자인 HSL 및 PLIN의 발현이 농도 의존적으로 증가하였다.
이를 통해 본 발명에 따른 디옥시콜산-펩타이드 결합체는 지방을 매우 효과적으로 분해할 수 있도록 지방의 분해나 지방산의 산화 촉진과 관련된 유전자의 발현을 증가시키는 것을 알 수 있다.
4-5. 지방조직을 이용한 지방 생성 유전자의 발현 감소 확인
지방조직에서, 상기 디옥시콜산-펩타이드 결합체가 지방 생성을 억제하는 효과를 가지는지 확인하기 위하여, 지방 생성(adipogenesis)과 관련된 유전자의 mRNA 발현 정도를 확인하였다.
구체적으로, 준비예 2를 통해 얻은 지방조직에 디옥시콜산-펩타이드 결합체 1 μM, 10 μM, 양성대조군인 CL 316,243 (Sigma, USA) 1 μM을 처리하고 72시간 추가 배양하였다. 세포를 회수하여 실험예 4-1에 기재된 방법으로 중합효소연쇄반응을 수행한 후 발현 산물을 아가로스겔에 로딩하여 지방 생성과 관련된 유전자의 mRNA 발현 정도를 확인하였다.
그 결과, [도 7]에 나타난 바와 같이 디옥시콜산-펩타이드 결합체를 처리한 후 지방 생성과 관련된 ACCα, FAS, PPARγ 유전자의 발현이 감소되는 것을 확인하였다.
이를 통해 본 발명에 따른 디옥시콜산-펩타이드 결합체는 지방 생성을 억제함으로써 비만을 예방 또는 치료하는 효과가 있음을 알 수 있다.
[실험예 5]
디옥시콜산-펩타이드 결합체에 의한 열발생 관련 유전자의 발현 증가 확인
본 발명의 디옥시콜산-펩타이드 결합체가 비만을 예방 또는 치료하는 효과를 가지는지 확인하기 위하여, 갈색지방세포의 열 발생과 관련된 유전자의 mRNA 발현 정도를 확인하였다.
구체적으로, 준비예 2를 통해 얻은 지방조직에 디옥시콜산-펩타이드 결합체 1 μM, 10 μM, 양성대조군인 CL 316,243 (Sigma, USA) 1 μM을 처리하고 72시간 추가 배양하였다. 세포를 회수하여 실험예 4-1에 기재된 방법으로 중합효소연쇄반응을 수행한 후 발현 산물을 아가로스겔에 로딩하여 지방 생성과 관련된 유전자의 mRNA 발현 정도를 확인하였다. 이때, 내부 대조군으로 GAPDH를 사용하였으며, 실험에 사용한 프라이머는 아래 [표 2]에 기재하였다.
유전자 프라이머 서열(5'->3') 서열번호
UCP1 F CCTGCCTCTCTCGGAAACAA 24
R GTAGCGGGGTTT ATCCCAT 25
PRDM F CCCCACATTCCGCTGTGAT 26
R CTCGCAATCCTTGCACTCA 27
Cidea F CGGGAATAGCCAGAGTCACC 28
R TGTGCATCGGATGTCGTAGG 29
그 결과, [도 8]에 나타난 바와 같이 디옥시콜산-펩타이드 결합체를 처리한 후 갈색지방세포의 열 발생과 관련된 UCP1, PRDM, Cidea 유전자의 발현이 증가하는 것을 확인하였다.이를 통해, 본 발명에 따른 디옥시콜산-펩타이드 결합체는 운동에 의해 발현이 증가되는 갈색지방세포의 열 발생과 관련된 유전자의 발현을 증가시킴으로써 지방 축적을 억제하여 비만을 예방 또는 치료하는 효과가 있음을 알 수 있다.
[실험예 6]
근육세포에서 디옥시콜산-펩타이드 결합체에 의한 IL-15 유전자의 발현 증가 확인
본 발명의 디옥시콜산-펩타이드 결합체가 비만을 예방 또는 치료하는 효과를 가지는지 확인하기 위하여, 근육세포에서 IL-15 유전자의 발현의 변화를 확인하였다. IL-15는 저항성 운동 시 근육축에 의해 그 발현량이 증가되는 마이오카인으로, 근육과 지방조직의 상호작용에 핵심적인 역할을 하는 것으로 알려졌으며, 지질 축적을 억제하여 항비만 효과를 나타낸다.
구체적으로, 마우스 근원 세포인 C2C12 세포를 2x105cells/well의 밀도로 6-웰 플레이트에 접종한 후 DMEM(10% FBS) 배지에서 3일간 배양하였다. 세포가 플레이트의 70~80% 정도까지 자란 상태에서 분화 배지(DMEM, 5% horse serum)로 교체한 다음 3일 동안 배양하였다. 그 후, 분화 배지(DMEM, 2% horse serum)으로 교체 후 4일 동안 배양시켜 근원세포에서 근관(myotube)으로 분화를 유도하였다. 그런 다음 무혈청 배지로 교체하여 2시간 동안 배양하고, 1 μM, 10 μM 농도의 디옥시콜산-펩타이드 결합체를 6시간 동안 처리하여 37℃, 5% CO2 환경에서 배양하였다. 세포를 회수하여 실험예 4-1에 기재된 방법으로 중합효소연쇄반응을 수행한 후 발현 산물을 아가로스겔에 로딩하여 지방 생성과 관련된 유전자의 mRNA 발현 정도를 확인하였다. 이때, 내부 대조군으로 GAPDH를 사용하였으며, 실험에 사용한 프라이머는 아래 [표 3]에 기재하였다.
유전자 프라이머 서열(5'->3') 서열번호
IL-15 F TGTCTTCATTTTGGGCTGTG 30
R TGCAACTGGGATGAAAGTCA 31
그 결과, [도 9]에 나타난 바와 같이 디옥시콜산-펩타이드 결합체를 처리한 후 지방조직의 지방 분해 기능을 가지고 있는 IL-15의 발현이 증가하는 것을 확인하였다.
이를 통해, 본 발명에 따른 디옥시콜산-펩타이드 결합체는 운동에 의해 발현이 증가되고, 지방 분해 기능을 가지는 IL-15 유전자의 발현을 증가시킴으로써 비만을 예방 또는 치료하는 효과가 있음을 알 수 있다.
이상에서 본 발명은 기재된 실시예에 대해서만 상세히 설명되었지만 본 발명의 기술사상 범위 내에서 다양한 변형 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 청구범위에 속함은 당연한 것이다.

Claims (15)

  1. 서열번호 1의 아미노산 서열로 구성된 펩타이드와 디옥시콜산이 결합된 디옥시콜산-펩타이드 결합체.
  2. 청구항 1에 있어서,
    상기 디옥시콜산은 펩타이드의 N-말단과 펩타이드 결합을 하는 것인, 디옥시콜산-펩타이드 결합체.
  3. 청구항 1에 있어서,
    상기 디옥시콜산-펩타이드 결합체는 지방세포에서의 지방 생성을 억제하는 것인, 디옥시콜산-펩타이드 결합체.
  4. 청구항 1에 있어서,
    상기 디옥시콜산-펩타이드 결합체는 지방분해를 촉진하는 것인, 디옥시콜산-펩타이드 결합체.
  5. 청구항 1에 있어서,
    상기 디옥시콜산-펩타이드 결합체는 지방세포의 크기를 감소시키는 것인, 디옥시콜산-펩타이드 결합체.
  6. 청구항 1의 디옥시콜산-펩타이드 결합체를 포함하는 지방 생성의 억제 또는 지방의 분해를 촉진하기 위한 용도의 조성물.
  7. 청구항 1의 디옥시콜산-펩타이드 결합체를 포함하는 비만 또는 비만 관련 질환의 예방, 치료, 또는 개선용 조성물.
  8. 청구항 1의 디옥시콜산-펩타이드 결합체를 포함하는 비만 예방 또는 치료용 약학적 조성물.
  9. 청구항 8에 있어서,
    상기 약학적 조성물은 약제학적으로 허용되는 담체, 부형제 또는 희석제를 추가로 포함하는 것인, 약학적 조성물.
  10. 청구항 8에 있어서,
    상기 담체는 식염수, 멸균수, 링거액, 완충식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 및 에탄올로 구성된 군에서 선택된 하나 이상인 것인, 약학적 조성물.
  11. 청구항 8에 있어서,
    상기 약학적 조성물은 경구용 제제, 주사용 제제 또는 외용제의 형태로 제형화 되는 것인, 약학적 조성물.
  12. 청구항 11에 있어서,
    상기 주사용 제제는 국소화된 지방 침적을 제거하기 위한 것인, 약학적 조성물.
  13. 청구항 12에 있어서,
    상기 국소화된 지방은 복부, 눈 밑, 턱 밑, 팔 밑, 엉덩이, 허벅지, 종아리, 등, 넓적다리, 및 브라라인으로 구성된 군에서 선택된 대상 부위에 국소화된 것인, 약학적 조성물.
  14. 청구항 1의 디옥시콜산-펩타이드 결합체를 포함하는, 비만의 예방 또는 개선용 화장료 조성물.
  15. 청구항 14에 있어서,
    상기 화장료 조성물은 스킨, 로션, 크림, 에센스, 유액, 젤, 핸드크림, 립스틱, 클렌징 폼, 클렌징 크림, 클렌징 워터, 분무제, 샴푸, 린스, 트리트먼트, 바디클렌져, 비누, 팩, 마사지제, 페이스파우더, 콤팩트, 파운데이션, 투웨이케이크, 및 메이크업베이스로 이루어진 그룹으로부터 선택된 어느 하나 이상의 제형을 가지는 것인, 화장료 조성물.
PCT/KR2021/007325 2020-06-12 2021-06-11 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도 WO2021251790A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
BR112022025040A BR112022025040A2 (pt) 2020-06-12 2021-06-11 Conjugado de ácido desoxicólico-peptídeo tendo atividade antiobesidade e uso do mesmo
CN202180042033.0A CN115867321A (zh) 2020-06-12 2021-06-11 具有抗肥胖活性的脱氧胆酸-肽缀合物及其用途
JP2022575916A JP7498804B2 (ja) 2020-06-12 2021-06-11 抗肥満活性を有するデオキシコール酸－ペプチド結合体及びその用途
EP21821658.8A EP4166162A4 (en) 2020-06-12 2021-06-11 DEOXYCHOLIC ACID-PEPTIDE CONJUGATE WITH ANTI-OBESITY ACTIVITY AND ITS USE
MX2022016048A MX2022016048A (es) 2020-06-12 2021-06-11 Conjugado de acido desoxicolico-peptido que tiene actividad anti-obesidad y uso del mismo.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0071657 2020-06-12
KR1020200071657A KR102456989B1 (ko) 2020-06-12 2020-06-12 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2021251790A1 true WO2021251790A1 (ko) 2021-12-16

Family

ID=78845800

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007325 WO2021251790A1 (ko) 2020-06-12 2021-06-11 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도

Country Status (7)

Country Link
EP (1) EP4166162A4 (ko)
JP (1) JP7498804B2 (ko)
KR (1) KR102456989B1 (ko)
CN (1) CN115867321A (ko)
BR (1) BR112022025040A2 (ko)
MX (1) MX2022016048A (ko)
WO (1) WO2021251790A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116712440A (zh) * 2023-07-04 2023-09-08 西湖实验室(生命科学和生物医学浙江省实验室) 脱氧胆酸在制备促进脂滴裂解药物中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100031512A (ko) * 2007-06-19 2010-03-22 키쎄라 바이오파마슈티컬즈 인코포레이티드 합성 담즙산 조성물, 방법 및 제조물
US20160279193A1 (en) * 2013-11-06 2016-09-29 Norwegian University Of Science And Technology (Ntnu) Immunosuppressive agents and their use in therapy
US20160289272A1 (en) * 2013-11-06 2016-10-06 Norwegian University Of Science And Technology Antimicrobial agents and their use in therapy
KR20190121699A (ko) * 2018-04-18 2019-10-28 (주)인벤티지랩 데옥시콜린산을 포함하는 피하 주사용 조성물 및 이의 제조 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7226577B2 (en) 2003-01-13 2007-06-05 Bracco Imaging, S. P. A. Gastrin releasing peptide compounds
KR20060121244A (ko) 2003-12-24 2006-11-28 브라코 이미징 에스.피.에이. 개선된 가스트린 방출 펩티드 화합물
US20080318870A1 (en) * 2007-06-19 2008-12-25 Kythera Biopharmaceuticals, Inc. Synthetic bile acid compositions and methods
CA3003746A1 (en) * 2015-11-04 2017-05-11 Kythera Biopharmaceuticals, Inc. Treatments of accumulated fat with deoxycholic acid and salts thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100031512A (ko) * 2007-06-19 2010-03-22 키쎄라 바이오파마슈티컬즈 인코포레이티드 합성 담즙산 조성물, 방법 및 제조물
US20160279193A1 (en) * 2013-11-06 2016-09-29 Norwegian University Of Science And Technology (Ntnu) Immunosuppressive agents and their use in therapy
US20160289272A1 (en) * 2013-11-06 2016-10-06 Norwegian University Of Science And Technology Antimicrobial agents and their use in therapy
KR20190121699A (ko) * 2018-04-18 2019-10-28 (주)인벤티지랩 데옥시콜린산을 포함하는 피하 주사용 조성물 및 이의 제조 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BAVIKAR, S. N. ET AL.: "Synthesis of chimeric tetrapeptide-linked cholic acid derivatives: impending synergistic agents", BIOORGANIC AND MEDICINAL CHEMISTRY LETTERS, vol. 18, no. 20, 2008, pages 5512 - 5517, XP025562096, DOI: 10.1016/j.bmcl.2008.09.013 *
ROTUNDA ET AL., DERMATOL SURG, vol. 30, no. 7, 2004, pages 1001 - 8
See also references of EP4166162A4

Also Published As

Publication number Publication date
KR102456989B1 (ko) 2022-10-21
BR112022025040A2 (pt) 2022-12-27
JP2023529466A (ja) 2023-07-10
EP4166162A1 (en) 2023-04-19
CN115867321A (zh) 2023-03-28
MX2022016048A (es) 2023-03-14
JP7498804B2 (ja) 2024-06-12
KR20210154535A (ko) 2021-12-21
EP4166162A4 (en) 2024-01-10

Similar Documents

Publication Publication Date Title
WO2019103203A1 (ko) 신규 펩티드 및 이를 포함한 조성물
WO2013176471A1 (ko) 곰보배추의 추출물 또는 이의 분획물을 유효성분으로 포함하는, stat3 매개 질환의 예방 또는 치료용 약학적 조성물
WO2021251789A1 (ko) 펜타펩타이드를 유효성분으로 포함하는 조성물
WO2020218720A1 (ko) 익모초 추출물 또는 레오누린을 함유하는 근육 질환 예방 또는 치료용 또는 근 기능 개선용 조성물
WO2021251790A1 (ko) 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도
WO2017200288A1 (ko) 천연 한방 추출물을 유효성분으로 포함하는 미백, 피부 노화 방지 또는 피부 주름 개선용 조성물
WO2015111832A1 (ko) 지실 추출물을 포함하는 전립선 관련 질환의 예방 또는 치료용 조성물
WO2021251788A1 (ko) 펜타펩타이드를 유효성분으로 포함하는 알러지성 질환 또는 가려움증의 예방, 개선 또는 치료용 조성물
WO2024123024A1 (ko) 중대가리풀 추출물을 포함하는 항염 및 자가면역 질환 예방 및 치료용 조성물 및 이의 제조 방법
WO2018062820A1 (ko) 피토에스트로겐을 유효성분으로 포함하는 탈모방지 및 모발 성장 촉진용 조성물
WO2017119756A1 (ko) 주름개선, 노화방지, 미백, 항염증 기능성 신규 펩티드 및 이를 포함하는 조성물
WO2023055007A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2022050634A1 (ko) 펩타이드 및 이를 포함하는 화장료 조성물 및 약학 조성물
WO2023054817A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2021107381A1 (ko) 페룰산 및 이의 유사체를 포함하는 유전자 돌연변이에 의한 피부질환 예방 및 치료용 조성물
WO2021080388A1 (ko) 커큐미노이드계 화합물, 및 감초 추출물 또는 이의 분획물을 포함하는 복합체를 포함하는 돼지 유행성 설사 바이러스 감염의 예방 또는 치료용 조성물
WO2020138674A1 (ko) 근육 이완용 조성물
WO2017142368A2 (ko) 알레르기성 또는 염증성 피부질환의 예방 또는 치료용 조성물
WO2021002642A1 (ko) 뱀독을 포함하는 류마티스 관절염의 예방 또는 치료용 조성물
WO2023055008A1 (ko) 항비만 활성을 갖는 펩타이드 및 이의 용도
WO2024080398A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
WO2024106823A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2024106821A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2024080400A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
WO2024106822A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21821658

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022575916

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022025040

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112022025040

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221207

ENP Entry into the national phase

Ref document number: 2021821658

Country of ref document: EP

Effective date: 20230112

NENP Non-entry into the national phase

Ref country code: DE