WO2021085916A1 - 에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법 - Google Patents

에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법 Download PDF

Info

Publication number
WO2021085916A1
WO2021085916A1 PCT/KR2020/014312 KR2020014312W WO2021085916A1 WO 2021085916 A1 WO2021085916 A1 WO 2021085916A1 KR 2020014312 W KR2020014312 W KR 2020014312W WO 2021085916 A1 WO2021085916 A1 WO 2021085916A1
Authority
WO
WIPO (PCT)
Prior art keywords
astaxanthin
mixture
ast
monoester
mixing
Prior art date
Application number
PCT/KR2020/014312
Other languages
English (en)
French (fr)
Inventor
윤민진
이석재
이귀진
김중길
박기수
황성현
Original Assignee
주식회사 내추럴바이오트리
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 내추럴바이오트리 filed Critical 주식회사 내추럴바이오트리
Publication of WO2021085916A1 publication Critical patent/WO2021085916A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/78—Separation; Purification; Stabilisation; Use of additives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/587—Unsaturated compounds containing a keto groups being part of a ring
    • C07C49/703—Unsaturated compounds containing a keto groups being part of a ring containing hydroxy groups
    • C07C49/723—Unsaturated compounds containing a keto groups being part of a ring containing hydroxy groups polycyclic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C67/00—Preparation of carboxylic acid esters
    • C07C67/08—Preparation of carboxylic acid esters by reacting carboxylic acids or symmetrical anhydrides with the hydroxy or O-metal group of organic compounds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/013—Esters of alcohols having the esterified hydroxy group bound to a carbon atom of a ring other than a six-membered aromatic ring

Definitions

  • the present invention relates to a method for producing astaxanthin monoester, and more specifically, the 1-1 step of preparing a basic alcohol solution, the 1-2 step of transesterification of astaxanthin, and the extraction of astaxanthin It relates to a method for producing an astaxanthin monoester comprising a step 1-3 and a second step of synthesizing an astaxanthin monoester.
  • Astaxanthin is a type of carotenoid pigment that can be separated from lobster, and is known as a pigment that gives red color to fish flesh such as salmon and trout, or gives red color when crustaceans such as shrimp are heated. Astaxanthin has an antioxidant function, so it is increasingly used as a material for promoting human health functions as it has preventive and therapeutic activities against various diseases caused by oxidative phosphorus in the body.
  • Astaxanthin is more efficient than the free form without esters, since the ester form with one or two esters is better absorbed by fish and easily migrates to the muscles when used as feed. Since it is stable to oxygen, a method of producing a diester type of free astaxanthin as a raw material is known. Further, according to Prior Document 1 (Japanese Patent No. 4410675), it is known that monoester-type astaxanthin is superior to diester-type astaxanthin in oral absorption. However, there is a problem in that the efficiency is lowered because monoester-type astaxanthin is not produced.
  • An object of the present invention is to solve the problems of the prior art and technical problems that have been requested from the past.
  • the present invention provides a 1-1 step of preparing a basic alcohol solution, a 1-2 step of transesterification of astaxanthin, a 1-3 step of extracting astaxanthin, and an astaxanthin monoester.
  • An object of the present invention is to provide a method for producing astaxanthin monoester comprising a second step of synthesizing.
  • One embodiment of the present invention is a step 1-1 of preparing a basic alcohol solution; A 1-2 step of transesterification reaction of astaxanthin; It relates to a method for producing an astaxanthin monoester comprising: a 1-3 step of extracting astaxanthin; a second step of synthesizing an astaxanthin monoester.
  • the 1-1st step of preparing the basic alcohol solution includes the 1-1-1st step of mixing sodium hydroxide with distilled water; Step 1-1-2 of mixing the mixture of step 1-1-1 with one or more mixtures selected from methanol, ethanol, and propanol; Step 1-1-3 of dehydrating the mixture of step 1-1-2; Step 1-1-4 of repeating the step 1-1-3 2 to 4 times while removing the precipitate; And a step 1-1-5 of filtering the mixture of steps 1-1-4 using a fine filter.
  • step 1-2 of the transesterification reaction of astaxanthin may include: a 1-2-1 step of mixing the supercritically extracted astaxanthin into the mixture of steps 1-1-5; Step 1-2-2 of reflux stirring the mixture of step 1-2-1 after vortexing; And a step 1-2-3 of cooling and neutralizing the mixture of step 1-2-2 to room temperature.
  • the mixture of steps 1-2-3 in which the astaxanthin transesterification reaction is completed is one or two selected from hexane and petroleum ether.
  • 1-3-1 step of vortexing by mixing with a species of compound A 1-32 step of separating the upper layer by centrifuging the mixture by rotating the mixture at high speed; A 1-33 step of drying the separated first 1-32 step mixture under reduced pressure;
  • the second step of synthesizing astaxanthin monoester may include a 2-1-1 step of mixing an activator, a catalyst, and a saturated fatty acid with the compound of step 1-3-4; Step 2-1-2 of reacting the mixture of step 2-1-1 at room temperature for 1 hour to 3 hours; A 2-1-3 step of repeating the 2-1-2 step 2 to 4 times; And a step 2-1-4 of evaporating the mixture of step 2-1-3 under reduced pressure.
  • FIG. 1 Chemical conversion of natural astaxanthin (Ast-N) to ester-type astaxanthin with free astaxanthin (Ast-F) and decanoic acid (Ast-E).
  • R1 is a carbon chain of a different length, known to range from 12 to 24, and R2 is derived from decanoic acid (C10).
  • FIG. 7 Gene expression associated with anti-inflammatory and antioxidant activity is shown.
  • A IL-1 ⁇
  • B IL-6
  • C TNF- ⁇
  • D NOX-2
  • E Nrf2
  • F MnSOD.
  • Data represent the mean ⁇ S.D of three individual experiments. *p ⁇ 0.05, **p ⁇ 0.01 vs. control group; #p ⁇ 0.05, #p ⁇ 0.01 vs. LPS group
  • Fig. 8 A schematic diagram of samples 1 to 3 of astaxanthin is shown.
  • Fig. 9 shows a calibration curve obtained by measuring the absorbance of 474 nm astaxanthin as an analysis standard at different concentrations. Results are expressed as the mean ⁇ SD of three independent experiments.
  • Step 1-1 of preparing a basic alcohol solution of the method for producing astaxanthin monoester of the present invention may include the following steps. For example, step 1-1-1 of mixing sodium hydroxide with distilled water; Step 1-1-2 of mixing the mixture of step 1-1-1 with one or more mixtures selected from methanol, ethanol, and propanol; Step 1-1-3 of dehydrating the mixture of step 1-1-2; Step 1-1-4 of repeating the step 1-1-3 2 to 4 times while removing the precipitate; It may include; steps 1-1-5 of filtering the mixture of steps 1-1-4 using a fine filter.
  • step 1-1-1 of mixing sodium hydroxide with distilled water 0.01g to 0.1g of sodium hydroxide may be mixed with 0.01ml to 1ml of distilled water. That is, the mixing ratio of distilled water and sodium hydroxide (sodium hydroxide/distilled water ml/g) 0.01 ml/g to 10 ml/g, more preferably 0.1 ml/g to 1 ml/g may be used.
  • the mixture of step 1-1-1 may be mixed with 50 ml of a mixture of one or two or more selected from methanol, ethanol, and propanol. That is, the mixture of step 1-1-1 with respect to one or two or more mixtures selected from methanol, ethanol, and propanol may use 50:0.1 to 1 in a volume ratio.
  • step 1-1-3 may proceed with a dehydration reaction by preferably using a compound represented by the following Formula 1-1 or Formula 1-2.
  • Step 1-1-4 may repeat the step 1-1-3 2 to 4 times while removing the precipitate. More preferably, steps 1-1-3 may be repeated 3 times.
  • the mixture of steps 1-1-4 may be filtered using a filter of 0.1 ⁇ m to 0.5 ⁇ m. More preferably, a 0.2 ⁇ m filter may be used.
  • Step 1-2 of transesterification reaction of astaxanthin in the method for producing an astaxanthin monoester of the present invention is a first step of mixing the supercritically extracted astaxanthin into the mixture of steps 1-1-5.
  • step 1-2-2 the mixture in step 1-2-1 is vortexed and stirred under reflux at 40°C to 60°C, and the mixture is cooled and neutralized at room temperature in step 1-2-3. Taxanthine methanol can be effectively synthesized.
  • the mixture of steps 1-2-3 in which the astaxanthin transesterification reaction is completed is mixed with hexane and petroleum ether.
  • 1-3-1 step of vortexing by mixing with one or two compounds selected from) A 1-32 step of separating the upper layer by centrifuging the mixture by rotating the mixture at high speed; A 1-33 step of drying the separated first 1-32 step mixture under reduced pressure;
  • the mixing ratio of the astaxanthin methanol and hexane or petroleum ether which is the mixture of the first step 1-2-3, in which the astaxanthin transesterification reaction is completed, is 1:5 to 10 It can be mixed in a volume ratio of. More preferably, the mixing ratio of astaxanthin methanol and hexane or petroleum ether may be mixed in a volume ratio of 1:7.
  • step 1-3-2 the upper layer portion may be separated by centrifugation by rotating the mixture in step 1-3-1 at 3000 rpm to 4000 rpm.
  • step 1-3-3 can be obtained by lowering the pressure of the separated step 1-3-2 mixture and drying the temperature at 40°C to 60°C under reduced pressure for 1 to 5 hours.
  • ester reaction of the present invention is summarized, it can be expressed as follows.
  • the step of esterifying using a saturated fatty acid in the method for producing astaxanthin monoester of the present invention is a 2-1-1 of mixing an activator, a catalyst, and a saturated fatty acid with the compound of step 1-3-4. step; Step 2-1-2 of reacting the mixture of step 2-1-1 at room temperature for 1 hour to 3 hours; A 2-1-3 step of repeating the 2-1-2 step 2 to 4 times; It may include; a 2-1-4 step of evaporating by depressurizing the mixture of the step 2-1-3.
  • a compound having may be used, and preferably, pH4.0 to pH6.0 may be used.
  • the use of the compound represented by the following formula (1) is useful for activating the carboxyl group of a saturated fatty acid.
  • the catalyst to be mixed in step 2-1-1 may be a nucleophilic catalyst, and preferably, the following formula (3) (where R is a hydrogen atom or an alkyl having 1 to 10 carbon atoms unsubstituted or substituted with a nitrogen atom) ) Can be used.
  • R may use an NMe2 group, and when the compound of Formula 4 is used, there is an advantage of stabilizing resonance of the pyridine structure.
  • a compound represented by the following formula (5) (where n is 2 to 5) may be used.
  • a compound represented by the following formula (6) may be used.
  • the activator, catalyst, and saturated fatty acid of the present invention use a mass ratio of 1:0.5 to 1.5:0.5 to 1.5, the efficiency of synthesizing astaxanthin monoether due to activation of the carboxyl group increases.
  • step 2-1-2 the mixture of step 2-1-1 may be reacted at 10° C. to 30° C. for 1 to 3 hours. More preferably, the mixture of the step 2-1-1 may be reacted at 20° C. for 1 hour to 3 hours.
  • step 2-1-4 can be obtained by lowering the pressure of the mixture and drying the mixture under reduced pressure at 40°C to 60°C for 1 to 5 hours.
  • FIG. 11 shows the HPLC results in the case of performing a monoester synthesis reaction without any pretreatment of supercritical astaxanthin. As shown in FIG. 2, it can be seen that most of them exist in the form of diesters without significant differences before and after synthesis. In addition, it is necessary to convert astaxanthin in an ester form into a free form, and proceed with a monoester synthesis reaction using this.
  • FIG. 13 shows HPLC results after synthesis of ester astaxanthin using free astaxanthin.
  • No. 1 is a graph in which the monoester synthesis reaction proceeded without adding anything
  • No. 2 is a graph in which decanoic acid was added and the monoester synthesis reaction was proceeded
  • No. 3 is a graph showing a diester synthesis reaction in which decanoic acid was added. Residues that are released upon conversion to the free form remain in the solution, and can be used in the synthesis of astaxanthin in the ester form.
  • Natural astaxanthin oleoresin derived from Hematococcus prualis isolated by supercritical liquid extraction using carbon dioxide, was purchased from Yunnan Alphy Becheth (Chuxiong, China) and stored at -20°C to avoid thermal degradation. This product was found to contain 10% astaxanthin.
  • Ast-N extracted from Hematococcus prualis (Sample 1 dissolved in acetone) was first converted to Ast-F by trans-esterification in order to remove fatty acid chains of different lengths.
  • The% linear concentration gradient was gradually increased, and then the ratio of solvent B was maintained at 100% for 4 minutes, and then the ratio of solvent A was maintained at 100% for 8 minutes. All samples including the standard material were diluted in acetone and used. Reference recovered energy-efficient astaxanthin from microalgae.
  • OD sample is the absorbance when there is an astaxanthin sample
  • OD control is the absorbance when there is no astaxanthin sample.
  • RAW 264.7 and B16F10 cells were purchased from Cellline Bank in Korea (Seoul, Korea), and HaCaT cells were purchased from ATCC (Manassas, VA, USA).
  • RAW 264.7, B16F10, HaCaT cells were first seeded with an uncoated 96-well cell culture plate at a density of 5 ⁇ 10 4 , 1 ⁇ 10 4 , and 0.8 ⁇ 10 4 cells/well, respectively, and 10% (v/v) High glucose (4.5 g/L) DMEM (Dulbecco's modified Eagle's medium) medium supplemented with Fetal bovine serum (FBS) and 1% penicillin/streptomycin (Gibco, Grand Island, NY, USA) at 37°C.
  • DMEM Dynamiconite
  • FBS Fetal bovine serum
  • penicillin/streptomycin Gabco, Grand Island, NY, USA
  • NO nitrogen oxides
  • RAW 264.7 macrophage cells were first seeded in 96-well cell-culture plates at a density of 5 ⁇ 10 4 cells/well.
  • Cells in DMEM supplemented with 10% (v/v) FBS and 1% penicillin/streptomycin were incubated at 37° C. for 24 hours in 5% CO2, and 1 ⁇ g/mL LPS (lipopolysaccharides; Sigma-Aldrich) for control was added to each well except that. Astaxanthin samples (Samples 1-3) were added to each well at various concentrations.
  • RAW 264.7 cells were initially treated with astaxanthin samples (samples 1-3) as described above, and then total RNA was extracted using NucleoSpin RNA Plus (Macherey-Nagel, Duren, Germany). Next, 150ng of total RNA was converted into cDNA using an M-MLV cDNA synthesis kit (Enzynomics, Daejeon, Korea), and gene expression was analyzed by qPCR (quantitative polymerase chain reaction). Specifically, qPCR was performed at 95°C for 10 minutes using a specific gene primer (500nM; Table 2), then 95°C for 10 seconds, 60°C for 15 seconds, 72°C for 30 seconds at 35 cycles 1X PreMix (Enzynomics).
  • Astaxanthin exists in various structural forms in nature.
  • Hematococcus pruviais known as the most abundant source of Ast-N, has three forms: Ast-F, Ast-mE, and Ast-dE.
  • Ast-E ester-formed astaxanthin
  • Ast-N example 1 consisting of Ast-mE and Ast-dE was first converted to Ast-F by removing fatty acids using dehydrated basic methanol (step 1 in Fig. 1). I did.
  • saponification can be used to prepare Ast-F, but the fatty acid after the saponification reaction contains an active carboxyl group capable of binding to Ast-F in the subsequent esterification reaction, so Ast- It is difficult to prepare E (decanoic acid, step 2 in Fig. 1).
  • E decanoic acid, step 2 in Fig. 1
  • the transesterification used in this example produces Ast-F in addition to the fatty acid methyl ester (Sample 2)
  • the added decanoic acid is Ast- It only reacted with the hydroxyl group of F.
  • Ast-E (Sample 3) with a short-length fatty acid chain (C10) was prepared to analyze various types of antioxidant activity of astaxanthin (Ast-F, Ast-mE, Ast-dE) with a constant fatty acid chain length. Can be facilitated.
  • samples 1-3 Prepared samples (Samples 1-3) containing different forms of astaxanthin (Ast-N, Ast-F, Ast-E) were characterized by HPLC.
  • the interpretation standard of AST-F was analyzed by HPLC.
  • the hold time was centered at 3.963 minutes.
  • chromatograms of other forms of astaxanthin were obtained.
  • the main peaks of Ast-N were 11.477, 13.627, 16.543, 20.450, and 21.373 minutes.
  • the first peak corresponds to Ast-F
  • the last two peaks correspond to Ast-mE
  • the last two peaks correspond to Ast-mE linked to decanoic acid
  • the second peak corresponds to Ast-mE linked to long fatty acids.
  • small fatty acids having an active carboxyl group can be produced as a by-product along with fatty acid methyl esters due to the generation of water during transesterification (step 1; Fig. 1) (step 2; Fig. 1), so that Ast-mE having long fatty acids is also It can be produced upon esterification (step 2; Fig. 1).
  • Table 3 shows three samples (1) determined by measuring the area under the peak (Fig. 2) and calculating the relative ratio of all forms of astaxanthin (Ast-F, Ast-mE, Ast-dE) found in each sample. , 2, 3) represent the relative amounts of all forms of astaxanthin.
  • Sample 3 which contained a higher amount of Ast-mE than Ast-dE, showed slightly higher antioxidant activity than that of Sample 1, which had a higher amount of Ast-dE than Ast-mE.
  • Sample 3 showed the best radical vitrification removal activity, the overall difference in antioxidant activity in vitro among the three samples was not significant.
  • the cytotoxicity of three astaxanthin samples (1 ⁇ 3) against B16F10 (murine melanoma), HaCaT (human keratinocyte), and Raw 264.7 (murine macrophage) cells was evaluated by MTT test.
  • the results of FIG. 4 show that all three astaxanthin samples were cytotoxic to 15 ⁇ m. A significant decrease in cell viability of less than 70%, sensitive to environmental conditions, was observed at concentrations above 10 ⁇ M. Based on these results, the maximum concentration for evaluating the cellular activity of the astaxanthin sample was established. Specifically, 5 ⁇ M astaxanthin was used.
  • astaxanthin is known as a powerful antioxidant that stops the induction of inflammation in the biological system.
  • murine macrophage Raw 264.7 cells were stimulated by LPS to create and release various immunologically active mediators such as tumor necrosis factor (TNF)- ⁇ , interleukin-1 ⁇ , and IL-6.
  • TNF tumor necrosis factor
  • IL-6 interleukin-6
  • This mediator induces transcription of nitrogen oxide synthase, which can generate large amounts of NO, and is thought to be involved in the cytotoxic effect of inflammation.
  • the resulting level of NO was determined by the Griess reaction, a spectrophotometric measurement performed to measure the nitrate ion level.
  • sample 3 prepared by chemical transformation was most effective in reducing the expression of Nrf2 and MnSOD. These results are consistent with the results of FIG. 5 on the antioxidant effect of astaxanthin. Overall, the highest anti-inflammatory and antioxidant activity was observed in Sample 3, which contained more Ast-mE than Ast-dE.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 아스타잔틴 모노에스테르의 제조방법에 관한 것으로서, 보다 구체적으로는 염기성 알코올 용액을 제조하는 제1-1 단계, 아스타잔틴을 에스테르 교환 반응하는 제1-2 단계, 아스타잔틴을 추출하는 제1-3 단계, 아스타잔틴 모노에스테르를 합성하는 제2 단계를 포함하는 아스타잔틴 모노에스테르의 제조방법에 관한 것이다.

Description

에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법
본 발명은 아스타잔틴 모노에스테르의 제조방법에 관한 것으로서, 보다 구체적으로는 염기성 알코올 용액을 제조하는 제1-1 단계, 아스타잔틴을 에스테르 교환 반응하는 제1-2 단계, 아스타잔틴을 추출하는 제1-3 단계, 아스타잔틴 모노에스테르를 합성하는 제2 단계를 포함하는 아스타잔틴 모노에스테르의 제조방법에 관한 것이다.
아스타잔틴은 카로테노이드 색소의 일종으로 랍스터에서 분리될 수 있고, 연어, 송어 등 어류 살의 붉은 색을 내거나 새우 등 갑각류의 가열 시 붉은 색을 내는 색소로 알려져 있다. 아스타잔틴은 항산화 기능을 가지고 있어 체내 산화인하여 유발되는 각종 질병에 대한 예방과 치료활성이 있어 인체 건강기능 증진소재로 사용이 증가하고 있다.
아스타잔틴은 에스테르가 결합되지 아니한 유리형보다 한 개 또는 두 개의 에스테르가 존재하는 에스테르 형태가 어류에 잘 흡수되고 사료로 사용할 때 근육으로 쉽게 이행되어 사료의 사용 효율이 우수하며, 유리형 보다 열과 산소에 안정하기 때문에 유리형 아스타잔틴을 원료로 디에스테르형으로 제조하는 방법이 공지되어 있다. 또한, 선행문헌 1(일본특허 제4410675호)에 의하면, 모노에스테르형의 아스타잔틴이 디에스테르형의 아스타잔틴보다 경구흡수성이 우수한 것으로 알려져 있다. 다만, 모노에스테르형의 아스타잔틴은 생산되지 않아 효율성이 저하되는 문제가 있다.
본 발명은 상기와 같은 종래기술의 문제점과 과거로부터 요청되어온 기술적 과제를 해결하는 것을 목적으로 한다.
구체적으로, 본 발명은 염기성 알코올 용액을 제조하는 제1-1 단계, 아스타잔틴을 에스테르 교환 반응하는 제1-2 단계, 아스타잔틴을 추출하는 제1-3 단계, 아스타잔틴 모노에스테르를 합성하는 제2 단계를 포함하는 아스타잔틴 모노에스테르의 제조방법을 제공하는 것을 목적으로 한다.
본 발명의 일실시 형태는 염기성 알코올 용액을 제조하는 제1-1 단계; 아스타잔틴을 에스테르 교환 반응하는 제1-2 단계; 아스타잔틴을 추출하는 제1-3 단계;아스타잔틴 모노에스테르를 합성하는 제2 단계;를 포함하는 아스타잔틴 모노에스테르의 제조방법에 관한 것이다.
여기서, 상기 염기성 알코올 용액을 제조하는 제1-1 단계는, 증류수에 수산화나트륨을 혼합하는 제1-1-1 단계; 메탄올, 에탄올, 프로판올에서 선택된 1종 또는 2종 이상의 혼합물에 상기 제1-1-1 단계의 혼합물을 혼합하는 제1-1-2 단계; 상기 제1-1-2 단계의 혼합물을 탈수 반응하는 제1-1-3 단계; 침전물을 제거하면서 상기 제1-1-3 단계을 2회 내지 4회 반복하는 제1-1-4 단계; 미세 필터를 사용하여 상기 제1-1-4 단계의 혼합물을 필터링 하는 제1-1-5 단계;를 포함한다.
또한, 상기 아스타잔틴을 에스테르 교환 반응하는 제1-2 단계는, 초임계 추출된 아스타잔틴을 상기 제1-1-5 단계의 혼합물에 혼합하는 제1-2-1 단계; 상기 제1-2-1 단계 혼합물을 볼텍싱(vortexing) 후 환류 교반시키는 제1-2-2 단계; 상기 제1-2-2 단계 혼합물을 상온으로 냉각하고 중화시키는 제1-2-3 단계;를 포함한다.
또한, 상기 아스타잔틴을 추출하는 제1-3 단계는, 아스타잔틴 에스테르 교환 반응이 완료된 상기 제1-2-3 단계 혼합물을 헥세인 및 석유에테르(petroleum ether)에서 선택되는 1종 또는 2종의 화합물에 혼합하여 볼텍싱하는 제1-3-1 단계; 상기 제1-3-1 단계 혼합물을 고속으로 회전하여 원심분리하여 상층부를 분리하는 제1-3-2 단계; 상기 분리된 제1-3-2 단계 혼합물을 감압 건조하는 제1-3-3 단계; 상기 제1-3-3 단계의 혼합물을 디클로로메탄, 디클로로에탄, 디클로로부탄에서 선택되는 1종의 화합물에 혼합하여 용해시키는 제1-3-4 단계; 를 포함한다.
또한, 아스타잔틴 모노에스테르를 합성하는 제2 단계는, 상기 제1-3-4 단계의 화합물에 활성화제, 촉매, 포화지방산을 혼합하는 제2-1-1 단계; 상기 제2-1-1 단계 혼합물을 상온에서 1시간 내지 3시간을 반응시키는 제2-1-2 단계; 상기 제2-1-2 단계를 2회 내지 4회 반복하는 제2-1-3 단계; 상기 제2-1-3 단계 혼합물을 감압하여 증발시키는 제2-1-4 단계;를 포함한다.
본 발명의 아스타잔틴 모노에스테르의 제조방법에 의하면, 제조 효율이 우수한 아스타잔틴 모노에스테르를 제조하는 것이 가능하다.
도 1. 천연 아스타산틴(Ast-N)이 프리형 아스타산틴(Ast-F)과 데카노산(Ast-E)을 가진 에스테르형 아스타산틴으로 화학적 변환을 나타낸다. R1은 길이가 다른 탄소 사슬로 12부터 24까지의 범위로 알려져 있으며, R2는 데카노산(C10)에서 유래한다.
도 2. (A) Ast-F, (B) 샘플 1, (C) 샘플 2, (D) 샘플 3의 HPLC 크로마토그램을 나타낸다.
도 3. (A) 샘플 1, (B) 샘플 2, (C) 샘플 3의 아스타산틴에서 DPPH 라디칼 제거 활동을 나타낸다. 결과는 3개의 독립 실험 중에서 평균 ± S.D로 표시된다.
도 4. (A) B16F10, (B) HaCaT, (C) 다른 형태의 아스타산틴에 노출된 Raw 264.7 세포의 세포독성을 나타낸다. 3개의 독립 실험 중에서 결과는 평균 ± S.D로 표시된다.
도 5. (A) B16F10 세포와 (B) HaCaT 세포에서 2.5와 5μM의 서로 다른 형태의 아스타산틴을 함유한 각 샘플(1~3)의 세포 항산화 활동을 나타낸다. 결과는 3개의 독립 실험 중에서 평균 ± S.D로 표시된다.
도 6. LPS-자극된 Raw 274.7 대식세포에 대한 아스타산틴 샘플(1~3)의 항염증 활동을 나타낸다. 결과는 3개의 독립 실험 중에서 평균 ± S.D로 표시된다.
도 7. 항염증 및 항산화 활동과 관련된 유전자 발현을 나타낸다. (A) IL-1β, (B) IL-6, (C) TNF-α, (D) NOX-2, (E) Nrf2, (F) MnSOD. 데이터는 세 가지 개별 실험의 평균 ± S.D를 나타낸다. *p < 0.05, **p < 0.01 vs. control group; #p < 0.05, #p < 0.01 vs. LPS group
도 8. 아스타산틴의 샘플 1 내지 3의 개략도를 나타낸다.
도 9 다른 농도에서의 해석 표준으로 아스타산틴 474 nm의 흡광도를 측정하여 얻은 검정곡선을 나타낸다. 결과는 세 가지 독립 실험의 평균 ± SD로 표시된다.
이하, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 본 발명의 기술적 사상을 용이하게 실시할 수 있을 정도로 상세히 설명하기 위하여, 본 발명의 가장 바람직한 실시예를 첨부 도면을 참조하여 설명하기로 한다. 또한, 본 발명을 설명함에 있어, 관련된 공지 구성 또는 기능에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명은 생략한다.
하기에서 본 발명의 아스타잔틴 모노에스테르의 제조방법의 구체적인 제조 단계를 설명한다.
본 발명의 아스타잔틴 모노에스테르의 제조방법의 염기성 알코올 용액을 제조하는 제1-1 단계는 하기의 단계를 포함할 수 있다. 예를 들어, 증류수에 수산화나트륨을 혼합하는 제1-1-1 단계; 메탄올, 에탄올, 프로판올에서 선택된 1종 또는 2종 이상의 혼합물에 상기 제1-1-1 단계의 혼합물을 혼합하는 제1-1-2 단계; 상기 제1-1-2 단계의 혼합물을 탈수 반응하는 제1-1-3 단계; 침전물을 제거하면서 상기 제1-1-3 단계을 2회 내지 4회 반복하는 제1-1-4 단계; 미세 필터를 사용하여 상기 제1-1-4 단계의 혼합물을 필터링 하는 제1-1-5 단계;를 포함할 수 있다.
여기서, 증류수에 수산화나트륨을 혼합하는 제1-1-1 단계는 증류수 0.01ml 내지 1ml에 수산화나트륨 0.01g 내지 0.1g을 혼합할 수 있다. 즉, 증류수 및 수산화나트륨의 혼합비(수산화나트륨/증류수 ml/g) 0.01ml/g 내지 10 ml/g, 보다 바람직하게는 0.1ml/g 내지 1 ml/g을 사용할 수 있다.
또한, 제1-1-2 단계는 메탄올, 에탄올, 프로판올에서 선택된 1종 또는 2종 이상의 혼합물 50ml에 상기 제1-1-1 단계의 혼합물을 혼합할 수 있다. 즉, 메탄올, 에탄올, 프로판올에서 선택된 1종 또는 2종 이상의 혼합물에 대한 상기 제1-1-1 단계의 혼합물은 부피비로 50:0.1 내지 1을 사용할 수 있다.
또한, 제1-1-3 단계는 하기 화학식 1-1 또는 화학식 1-2의 화합물을 바람직하게 사용하여 탈수 반응을 진행시킬 수 있다.
Figure PCTKR2020014312-appb-img-000001
제1-1-4 단계는 침전물을 제거하면서 상기 제1-1-3 단계을 2회 내지 4회 반복할 수 있다. 더욱 바람직하게는 상기 제1-1-3 단계을 3회 반복할 수 있다. 또한, 제1-1-5 단계는 0.1㎛ 내지 0.5㎛의 필터를 사용하여 상기 제1-1-4 단계의 혼합물을 필터링 할 수 있다. 더욱 바람직하게는 0.2㎛의 필터를 사용할 수 있다.
본 발명의 아스타잔틴 모노에스테르의 제조방법의 아스타잔틴의 에스테르 교환 반응하는 제1-2 단계는 초임계 추출된 아스타잔틴을 상기 제1-1-5 단계의 혼합물에 혼합하는 제1-2-1 단계; 상기 제1-2-1 단계 혼합물을 볼텍싱(vortexing) 후 환류 교반시키는 제1-2-2 단계; 상기 제1-2-2 단계 혼합물을 상온으로 냉각하고 중화시키는 제1-2-3 단계;를 포함할 수 있다.
상기 제1-2-2 단계는 상기 제1-2-1 단계 혼합물을 볼텍싱(vortexing) 후 40℃ 내지 60℃로 환류 교반시키고 제1-2-3 단계의 상온 냉각과 중화 단계에 의하여 아스타잔틴 메탄올을 효과적으로 합성할 수 있다.
본 발명의 아스타잔틴 모노에스테르의 제조방법의 아스타잔틴을 추출하는 제1-3 단계는 아스타잔틴 에스테르 교환 반응이 완료된 상기 제1-2-3 단계 혼합물을 헥세인 및 석유에테르(petroleum ether)에서 선택되는 1종 또는 2종의 화합물에 혼합하여 볼텍싱하는 제1-3-1 단계; 상기 제1-3-1 단계 혼합물을 고속으로 회전하여 원심분리하여 상층부를 분리하는 제1-3-2 단계; 상기 분리된 제1-3-2 단계 혼합물을 감압 건조하는 제1-3-3 단계; 상기 제1-3-3 단계의 혼합물을 디클로로메탄, 디클로로에탄, 디클로로부탄에서 선택되는 1종의 화합물에 혼합하여 용해시키는 제1-3-4 단계;를 포함할 수 있다.
여기서, 제1-3-1 단계는 아스타잔틴 에스테르 교환 반응이 완료된 상기 제1-2-3 단계 혼합물인 아스타잔틴 메탄올과 헥세인 또는 석유에테르(petroleum ether)의 혼합비는 1:5~10의 체적비로 혼합할 수 있다. 더욱 바람직하게는 아스타잔틴 메탄올과 헥세인 또는 석유에테르(petroleum ether)의 혼합비는 1:7의 체적비로 혼합할 수 있다.
또한, 제1-3-2 단계는 상기 제1-3-1 단계 혼합물을 3000rpm 내지 4000rpm으로 회전하여 원심분리하여 상층부를 분리할 수 있다. 또한, 제1-3-3 단계는 상기 분리된 제1-3-2 단계 혼합물을 압력을 낮추고, 온도를 40℃내지 60℃에서 1시간 내지 5시간 동안 감압 건조하여 얻을 수 있다
본 발명의 에스테르 반응을 정리하면 하기와 같이 나타낼 수 있다.
Figure PCTKR2020014312-appb-img-000002
본 발명의 아스타잔틴 모노에스테르의 제조방법의 포화지방산을 사용하여 에스테르화를 하는 단계는 상기 제1-3-4 단계의 화합물에 활성화제, 촉매, 포화지방산을 혼합하는 제2-1-1 단계; 상기 제2-1-1 단계 혼합물을 상온에서 1시간 내지 3시간을 반응시키는 제2-1-2 단계; 상기 제2-1-2 단계를 2회 내지 4회 반복하는 제2-1-3 단계; 상기 제2-1-3 단계 혼합물을 감압하여 증발시키는 제2-1-4 단계;를 포함할 수 있다.
제2-1-1 단계에서 혼합하는 활성화제로서, 수용성 R1N=C=NR2 (여기서, R1 및 R2는 수소원자, 또는 치환되지 않거나 탄소 원자가 질소 원자로 치환된 탄소원자수 1 내지 10의 알킬) 구조를 갖는 화합물을 사용할 수 있으며, 바람직하게는 pH4.0 내지 pH6.0을 사용할 수 있다. 예를 들어, 하기 화학식 1의 화합물을 사용하면 포화지방산의 카르복실기를 활성화하는데 유용하다.
[화학식 2]
Figure PCTKR2020014312-appb-img-000003
제2-1-1 단계에서 혼합하는 촉매는 친핵성 촉매일 수 있고, 바람직하게는 하기 화학식 3(여기서, R은 수소원자, 또는 치환되지 않거나 탄소 원자가 질소 원자로 치환된 탄소원자수 1 내지 10의 알킬)을 사용할 수 있다.
[화학식 3]
Figure PCTKR2020014312-appb-img-000004
바람직하게는 R은 NMe2기를 사용할 수 있고, 하기 화학식 4의 화합물을 사용하면 피리딘 구조의 공명 안정화가 되는 장점이 있다.
[화학식 4]
Figure PCTKR2020014312-appb-img-000005
제2-1-1 단계에서 혼합하는 포화지방산으로서 하기 화학식 5의 화합물(여기서, n은 2 내지 5)을 사용할 수 있다.
[화학식 5]
Figure PCTKR2020014312-appb-img-000006
바람직하게는 하기 화학식 6의 화합물을 사용할 수 있다.
[화학식 6]
Figure PCTKR2020014312-appb-img-000007
본 발명의 활성화제, 촉매, 포화지방산은 1:0.5~1.5:0.5~1.5 질량비를 사용하는 것이 카르복실기가활성화에 따른 아스타잔틴 모노에테스테르 합성 효율이 높아진다.
한편, 상기 제2-1-2 단계는 상기 제2-1-1 단계 혼합물을 10℃내지 30℃에서 1시간 내지 3시간을 반응시킬 수 있다. 더욱 바람직하게는 상기 제2-1-1 단계 혼합물을 20℃에서 1시간 내지 3시간을 반응시킬 수 있다. 또한, 상기 제2-1-4 단계는 혼합물을 압력을 낮추고, 온도를 40℃내지 60℃에서 1시간 내지 5시간 동안 감압 건조하여 얻을 수 있다.
본 발명의 아스타잔틴 모노에테스테르 합성 반응을 정리하면 하기와 같이 나타낼 수 있다.
Figure PCTKR2020014312-appb-img-000008
도 10은 초임계 추출에 의한 아스타잔틴(astaxanthin)의 HPLC를 나타내는 결과이다. 조류(H. pluvialis) 내에는 유리형(free form)보다 에스테르형(ester form)의 아스타잔틴이 다량 존재하게 된다. 조류(H. pluvialis) 내에 저장하는 아스타잔틴은 주로 에스테르(ester) 형태이며, 에스테르 잔기의 탄소체인(carbon chain) 형태가 다양하다.
도 11는 초임계 추출 아스타잔틴을 어떠한 전처리 과정 없이, 모노에스테르(monoester) 합성 반응을 진행하는 경우의 HPLC 결과를 나타낸다. 도 2에 나타난 바와 같이, 합성 전, 후에 큰 차이 없이 대부분 디에스테르(diester) 형태로 존재하는 것을 알 수 있다. 또한, 에스테르(Ester) 형태의 아스타잔틴을 유리형(free form)으로 전환하고, 이를 이용하여 모노에스테르 합성 반응을 진행할 필요가 있다.
도 12은 초임계 추출 아스타잔틴을 비누화(Saponification) 과정의 전후의 HPLC 결과를 나타낸다. 도 3에 나타난 바와 같이, 비누화(Saponification) 과정 후에, 에스테르(ester) 형태의 아스타잔틴이 유리형으로 전환되는 것을 확인하였다.
도 13는 유리형 아스타잔틴을 이용한 에스터 아스타잔틴 합성 후의 HPLC 결과를 나타낸다. 도 4에 나타난 바와 같이 초임계 추출 아스타잔틴을 유리형으로 전환 후, No. 1은 아무것도 넣지 않고 모노에스터 합성 반응 진행한 그래프이며, No. 2는 데칸산을 넣고 모노에스테르 합성 반응을 진행한 그래프이며, No. 3은 데칸산을 넣고 디에스테르 합성 반응을 진행한 그래프이다. 유리형으로 전환 시에 떨어져나간 잔기들이 용액내에 잔류하며, 에스테르(ester) 형태의 아스타잔틴 합성 과정에 이용될 수 있다.
하기 표에서 초임계 추출된 아스타잔틴을 비누화 과정을 통하여 모노에스테르 합성을 한 경우, 모노에스테르가 11.6% 존재하는 것을 확인하였다.
Free form Monoester form Diester form
Retention time 3.8~4.5 min 6.9~7.9 min 14.9~16.4 min 20~25 min
초임계 추출 1.4 % 2.4 % 3.9~12.5 % 70.9 %
Saponification 70.3 % 1.6 % 0 % 10.4 %
Saponification→
esterfication(mono)
2 %
11.6 %
20.5 % 1)
39.7 %
(실험)
2.1. 천연 아스타산틴의 화학적 변화
이산화탄소를 이용한 초임계액 추출에 의해 격리된 헤마토코쿠스 프루알리스 유래의 천연 아스타산틴 올레오레진은 알피(Yunnan Alphy Becheth, Chuxiong, 중국)에서 구입해 -20℃에 저장해 열저하를 피했다. 이 제품에는 아스타산틴이 10% 함유된 것으로 확인됐다. 헤마토코쿠스 프루알리스(아세톤에 용해된 샘플 1)에서 추출한 Ast-N은 서로 다른 길이의 지방산 사슬을 제거하기 위해 먼저 트랜스-에스테르화 반응에 의해 Ast-F로 변환되었다. 구체적으로 수산화나트륨(0.0072g, 삼춘화학)을 50mL 메탄올(삼춘화학)에 넣고 무수 황산나트륨(삼춘화학)을 섞어 잔류 수분을 제거했다. 준비된 기본 알코올 용액은 0.2 μm 주사기 필터로 걸러낸 뒤 50℃에서 흔들림 인큐베이터에 1 g의 Ast-N을 넣어 4시간 동안 배양한 뒤, Ast-F라는 이름의 분자를 석유에테르(삼춘화학)로 추출했다. 에테르를 증발시키고, 그 결과로 생긴 Ast-F는 각각 에스테리화 반응이나 HPLC 분석을 위해 디클로로메탄(삼춘화학)이나 아세톤(HPLC급, 삼춘화학)에 용해되어 샘플 2로 명명되었다. 마지막으로 샘플 2의 Ast-F는 C10 스트레이트 체인 포화지방산인 데카노산(일본 도쿄화학공업)을 이용한 스테글리히 에스테리화법에 의해 Ast-E로 변형되었다. 구체적으로는 디클로로메탄의 Ast-F를 화학식 6의 화합물(0.12 mM), 화학식 2의 화합물(0.14 mM), 화학식 4의 화합물(0.11 mM)과 순차적으로 혼합하였다. 20℃에서 2시간 배양하였다. 이러한 과정을 3회 반복하고 디클로로메탄은 증발하였다. 그 결과로 나온 Ast-E는 추가 분석을 위해 아세톤(샘플 3)에 용해되었다.
2.2. HPLC 측정
측정 조건으로서, Waters symmetry C 18 column (4.6 x 250mm, 5μm, waters, USA), UV/visible detector (474nm), Column 온도는 25°C로 유지하였으며 유속은 1mL/min으로 설정하였다. 이동상은 용매 A (methanol : tert-butyl methyl ether : 1% (w/v) phosphoric acid, 81:15:4. v/v), 용매 B ( methanol : tert-butyl methyl ether : 1% (w/v) phosphoric acid, 16:80:4, v/v)를 사용하였으며, 각각의 이동상 용매는 0~15분까지 용매 A를 100%로 한 후, 23분까지 용매 B를 시간에 따라 0~100%선형 농도 구배를 하여 점차적으로 증가시켰고, 그 후 4분 동안 용매 B의 비율을 100%로 유지한 다음 8분 동안 용매 A의 비율을 100%로 유지하였다. Standard 물질을 포함한 모든 시료는 아세톤에 희석하여 사용하였다. Reference는 미세조류로부터의 에너지 효율적인 아스타잔틴을 회수하였다.
2.3. 항산화 활동을 위한 체외 검사
아스타산틴의 체외 항산화 활동을 측정하기 위해 DPPH 유리기 제거 분석을 실시했다. 구체적으로는 메탄올에 용해된 DPPH(1,1-diphenyl-2-picryl hydrazyl)(DPPH; 10 mM; 시그마-알드리치) 180 μL에 각 시료(샘플 1~3) 20 μL를 더했다. 37℃에서 30분간 배양한 후 마이크로플레이트 판독기에서 광학 밀도(OD)를 517nm에서 평가하였다. DPPH 유리기 제거 분석(%)을 나타내는 결과는 다음과 같은 방정식(%) = [1-(OD Sample/OD Control)] × 100(%)을 사용하여 표현되었다. 여기서 OD sample은 아스타산틴 샘플이 있는 경우 흡광도, OD control은 아스타산틴 샘플이 없는 경우 흡광도이다.
2.4. 세포독성 시험
RAW 264.7과 B16F10 셀은 한국 셀라인뱅크(서울, 한국)에서 구입하고, HaCaT 셀은 ATCC(Manassas, VA, 미국)에서 구입했다. RAW 264.7, B16F10, HaCaT 세포는 각각 5 × 10 4, 1 × 10 4, 0.8 × 10 4 세포/웰의 밀도에서 코팅되지 않은 96-웰 세포 배양판으로 처음 시딩되었고, 10% (v/v) 소태아혈청(Fetal bovine serum, FBS) 및 1% penicillin/streptomycin (Gibco, Grand Island, NY, USA)로 보충된 높은 글루코스(4.5 g/L)의 DMEM(Dulbecco's modified Eagle's medium) 배지로 37℃에서 24시간 동안 배양되었다. 다음으로, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT)가 0.5mg/mg의 농도로 각각의 웰에 첨가되었다. 37℃에서 24시간 동안 어두운 곳에서 배양되었다. 각각의 웰에 20 % SDS 용액 50 μL를 첨가한 후, 플레이트는 밤새 어둠 속에서 배양하였다. 끝으로, OD는 마이크로플레이트 판독기에서 595 nm에서 평가되었다. 아세톤이 세포 성장에 미치는 영향을 배제하기 위해 아스타산틴 샘플의 최종 아세톤 농도는 5% 미만이어서 세포 생존능을 계산하는 블랭크로 사용하였다. 세포 생존능이 블랭크의 70% 미만으로 감소하면 화합물은 세포독성 잠재력을 갖는 것으로 간주되었다.
2.5. 세포 항산화 활성 검사(CAA)
B16F10과 HaCaT 세포의 ROS 생산을 측정하기 위해, 산화 민감 지표인 2',7'-DCFH-DA(2',7'-dichlorofluorescein 3'6'-diacetate;시그마-알드리치)를 사용했다. ROS가 존재하는 상태에서 DCFH는 형광 DCF(2',7'-dichlorofluorescein)으로 산화되며, 이 흡수율은 마이크로플레이트 판독기에서 측정할 수 있다. 모든 세포선 세포는 96-웰 세포-배향판에 0.8~1 × 10 4 세포/웰의 밀도로 시딩하였다. 10 % (v/v) FBS, 1% 페니실린/스트렙토마이신으로 보충한 DMEM의 세포를 24시간 5% CO2에서 배양한 후, 1x PBS로 세포를 세척하였다. 각각의 웰에 10μM DCFH-DA를 첨가한 후 37℃에서 1시간 동안 배양하였다. 세포 내부에서만 발생하는 산화 반응을 측정하기 위해 1x PBS로 세척하여 매질 내 과잉 표시기를 제거하였다. 다음으로 아스타산틴 샘플(샘플 1~3)을 과산화수소(H 2O 2, 1mM, 시그마-알드리치)와 함께 각 웰에 첨가하여 30분 동안 산화스트레스를 유도하였고, 최종적으로 형광 강도를 마이크로플레이트 판독기에서 각각 485와 530nm의 여기 및 방출 파장으로 측정하였다. 선량 반응 곡선은 H 2O 2로 처리되지 않은 블랭크를 사용하여 설정되었다. ROS 제거 활동은 다음과 같은 방정식(%) = [(Ic - Is)/Ic] × 100을 사용하여 CAA(%)로 표현되었다. 여기서, Is는 다른 농도에서 아스타산틴이 존재하는 경우 H 2O 2에 노출되는 샘플의 강도, Ic는 아스타산틴이 없는 경우 H 2O 2에 노출되는 제어 샘플의 강도를 나타낸다.
2.6. 항염증 검사
RAW 264.7 세포에서 질소산화물(NO)의 생산을 측정하기 위해, Griess 반응을 통해 NO 농도를 측정했다. RAW 264.7 대식 세포(macrophage cells)는 처음 96-웰 셀-배양판에 5 × 10 4 셀/웰의 밀도로 시딩되었다. 10%(v/v) FBS와 1% 페니실린/스트렙토마이신으로 보충한 DMEM의 세포를 37℃에서 24시간 동안 5% CO2에서 배양하고, 1μg/mL LPS(lipopolysaccharides; 시그마-알드리치)를 제어를 위한 것을 제외하고 각 웰에 추가했다. 아스타산틴 샘플(샘플 1~3)은 다양한 농도로 각각의 웰에 첨가되었다. 이틀 동안 배양한 후, 각 웰에서 100 μL의 상청액을 채취하여 Griess 시약(5% 인산의 1% 설퍼닐아미드 및 물의 0.1% 나프틸에티렌디아민 디하이드로클로라이드) 100 μL를 별도의 96-well 플레이트에 혼합하였다. 25℃에서 15분간 배양한 후 540 nm에서 OD를 마이크로플리에트 판독기에서 측정하였다. 생산량(%)은 다음과 같은 방정식 (%) = (As/Ac) × 100을 사용하여 계산하였다. 여기서 Ac는 다른 농도에서 아스타산틴이 존재하는 상태에서 LPS에 피폭된 샘플의 흡광도, Ac는 아스타산틴이 없는 상태에서 LPS에 피폭된 대조 샘플의 흡광도이다.
2.7. mRNA 분석
RAW 264.7 세포는 위에서 설명한 대로 아스타산틴 샘플(샘플 1~3)로 처음에 처리되었고, 그 후 NucleoSpin RNA Plus(Macherey-Nagel, 독일 듀렌)를 사용하여 총 RNA를 추출했다. 다음으로 M-MLV cDNA 합성키트(Enzynomics, 한국 대전)를 사용하여 총 RNA의 150ng를 cDNA로 변환하였으며, 유전자 발현을 qPCR(quantitative polymerase chain reaction)으로 분석하였다. 구체적으로는 qPCR을 특이 유전자 프라이머(500nM; 표 2)를 이용하여, 10분 동안 95℃ 수행하고, 그 후 10초 동안 95 ℃, 15초 동안 60℃, 30초 동안 72℃를 35 사이클로 1X PreMix(Enzy노믹스)에서 수행하였다. 각 실험은 최소 3회 반복되었고, qPCR 데이터는 평균 ± 표준 편차(S.D.)로 표현되었다. 통계적으로 유의한 차이는 Dunnett의 검정에 따른 일원 배치 분석에 의해 계산되었다(Minitab, 버전 18). 0.05 미만의 양면 p-값은 통계적으로 중요한 것으로 간주되었다.
Gene-specific primers for qPCR experiments
Gene Forward primer [5'-3'] Reverse primer [5'-3']
Rplp0 TGAACATGCTGAACATCT TATAAATGCTGCCGTTGT
IL-1β GTCACAAGAAACCATGGCACAT GCCCATCAGAGGCAAGGA
IL-6 CTGCAAGAGACTTCCATCCAGTT AGGGGAAGGCCGTGGTTGT
TNF-α GGCTGCCCCGACTACGT ACTTTCTCCTGGTATGAGATAGCAAT
Nox2 CTACCTAAGATAGCAGTTGA CTAACATCACCACCTCATA
Nrf2 GGCCCAGCATATCCAGACA TGTGGGCAACCTGGGAGTAG
MnSOD GTGACTTTGGGTCTTTTGA GCTAACATTCTCCCAGTT
3. 결과 및 토론
3.1. 아스타산틴의 화학적 변화
아스타산틴은 자연에서 다양한 구조적 형태로 존재한다. 특히 Ast-N의 가장 풍부한 공급원으로 알려진 헤마토코쿠스 프루비아리스는 Ast-F, Ast-mE, Ast-dE의 3가지 형태를 가지고 있다. Ast-mE와 Ast-dE를 포함한 에스테르성형 아스타산틴(Ast-E)의 경우 길이가 다른 탄소 사슬을 가진 지방산이 에스테르 결합을 통해 Ast-F에 결합된다. 다른 형태의 아스타산틴을 준비하기 위해 Ast-mE와 Ast-dE로 구성된 Ast-N(샘플 1)을 탈수된 기본 메탄올(도 1의 1단계)을 사용하여 지방산을 제거하여 Ast-F로 처음 전환하였다. 특히, 비누화는 Ast-F를 준비하는 데 사용할 수 있지만, 비누화 반응 후의 지방산에는 이후의 에스테르화 반응에서 Ast-F와 결합할 수 있는 활성 카르복실 그룹이 포함되어 있어 특정 길이의 지방산을 가진 Ast-E를 준비하기가 어렵다(데카노산, 도 1의 2단계). 이와는 대조적으로 본 실시예에 사용된 트랜스에스트르화는 지방산 메틸에스테르(샘플 2) 외에 Ast-F를 생성하므로, 첨가된 데카노산은 후속 스테글리히 에스테르화 반응(도 1의 2단계)에서 Ast-F의 히드록실 그룹과 반응했을 뿐이다. 결과적으로 단 길이의 지방산 체인(C10)을 가진 Ast-E(샘플 3)을 준비하여 지방산 사슬의 길이가 일정한 아스타산틴(Ast-F, Ast-mE, Ast-dE)의 다양한 형태의 항산화 활동 분석을 용이하게 할 수 있다.
3.2. 아스타산틴의 특성화
다른 형태의 아스타산틴(Ast-N, Ast-F, Ast-E)을 포함하는 준비된 샘플(샘플 1~3)은 HPLC로 특징 지어졌다. 첫째, AST-F의 해석 표준은 HPLC에 의해 분석되었다. 도 2A와 같이, 유지 시간은 3.963분에 중심화되었다. 마찬가지로 아스타산틴의 다른 형태의 크로마토그램도 얻었다. 도 2B와 같이 Ast-N(샘플 1)의 주요 피크는 11.477, 13.627, 16.543, 20.450, 21.373분이었다. Ast-N은 길이가 다른 지방산과 결합된 아스타산틴을 함유하고 있기 때문에 첫번째 3 피크와 다음 2 피크는 각각 Ast-mE와 Ast-dE가 될 것으로 예측되었다. 또한 우리는 샘플 2의 Ast-F의 보유 시간이 분석 등급 Ast-F(도 2A)에 대한 결과와 잘 일치하는 트랜스에스테르화 반응(도 2C) 이후 3.943분에서 중심화되어 있음을 확인했다. 이러한 결과는 길이가 다른 지방산이 Ast-E에서 제거되었음을 명확히 보여준다. 마지막으로 데카노산(샘플 3)과의 에스테르화 반응 후 크로마토그램이 획득되었다. 도 2D의 결과에 따르면 샘플 3의 주요 피크는 3.787, 6.863, 14.973분이었다. 첫 번째 피크는 Ast-F에 해당하고, 마지막 2 피크는 Ast-mE에 해당하며, 마지막 2 피크는 데카노산과 연결된 Ast-mE와, 두 번째 피크는 긴 지방산과 연결된 Ast-mE와 일치한다. 특히 활성 카복실군이 있는 소지방산은 트랜스에스테르화(단계 1; 도 1) 중 물의 발생으로 인해 지방산 메틸에스테르와 함께 부산물로 생산될 수 있어(단계 2; 도 1) 긴 지방산을 갖는 Ast-mE도 에스테르화 시에 생산될 수 있다(단계 2; 도 1). 3가지 샘플(1, 2, 3)에서 모든 형태의 아스타산틴(Ast-F, Ast-mE, Ast-dE)의 상대적인 양은 피크 아래의 면적을 측정하여 측정하였다(도 2). 표 3에서 표시한 바와 같이, 샘플 3의 Ast-mE 양은 Ast-dE양보다 높았고, 샘플 3의 조성은 Ast-dE보다 풍부했던 샘플 1의 조성과는 다르다는 것을 시사했다. 전반적으로 화학적 변환에 의해 다른 형태의 아스타산틴을 성공적으로 합성했다.
하기 표 3는 피크(도 2) 아래의 면적을 측정하고 각 샘플에서 발견된 모든 형태의 아스타산틴(Ast-F, Ast-mE, Ast-dE)의 상대적 비율을 계산하여 결정한 3개의 샘플(1, 2, 3)에서 모든 형태의 아스타산틴의 상대적 양을 나타낸다.
Ast-F Ast-mE Ast-dE
Sample1 2.15 % 47.5 % 50.3 %
Sample2 89.5 % 5.57 % 4.95 %
Sample3 22.0 % 68.1 % 9.83 %
3.3. 아스타산틴의 체외 항산화 활성
준비된 다른 형태의 아스타산틴의 생물학적 활동을 평가하였다. 첫째, 시험관내 항산화 활동을 DPPH 유리화 제거 검사로 조사하였다. 원칙적으로 항산화제의 수소 공여능은 프리 유리화 DPPH(보라색)를 안정적인 DPPH(노란색)로 감소시켜, 517nm에서 흡광도 저하를 초래한다. 도 3과 같이 다양한 농도의 아스타산틴(샘플 1~3)을 시험하여 DPPH 유리화 제거 활동을 측정하였다. 항산화제로서, 다른 형태의 아스타산틴은 모두 농도에 의존하는 유리화 제거 활동을 보여주었다. 샘플 1과 샘플 3의 급진적인 제거 활동은 샘플 2의 활동보다 약간 더 높았다. 중요한 것은 Ast-dE보다 더 많은 양의 Ast-mE를 함유한 샘플 3은 Ast-mE보다 더 많은 양의 Ast-dE를 가지고 있는 샘플 1의 활동보다 약간 더 높은 항산화 활동을 보여주었다. 그러나 샘플 3이 가장 뛰어난 급진적 유리화 제거 활동을 보였음에도 불구하고 3가지 샘플 중 시험관내 항산화 활동에서의 전반적인 차이는 크지 않았다.
3.4. 세포 생존능
B16F10(murine melanoma), HaCaT(human keratinocyte), Raw 264.7(murine macrophage) 세포에 대한 3개의 아스타산틴 샘플(1~3)의 세포독성은 MTT 검사에서 평가되었다. 도 4의 결과는 3개의 아스타산틴 샘플이 모두 15μm까지 세포 독성이었음을 보여준다. 환경 조건에 민감하게 반응하는 70% 미만의 세포 생존성의 현저한 감소가 10μM 이상의 농도에서 관찰되었다. 이러한 결과를 바탕으로 아스타산틴 샘플의 세포 활동을 평가하기 위한 최대 농도를 설정했다. 구체적으로 5μM 아스타산틴을 사용하였다.
3.5. 세포 항산화 활동 측정
세포내 응력 기반 모델에 의존하는 잘 확립된 CAA 검사를 수행했다. 구체적으로, H 2O 2에 노출되어 B16F10과 HaCaT 세포에서 산화 스트레스를 유도하였는데, H 2O 2는 Fenton 반응을 통해 쉽게 세포막을 관통하여 가장 반응성이 높은 형태의 산소인 히드록실 라디컬을 발생시킬 수 있다. 다음으로, 산화 민감 지표인 DCFH-DA를 추가하여 B16F10의 ROS 생산량을 측정하였다.. 원칙적으로 세포에 들어간 후 DCFH-DA는 세포 디아세틸라제 효소에 의해 DCFH로 변환되며, ROS가 있으면 형광 DCF로 산화된다. 따라서 항산화 활동이 강하면 DCFH 산화를 방지함으로써 생성되는 형광신호가 낮아진다. 형광 신호에 반비례하는 CAA(%)를 계산했다(실험 섹션 참조). 도 5와 같이, 3가지 샘플 중 Ast-F로 구성된 샘플 2는 B16F10 세포와 HaCaT 세포(도 5 (A) 및 (B))에서 항산화 능력이 가장 낮은 것으로 나타났다. 중요한 것은 Ast-dE보다 더 많은 Ast-mE를 함유한 샘플 3이 Ast-mE보다 더 많은 Ast-N(샘플 1)보다 항산화 능력이 더 높다는 점이다. 이러한 결과는 샘플 3, 특히 Ast-mE가 세포 항산화 활동의 강화에 중요하다는 것을 증명한다. 흥미롭게도 항산화 활동에 대한 시험관내 검사(도 3)와 달리 세포내 항산화 검사(도 5)에서 3가지 샘플 중 항산화 작용의 뚜렷한 차이가 관찰되었는데, 이는 시험관내 항산화 활성보다 세포내 항산화 작용에 더 큰 영향을 미친다는 것을 보여준다. 이에 기초하여, 폴리엔 체인과 아스타산틴의 말단 링 세포에서 라디컬을 제거하여, Ast-mE는 인지질 2중층으로 쉽게 삽입될 수 있어 항산화 활성도가 우수하다.
3.6. 아스타산틴의 항염 활동
항산화 활동과 항염증 활동이 밀접한 관련이 있는 것으로 알려졌다. 또한 아스타산틴은 생물학적 계통에서 염증의 유도를 중단시키는 강력한 항산화제로 알려져 있다. 아스타산틴의 항염증 활동을 평가하기 위해 murine 대식세포 Raw 264.7 세포는 LPS의 자극을 받아 종양 괴사 인자(TNF)-α, 인터루킨-1β, IL-6 등 다양한 면역학적으로 활성 매개체를 만들어 방출했다. 이 중재자는 NO를 다량 발생시킬 수 있는 질소산화물 신타아제의 전사를 유도하고 염증에 따른 세포독성 효과에 관여한다고 생각된다. NO의 결과 레벨은 질산염 이온 수준을 측정하기 위해 수행된 분광 광도 측정인 Griess 반응에 의해 결정되었다. NO의 생산량이 증가하면 색도계 신호가 증가하여 항염증 활동이 덜 효과적이라는 것을 알 수 있다. 도 6의 결과는 3개의 아스타산틴 검체(1~3)에 의한 NO 생산 억제(%)를 나타낸다(실험 섹션 참조). 세포 항산화 활동에 따라 아스타산틴의 항산화 및 항염증 활동에서 Ast-mE의 중요한 역할을 지원하면서 Ast-mE가 포함된 샘플 3에서 가장 높은 항염증 활성도가 관찰되었다.
3.7. 항염증 및 항산화 활동과 관련된 유전자 발현
아스타산틴의 화학적 변환, 특성, 생물학적 활동에 대한 결과를 바탕으로 샘플 3에 대한 이러한 개선된 활동의 메커니즘을 조사했다. 염증에 대한 아스타산틴 검체의 억제 효과를 더 잘 이해하기 위해, 염증사이토카인의 mRNA 발현을 처음으로 LPS로 자극된 RAW 264.7 대식세포에서 qPCR에 의해 조사하였다(실험 섹션 참조). LPS 활성화 대식세포는 염증의 발육과 진행을 촉진하기 위해 IL-1β, IL-6, TNF-α를 포함한 염증사이토카인 및 NO와 같은 다른 염증 매개체를 과다하게 생성한다. 도 7A-C와 같이 염증사이토카인의 유전자 발현 수준은 잔여의 RAW 264.7 대식세포와 비교하여 LPS-자극된 RAW 264.7 대식세포에서 현저하게 증가하였다.
대조적으로, 다른 아스타산틴 샘플(1~3)은 IL-1β, IL-6 및 TNF-α의 mRNA 수준을 상당히 감소시켰다. 가장 중요하게, 샘플 2는 IL-1β, IL-6, TNF-α 표현 수준을 줄이는 데 가장 효과적이지 않은 샘플이었고, 샘플 3은 샘플 1에 비해 염증사이토카인(p < 0.01) 수준을 더 효과적으로 감소시켰다. 이러한 결과는 화학적 변환에 의해 준비된 샘플 3이 아스타산틴의 3가지 형태 중 활성 대식세포에서 염증사이토카인의 생산을 가장 효과적으로 억제하였음을 나타낸다. 이러한 결과는 아스타산틴의 항염증 효과에 대한 도 6의 결과와 일치한다.
다음으로 항산화 활동과 관련된 유전자의 발현이 분석되었다. 아스타산틴은 ROS 제거 기능 외에도 산소 분자에 전자를 공여하여 대식세포에서 ROS를 생성하는 중요한 효소인 NOXs의 발현을 억제하여 LPS 자극 대식세포에서 ROS 생산을 감소시키는 것으로 알려져 있다. 도 7D와 같이, 아스타산틴의 존재하에 LPS에 의한 Nox2 발현의 현저한 유도를 발견했다. 특히, 샘플 3은 Nox2(p < 0.01)의 발현에서 가장 큰 감소를 유발했다. 나아가 내성의 항산화 방어 메커니즘에 중요한 역할을 하고 항산화 효소의 생성을 자극하여 산화 스트레스를 방지하는 핵 인자 E2 관련 인자 2(Nrf2)의 발현이 LPS 자극에 의해 증가하였고, 이에 따라 타겟 유전자(MnSOD)의 발현도 증가하였다(도e 7E와 F). 중요한 것은 화학적 변환에 의해 준비된 샘플 3이 Nrf2와 MnSOD의 발현을 줄이는 데 가장 효과적이었다. 이러한 결과는 아스타산틴의 항산화 효과에 대한 도 5의 결과와 일치한다. 전체적으로 Ast-dE보다 Ast-mE가 더 많이 함유된 샘플 3에서 가장 높은 항염증 및 항산화 활동이 관찰되었다.
본 실시예에서는 화학적 변환에 의한 아스타산틴, Ast-F, Ast-ME, Ast-DE의 다양한 형태를 준비하여 에스테르화의 정도와 항산화, 항염증 활동 등 생물학적 활동에 미치는 영향을 조사하였다. 여기서, 유전자 발현 분석을 통해 아스타산틴이 항산화 작용과 염증 활동을 어떻게 하는지를 알아냈다. Ast-dE보다 더 많은 Ast-mE를 함유한 화학 합성 샘플 3이 가장 강력한 항산화 및 항염증 활동을 보여주었다. 다만, 아스타산틴의 변환 효율은 HPLC 결과에서 보듯이 특히 에스테리화 반응(단계 2; 도 1)에서 100%가 아니었다. 따라서, Ast-F는 샘플 3에 그대로 남아 있어 항산화 활동에 가장 적합한 구조를 식별하기가 어려웠다. 또한 지방산 사슬 길이의 효과를 평가해야 한다. 그러나, 본 실시예는 아스타산틴의 에스테라화가 생물활동에 미치는 영향을 조사하여 다른 형태에 비해 Ast-mE가 가장 효과적이라는 것을 입증한 첫 번째 연구다. 본 실시예는 또한 화학적 변형을 통한 구조적 변환을 다른 원천으로부터 자유롭게 형성된 아스타산틴에 적용하여 항산화 능력을 높일 수 있음을 시사한다. 따라서 아스타산틴은 산화 스트레스를 줄이기 위해 식품 보충제 및/또는 기능 성분으로 적용될 수 있다. 이러한 결과는 아스타산틴이나 다른 항산화 분자를 심층적으로 조사할 수 있는 토대를 제공해 새로운 항산화제나 항염증 분자의 발달을 가능하게 한다.
(사용된 약어)
Ast-N 천연 아스타산틴
Ast-F 프리 형태의 아스타산틴
Ast-E 에스테르형 아스타산틴
Ast-dE 아스타산틴의 디에스테르 형태
Ast-mE 아스타산틴의 모노에스테르 형태
CAA 세포 항산화 검사
DCFH-DA 2′,7′-Dichlorofluorescein 3′6′-diacetate
DCF 2',7'-디클로로플루오레세인
DMEM Dulbecco의 변형된 이글의 매체
FBS 소태아 혈청
IL 인터루킨
LPS 리포다당류
MT 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide
NO 산화질소
OD 광학 밀도
qPCR Quanitative polymerase chain reaction
ROS 반응성 산소종
TNF 종양 괴사 인자
Nrf 핵 인자 E2 관련 인자

Claims (5)

  1. 염기성 알코올 용액을 제조하는 제1-1 단계;
    아스타잔틴을 에스테르 교환 반응하는 제1-2 단계;
    아스타잔틴을 추출하는 제1-3 단계;
    아스타잔틴 모노에스테르를 합성하는 제2 단계;를 포함하는 아스타잔틴 모노에스테르의 제조방법.
  2. 청구항 1에 있어서,
    상기 염기성 알코올 용액을 제조하는 제1-1 단계는,
    증류수에 수산화나트륨을 혼합하는 제1-1-1 단계;
    메탄올, 에탄올, 프로판올에서 선택된 1종 또는 2종 이상의 혼합물에 상기 제1-1-1 단계의 혼합물을 혼합하는 제1-1-2 단계;
    상기 제1-1-2 단계의 혼합물을 탈수 반응하는 제1-1-3 단계;
    침전물을 제거하면서 상기 제1-1-3 단계을 2회 내지 4회 반복하는 제1-1-4 단계;
    미세 필터를 사용하여 상기 제1-1-4 단계의 혼합물을 필터링 하는 제1-1-5 단계;를 포함하는 아스타잔틴 모노에스테르의 제조방법.
  3. 청구항 2에 있어서,
    상기 아스타잔틴을 에스테르 교환 반응하는 제1-2 단계는,
    초임계 추출된 아스타잔틴을 상기 제1-1-5 단계의 혼합물에 혼합하는 제1-2-1 단계;
    상기 제1-2-1 단계 혼합물을 볼텍싱(vortexing) 후 환류 교반시키는 제1-2-2 단계;
    상기 제1-2-2 단계 혼합물을 상온으로 냉각하고 중화시키는 제1-2-3 단계;를 포함하는 아스타잔틴 모노에스테르의 제조방법.
  4. 청구항 3에 있어서,
    상기 아스타잔틴을 추출하는 제1-3 단계는,
    아스타잔틴 에스테르 교환 반응이 완료된 상기 제1-2-3 단계 혼합물을 헥세인 및 석유에테르(petroleum ether)에서 선택되는 1종 또는 2종의 화합물에 혼합하여 볼텍싱하는 제1-3-1 단계;
    상기 제1-3-1 단계 혼합물을 고속으로 회전하여 원심분리하여 상층부를 분리하는 제1-3-2 단계;
    상기 분리된 제1-3-2 단계 혼합물을 감압 건조하는 제1-3-3 단계;
    상기 제1-3-3 단계의 혼합물을 디클로로메탄, 디클로로에탄, 디클로로부탄에서 선택되는 1종의 화합물에 혼합하여 용해시키는 제1-3-4 단계; 를 포함하는 아스타잔틴 모노에스테르의 제조방법.
  5. 청구항 4에 있어서,
    아스타잔틴 모노에스테르를 합성하는 제2 단계는,
    상기 제1-3-4 단계의 화합물에 활성화제, 촉매, 포화지방산을 혼합하는 제2-1-1 단계;
    상기 제2-1-1 단계 혼합물을 상온에서 1시간 내지 3시간을 반응시키는 제2-1-2 단계;
    상기 제2-1-2 단계를 2회 내지 4회 반복하는 제2-1-3 단계;
    상기 제2-1-3 단계 혼합물을 감압하여 증발시키는 제2-1-4 단계;를 포함하는 아스타잔틴 모노에스테르의 제조방법.
PCT/KR2020/014312 2019-10-29 2020-10-20 에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법 WO2021085916A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2019-0135965 2019-10-29
KR20190135966 2019-10-29
KR10-2019-0135966 2019-10-29
KR20190135965 2019-10-29

Publications (1)

Publication Number Publication Date
WO2021085916A1 true WO2021085916A1 (ko) 2021-05-06

Family

ID=75716031

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/014312 WO2021085916A1 (ko) 2019-10-29 2020-10-20 에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법

Country Status (1)

Country Link
WO (1) WO2021085916A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040103979A (ko) * 2002-04-30 2004-12-09 산또리 가부시키가이샤 아스타산틴 중쇄 지방산 에스테르, 그 제조법, 및 이들을함유하는 조성물
CN103012229A (zh) * 2012-12-21 2013-04-03 宁波红龙生物科技有限公司 制备高纯度虾青素提取物的方法
KR20170005886A (ko) * 2017-01-06 2017-01-16 인하대학교 산학협력단 아스타잔틴 모노에스터의 제조방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040103979A (ko) * 2002-04-30 2004-12-09 산또리 가부시키가이샤 아스타산틴 중쇄 지방산 에스테르, 그 제조법, 및 이들을함유하는 조성물
CN103012229A (zh) * 2012-12-21 2013-04-03 宁波红龙生物科技有限公司 制备高纯度虾青素提取物的方法
KR20170005886A (ko) * 2017-01-06 2017-01-16 인하대학교 산학협력단 아스타잔틴 모노에스터의 제조방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIAN-PING YUAN , XIAN-DI GONG , FENG CHEN: "Separation and identification of astaxanthin esters and chlorophylls in Haematococcus lacustris by HPLC", BIOTECHNOLOGY TECHNIQUES, vol. 10, no. 9, 1 September 1996 (1996-09-01), pages 655 - 660, XP055807189, ISSN: 0951-208X, DOI: 10.1007/BF00168474 *
SUN WEIHONG, LIN HONG, ZHAI YUXIU, CAO LIMIN, LENG KAILIANG, XING LIHONG: "Separation, Purification, and Identification of ( 3S,3′S )- trans -Astaxanthin from Haematococcus pluvialis", SEPARATION SCIENCE AND TECHNOLOGY, vol. 50, no. 9, 13 June 2015 (2015-06-13), pages 1377 - 1383, XP055807184, ISSN: 0149-6395, DOI: 10.1080/01496395.2014.976873 *

Similar Documents

Publication Publication Date Title
KR101079980B1 (ko) 신이로부터 분리된 리그난 성분과 그 용도
WO2007064085A1 (en) Cosmetic composition containing hydrolysates of icariin
Krol A New Synthesis of Porphin
CN111285758A (zh) 化合物trieffusols C-E制备方法及其在制备抗炎药物中的应用
CN114209679B (zh) 3，5-二羟基-4-甲氧基苄醇的合成方法及其应用
WO2021085916A1 (ko) 에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법
DK408186A (da) Podophyllotoxin og derivater deraf, fremgangsmaader til deres fremstilling og anvendelse samt farmaceutiske praeparater indeholdende forbindelserne
CN113234047A (zh) 一种多酚类化合物和组合物及其在制备具有抗衰老作用的产品中的应用
Jang et al. Antioxidant activity and inhibitory effects on oxidative DNA damage of callus from Abeliophyllum distichum Nakai
CN110343045B (zh) 芳基四氢萘型木脂素类化合物及制备和应用
KR102423643B1 (ko) 에스테르 교환 반응을 통한 아스타잔틴 모노에스테르의 제조방법
CN114349623B (zh) 一种具有神经细胞保护活性的对映-异海松烷型二萜及其制备方法和应用
CN115894414A (zh) 白英中制备的酰胺木脂素类化合物及其制备方法和应用
WO2015016500A1 (ko) 알로에신 또는 그 유도체를 함유하는 피부 노화 억제용 조성물
Zhang et al. Novel secoeunicellins produced by an octocoral Cladiella sp
Jung et al. Antioxidant activity of roasted defatted perilla seed
Kagho et al. Ceramides and other bioactive compounds from Celtis tessmannii Rendle
Jung et al. Antioxidant activity of Artemisia capillaris Thunberg
KR20130087938A (ko) 오미자 추출물을 포함하는 주름 개선용 화장료 조성물
KR20100071652A (ko) 패출리 알코올을 포함하는 피부미백용 조성물
KR20090089973A (ko) 털산박하 추출물을 유효성분으로 함유하는 항산화 및미백용 화장료 조성물
CN117466845A (zh) 一种酯类化合物及其用途
EP3177283B1 (en) Active compound and related composition for dermatological use in the pharmaceutical or cosmetic field
KR102332943B1 (ko) 왜모자반 유래 추출물을 유효성분으로 함유하는 피부노화 개선용 화장료 조성물
KR100429406B1 (ko) 솔잎유래의 항산화물질 및 그 분리방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20881220

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20881220

Country of ref document: EP

Kind code of ref document: A1