WO2020130627A1 - 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도 - Google Patents

황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도 Download PDF

Info

Publication number
WO2020130627A1
WO2020130627A1 PCT/KR2019/018001 KR2019018001W WO2020130627A1 WO 2020130627 A1 WO2020130627 A1 WO 2020130627A1 KR 2019018001 W KR2019018001 W KR 2019018001W WO 2020130627 A1 WO2020130627 A1 WO 2020130627A1
Authority
WO
WIPO (PCT)
Prior art keywords
yellow fever
ediii
yfv
dna aptamer
biosensor
Prior art date
Application number
PCT/KR2019/018001
Other languages
English (en)
French (fr)
Inventor
김윤근
반창일
Original Assignee
주식회사 엠디헬스케어
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엠디헬스케어, 포항공과대학교 산학협력단 filed Critical 주식회사 엠디헬스케어
Priority to CN201980083915.4A priority Critical patent/CN113227377B/zh
Publication of WO2020130627A1 publication Critical patent/WO2020130627A1/ko

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/02Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating impedance
    • G01N27/021Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating impedance before and after chemical transformation of the material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54366Apparatus specially adapted for solid-phase testing
    • G01N33/54386Analytical elements
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/588Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with semiconductor nanocrystal label, e.g. quantum dots
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08RNA viruses
    • G01N2333/18Togaviridae; Flaviviridae
    • G01N2333/183Flaviviridae, e.g. pestivirus, mucosal disease virus, bovine viral diarrhoea virus, classical swine fever virus (hog cholera virus) or border disease virus
    • G01N2333/185Flaviviruses or Group B arboviruses, e.g. yellow fever virus, japanese encephalitis, tick-borne encephalitis, dengue
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention is a DNA aptamer that specifically binds to yellow fever virus envelope protein domain III (YFV EDIII), a yellow fever diagnostic composition comprising the same, a yellow fever diagnostic kit, a yellow fever diagnostic biosensor, and information for yellow fever diagnosis It is about a delivery method.
  • ZFV EDIII yellow fever virus envelope protein domain III
  • Yellow fever is an acute infectious hemorrhagic fever caused by a yellow fever virus, a type of flavivirus, and is a fatal infectious disease transmitted through the mediation of Egyptian forest mosquitoes. It develops after an incubation period of 3-6 days after infection, and symptoms include fever, muscle pain, headache, vomiting and nausea. A large number of patients recover, but about 15% of patients enter the severe stage, and about 50% of severe patients are known to die within 10-14 days. Vaccines have been developed, but there are no specialized treatments for patients after the onset. Patient treatment is mainly focused on symptomatic therapy and is aimed at preventing dehydration, dyspnea, fever, and complications. 200,000 cases of yellow fever are reported each year, of which 30,000 die (Korea Registered Patent Publication 10-0883703).
  • yellow fever virus envelope protein domain III (YFV EDIII) is part of domain III located on the surface protein of yellow fever virus, and the flavivirus to which the yellow fever virus belongs is inside the capsid protein.
  • Genomic RNA (genomic RNA) is located on the outer surface (envelope; E) of the protein dimer (dimer) and membrane protein (membrane (M) protein) has a structure surrounding.
  • the envelope protein located on the outermost side of the flavivirus antigen is composed of domains I, II, and III, of which domain III is a location where viral receptors bind, and is receiving attention as a major target for diagnosis and immunological studies using serum. have.
  • domain III is highly antigenic and has a linear epitope recognized by a virus-neutralizing single antibody. Diseases of the same flavivirus have a strong antigen-cross reaction between viruses, making it difficult for serological diagnosis. For example, there are reports that most infections have been misdiagnosed by a cross reaction between type 3 dengue fever, yellow fever, and St. Louis encephalitis. In order to solve this problem, the domain III sequence having distinct characteristics even in viruses of the same genus is receiving attention.
  • aptamers are single-stranded DNA (ssDNA) or RNA with high specificity and affinity for specific substances.
  • Aptamers have been developed in recent years because their affinity for specific substances is very high and stable, and their application as therapeutic and diagnostic sensors using them has been actively progressing. Synthesis of aptamers is possible in a relatively simple way, and even cells, proteins, and even small organic substances can be targeted, enabling the development of new detection methods using them, and their specificity and stability are very high compared to antibodies already developed. Therefore, it is possible to develop therapeutic agents, drug delivery systems, and applications as diagnostic biosensors.
  • the present invention has been devised to solve the above problems, and confirms the specific binding ability of the DNA aptamer produced in the present invention to the yellow fever virus envelope protein domain III (YFV EDIII) and based on this The present invention has been completed.
  • YFV EDIII yellow fever virus envelope protein domain III
  • an object of the present invention is a DNA aptamer that specifically binds to yellow fever virus envelope protein domain III (YFV EDIII), characterized in that the DNA aptamer consists of the nucleotide sequence of SEQ ID NO: 6, To provide a DNA aptamer.
  • YFV EDIII yellow fever virus envelope protein domain III
  • Another object of the present invention is to provide a composition for diagnosing yellow fever or a yellow fever diagnostic kit comprising a DNA aptamer.
  • another object of the present invention is a yellow fever virus EDIII (Yellow fever virus envelope protein domain III; YFV EDIII) specific DNA aptamer; And it is to provide a biosensor for yellow fever diagnosis, characterized in that the DNA aptamer comprises a base sequence to which the DNA aptamer is fixed, the DNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 6.
  • EDIII yellow fever virus envelope protein domain III
  • another object of the present invention (a) injecting a subject sample in the biosensor; (B) injecting a detection probe containing a quantum dot (quantum dot) to the biosensor processed the sample of the step (a); (c) injecting an acid into the biosensor injecting the detection probe containing the quantum dots of step (b); (d) obtaining a solution in which the quantum dot and acid of step (c) react; And (e) measuring the current (Ampere; A) of the solution of step (d), provides an information providing method for yellow fever diagnosis.
  • the present invention is a DNA aptamer that specifically binds to yellow fever virus envelope protein domain III (YFV EDIII), wherein the DNA aptamer is the base of SEQ ID NO: 6 It provides a DNA aptamer, characterized in that consisting of a sequence.
  • YFV EDIII yellow fever virus envelope protein domain III
  • the YFV EDIII may be a domain protein included on the surface of a yellow fever virus antigen.
  • the present invention provides a composition for diagnosing yellow fever, including the DNA aptamer.
  • the present invention provides a yellow fever diagnostic kit comprising the DNA aptamer.
  • the present invention is a yellow fever virus EDIII (Yellow fever virus envelope protein domain III; YFV EDIII) specific DNA aptamer; And a biosensor for yellow fever diagnosis comprising a substrate on which the DNA aptamer is fixed, wherein the DNA aptamer comprises a base sequence of SEQ ID NO: 6.
  • EDIII yellow fever virus envelope protein domain III
  • YFV EDIII yellow fever virus envelope protein domain III
  • the substrate may include a metal electrode layer and a metal nanoparticle layer, and the metal may be gold (Au).
  • the DNA aptamer may be one that is hybridized with a fixed sequence and is fixed to the substrate by double strands.
  • the present invention comprises the steps of (a) injecting a subject sample into the biosensor; (B) injecting a detection probe containing a quantum dot (quantum dot) to the biosensor processed the sample of the step (a); (c) injecting an acid into the biosensor injecting the detection probe containing the quantum dots of step (b); (d) obtaining a solution in which the quantum dot and acid of step (c) react; And (e) measuring the current (Ampere; A) of the solution of step (d), provides an information providing method for yellow fever diagnosis.
  • the quantum dot may be cadmium sulfide (CdS).
  • the present invention provides a method for diagnosing yellow fever, comprising administering to a subject a DNA aptamer that specifically binds YFV EDIII.
  • the present invention provides a yellow fever diagnostic use of a DNA aptamer that specifically binds YFV EDIII.
  • the present inventors have conducted extensive research to develop a new biomarker for the diagnosis of yellow fever, and a DNA aptamer having specific binding ability to yellow fever virus envelope protein domain III (YFV EDIII) ( DNA Aptamer) confirmed that it has a strong binding ability and excellent specificity with YFV EDIII, and it can expect superior stability than the ELISA method using an existing antibody, so a composition for diagnosing yellow fever, a biosensor for diagnosing yellow fever, and a method for providing information for yellow fever diagnosis It is expected to be useful in the development of such.
  • YFV EDIII yellow fever virus envelope protein domain III
  • Figure 1a shows the results confirmed by amplifying the YFV EDIII gene.
  • Figure 1b shows the results of observing the high purity recombinant YFV EDIII protein obtained through FPLC after overexpressing the recombinant YFV EDIII protein.
  • Figure 2 is a graph showing the results of confirming the binding degree (%) of ssDNA (single strand DNA) and YFV EDIII, and the selection process.
  • 3 is a graph showing the result of confirming the Kd value for the YF1 aptamer sequence through fluorescence measurement.
  • FIG. 4 is a schematic schematic diagram of a biosensor for YFV EDIII detection using a DNA aptamer.
  • 5A is a graph confirming YFV EDIII detection results using YF1 aptamer when the concentration of YFV EDIII is different.
  • 5B is a graph confirming that the YFV EDIII detection result using the YF1 aptamer quantitatively appears when the concentration value of YFV EDIII converted to Log is the x-axis.
  • FIG. 6 is a graph showing the change in the relative current value according to each protein and reaction in the binding specificity experiment for YFV EDIII protein.
  • the present inventors have conducted extensive research to develop a novel biomarker for the diagnosis of yellow fever, and a DNA aptamer having a specific binding ability against yellow fever virus envelope protein domain III (YFV EDIII) ( DNA Aptamer) was confirmed to have strong binding force and excellent specificity with YFV EDIII, and the present invention was completed.
  • YFV EDIII yellow fever virus envelope protein domain III
  • the present invention provides a DNA aptamer that specifically binds YFV EDIII.
  • Y fever virus envelope EDIII (Yellow fever virus envelope protein domain III; YFV EDIII)
  • YFV EDIII a domain III (domain III) portion located on the surface protein of the yellow fever virus, flavivirus to which the yellow fever virus belongs
  • the genomic RNA is located inside the capsid protein, and has a structure surrounded by the dimer and membrane protein of the envelope (E) protein.
  • the envelope protein located on the outermost side of the flavivirus antigen is composed of domains I, II, and III, of which domain III is a location where viral receptors bind, and is receiving attention as a major target for diagnosis and immunological studies using serum. have.
  • domain III is highly antigenic and has a linear epitope recognized by a virus-neutralizing single antibody. Diseases of the same flavivirus have a strong antigen-cross reaction between viruses, making it difficult for serological diagnosis. For example, there are reports that most infections have been misdiagnosed by a cross reaction between type 3 dengue fever, yellow fever, and St. Louis encephalitis. In order to solve this problem, the sequence of domain III, which has distinct characteristics in viruses of the same genus, is attracting attention, and YFV EDIII can effectively diagnose yellow fever, and yellow fever virus EDIII is a yellow fever virus antigen (antigen). ) May be a domain protein included in the surface, but is not limited thereto.
  • aptamer is a single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance.
  • ssDNA single-stranded DNA
  • RNA RNA having high specificity and affinity for a specific substance.
  • Conventional methods using antibodies are relatively time-consuming and expensive because they are made using the immune system of a living body, and their stability may be problematic because they are proteins, whereas aptamers are relatively synthetic in synthesis. Since it is possible by a simple method and can target cells, proteins, and even small organic substances, it is possible to develop new detection methods using this, and the specificity and stability are very high compared to the antibodies already developed.
  • DNA aptamers were used for the specific detection of EDIII. Any DNA (ssDNA) or RNA capable of specific detection of YFV EDIII may correspond to the aptamer of the present invention, and may be preferably composed of the nucleotide sequence of SEQ ID NO: 6, but is not limited thereto.
  • the present invention provides a composition for diagnosing yellow fever, including the DNA aptamer.
  • composition of the present invention may further include a pharmacologically or physiologically acceptable carrier, excipient, and diluent in addition to the DNA aptamer.
  • a pharmacologically or physiologically acceptable carrier such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions according to a conventional method.
  • Carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oil.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, and the like.
  • the present invention provides a yellow fever diagnostic kit comprising the DNA aptamer.
  • the kit includes the aptamer of the present invention that specifically binds YFV EDIII, and the aptamer may be attached with detection labels widely used in the art, for example, biotin residues. After introducing a labeling substance into the biotin-attached aptamer, it can be used for the detection, quantification and diagnosis of YFV EDIII through its analysis.
  • detection labels widely used in the art, for example, biotin residues.
  • biotin residues After introducing a labeling substance into the biotin-attached aptamer, it can be used for the detection, quantification and diagnosis of YFV EDIII through its analysis.
  • a labeling material used for biotin various known analytical labeling materials can be used, for example, fluorescence analysis using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine or Q-dot, etc. Can.
  • the aptamer for YFV EDIII detection may be labeled with a conventional labeling material, such as a biotin residue, other fluorescent substances, magnetic substances, dyes, enzymes, radioactive isotopes, and a conventional detection means, for example, fluorescence It can be detected through a microscope, Radioimmnodetection (RAID), or the like.
  • a conventional labeling material such as a biotin residue, other fluorescent substances, magnetic substances, dyes, enzymes, radioactive isotopes
  • a conventional detection means for example, fluorescence It can be detected through a microscope, Radioimmnodetection (RAID), or the like.
  • kit is a variety of tools or reagents that can be used to qualitatively or quantitatively determine whether aptamer and YFV EDIII are bound in a sample, such as a support (substrate), buffer solution, reaction stopper, solubilizer, detergent or stabilizer. It may further include.
  • the aptamer-fixed substrate may be, for example, a solid substrate, selected from the group consisting of polymers, glass, gold, paper, and biomembrane. More specifically, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposome, carboxymethyl cellulose, polyacrylamide, Polysterene, companion rock, filter paper, ion exchange resin, plastic film, plastic tube, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or Magnetic particles and the like can be used.
  • polystyrene polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposome, carboxymethyl cellulose, polyacrylamide,
  • Cell culture plates, ELISA plates, tubes, and polymeric membranes may be used as other solid substrates.
  • the substrate may have any possible shape, for example spherical (bead), cylindrical (inside the test tube or well), planar (sheet, test strip), more preferably a multi-well plate (eg, 24 well) , 96 well, 192 well, 384 well, 576 well, etc.).
  • the present invention is a yellow fever virus EDIII (Yellow fever virus envelope protein domain III; YFV EDIII) specific DNA aptamer; And it provides a biosensor for the diagnosis of yellow fever, including a substrate on which the DNA aptamer is fixed.
  • EDIII yellow fever virus envelope protein domain III
  • the substrate on which the DNA aptamer is fixed is made of a metal electrode layer and a metal nanoparticle layer of a screen printed electrode (Screen Printed Gold Electrode), and the electrode layer and nanoparticle material can be attracted by an electric field or a magnetic field, and characteristics of the electric field Any material that can change the can be used, preferably made of gold (Au), but is not limited thereto.
  • the DNA aptamer immobilized on the substrate can be immobilized on the substrate by hybridizing with a fixed sequence, and is not limited to any one as long as it is a DNA aptamer that specifically binds YFV EDIII, and preferably the DNA aptamer is YF1 aptamer. May be, but is not limited to.
  • the fixed sequence is hybridized with YF1 aptamer, can be fixed to the substrate by a thiol-gold reaction, preferably 5'-AAG CAG TCC AAC TCG AAC ACA CTG-(CH 2 ) 6 -SH-3' It may be a sequence, but is not limited thereto.
  • YFV EDIII was expressed and purified to confirm a specific binding sequence (see Examples 1 to 3).
  • the sequence and structure of YF1 aptamer was analyzed and confirmed (see Example 4), and the binding force between the YFV EDIII and the aptamer was measured using fluorescence measurement (see Example 5).
  • DNA pressure with excellent stability and binding ability was measured.
  • a tamer and a biosensor were prepared (see Example 6), and it was confirmed that the biosensor had excellent specificity for YFV EDIII, and thus it could be used as a method for providing information for yellow fever diagnosis (Example 7). Reference).
  • the present invention comprises the steps of (a) injecting a subject sample into the biosensor; (B) injecting a detection probe containing a quantum dot (quantum dot) to the biosensor processed the sample of the step (a); (c) injecting an acid into the biosensor injecting the detection probe containing the quantum dots of step (b); (d) obtaining a solution in which the quantum dot and acid of step (c) react; And (e) measuring the current (Ampere; A) of the solution of step (d), provides an information providing method for yellow fever diagnosis.
  • the sample for the diagnosis of yellow fever may be tissue, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid, or urine, but is not limited thereto.
  • the detection probe is YFV EDIII is combined with the biosensor aptamer, the more the detection probe fills the spot, preferably, the detection probe sequence is 5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC-(CH 2 ) 6 -NH 2 -3', but is not limited thereto.
  • the quantum dot may be included in the detection probe, and is not limited to any one as long as it can react with the acid, for example, cadmium sulfide (CdS), lead sulfide (PbS), and the like, preferably sulfide Cadmium, but is not limited thereto.
  • CdS cadmium sulfide
  • PbS lead sulfide
  • Cadmium preferably sulfide Cadmium
  • the acid is not limited to any one as long as it can react with the quantum dot, for example, nitric acid, sulfuric acid, hydrochloric acid, and the like, preferably nitric acid, but is not limited thereto.
  • Forward primer including BamH1 restriction enzyme recognition sequence (5'-CCC GGA TCC TCT GCT CTG ACC CTG AAA GG-3') to amplify the gene for yellow fever virus envelope protein domain III (YFV EDIII); sequence No. 1) and a reverse primer (5'-CCC AAG CTT TTT ACC GAT AGA AGA ACC TTC TTT GTG CC-3'; SEQ ID NO: 2) comprising the HindIII restriction enzyme recognition sequence was used.
  • BamH1 restriction enzyme recognition sequence 5'-CCC GGA TCC TCT GCT CTG ACC CTG AAA GG-3'
  • a reverse primer 5'-CCC AAG CTT TTT ACC GAT AGA AGA ACC TTC TTT GTG CC-3'; SEQ ID NO: 2 comprising the HindIII restriction enzyme recognition sequence was used.
  • a gene codon optimized YFV EDIII gene sequence (strain Ghana/Asibi/1927, 573Ser-683Lys) was used for E.coli K-12, and i-pfu polymerase was used. It was amplified through the polymerase chain reaction (PCR) process.
  • PCR polymerase chain reaction
  • Each step of the polymerase chain reaction is as follows. 1) The step of releasing the double-stranded DNA of the template is incubation for 20 seconds at 98°C, 2) The incubation for 20 seconds at 55°C as the step of binding the template and the primer, 3) The step of synthesizing the new strand is 72° C was incubated for 30 seconds, and this step was repeated 20 times.
  • the amplified YFV EDIII gene was cloned into a pET32a vector containing (His) 6- tag through reaction with restriction enzymes and DNA ligase, and transformed into BL21 (DE3) E. coli cells using the vector. .
  • BL21 (DE3) cells transformed with YFV EDIII gene were cultured in LB (Luria Bertani) medium, and cultured at 37° C. until OD (optical density) reached 0.6 at UV 600 nm. After that, IPTG (isopropyl-thio-b-D-galactopyranoside) was added so that the final concentration was 1 mM to induce the expression of the protein, followed by incubation at 18°C for 20 hours. Expression of the protein was confirmed by SDS PAGE, and the cells were separated from the medium using a centrifuge, and washed once with PBS buffer (10 mM sodium phosphate, 150 mM NaCl, pH 8.0).
  • PBS buffer 10 mM sodium phosphate, 150 mM NaCl, pH 8.0.
  • a cell lysis buffer (20mM Tris, 500mM NaCl, 0.5mM ⁇ -mercaptoethanol, 5% glycerol, pH 8.0) to purify YFV EDIII protein expressed in bacterial cell BL21 (DE3) with high purity.
  • Cells were destroyed by sonication for 20 minutes using a sonicator.
  • the cells were separated for 40 minutes at 18,000 rpm using a centrifuge.
  • Ni-NTA Ni-Nitrilotriacetic acid
  • His His 6 -tag amino acid
  • the buffer was changed through a desalting column to remove imidazole from the isolated protein, and the purified protein was a storage buffer (storage buffer, 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 5 mM ⁇ - mercaptoethanol).
  • storage buffer 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 5 mM ⁇ - mercaptoethanol).
  • Synthesized library with 90 sequences including 40 random DNA bases in the middle and 40 binding sequences of primers for PCR amplification and cloning at both ends (SEQ ID NO: 3) was designed.
  • forward primer (5'-CACCTAATACGACTCACTATAGCGGA-3'; SEQ ID NO: 4) and reverse primer (5'-GCAAGCTTGTTCGAGCCAG-3'; SEQ ID NO: 5) and biotin reverse reverse primer (5') -Biotin-GCAAGCTTGTTCGAGCCAG-3'
  • All oligonucleotides used herein were synthesized and purified by PAGE from Bionics (Korea).
  • the purified YFV EDIII was coated with cobalt on the surface and fixed to the bead using Dynabeads (Invitrogen, Norway), a magnetic bead that binds to the His-tag of the protein.
  • a protein binding buffer (20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl 2, pH 8.0) after washing the protein 1000pmole and 15uL bead of dissolved in 100uL in binding buffer using an external magnet, the reaction was allowed at room temperature for one hour It was fixed to the bead.
  • a specific separation method using magnetism was performed. Specifically, first, for the most stable structure formation of ssDNA, the ssDNA library (500 pmole) dissolved in 100 uL of binding buffer was incubated at 90°C for 3 minutes, and then cultured at 4°C for 30 minutes. Thereafter, the reaction was performed for 1 hour while gently shaking with YFV EDIII previously immobilized on a magnetic bead. Then, the bead was washed twice with a binding buffer to remove ssDNA that did not bind YFV EDIII bound to the bead.
  • the protein and the bound ssDNA are eluted using an elution buffer (20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl 2 , 0.01% tween 20, 300 mM immidazole, pH 8.0) to separate the protein-bound ssDNA from the magnetic bead.
  • elution buffer 20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl 2 , 0.01% tween 20, 300 mM immidazole, pH 8.0
  • the eluted ssDNA was precipitated using ethanol, dissolved in 60 uL of distilled water, and then amplified by PCR using i-pfu polymerase (Intron Biotechnology, Korea) using Forward primer and Biotin-bound Reverse primer.
  • Coupling buffer (5mM Tris-HCl, 0.5mM EDTA, 1M NaCl) with magnetic beads coated with streptavidin that binds biotin-linked PCR products with biotin to generate ssDNA for the next screening process , 0.005% tween 20, pH 7.5) and incubated for 1 hour. After culturing, in order to separate only ssDNA, 100 ⁇ L of 100 mM NaOH and incubated for 10 minutes, and only the selected ssDNA was obtained using an external magnet. In addition, the screening was repeated using the first screened ssDNA for the next screening.
  • the amount of ssDNA and the concentration of YFV EDIII were further reduced for strict screening, and the ssDNA eluted from repeated screening was measured with a UV spectrometer (UV spectrometer, Biochrom Libra S22 spectromether) to measure the remaining ssDNA YFV.
  • UV spectrometer UV spectrometer, Biochrom Libra S22 spectromether
  • the screening process was performed while confirming the degree of binding with EDIII.
  • the degree of bonding (%) is as shown in FIG. 2.
  • the 11th repeatedly selected ssDNA was amplified through PCR using unmodified Forward and Reverse primers, cloned into a pENTR/TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and E.coli TOP10 cells (Invitrogen, USA). After the clone into which the ssDNA was inserted was purified using a miniprep kit (GeneAll, Korea), the base sequence was analyzed (COSMO Genetech, Korea). As a result, it was possible to analyze the sequence shown in Table 1.
  • Aptamer candidate sequence (5' ⁇ 3') YF1 (90 mer) CACCTAATACGACTCACTATAGCGGATCCGAATATATCTCCTTAGTTCGAGTTGGAC TGCTTCTAGGATTGCTGGCTCGAACAAGCTTGC
  • binding buffer (20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl2, pH 8.0). Washed twice with binding buffer to separate unbound YFV EDIII. Thereafter, the aptamer labeled with various concentrations of 6-FAM was incubated for 1 hour, and the unbound aptamer was removed by washing.
  • the amount of 6-FAM-labeled ssDNA aptamer bound to magnetic beads with YFV EDIII immobilization was measured by fluorescence (1420 Victor multilabel counter, PerkinElmer, by separating only 6-FAM-labeled ssDNA bound to YFV EDIII using a magnet) USA).
  • fluorescence 1420 Victor multilabel counter, PerkinElmer, by separating only 6-FAM-labeled ssDNA bound to YFV EDIII using a magnet
  • FIG. 4 is a schematic schematic diagram of a biosensor for YFV EDIII detection using the DNA aptamer of the present invention.
  • the YF1 aptamer that specifically reacts to YFV EDIII binds to the protein and falls off, and a fixed sequence corresponding to that amount remains as a single strand.
  • the detection probe sequence (5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC-(CH 2 ) 6 -NH 2 -3') linked to cadmium sulfide quantum dots (CdS) was for 40 minutes.
  • recombinant YFV EDIII was detected using the selected YF1 aptamer.
  • FIGS. 5A and 5B it was confirmed that the current value increased as the concentration of YFV EDIII increased (1 pM-100 nM) (see FIG. 5A ).
  • a graph was drawn with the current value as the y-axis and the concentration value of the YFV EDIII converted to Log as the x-axis. Accordingly, it was confirmed that the detection of the YFV EDIII was quantitatively performed through the biosensor, and the detection limit was 0.10 pM. (See Fig. 5b).
  • binding specificity that does not react with other proteins in the blood other than the target YFV EDIII is important. was confirmed. At this time, the concentration of each protein in PBS was mixed to detect 10 nM.
  • CHIKV among the control proteins is a surface protein of a tropical infectious virus similar to YFV, and was generally found to not bind to the DNA aptamer developed in the present invention, although it is known to have high cross-reactivity between tropical infectious diseases. .
  • the DNA aptamer of the present invention has high binding specificity and reacts with YFV EDIII. It also had high specificity when compared to the serum protein HSA.
  • the DNA aptamer YF1 developed in the present invention not only has a very high binding characteristic to YFV EDIII, but can also be used as a biosensor in complex biological samples.
  • the DNA aptamer that specifically binds to the yellow fever virus envelope protein domain III (YFV EDIII) of the present invention has strong binding ability and excellent specificity to the surface protein of the yellow fever virus, and is compared with diagnosis using existing antibodies. Therefore, since it is possible to diagnose yellow fever virus with significantly increased accuracy, it is expected to be effectively used in various products for diagnosis, such as a diagnostic kit and a diagnostic composition.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Electrochemistry (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Materials Engineering (AREA)
  • Nanotechnology (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 특이적으로 결합하는 DNA 압타머, 이를 포함하는 황열 진단용 조성물, 황열 진단 키트, 황열 진단용 바이오센서, 및 황열 진단을 위한 정보제공 방법에 관한 것으로서, 본 발명자들은 황열(Yellow fever)의 진단을 위한 신규 바이오 마커를 개발하기 위해 예의 연구한 결과, 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 대하여 특이적인 결합능을 갖는 DNA 압타머(DNA Aptamer)가 YFV EDIII와의 강한 결합력과 우수한 특이성이 있다는 것을 확인하였는 바, 기존의 항체를 이용한 ELISA 방법보다 뛰어난 안정성을 기대할 수 있으므로, 황열 진단용 조성물, 황열 진단용 바이오센서, 황열 진단을 위한 정보제공 방법 등의 개발 시에 유용하게 이용될 수 있을 것으로 기대된다.

Description

황열 바이러스 EDIII에 특이적으로 결합하는 DNA 압타머 및 이의 용도
본 발명은 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 특이적으로 결합하는 DNA 압타머, 이를 포함하는 황열 진단용 조성물, 황열 진단 키트, 황열 진단용 바이오센서, 및 황열 진단을 위한 정보제공 방법에 관한 것이다.
황열은 플라비바이러스(flavivirus)의 한 종류인 황열 바이러스에 의해 발병하는 급성 감염성 출혈열로, 이집트숲모기의 매개를 통해 전염되는 치명적인 감염 질환이다. 감염 이후 3-6일의 잠복기를 거친 이후에 발병하며, 발열, 근육통, 두통, 구토와 오심 등의 증상이 나타난다. 다수의 환자는 회복되지만 약 15%의 환자는 중증 단계로 돌입하여 중증 환자의 50% 가량이 10-14일 내로 사망하는 것으로 알려져 있다. 백신이 개발되어 있으나 이미 발병 이후의 환자에 대한 특화적 치료 방법은 아직 없다. 환자 치료는 대증요법 위주로 행해지며 탈수와 호흡곤란, 열, 합병증을 막기 위한 목적으로 시행된다. 매년 20만 건의 황열 발병이 보고되고, 그중 3만명이 사망한다(대한민국등록특허공보 10-0883703).
한편, 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)는 황열 바이러스의 표면 단백질에 위치하는 도메인 III(domain III) 부분으로, 황열 바이러스가 속하는 플라비바이러스는 캡시드 단백질(capsid protein) 내부에 게놈 RNA(genomic RNA)가 위치하며, 바깥쪽을 표면(envelope; E) 단백질의 다이머(dimer)와 막 단백질(membrane(M) protein)이 둘러싸고 있는 구조를 가지고 있다. 플라비바이러스 항원의 가장 바깥쪽에 위치하는 envelope protein은 domain I, II, III로 구성되어 있으며, 이 중 domain III는 바이러스 수용체가 결합하는 위치로, 혈청을 이용한 진단과 면역 연구의 주요한 타겟으로 주목받고 있다. domain III는 매우 항원적 특성이 강하며 바이러스-중화(virus-neutralizing) 단일 항체에 의해 인식되는 선형의 에피톱을 가지고 있다. 같은 플라비바이러스 속의 질병들은 바이러스 사이의 항원-교차반응이 강하므로 혈청학적 진단에 어려움이 있다. 그 일례로, 3 유형 뎅기열, 황열, 그리고 세인트루이스 뇌염 사이의 교차 반응에 의해 대부분의 감염이 오진단 되었다는 보고도 있다. 이러한 문제를 해결하기 위해, 같은 속의 바이러스에서도 뚜렷하게 구분되는 특성을 가지는 domain III의 서열이 주목 받고 있다.
현재 황열과 같은 열대 풍토성 질환은 증상에 기반한 진단, 중합효소 연쇄반응(PCR)을 이용한 감염체 검출, 항원-항체 반응을 이용한 면역진단법 등에 의해 진단되고 있다. 그러나 현존하는 방법들은 의료 시설이 열악한 빈곤 국가에서는 비용상의 문제로 널리 쓰이지 못하거나, 또는 민감도·선별도 등의 척도에서 적합한 수준에 미달되어 있다. 따라서 기존의 진단법이 갖는 한계를 극복하고 빈곤 국가에서 실제로 활용될 수 있는 소외질환 검출 플랫폼을 개발하는 것이 요구된다.
한편, 압타머는 특정 물질에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA(ssDNA) 또는 RNA이다. 압타머는 특정물질에 대한 친화도가 매우 높고 안정하기 때문에 최근 많이 개발되고 있고 이를 이용한 치료제 및 진단용 센서로의 응용이 활발히 진행되고 있다. 압타머의 합성은 비교적 단순한 방법으로 가능하고 세포, 단백질 그리고 작은 유기물질까지도 표적물질이 될 수 있기 때문에 이를 이용한 새로운 검출방법들의 개발이 가능하며 그 특이성 및 안정성이 이미 개발되어 있는 항체에 비해 매우 높기 때문에 치료제 개발 및 약물전달 시스템, 진단용 바이오센서로의 응용이 가능하다.
따라서, 소외 질환 검출 플랫폼을 개발하기 위해, 신규 바이오 마커를 이용한 황열의 진단이 주요한 과제의 대상이 되고 있고, 이에 대한 연구가 이루어지고 있으나, 아직 미비한 실정이다.
본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로, 본 발명에서 제조된 DNA 압타머의 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 대한 특이적인 결합능을 확인하고 이에 기초하여 본 발명을 완성하게 되었다.
이에, 본 발명의 목적은 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 특이적으로 결합하는 DNA 압타머로서, 상기 DNA 압타머는 서열번호 6의 염기서열로 이루어지는 것을 특징으로 하는, DNA 압타머를 제공하는 것이다.
또한, 본 발명의 다른 목적은 DNA 압타머를 포함하는, 황열 진단용 조성물 또는 황열 진단키트를 제공하는 것이다.
또한, 본 발명의 또 다른 목적은 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII) 특이적 DNA 압타머; 및 상기 DNA 압타머가 고정되어 있는 기판을 포함하는 황열 진단용 바이오센서로서, 상기 DNA 압타머는 서열번호 6의 염기서열로 이루어지는 것을 특징으로 하는, 황열 진단용 바이오센서를 제공하는 것이다.
또한, 본 발명의 또 다른 목적은 (a) 상기 바이오센서에 피검체 시료를 주입하는 단계; (b) 상기 (a)단계의 피검체 시료를 처리한 바이오센서에 양자점(quantum dot)이 포함된 검출탐침을 주입하는 단계; (c) 상기 (b)단계의 양자점이 포함된 검출탐침을 주입한 바이오센서에 산을 주입하는 단계; (d) 상기 (c)단계의 양자점과 산이 반응한 용액을 얻는 단계; 및 (e) 상기 (d)단계의 용액의 전류(Ampere; A)를 측정하는 단계를 포함하는, 황열 진단을 위한 정보제공 방법을 제공한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 특이적으로 결합하는 DNA 압타머로서, 상기 DNA 압타머는 서열번호 6의 염기서열로 이루어지는 것을 특징으로 하는, DNA 압타머를 제공한다.
본 발명의 일 구현 예로서, 상기 YFV EDIII는 황열 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질일 수 있다.
또한, 본 발명은 상기 DNA 압타머를 포함하는, 황열 진단용 조성물을 제공한다.
또한, 본 발명은 상기 DNA 압타머를 포함하는, 황열 진단 키트를 제공한다.
또한, 본 발명은 황열 바이러스 EDIII (Yellow fever virus envelope protein domain III; YFV EDIII) 특이적 DNA 압타머; 및 상기 DNA 압타머가 고정되어 있는 기판을 포함하는 황열 진단용 바이오센서로서, 상기 DNA 압타머는 서열번호 6의 염기서열로 이루어지는 것을 특징으로 하는, 황열 진단용 바이오센서를 제공한다.
본 발명의 일 구현 예로서, 상기 기판은 금속 전극층 및 금속 나노입자층을 포함하는 것일 수 있고, 상기 금속은 금(Au)일 수 있다.
본 발명의 다른 구현 예로서, 상기 DNA 압타머는 고정서열과 혼성화되어 이중가닥으로 기판에 고정되는 것일 수 있다.
또한, 본 발명은 (a) 상기 바이오센서에 피검체 시료를 주입하는 단계; (b) 상기 (a)단계의 피검체 시료를 처리한 바이오센서에 양자점(quantum dot)이 포함된 검출탐침을 주입하는 단계; (c) 상기 (b)단계의 양자점이 포함된 검출탐침을 주입한 바이오센서에 산을 주입하는 단계; (d) 상기 (c)단계의 양자점과 산이 반응한 용액을 얻는 단계; 및 (e) 상기 (d)단계의 용액의 전류(Ampere; A)를 측정하는 단계를 포함하는, 황열 진단을 위한 정보제공 방법을 제공한다.
본 발명의 일 구현 예로서, 상기 양자점은 황화 카드뮴(CdS)일 수 있다.
또한, 본 발명은 YFV EDIII에 특이적으로 결합하는 DNA 압타머를 개체에 투여하는 단계를 포함하는 황열의 진단방법을 제공한다.
또한, 본 발명은 YFV EDIII에 특이적으로 결합하는 DNA 압타머의 황열 진단 용도를 제공한다.
본 발명자들은 황열(Yellow fever)의 진단을 위한 신규 바이오 마커를 개발하기 위해 예의 연구한 결과, 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 대하여 특이적인 결합능을 갖는 DNA 압타머(DNA Aptamer)가 YFV EDIII와의 강한 결합력과 우수한 특이성이 있다는 것을 확인하였는 바, 기존의 항체를 이용한 ELISA 방법보다 뛰어난 안정성을 기대할 수 있으므로, 황열 진단용 조성물, 황열 진단용 바이오센서, 황열 진단을 위한 정보제공 방법 등의 개발 시에 유용하게 이용될 수 있을 것으로 기대된다.
도 1a는 YFV EDIII 유전자를 증폭하여 확인한 결과를 나타낸 것이다.
도 1b는 재조합 YFV EDIII 단백질을 과발현한 후에 FPLC를 통해 얻은 고순도의 재조합 YFV EDIII 단백질을 관찰한 결과를 나타낸 것이다.
도 2는 ssDNA(single strand DNA)와 YFV EDIII의 결합 정도(%)를 확인하고, 선별 과정을 진행한 결과를 나타낸 그래프이다.
도 3은 YF1 압타머 서열에 대한 Kd 값을 형광측정을 통하여 확인한 결과를 나타낸 그래프이다.
도 4는 DNA 압타머를 이용한 YFV EDIII 검출용 바이오센서에 대한 개략적인 모식도이다.
도 5a는 YFV EDIII의 농도를 다르게 했을 때, YF1 압타머를 이용한 YFV EDIII 검출 결과를 확인한 그래프이다.
도 5b는 Log로 환산한 YFV EDIII의 농도 값을 x축으로 하는 경우, YF1 압타머를 이용한 YFV EDIII 검출 결과가 정량적으로 나온다는 것을 확인한 그래프이다.
도 6은 YFV EDIII 단백질에 대한 결합특이성 실험에서 각 단백질과 반응에 따른 상대적인 전류 값의 변화를 나타낸 그래프이다.
본 발명자들은 황열(Yellow fever)의 진단을 위한 신규 바이오 마커를 개발하기 위해 예의 연구한 결과, 황열 바이러스 EDIII (Yellow fever virus envelope protein domain III; YFV EDIII)에 대하여 특이적인 결합능을 갖는 DNA 압타머(DNA Aptamer)가 YFV EDIII와의 강한 결합력과 우수한 특이성이 있다는 것을 확인하고, 본 발명을 완성하였다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 YFV EDIII에 특이적으로 결합하는 DNA 압타머를 제공한다.
본 발명에서 사용되는 용어, "황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)"란, 황열 바이러스의 표면 단백질에 위치하는 도메인 III(domain III) 부분으로, 황열 바이러스가 속하는 플라비바이러스는 캡시드 단백질(capsid protein) 내부에 게놈 RNA(genomic RNA)가 위치하며, 바깥쪽을 표면(envelope; E) 단백질의 다이머(dimer)와 막 단백질(membrane(M) protein)이 둘러싸고 있는 구조를 가지고 있다. 플라비바이러스 항원의 가장 바깥쪽에 위치하는 envelope protein은 domain I, II, III로 구성되어 있으며, 이 중 domain III는 바이러스 수용체가 결합하는 위치로, 혈청을 이용한 진단과 면역 연구의 주요한 타겟으로 주목받고 있다. domain III는 매우 항원적 특성이 강하며 바이러스-중화(virus-neutralizing) 단일 항체에 의해 인식되는 선형의 에피톱을 가지고 있다. 같은 플라비바이러스 속의 질병들은 바이러스 사이의 항원-교차반응이 강하므로 혈청학적 진단에 어려움이 있다. 그 일례로, 3 유형 뎅기열, 황열, 그리고 세인트루이스 뇌염 사이의 교차 반응에 의해 대부분의 감염이 오진단 되었다는 보고도 있다. 이러한 문제를 해결하기 위해, 같은 속의 바이러스에서도 뚜렷하게 구분되는 특성을 가지는 domain III의 서열이 주목 받고 있는 바, YFV EDIII의 검출을 통해 효과적으로 황열을 진단할 수 있고, 황열 바이러스 EDIII는 황열 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질일 수 있으나, 이에 제한되지 않는다.
본 발명에서 사용되는 용어, "압타머"란 특정 물질에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA(ssDNA) 또는 RNA이다. 기존에 개발되어 있는 항체를 이용한 방법은 생체의 면역시스템을 이용하여 만들어지기 때문에 비교적 많은 시간이 들고 고비용이라는 점, 단백질이기 때문에 그 안정성이 문제가 되는 경우가 있는 반면, 압타머는 합성에 있어서, 비교적 단순한 방법으로 가능하고 세포, 단백질 그리고 작은 유기물질까지도 표적물질이 될 수 있기 때문에 이를 이용한 새로운 검출방법들의 개발이 가능하며 그 특이성 및 안정성이 이미 개발되어 있는 항체에 비해 매우 높은 점에 착안하여, YFV EDIII의 특이적 검출을 위하여 DNA 압타머를 사용하였다. YFV EDIII의 특이적 검출이 가능한 DNA(ssDNA) 또는 RNA라면 모두 본 발명의 압타머에 해당할 수 있고, 바람직하게는 서열번호 6의 염기서열로 이루어질 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 상기 DNA 압타머를 포함하는, 황열 진단용 조성물을 제공한다.
본 발명의 조성물은 상기 DNA 압타머 외에 약리학적으로나 생리학적으로 허용되는 담체, 부형제, 및 희석제를 더 포함할 수 있다. 또한 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제, 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
상기 조성물에 포함될 수 있는 담체, 부형제, 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 및 광물유 등이 있다. 상기 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
또한, 본 발명은 상기 DNA 압타머를 포함하는, 황열 진단 키트를 제공한다.
상기 키트는 YFV EDIII에 특이적으로 결합하는 본 발명의 압타머를 포함하고 있으며, 압타머에는 당업계에 널리 사용되는 검출 표지들, 예를 들어 바이오틴 잔기가 부착될 수 있다. 바이오틴이 부착된 압타머에 표지물질을 도입한 다음, 이의 분석을 통해 YFV EDIII의 검출, 정량 및 진단에 이용할 수 있다. 바이오틴에 사용되는 표지물질로서 다양한 공지된 분석용 표지물질이 사용될 수 있으며, 예를 들면, 스트렙타비딘, 아비딘, Cy3, Cy5, Alexa, BODIPY, Rhodamine 또는 Q-dot 등을 사용하여 형광분석을 할 수 있다. 또한, YFV EDIII 검출을 위한 압타머에는 바이오틴 잔기 외에도, 기타 형광물질, 자성체, 염색물질, 효소, 방사성동위원소 등과 같은 통상의 표지 물질로 표지할 수 있으며, 통상의 검출 수단, 예를 들어, 형광 현미경, Radioimmnodetection(RAID) 등을 통하여 검출할 수 있다.
또한, 상기 키트는 압타머와 시료 내 YFV EDIII의 결합 여부를 정성 또는 정량적으로 측정하는데 사용할 수 있는 각종 도구 또는 시약으로서, 지지체(기재), 완충용액, 반응 정지제, 용해제, 세척제 또는 안정화제 등을 추가로 포함할 수 있다.
본 발명에서 압타머가 고정된 기재는, 예컨대 고체 기재로서 고분자, 유리, 금, 종이 및 생체막(membrane)으로 이루어진 군에서 선택된 것을 사용할 수 있다. 보다 구체적으로는, 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 아가로스, 셀룰로즈, 니트로셀룰로즈, 덱스트란, 세파덱스, 세파로즈, 리포솜, 카복시메틸 셀룰로즈, 폴리아크릴아미드, 폴리스테린, 반려암, 여과지, 이온교환수지, 플라스틱 필름, 플라스틱 튜브, 폴리아민-메틸 비닐-에테르-말레산 공중합체, 아미노산 공중합체, 에틸렌-말레산 공중합체, 나일론, 금속, 유리, 글래스 비드, 또는 자성 입자 등을 사용할 수 있다. 그 외의 다른 고체 기질로는 세포배양 플레이트, ELISA 플레이트, 튜브 및 폴리머성 막 등을 사용할 수 있다. 상기 기재는 임의의 가능한 형태, 예를 들어 구형(비드), 원통형(시험관 또는 웰 내면), 평면형(시트, 시험 스트립)을 가질 수 있으며, 보다 바람직하게는 멀티 웰 플레이트(예를 들어, 24웰, 96웰, 192웰, 384웰, 576웰 등)를 사용할 수 있다.
또한, 본 발명은 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII) 특이적 DNA 압타머; 및 상기 DNA 압타머가 고정되어 있는 기판을 포함하는 황열 진단용 바이오센서를 제공한다.
상기 DNA 압타머가 고정되어 있는 기판은 표면 인쇄 전극칩(Screen Printed Gold Electrode)의 금속 전극층 및 금속 나노입자층으로 이루어지며, 상기 전극층 및 나노입자 재질은 전기장 또는 자기장에 의해 유인될 수 있고, 전기장의 특성을 변화시킬 수 있는 어떠한 재질도 사용할 수 있으며, 바람직하게는 금(Au)로 이루어질 수 있으나, 이에 제한되는 것은 아니다.
상기 기판에 고정된 DNA 압타머는 고정서열과 혼성화되어 이중가닥으로 기판에 고정될 수 있으며, YFV EDIII에 특이적으로 결합하는 DNA 압타머라면 어느 하나에 제한되지 않으며, 바람직하게는 DNA 압타머는 YF1 압타머일 수 있으나, 이에 제한되지 않는다.
또한, 고정서열은 YF1 압타머와 혼성화되어, thiol-gold 반응에 의하여 기판에 고정될 수 있고, 바람직하게는 5'-AAG CAG TCC AAC TCG AAC ACA CTG-(CH 2) 6-SH-3' 서열일 수 있으나 이에 제한되지 않는다.
본 발명의 일 실시예에서는 YFV EDIII을 발현 정제하여 특정 결합서열을 확인하였으며(실시예1 내지 3 참조), SELEX를 이용하여 YFV EDIII에 대한 압타머를 탐색한 결과, YF1 압타머의 서열 및 구조를 분석 및 확인하였고(실시예 4 참조), 형광 측정을 이용하여 YFV EDIII와 압타머 간의 결합력을 측정하였으며(실시예 5 참조), 또한, 상기 실험 결과에 기초하여, 안정성 및 결합능이 우수한 DNA 압타머 및 바이오 센서를 제조하였으며(실시예 6 참조), 상기 바이오 센서가 YFV EDIII에 대한 특이성이 우수하다는 것을 확인하였는 바, 황열 진단을 위한 정보제공 방법으로 이용될 수 있음을 확인하였다(실시예 7 참조).
이에, 본 발명은 (a) 상기 바이오센서에 피검체 시료를 주입하는 단계; (b) 상기 (a)단계의 피검체 시료를 처리한 바이오센서에 양자점(quantum dot)이 포함된 검출탐침을 주입하는 단계; (c) 상기 (b)단계의 양자점이 포함된 검출탐침을 주입한 바이오센서에 산을 주입하는 단계; (d) 상기 (c)단계의 양자점과 산이 반응한 용액을 얻는 단계; 및 (e) 상기 (d)단계의 용액의 전류(Ampere; A)를 측정하는 단계를 포함하는, 황열 진단을 위한 정보제공 방법을 제공한다.
상기 황열 진단을 위한 피검체 시료는 조직, 세포, 전혈, 혈액, 타액, 객담, 뇌척수액, 또는 뇨 등일 수 있으나, 이에 제한되지 않는다.
또한, 상기 검출탐침은 YFV EDIII이 바이오센서 압타머와 결합하여 떨어져 나갈수록 그 자리를 더 많은 검출탐침이 채우며, 바람직하게는 검출탐침 서열은 5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC-(CH 2) 6-NH 2-3'이나 이에 제한되지 않는다.
또한, 상기 양자점은 검출탐침에 포함될 수 있고, 상기 산과 반응 할 수 있다면 어느 하나에 제한되지 않으며, 예를 들어, 황화 카드뮴(CdS), 황화 납(PbS) 등이 있을 수 있고, 바람직하게는 황화 카드뮴이나, 이에 제한되지 않는다.
또한, 상기 산은 상기 양자점(quantum dot)과 반응할 수 있다면 어느 하나에 제한되지 않으며, 예를 들어, 질산, 황산, 염산 등이 있으며, 바람직하게는 질산일 수 있으나 이에 제한되지 않는다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. YFV EDIII 유전자 클로닝
황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 대한 유전자를 증폭하기 위해 BamH1 제한효소 인식 서열을 포함한 Forward 프라이머 (5'-CCC GGA TCC TCT GCT CTG ACC CTG AAA GG-3'; 서열번호 1)와 HindIII 제한효소 인식서열을 포함하는 Reverse 프라이머(5'-CCC AAG CTT TTT ACC GAT AGA AGA ACC TTC TTT GTG CC-3'; 서열번호 2)를 사용하였다.
유전자 증폭을 위한 주형(templete)으로 E.coli K-12에 맞추어 유전자 코돈 최적화된 YFV EDIII gene sequence(strain Ghana/Asibi/1927, 573Ser-683Lys)를 사용하였고, i-pfu 중합효소(polymerase)를 이용하여 중합효소 연쇄 반응(polymerase chain reaction; PCR) 과정을 통해 증폭하였다. 중합효소 연쇄 반응의 각 단계는 다음과 같다. 1) 주형의 이중 가닥 DNA을 풀어주는 단계로 98°C에서 20초 incubation, 2) 주형과 프라이머가 결합하는 단계로 55°C 에서 20초 incubation, 3) 새로운 가닥을 합성해 나가는 단계로 72°C에서 30초 incubation하였고, 이와 같은 단계를 20번 반복하였다.
증폭된 YFV EDIII 유전자는 제한효소와의 반응 및 DNA ligase 통해 (His) 6-tag이 포함된 pET32a 벡터(vector)에 클로닝 하였고, 상기 벡터를 이용하여 BL21(DE3) E. coli 세포에 형질전환 하였다.
실시예 2. YFV EDIII 단백질의 발현
YFV EDIII 유전자가 형질 전환된 BL21(DE3) 세포는 LB(Luria Bertani) 배지에서 배양하였으며, UV600nm에서 OD(optical density)가 0.6에 도달할 때까지 37℃에서 배양하였다. 그 후, 단백질의 발현을 유도하기 위해 최종 농도가 1mM이 되도록 IPTG(isopropyl-thio-b-D-galactopyranoside)를 첨가한 후, 18℃에서 20시간 배양하였다. 단백질의 발현은 SDS PAGE로 확인하였고, 세포는 원심분리기를 이용하여 배지와 분리시킨 후, PBS buffer(10mM sodium phosphate, 150mM NaCl, pH 8.0)로 한번 씻어 주었다.
실시예 3. YFV EDIII 단백질의 정제
박테리아 세포 BL21(DE3)에서 발현된 YFV EDIII 단백질을 고순도로 정제하기 위해 세포 용균 버퍼(lysis buffer)(20mM Tris, 500mM NaCl, 0.5mM β-mercaptoethanol, 5% glycerol, pH 8.0)에 세포를 녹인 후, 초음파 분쇄기(sonicator)를 이용하여 20분 동안 초음파 분쇄(sonication)함으로써 세포를 파괴하였다. 수용액상의 단백질과 세포를 분리하기 위해 원심분리기를 이용하여 18,000rpm 에서 40분 동안 분리하였다.
또한, 고순도의 단백질을 얻기 위해 Ni-NTA(Ni-Nitrilotriacetic acid)와 (His) 6-tag 아미노산이 결합하는 특성을 이용하였다. 구체적으로, FPLC(Fast protein liquid chromatography)에 Ni-NTA 컬럼을 연결하고, 수용액상의 YFV EDIII를 컬럼에 흘려줌으로서 결합시켰다. Ni-NTA 컬럼에 결합된 단백질의 (His) 6-tag은 이미다졸(immidazole)의 화합물과 경쟁적으로 결합하기 때문에 표적 단백질을 컬럼에서 분리시키기 위해 elution buffer(20 mM Tris, 500 mM NaCl, 0.5 mM β-mercaptoethanol, 300 mM immidazole, pH 8.0)의 농도를 순차적으로 흘려줌으로서 YFV EDIII를 고순도로 분리하였다.
나아가, 상기 분리된 단백질에서 이미다졸을 제거하기 위해 desalting column을 거치며 버퍼를 바꾸었고, 정제된 단백질은 보존 버퍼(storage buffer, 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 5 mM β-mercaptoethanol)에 보관되었다.
실시예 4. SELEX을 이용한 YFV EDIII에 대한 압타머 탐색
4-1.ssDNA(single strand DNA)라이브러리의 제조
양 말단에 PCR 증폭 및 클로닝을 위한 프라이머의 결합서열을 갖고 가운데 40개의 무작위 DNA염기서열을 포함하는 90개의 서열을 가지는 합성된 라이브러리(5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3'; 서열번호 3)를 설계하였다. 또한, PCR 증폭 및 ssDNA 생성을 위하여 Forward 프라이머(5'-CACCTAATACGACTCACTATAGCGGA-3'; 서열번호 4)와 Reverse 프라이머 (5'-GCAAGCTTGTTCGAGCCAG-3'; 서열번호 5) 및 비오틴이 결합된 Reverse 프라이머(5'-Biotin-GCAAGCTTGTTCGAGCCAG-3')을 사용하였다. 여기서 사용된 모든 올리고 뉴클레오티드는 바이오닉스 사(한국)에서 합성 및 PAGE 정제하였다.
4-2. YFV EDIII의 Ni-NTA 자성 비드에 고정화
정제된 YFV EDIII는 표면에 코발트로 코팅되어 있어 단백질의 His-tag과 결합하는 자성 비드(magnetic bead)인 Dynabeads(Invitrogen, 노르웨이)를 이용하여 bead에 고정하였다.
구체적으로 단백질 결합 버퍼(20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl 2, pH 8.0) 100uL에 녹아 있는 단백질 1000pmole과 15uL의 bead를 외부 자석을 이용하여 결합버퍼로 세척 후, 한 시간 동안 실온에서 반응하여 bead에 고정하였다.
4-3. YFV EDIII에 특이적인 압타머 선별
YFV EDIII에 특이적인 압타머를 선별하기 위해 자성을 이용한 특이적 분리 방법을 수행하였다. 구체적으로, 먼저 ssDNA의 가장 안정한 구조형성을 위해, 100 uL의 결합 버퍼에 녹아 있는 ssDNA 라이브러리(500 pmole)를 90℃에서 3분 동안 배양 후, 4℃에서 30분 동안 배양하였다. 그 후, 앞서 magnetic bead에 고정화된 YFV EDIII과 함께 약하게 흔들어주면서 1시간 동안 반응하였다. 그 다음, bead에 결합된 YFV EDIII과 결합하지 않는 ssDNA를 제거하기 위해 결합 버퍼로 bead를 두 번 세척하였다. 그 후, magnetic bead에서 단백질과 결합한 ssDNA를 분리하기 위해 용출 버퍼(20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl 2, 0.01% tween 20, 300 mM immidazole, pH 8.0)를 이용해 단백질 및 결합 ssDNA를 용출하였다. 용출된 ssDNA는 에탄올을 이용해 침전시킨 후, 60 uL의 증류수에 용해한 다음 Forward 프라이머 및 비오틴이 결합된 Reverse 프라이머를 이용하여 i-pfu polymerase(인트론 바이오 테크놀로지, 한국)를 이용하여 PCR에 의해 증폭시켰다. 다음 선별 과정을 위한 ssDNA를 생성하기 위해, 비오틴이 결합된 PCR 산물을 비오틴과 결합하는 스트렙타아비딘(streptavidin)이 코팅된 자성 비드와 함께 커플링 버퍼(5mM Tris-HCl, 0.5mM EDTA, 1M NaCl, 0.005% tween 20, pH 7.5)조건에서 1시간 배양하였다. 배양 후 ssDNA만을 분리하기 위해 100uL의 100mM NaOH와 10분 동안 배양하였고, 외부 자석을 이용해 선별된 ssDNA만을 얻을 수 있었다. 또한, 첫 번째 선별된 ssDNA를 다음 선별에 사용하여 선별을 반복하였다. 이때 ssDNA의 양 및 YFV EDIII의 농도는 엄격한 선별을 위해 보다 감소시키면서 진행하였으며, 반복되는 선별에서 용출된 ssDNA를 UV 분광광도계(UV spectrometer, Biochrom Libra S22 spectromether)로 농도를 측정하여 남아 있는 ssDNA의 YFV EDIII와의 결합 정도를 확인하며 선별 과정을 진행하였다. 상기 결합 정도(%)는 도 2에 나타난 바와 같다.
4-4. 압타머 서열분석 및 구조분석
11번째의 반복 선별된 ssDNA는 변형되지 않은 Forward 프라이머와 Reverse 프라이머를 이용하여 PCR 과정을 통해 증폭하였고, pENTR/TOPO 벡터(TOPO TA Cloning kit, Invitrogen, 미국)에 클로닝한 후, E.coli TOP10 세포(Invitrogen, 미국)에 형질전환하였다. ssDNA가 삽입된 클론을 miniprep 키트(GeneAll, 한국)를 이용하여 정제한 후, 염기서열을 분석(COSMO Genetech, 한국)하였다. 그 결과, 하기 표 1과 같은 서열을 분석할 수 있었다.
Aptamer candidate sequence (5'→3')
YF1 (90 mer) CACCTAATACGACTCACTATAGCGGATCCGAATATATCTCCTTAGTTCGAGTTGGAC TGCTTCTAGGATTGCTGGCTCGAACAAGCTTGC
실시예 5. 형광 측정을 이용한 단백질과 압타머 간의 결합력 측정
400pmole의 YFV EDIII를 10uL 자성 비드(megnetic bead)와 혼합한 후, 100uL의 결합 버퍼(20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl2, pH 8.0)에서 1시간 동안 배양하였다. 결합하지 않은 YFV EDIII를 분리하기 위해 결합 버퍼로 2번 세척하였다. 그 후 다양한 농도의 6-FAM으로 표지된 압타머와 1시간 동안 배양하고, 결합하지 않은 압타머는 세척을 통해 제거하였다. YFV EDIII가 고정된 자성 비드에 결합된 6-FAM이 표지된 ssDNA 압타머의 양은 자석을 이용하여 YFV EDIII에 결합된 6-FAM가 표지된 ssDNA만을 분리하여 형광측정(1420 Victor multilabel counter, PerkinElmer, USA)을 통해 측정하였다. 그 결과, 도 3 및 하기 표 2에 나타낸 바와 같이, YF1 염기서열이 갖는 DNA 압타머의 kd값을 측정 할 수 있었다.
압타머 Kd (nM)
YF1 12.2 nM
실시예 6. 검출 조건 최적화 및 바이오센서 제작
상기 실시예 4에서 발굴한 DNA 압타머를 가지고 YFV EDIII를 검출하기 위하여, 스트립핑 전압전류법(Stripping Voltammetry) 기술을 이용하여 검출 감도가 뛰어난 바이오센서를 설계하였다. 도 4는 본 발명의 DNA 압타머를 이용한 YFV EDIII 검출용 바이오센서에 대한 개략적인 모식도이다.
먼저, SPGE(Screen Printed Gold Electrode) 칩의 금 전극에 금 나노입자를 흡착시킨 후 아미노기와 결합된 고정 서열(5'-AAG CAG TCC AAC TCG AAC ACA CTG-(CH 2) 6-SH-3'), YF1 압타머(5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC-3')이 혼성화된 이중 가닥을 thiol-gold 반응에 의하여 금 표면에 고정한다. 그 후에 검출하고자 하는 YFV EDIII를 넣고 40분간 반응한 다음 증류수로 씻어내면, YFV EDIII에 특이적으로 반응하는 YF1 압타머가 단백질과 결합하여 떨어져 나가고 그 만큼에 상응하는 고정 서열이 단일 가닥으로 남는다. 마지막으로 황화 카드뮴 양자점(quantum dot, CdS)와 연결한 검출 탐침서열 (5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC-(CH 2) 6-NH 2-3')을 40분간 반응하고 증류수로 씻어낸 다음, 1 M 질산 70 uL로 한시간 추가로 반응한 용액을 1 mL 아세테이트/비스무트 버퍼(0.1 M acetate buffer, 400 ug/L bismuth, pH 4.5)로 옮겨 stripping square wave voltammetry 분석을 시행한다.
더 많은 YFV EDIII이 바이오센서 표면 탐침과 결합하여 떨어져 나갈수록 그 자리를 더 많은 검출 탐침서열이 채우며, 질산과 반응한 황화 카드뮴이 다량의 카드뮴 이온을 용액 중으로 방출한다. 이를 금속 이온을 매우 높은 특이성과 민감성으로 탐지하는 stripping voltammetry 기법 그래프 상의 피크로 관찰할 수 있고 이로 인한 signal-on 방식의 정량분석이 가능하다.
전기화학을 기반으로, 선택된 YF1 압타머를 이용하여 재조합된 YFV EDIII를 검출하였다. 그 결과, 도 5a 및 도 5b에 나타낸 바와 같이, YFV EDIII의 농도가 높아질수록 (1 pM - 100 nM) 전류 값이 증가하는 것을 확인할 수 있었다(도 5a 참조). 전류 값을 y축으로, Log로 환산한 YFV EDIII의 농도 값을 x축으로 둔 그래프를 도출하였으며 이에 상기 제작된 바이오센서를 통하여 YFV EDIII의 검출이 정량적으로 이루어지며, 검출한계는 0.10 pM 임을 확인하였다(도 5b 참조).
실시예 7. YFV EDIII 검출 압타머의 결합특이성 확인
DNA 압타머가 바이오센서로 사용되기 위해서는, 표적 YFV EDIII 외에 혈액 안의 다른 여러 단백질과 반응을 하지 않는 결합특이성이 중요한바, DNA 압타머가 선택적으로 결합하는지 여부를 확인하기 위하여, 여러 단백질 시료에 대하여 결합 특이성을 확인하였다. 이 때 PBS에 각 단백질의 농도가 10nM이 되도록 혼합하여 검출하였다.
그 결과, 도 6에 나타낸 바와 같이, YFV EDIII에 대해 특이성이 뛰어난 것을 확인하였다. 특히, 대조된 단백질 중 CHIKV는 YFV와 유사한 열대 감염성 바이러스의 표면 단백질로, 일반적으로 열대 감염병 사이에 높은 교차 반응성을 가지는 것으로 알려져 있음에도 불구하고 본 발명에서 개발된 DNA 압타머와 결합하지 않는 것으로 확인되었다. 이는 본 발명의 DNA 압타머가 높은 결합특이성을 가지고 YFV EDIII와 반응한다는 것을 의미한다. 또한 혈청 단백질인 HSA과 비교했을 때도 높은 특이성을 가졌다.
상기로부터, 본 발명에서 개발된 DNA 압타머 YF1가 YFV EDIII에 매우 높은 결합특이성을 가지고 있을 뿐 아니라, 복잡한 생물학적 시료에서도 바이오센서로 사용될 수 있음을 의미한다.
참고로, 본 발명의 서열목록 리스트는 하기 표3과 같다.
서열목록 명칭 서열
서열번호 1 YFV EDIII Forward primer CCC GGA TCC TCT GCT CTG ACC CTG AAA GG
서열번호 2 YFV EDIII Reverse primer CCC AAG CTT TTT ACC GAT AGA AGA ACC TTC TTT GTG CC
서열번호 3 ssDNA library cacctaatacgactcactatagcggatccgannnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnctggctcgaacaagcttgc
서열번호 4 Forward primer cacctaatac gactcactat agcgga
서열번호 5 Reverse primer gcaagcttgt tcgagccag
서열번호 6 YF1 Aptamer gcaagcttgt tcgagccag
서열번호 7 fixed sequence AAG CAG TCC AAC TCG AAC ACA CTG
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 특이적으로 결합하는 DNA 압타머는 황열 바이러스의 표면 단백질에 강한 결합력과 우수한 특이성을 가지고 있어, 기존의 항체를 이용한 진단과 비교하여 현저히 증가된 정확성을 가지고 황열 바이러스를 진단할 수 있으므로, 진단 키트, 진단용 조성물 등 진단을 위한 다양한 제품에 효율적으로 이용될 수 있을 것으로 기대된다.

Claims (9)

  1. 황열 바이러스 EDIII(Yellow fever virus envelope protein domain III; YFV EDIII)에 특이적으로 결합하는 DNA 압타머로서,
    상기 DNA 압타머는 서열번호 6의 염기서열로 이루어지는 것을 특징으로 하는, DNA 압타머.
  2. 제1항에 있어서,
    상기 YFV EDIII는 황열 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질인 것을 특징으로 하는, DNA 압타머.
  3. 제1항의 DNA 압타머를 포함하는, 황열 진단용 조성물.
  4. 제1항의 DNA 압타머를 포함하는, 황열 진단 키트.
  5. 황열 바이러스 EDIII (Yellow fever virus envelope protein domain III; YFV EDIII) 특이적 DNA 압타머; 및 상기 DNA 압타머가 고정되어 있는 기판을 포함하는 황열 진단용 바이오센서로서,
    상기 DNA 압타머는 서열번호 6의 염기서열로 이루어지는 것을 특징으로 하는, 황열 진단용 바이오센서.
  6. 제5항에 있어서,
    상기 기판은 금속 전극층 및 금속 나노입자층을 포함하고, 상기 금속은 금(Au)인 것을 특징으로 하는, 황열 진단용 바이오센서.
  7. 제5항에 있어서,
    상기 DNA 압타머는 고정서열과 혼성화되어 이중가닥으로 기판에 고정되는 것을 특징으로 하는, 황열 진단용 바이오센서.
  8. 하기 단계를 포함하는, 황열 진단을 위한 정보제공 방법.
    (a) 제5항의 바이오센서에 피검체 시료를 주입하는 단계;
    (b) 상기 (a)단계의 피검체 시료를 처리한 바이오센서에 양자점(quantum dot)이 포함된 검출탐침을 주입하는 단계;
    (c) 상기 (b)단계의 양자점이 포함된 검출탐침을 주입한 바이오센서에 산을 주입하는 단계;
    (d) 상기 (c)단계의 양자점과 산이 반응한 용액을 얻는 단계; 및
    (e) 상기 (d)단계의 용액의 전류(Ampere; A)를 측정하는 단계.
  9. 제8항에 있어서,
    상기 양자점은 황화 카드뮴(CdS)인 것을 특징으로 하는, 황열 진단을 위한 정보제공 방법.
PCT/KR2019/018001 2018-12-19 2019-12-18 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도 WO2020130627A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201980083915.4A CN113227377B (zh) 2018-12-19 2019-12-18 与黄热病病毒ediii特异性结合的dna适体及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180165205A KR101970963B1 (ko) 2018-12-19 2018-12-19 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도
KR10-2018-0165205 2018-12-19

Publications (1)

Publication Number Publication Date
WO2020130627A1 true WO2020130627A1 (ko) 2020-06-25

Family

ID=66285261

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/018001 WO2020130627A1 (ko) 2018-12-19 2019-12-18 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도

Country Status (3)

Country Link
KR (1) KR101970963B1 (ko)
CN (1) CN113227377B (ko)
WO (1) WO2020130627A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101970963B1 (ko) * 2018-12-19 2019-04-23 주식회사 엠디헬스케어 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도
KR102048812B1 (ko) * 2018-12-19 2019-11-26 주식회사 엠디헬스케어 뎅기 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도
KR102196156B1 (ko) * 2019-09-25 2020-12-29 충북대학교 산학협력단 황열 바이러스 비구조단백질 1에 대한 단일클론항체, 이를 생산하는 하이브리도마 세포주 및 이의 용도

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150067801A (ko) * 2013-12-09 2015-06-19 대한민국(관리부서 질병관리본부장) 초파리 발현 시스템에서 황열바이러스 유사 입자 생산 방법
US20170226511A1 (en) * 2013-11-13 2017-08-10 National University Of Singapore Aptamers for binding flavivirus proteins
KR101970963B1 (ko) * 2018-12-19 2019-04-23 주식회사 엠디헬스케어 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1635693A2 (en) * 2003-05-23 2006-03-22 Board Of Regents, The University Of Texas System High throughput screening of aptamer libraries for specific binding to proteins on viruses and other pathogens
CN100503628C (zh) 2003-05-30 2009-06-24 法莫赛特股份有限公司 修饰的氟化核苷类似物
EP2532748B1 (en) * 2011-06-07 2014-10-08 Postech Academy-industry Foundation DNA aptamer specifically binding to human cardiac troponin I
US20150087728A1 (en) * 2013-09-20 2015-03-26 Integrated Diagnostics, Inc. Compositions, methods and kits for diagnosis of lung cancer
EP3191589A4 (en) * 2014-09-11 2018-05-09 VLP Therapeutics, LLC Flavivirus virus like particle
CN105301085B (zh) * 2015-11-09 2017-10-27 江南大学 一种基于核酸适配体和量子点同时检测链霉素氯霉素四环素三种抗生素残留的方法
US11531029B2 (en) * 2017-05-08 2022-12-20 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Methods and compositions for the detection of flavivirus infections
KR102016668B1 (ko) * 2018-12-19 2019-08-30 주식회사 엠디헬스케어 치쿤군야 바이러스 e2에 특이적으로 결합하는 dna 압타머 및 이의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170226511A1 (en) * 2013-11-13 2017-08-10 National University Of Singapore Aptamers for binding flavivirus proteins
KR20150067801A (ko) * 2013-12-09 2015-06-19 대한민국(관리부서 질병관리본부장) 초파리 발현 시스템에서 황열바이러스 유사 입자 생산 방법
KR101970963B1 (ko) * 2018-12-19 2019-04-23 주식회사 엠디헬스케어 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RYMAN , KATE D. ET AL.: "Mutation in a 17D-204 vaccine substrain-specific envelope protein epitope alters the pathogenesis of yellow fever virus in mice", VIROLOGY, vol. 244, 1998, pages 59 - 65, XP004845013 *
UMAMAHESWARI , AMINENI ET AL.: "Docking studies towards exploring antiviral compounds against envelope protein of yellow fever virus", INTERDISCIPLINARY SCIENCES: COMPUTATIONAL LIFE SCIENCES, vol. 3, 2011, pages 64 - 77, XP055721648 *

Also Published As

Publication number Publication date
KR101970963B1 (ko) 2019-04-23
CN113227377B (zh) 2023-11-28
CN113227377A (zh) 2021-08-06

Similar Documents

Publication Publication Date Title
WO2020130624A1 (ko) 치쿤군야 바이러스 e2에 특이적으로 결합하는 dna 압타머 및 이의 용도
WO2020130627A1 (ko) 황열 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도
JP2618381B2 (ja) 核酸ハイブリダイゼーシヨン検定を行うための方法およびキツト
KR0171617B1 (ko) 단백질-핵산 프로브 및 그를 사용하는 면역분석법
JP2001095590A (ja) 核酸ハイブリダイゼーションアッセイのためのプローブ
US20230228751A1 (en) Aptamers against sars-cov-2
TW201002825A (en) Novel method and kit for diagnosis of mycobacterium tuberculosis and nontuberculous mycobacterium
JP2001512691A (ja) イムノアッセイ分析および分子生物学的な過程を調べるための電気化学的レポーターシステム
KR101887876B1 (ko) H5형 조류독감 바이러스에 특이적으로 결합하는 핵산 압타머 및 이를 이용하는 h5형 조류독감 바이러스의 검출방법
WO2019059645A1 (ko) Tb7.7에 특이적으로 결합하는 dna 압타머 및 이의 용도
WO2020130626A1 (ko) 뎅기 바이러스 ediii에 특이적으로 결합하는 dna 압타머 및 이의 용도
WO2019059644A1 (ko) Esat6에 특이적으로 결합하는 dna 압타머 및 이의 용도
CA2353920A1 (en) Test system for detecting different markers, and production and use thereof
WO2019112178A1 (ko) 오담에 특이적으로 결합하는 dna 앱타머 및 그의 용도
WO2019059643A1 (ko) Cfp10에 특이적으로 결합하는 dna 압타머 및 이의 용도
CN113252892B (zh) 一种用于提高病原微生物抗原检测灵敏度的探针及试剂盒
JPH11511027A (ja) Gb型肝炎ウィルス遺伝子型の検出
Yu Rapid and sensitive detection of Escherichia coli O157: H7 using a QCM sensor based on aptamers selected by whole-bacterium SELEX and a multivalent aptamer system
JP4393378B2 (ja) ハイブリダイゼーション反応及び免疫反応を同時に検出する方法、並びに、診断におけるその使用
WO2015046737A1 (ko) 리스테리아의 병원성 조절인자 prfa 단백질과 특이적으로 결합하는 dna 앱타머 및 이의 용도
WO2013118967A1 (ko) 시겔라 소네이의 침입성 플라스미드 항원 h 단백질과 특이적으로 결합하는 dna 앱타머 및 이의 용도
JP2002116207A (ja) 高感度測定法およびそれに使用するキット

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19898224

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19898224

Country of ref document: EP

Kind code of ref document: A1