WO2020076078A1 - 락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용 - Google Patents

락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용 Download PDF

Info

Publication number
WO2020076078A1
WO2020076078A1 PCT/KR2019/013260 KR2019013260W WO2020076078A1 WO 2020076078 A1 WO2020076078 A1 WO 2020076078A1 KR 2019013260 W KR2019013260 W KR 2019013260W WO 2020076078 A1 WO2020076078 A1 WO 2020076078A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
target protein
expression vector
microorganism
pgsa
Prior art date
Application number
PCT/KR2019/013260
Other languages
English (en)
French (fr)
Inventor
박영철
기대은
남경준
변세은
문하나
강현준
함경수
Original Assignee
주식회사 바이오리더스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오리더스 filed Critical 주식회사 바이오리더스
Priority to US17/281,743 priority Critical patent/US20220033812A1/en
Priority to JP2021518738A priority patent/JP7147060B2/ja
Priority to EP19871372.9A priority patent/EP3865578A4/en
Priority to CN201980075582.0A priority patent/CN113330119A/zh
Priority to KR1020217010523A priority patent/KR102594583B1/ko
Publication of WO2020076078A1 publication Critical patent/WO2020076078A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y501/00—Racemaces and epimerases (5.1)
    • C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)
    • C12Y501/03003—Aldose 1-epimerase (5.1.3.3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a promoter of a galactose mutarotase gene derived from Lactobacillus casei , and more specifically, Lactobacillus casei represented by the nucleotide sequence of SEQ ID NO: 1. It relates to a promoter of the derived galactose mutarotase gene, an expression vector containing the promoter, and a microorganism transformed with the expression vector.
  • the present invention relates to a new vector that effectively expresses a foreign protein on the surface of a microorganism using an extracellular membrane protein (pgsA) involved in the synthesis of polygamma glutamic acid derived from a strain of the genus Bacillus, and furthermore, the present invention is a strain of the genus Bacillus It relates to a method for producing a protein that expresses a foreign protein on the surface of a microorganism using an extracellular membrane protein involved in the synthesis of the derived polygamma glutamic acid.
  • pgsA extracellular membrane protein
  • Lactic acid bacteria the most important microbial group among food microorganisms, are microorganisms that have been used in various foods and have been proven to be safe (GRAS: generally recognized as safe), and have plasmids, bacteriophage, and transposons to introduce themselves. It is possible to develop a vector, and it is easy to transform by a method commonly used in the art, and it can be said to be the most suitable strain for use as an edible product, since the edible selection marker genes are also secured.
  • lactic acid bacteria have effects such as intestinal harmful bacterium suppression and intestinal action, blood cholesterol reduction function, nutritional value enhancement, pathogen infection suppression action, liver cirrhosis improvement action, anti-cancer action, anti-aging action, and immune-enhancing action through macrophage activation. Have.
  • lactic acid bacteria are vaccines because it is known that a large amount of components contained in lactic acid bacteria, such as unmethylated CpG DNA, lipidochoic acid, and peptidoglycan, act as adjuvants. Its usefulness as a vehicle is highly regarded.
  • lactic acid bacteria have a number of advantages in that they can induce intestinal mucosal immunity because they are resistant to bile acids and gastric acids and can transmit antigens to the intestine (Jos FMK Seegers, Trends Biotechnol., Vol. 20, pp 508- 515, 2002).
  • lactobacillus is suitable as a carrier of beccin, such as confirming the efficacy of treating diseases using secretion-expressing strains (Lothar Steidler et al., Nat. Biotechnol. Vol. 21, pp 785-789, 2003). .
  • cell surface expression refers to a technology that fuses a protein or peptide with an appropriate surface expression motif to express on the surface of Gram-negative, positive bacteria, fungi, yeast, and animal cells (Lee SY, et al., Trends) Biotechnol., 21: 4552, 2003).
  • the first cell surface expression technology was expressed by fusion of a peptide or small protein with pIII of a filamentous phage using a relatively simple phage, which is called a surface-expression system. .
  • Cell surface expression using phage was used for screening of antibodies or screening of epitope, high-affinity ligand, etc., however, the size of proteins that could be expressed on the surface of phage was relatively limited, revealing limitations. Therefore, as an alternative, cell surface expression using bacteria has been developed. It is a field that stably expresses foreign proteins on the surface of microorganisms by using surface proteins of microorganisms such as bacteria and yeast as a surface anchoring motif.
  • the appropriate surface protein and the foreign protein are linked to each other at the gene level so that the fusion protein is biosynthesized, and they stably pass through the inner membrane and adhere to the cell surface.
  • a protein having the following properties as a matrix for surface expression First, it has a secretion signal that can pass through the intracellular membrane at the N-terminus, and second, it is used on the cell outer membrane surface. It must have a targeting signal that can be stably attached. Third, it can be expressed in a large amount on the cell surface within a range that does not adversely affect cell growth, and finally, protein activity can be high.
  • a secretion signal through which the biosynthesized protein in the cell can pass through the cell membrane must be on the primary sequence of the protein.
  • it in the case of Gram-negative bacteria, it must be seated so that it passes through the intracellular membrane and the cell membrane space and is attached to the extracellular membrane and protrudes out of the membrane.
  • proteins having such secretion signals and targeting signals that settle on the cell surface include, for example, surface proteins, special enzymes, and toxin proteins. In fact, if the secretion signals and target signals of these proteins are used together with an appropriate promoter, the proteins can be successfully expressed on the surface of bacteria.
  • the surface proteins of bacteria used for the surface expression of foreign proteins can be largely divided into four types: extracellular membrane proteins, lipoproteins, secreted proteins, and cell surface organ proteins.
  • extracellular membrane proteins lipoproteins
  • secreted proteins cell surface organ proteins.
  • cell surface organ proteins cell surface organ proteins.
  • surface proteins mainly present in Gram-negative bacteria such as LamB, PhoE, and OmpA.
  • LamB LamB
  • PhoE PhoE
  • OmpA the size of the protein that can be structurally inserted is limited because the foreign protein is inserted into a loop protruding from the cell surface.
  • the C-terminus and the N-terminus of the foreign protein to be inserted must be positioned three-dimensionally close, there is a problem in that the distance between the two ends with a connecting peptide should be close when the distance is long.
  • Lipid proteins are also used as surface proteins for surface expression.
  • the lipoprotein of E. coli has a secretion signal at its N-terminus and can pass through the intracellular membrane, and the terminal cysteine (L-cysteine) is covalently attached to the extracellular membrane lipid or the intracellular membrane lipid directly.
  • the main lipoprotein, Lpp is bound to the N-terminus by the extracellular membrane and the C-terminus by the cell wall (peptidoglycan, PG) .When connected to the extracellular membrane protein OmpA fragment, it can stably secrete foreign proteins to the extracellular membrane to express the surface. [Francisco et al., Proc. Natl. Acad. Sci.
  • Another lipoprotein, TraT was used to surface-express peptides such as the C3 epitope of poliovirus using these properties of lipoproteins [Felici et al., J. Mol. Biol., 222: 301-310 (1991)].
  • cell wall-attached lipoprotein (PAL) whose exact function is not yet known, was also used for surface expression of recombinant antibodies [Fuchs et al., Bio / Technology, 9: 1369-1372 (1991)]. In this case, the C-terminus of the PAL was connected to the cell wall, and the N-terminus was connected to the recombinant antibody to express the fusion protein.
  • the secreted protein passing through the extracellular membrane can also be used as a surface protein, but in the case of Gram-negative bacteria, the secreted protein is not developed, and only a few secreted proteins have proteins involved in the specific secretion mechanism, so that the extracellular membrane passes Is helping.
  • pullulanase of the genus Klebsiella is a lipoprotein whose N-terminus is replaced with fat, attached to the extracellular membrane, and then completely secreted into cell culture. Konacker et al.
  • the IgA protease from the pathogenic microorganism Neisseria which has a unique secretion system, has a signal that allows the protease present at the N-terminus to settle on the extracellular membrane in a fragment present at the C-terminus. Once reaching the extracellular membrane, the protease that protrudes on the cell surface is secreted into the cell culture medium by its hydrolysis ability. Klauser et al. Used this IgA protease-fragment to stably express a cholera toxin B subunit of about 12 kDa on the cell surface [Klauser et al., EMBO J., 9: 1991-1999 (1990)]. However, secretion of the fusion protein was suppressed by protein folding in the cell membrane space during the secretion process.
  • cell organelles that are present on the cell surface and can be applied to the surface expression include flagella, pili, and fimbriae.
  • flagella protein Flagellin
  • flagella protein a constituent subunit of flagella, peptides derived from cholera toxin B subunit and hepatitis B virus were stably expressed, and they reacted strongly with antibodies against them [Newton et al., Science, 244: 70-72 (1989)].
  • a lipase derived from Staphylococcus hyicus is used as a secretion signal
  • protein A derived from Staphylococcus aureus is used as a membrane-attaching matrix, resulting in an 80 amino acid malaria antigen (malaria) Blood stage antigen) and streptococcus protein G-derived albumin-attached proteins have been effectively expressed on the surface of Gram-positive bacteria.
  • the appropriate extracellular membrane protein and the foreign protein are linked to each other at the gene level to induce fusion proteins to be biosynthesized, and they stably pass through the intracellular membrane. It should be kept attached to the extracellular membrane.
  • the surface-expressing matrix that satisfies all the above conditions has not been developed yet, and so far is a level that compensates for the disadvantages of the above-described cases.
  • the present inventors utilize the synthetic complex gene (pgsBCA) of polygamma glutamic acid derived from a strain of the genus Bacillus subtilis var. Chungkookjang as a new surface expression matrix, and a new vector for effectively expressing foreign proteins on the surface of microorganisms and A method of expressing a target protein on the surface of a microorganism transformed with a vector has been developed (Korean Patent Registration No. 0469800).
  • pgsBCA synthetic complex gene of polygamma glutamic acid derived from a strain of the genus Bacillus subtilis var. Chungkookjang
  • the present inventors have developed a vector capable of stably high-expressing an antigen or an antigenic determinant in the lactobacillus using the surface-expressing matrix described in the patent, and thus the human body is friendly to the immune response efficiently and efficiently because the antigen is exposed on the surface of the lactobacillus.
  • the promoter of the galactose mutarotase gene is compared to the previously used promoter.
  • the main object of the present invention is to provide a promoter derived from Lactobacillus casei ( Lactobacillus casei ) that induces an increase in expression of a target gene.
  • Another object of the present invention is to provide an expression vector characterized in that the gene encoding the promoter and the target protein is linked.
  • Another object of the present invention is to provide a method for producing a target protein using the microorganism transformed with the expression vector and the transformed microorganism.
  • Another object of the present invention is to provide a method for producing a microbial vaccine using the transformed microorganism.
  • Another object of the present invention is to select an extracellular membrane protein involved in the synthesis of polygamma glutamic acid derived from a strain of the genus Bacillus as a surface expression parent capable of expressing a large amount of foreign protein on the surface of a microorganism, and using it as a foreign expression protein or It is intended to provide a method for preparing a surface expression vector of a target protein capable of expressing a peptide on a microbial surface, and efficiently expressing a foreign protein on the surface of a transformant in various transformants transformed with the target protein.
  • the present invention provides a promoter of galactose mutarotase gene derived from Lactobacillus casei .
  • the promoter may be characterized in that represented by SEQ ID NO: 1.
  • the present invention also provides an expression vector and a microorganism transformed with the expression vector, wherein the target gene is linked to the end of the promoter.
  • the present invention also provides a microbial surface expression vector and a microorganism transformed with the surface expression vector to which the promoter, the polygamma glutamic acid synthetase complex gene and the gene encoding the target protein are linked.
  • the target protein may be characterized as an antigen.
  • the target protein is a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a signal transduction protein or a portion thereof, an antibody or a portion thereof, a short chain antibody, a binding protein, a binding domain, a peptide, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin It may be characterized in that it is any one selected from the group consisting of proteins, cytokines, transcriptional regulatory factors, blood coagulation factors and plant bioprotective proteins.
  • the poly-gamma-glutamic acid synthase complex gene may be characterized by at least one of pgsA, pgsB and pgsC.
  • the present invention also provides a method for expressing a target protein on the surface of a microorganism, characterized by culturing the transformed microorganism.
  • the present invention further comprises: (a) culturing the microorganism transformed with the microorganism surface expression vector to surface express the antigen on the microorganism surface; And (b) recovering the microorganism on which the antigen is surface-expressed.
  • the present invention provides a surface expression vector of a target protein comprising a gene encoding a polygamma glutamic acid synthetase complex pgsA and a target protein.
  • the gene pgsA may be characterized as derived from a strain of the genus Bacillus that produces polygamma glutamic acid.
  • the gene pgsA encoding the polygammaglutamic acid synthetase complex may be characterized by having any one of nucleotide sequences of SEQ ID NOs: 18 to 22 and 29 to 31.
  • the gene pgsA encoding the polygammaglutamic acid synthetase complex may be characterized by having any one of nucleotide sequences of SEQ ID NOs: 18 to 21 and 29 to 31.
  • a linker is inserted into the terminal portion of the gene pgsA, and a gene encoding a target protein is inserted into the inserted linker.
  • the target protein may be characterized in that a portion of the amino acid sequence of the target protein is removed or position-specific mutated to favor surface expression.
  • the present invention also provides a microorganism transformed with the surface expression vector.
  • the microorganism used for transformation may be characterized in that it is modified so as not to produce intracellular or extracellular proteolytic enzymes involved in decomposing the expressed target protein so as to favor the cell surface expression of the target protein. .
  • the microorganism may be characterized in that the lactic acid bacteria.
  • the lactic acid bacteria may include the genus Lactobacillus, Streptococcus genus and Bifidobacterium genus.
  • the genus Lactobacillus is Lactobacillus acidophilus , L. casei , Lactobacillus plantarum , L. ferementum , Lactobacillus L. delbrueckii , L. johnsonii LJI , L. reuteri and L. bulgaricus ;
  • the genus Streptococcus is S. thermophilus ;
  • the genus Bifidobacterium is B. infantis, B.
  • B. longum B. psuedolongum
  • Bifidobacterium breve B. breve
  • Bifidobacterium lactis Bb-12 B. lactis Bb-12
  • Bifidobacterium adolescentis can be used as hosts. And more preferably the genus Lactobacillus.
  • the present invention also provides a method for expressing a cell surface of a target protein comprising culturing the transformed microorganism to express the target protein on the cell surface and recovering the cell expressing the target protein on the surface.
  • the target protein is a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a signal transduction protein or a portion thereof, an antibody or a portion thereof, a single chain antibody, a binding protein, a binding domain, a peptide, an antigen, an adhesion protein, a structural protein, and regulation It may be characterized in that it is any one selected from the group consisting of proteins, toxin proteins, cytokines, transcription regulatory factors, blood coagulation factors and plant biodefense-inducing proteins.
  • the present invention also provides a method characterized by inducing humoral immunity or cellular immunity by administering cells expressing the antigen on the surface to a vertebrate other than humans by the above method.
  • the present invention is also produced by the above method, characterized in that by administering cells expressing the antigen on the surface to vertebrates other than humans to induce an immune response, and recovering antibodies generated by the immune response. Methods for making antibodies in animals are provided.
  • the present invention also provides a surface expression vector of a target protein, characterized in that the vector is applied to Gram-negative bacteria or Gram-positive bacteria.
  • the present invention also, (a) preparing a recombinant vector by inserting a gene encoding a target protein into a vector for microbial surface expression; (b) transforming Gram-negative or Gram-positive host cells with the recombinant vector; And (c) culturing the transformed host cell to express the target protein on the surface of the host cell, thereby providing a method for expressing the target protein on the surface of the gram-negative or gram-positive host cell.
  • the present invention has an effect of providing a galactose mutarotase promoter derived from Lactobacillus casei capable of highly expressing a target protein in lactic acid bacteria and a vector for expression using the promoter. Since the vector contains a gene for surface-expressing the target protein, in the transformant using the vector, the target protein can be effectively expressed on the surface of the cell, and lactic acid bacteria can be utilized as a vaccine carrier.
  • the surface expression vector of the target protein can stably express the target protein, and the surface expression vector according to the present invention constantly expresses the target protein while simultaneously expressing the target protein. It can be useful for the production of antigens for vaccine production.
  • Figure 1 shows the method of obtaining the galactose mutarotase (galactose mutarotase) promoter of the present invention.
  • Figure 2 shows the genetic map of the vector for surface expression constructed using the galactose mutarotase (galactose mutarotase) promoter of the present invention.
  • Figure 3 Compared with the lactic acid bacteria transformed with the expression vector of the present invention, the degree of expression of the target protein between each promoter is shown through Western blotting.
  • Figure 5 shows the genetic map of the surface expression vector, pKV-Pald-PgsA-EGFP, using Lactobacillus casei as a host according to the present invention.
  • Figure 6 shows the genetic map of the surface expression vector (pKV-Pald-pgsA1), PgsA motif 1-60 a.a -EGFP as a host of Lactobacillus casei according to the present invention.
  • Figure 7 shows the genetic map of the surface expression vector (pKV-Pald-pgsA2), PgsA motif 1-70 a.a -EGFP, which is a host of Lactobacillus casei according to the present invention.
  • Figure 8 shows the genetic map of the surface expression vector (pKV-Pald-pgsA3), PgsA motif 1-80 a.a -EGFP as a host of Lactobacillus casei according to the present invention.
  • FIG. 9 Surface expression vector (pKV-Pald-pgsA5), host of Lactobacillus casei according to the present invention, shows a genetic map of PgsA motif 1-100 a.a -EGFP.
  • Fig. 10 shows the genetic map of the surface expression vector (pKV-Pald-pgsA5), pKV-PgsA 1-188 a.a-EGFP, which hosts Lactobacillus casei according to the present invention as a host.
  • Fig. 11 shows the genetic map of the surface expression vector (pKV-Pald-pgsA6), PgsA motif 25-60 a.a -EGFP, which hosts Lactobacillus casei according to the present invention as a host.
  • Fig. 12 shows the genetic map of the surface expression vector (pKV-Pald-pgsA7), PgsA motif 25-70 a.a -EGFP, which is a host of Lactobacillus casei according to the present invention.
  • Figure 13 shows the genetic map of the surface expression vector (pKV-Pald-pgsA8), PgsA motif 25-100 a.a -EGFP as a host of Lactobacillus casei according to the present invention.
  • Figure 14 shows a Western blotting photograph showing the surface expression of EGFP protein in Lactobacillus casei transformed with the surface expression vectors pKV-Pald-pgsA1 to pKV-Pald-pgsA8 of the present invention.
  • Example 2 Construction of EGFP protein surface expression vector (pKV-Pgm-pgsA-EGFP) using a galactose mutarotase promoter
  • an expression vector of the EGFP protein that is expressed by the galactose mutarotase promoter a vector having RepE capable of replicating in E. coli and Lactobacillus casei as a replication origin, a galactose mutaro derived from Lactobacillus casei After inserting the Tase promoter, pgsA, a surface expression parent derived from Bacillus subtilis var.
  • Chungkookjang is introduced downstream of the promoter, and restriction of BamHI and XbaI capable of inserting a target gene into the carboxy terminus of pgsA
  • the enzyme site was added to prepare a pKV-Pgm-pgsA vector containing the galactose mutarotase promoter.
  • the pgsA gene was used as disclosed in Korean Patent Registration No. 0469800.
  • the EGFP gene was obtained after PCR using the synthetic EGFP gene fragment as a template and using SEQ ID NO: 4 and SEQ ID NO: 5 as primers.
  • the present invention in one aspect, relates to a promoter of a galactose mutarotase gene derived from Lactobacillus casei .
  • the galactose mutarotase promoter of the present invention is a promoter that induces the expression of the galactose mutarotase gene present in Lactobacillus casei.
  • the promoter includes a portion in which RNA polymerase binds to induce transcription initiation, and since the degree of RNA synthesis is determined according to the base sequence of the promoter, the expression intensity of the gene may be different depending on the promoter.
  • the EGFP gene is inserted into an expression vector containing the promoter and an existing aldolase promoter, respectively, and lactose is prepared using the prepared vectors.
  • Bacillus casei was transformed, the expression level of EGFP induced by each promoter was compared through Western blotting. As a result, it was confirmed that the expression level of EGFP was effectively increased in the transformant of the vector containing the galactose mutarotase promoter, and the expression induction intensity of the promoter of the present invention was also stronger than the existing aldolase promoter.
  • the expression level of EGFP was effectively increased in the transformant of the vector containing the galactose mutarotase promoter, and the expression induction intensity of the promoter of the present invention was also stronger than the existing aldolase promoter.
  • the present invention relates to an expression vector containing a gene encoding the galactose mutarotase promoter and a target protein and a microorganism transformed with the expression vector.
  • the expression vector usually requires at least a promoter that enables transcription, a gene that expresses the target protein downstream of the promoter, a gene that can self-replicate and amplify in the microorganism, and a selectable marker gene to select the desired vector.
  • the genes, excluding the target gene may vary depending on the backbone of the vector and the selected host.
  • the minimally necessary genes in vector construction are well known to those skilled in the art, and can be easily selected according to gene expression conditions and purposes.
  • the backbone of the vector can be used, such as those having a replication origin of pWV01, pAM ⁇ 1, but is not limited thereto.
  • Various methods and means can be used to insert a vector or DNA sequence that is intended for gene expression, including a target gene as well as an additional regulatory site, into a suitable host cell.
  • biochemical methods such as transformation, transfection, conjugation, protoplast fusion, and calcium phosphate precipitation, or diethylminoehtyl (DEAE) dextran, or electroporation Physical methods such as can be used.
  • DEAE diethylminoehtyl
  • a target gene After inserting the expression vector into an appropriate host cell, a target gene can be expressed using a selection medium suitable for growth of a host containing an antibiotic capable of selecting only transformants using conventional techniques known in the art. Transformants containing the present vector can be selected.
  • the present invention provides a microorganism surface expression vector and a microorganism transformed with the surface expression vector to which the galactose mutarotase promoter, a polygamma glutamate synthetase complex gene and a gene encoding a target protein are linked. It is about.
  • Downstream of the promoter contains the gene of the polygammaglutamic acid synthetase complex, which is a surface expression parent, which is located between the promoter and the target gene on the DNA sequence of the vector. Since the gene of the surface-expressing mother is encoded with an amino acid, it is linked to the first half of the target protein and functions to induce the expressed protein to bind with the lipid of the cell membrane, so it plays a decisive role in surface expression of the target protein.
  • the method of linking the gene of the surface-expressing parent with the promoter and the target gene can be easily carried out by those skilled in the art such as PCR (polymerase chain reaction), restriction enzyme digestion and ligation. Technology can be used.
  • 'host', or 'microorganism' refers to lactic acid bacteria, which are gram-positive bacteria of probiotic, and the general probiotic microorganism selection criteria include (i) human-derived microorganisms; (ii) stable to bile, acid, enzymes and oxygen; (iii) have the ability to adhere to the intestinal mucosa; (iv) have the ability to form colonies in the digestive tract; (v) be able to produce antibacterial substances; And (vi) efficacy or stability can be demonstrated.
  • lactic acid bacteria are friendly and harmless bacteria that grow in the human body.
  • the strain when a transformant using lactic acid bacteria as a host is applied to the human body and used for the purpose of gene transfer or protein transfer for the prevention or treatment of disease, unlike the conventional vaccine manufacturing method using the strain, the strain is not toxicized Or no step of detoxification is required.
  • the microorganism may include the genus Lactobacillus, Streptococcus genus, and Bifidobacterium genus.
  • the genus Lactobacillus is Lactobacillus acidophilus , L. casei , Lactobacillus plantarum , L. ferementum , Lactobacillus L. delbrueckii , L. johnsonii LJI, L. reuteri and L. bulgaricus ;
  • the genus Streptococcus is S. thermophilus ;
  • Bifidobacterium Bifidobacterium bonus B. bifidum
  • Bifidobacterium rongeom B. longum
  • Bifidobacterium pseudo rongeom B. psuedolongum
  • Bifidobacterium breve B. breve
  • Bifidobacterium lactis Bb-12 B. lactis Bb-12
  • Bifidobacterium adolescentis can be used as hosts. And more preferably the genus Lactobacillus.
  • an expression vector (pKV-Pgm-pgsA-EGFP) capable of expressing the EGFP gene as a target gene was prepared by including the base sequence linked to the promoter and the surface expression parent pgsA, and the expression vector was lactobacillus.
  • a transformant expressing EGFP was prepared by inserting it into Kasay.
  • the target protein expressed by the promoter having the improved gene expression ability of the present invention is expressed on the surface of the cell, so the transformed microorganism of the present invention can be used as a vaccine.
  • the present invention relates to a method for producing a microbial vaccine, characterized by using lactic acid bacteria transformed with the surface expression vector.
  • Vaccines are drugs that are used to stimulate the immune system by using living organisms for the purpose of preventing disease.
  • Immune activation refers to a process for efficiently removing an antigen by stimulating antibody production, stimulation of T-lymphocytes, or other immune cells (eg, macrophages) in an organism.
  • the target of administration of the transformed microbial vaccine expressing a target protein as an antigen may be a mammal, more preferably a human.
  • the preparation of the vaccine composition can be carried out using standard techniques, and the dosage suitable for the operator varies depending on the antigenicity of the gene product and may be an amount sufficient to induce the typical immune response of the existing vaccine, and through routine experimental procedures. Needs can be easily determined.
  • a typical initial vaccine dose is 0.001 to 1 mg antigen per kg body weight, increasing the amount or using multiple doses as needed to provide the desired level of protection.
  • the amount can be determined by a person skilled in the art and depends on factors such as formulation method, mode of administration, age, body weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and response sensitivity. It can also be prescribed in various ways.
  • the antigenic material In order for the vaccine to be effective in producing antibodies, the antigenic material must be introduced into the body so that the antibody-producing mechanism of the vaccinated subject can be realized. Therefore, for the immune response, the microorganism carrier of the gene product must first be introduced into the body.
  • administration methods such as intravenous injection, intramuscular injection, and subcutaneous injection are possible. It is preferred to administer.
  • the vaccine composition for oral administration of the vaccine composition to the administerer, it is useful to be provided in a lyophilic form, for example in capsule form.
  • the capsule is provided as an enteric coating comprising Eudragate S, Eudragate L, cellulose acetate, cellulose phthalate or hydroxy propylmethyl cellulose.
  • the capsules may be used by themselves or recomposed of a lyophilic material such as a suspension before administration. It is effective to reconstitute in a buffer of pH suitable for the survival of the transformed microorganism. It may be useful to administer the sodium bicarbonate preparation prior to each vaccine administration to protect the transformed microorganisms and vaccines from gastric acid.
  • the vaccine can be prepared for parenteral administration, intranasal administration, or intramammary administration.
  • the transformed lactic acid bacteria containing the promoter of the present invention and containing a gene expressing a target protein capable of acting as an antigen forms colonies on the mucous membranes of the digestive system so that the desired efficacy can be obtained. It maintains the desired transgenic properties, and can simultaneously administer selected antibiotics in the vector for smooth colony formation.
  • undesired lactic acid bacteria that do not have a vector that can be derived in the process of dividing the transformant The occurrence can be controlled.
  • the above screening method can be easily carried out by conventional techniques in the art, and the selective antibiotics that can be used in the above process may vary depending on the antibiotic gene included in the expression vector.
  • a surface expression vector (pKV-Pald-PgsA-EGFP) ) was obtained by performing PCR using the primers of SEQ ID NOs: 8 to 17 as a template.
  • each PgsA1 to A5 motif fragment has a nucleotide sequence of SEQ ID NOs: 18 to 22.
  • the surface expression vector (pKV-Pald-PgsA-EGFP) of SEQ ID NOs: 23 to 28 PCR was performed using primers to obtain.
  • each PgsA motif fragment has a nucleotide sequence of SEQ ID NOs: 29 to 31.
  • the present invention selects an extracellular membrane protein involved in the synthesis of polygamma glutamic acid derived from a strain of the genus Bacillus as a new surface expression parent capable of expressing a large amount of foreign protein on the surface of a microorganism, and uses it to microbial foreign protein or peptide It is an object of the present invention to provide a surface expression vector capable of expressing on a surface, and to provide a method for efficiently expressing a foreign protein on the surface of a transformant in various transformants transformed therewith.
  • the present invention provides a microbial surface expression vector comprising the gene pgsA constituting the polygamma glutamic acid synthetase complex and a strain transformed by the vector.
  • the present invention also provides a method of expressing a foreign protein on the surface of a transformed strain using the microbial surface expression vector to achieve the above object.
  • the protein encoded by the gene pgsA is an extracellular membrane protein present in Bacillus, Bacillus subtilis IFO3336; Nattobacteria; Biochem. Biophy. Research Comm., 263, 6-12, 1999), Bacillus licheniformis (Bacillus) licheniformis ATCC9945; Biotech. Bioeng. 57 (4), 430-437, 1998), edible, water-soluble, anionic, produced from Bacillus anthracis (J. Bacteriology, 171, 722-730, 1989), etc. It is a protein involved in the synthesis of poly-gamma-glutamic acid, a biodegradable polymer.
  • the extracellular membrane protein isolated from bacteria consists of a total of 922 amino acids, consisting of pgsB, pgsC and pgsA, pgsB is 393 amino acids, pgsC is 149 amino acids and pgsA is 380 It is composed of amino acids.
  • Ashiuchi et al. Have observed the synthesis of polygamma glutamic acid from Bacillus natto bacteria, cloned and transformed into E. coli to observe the synthesis of polygamma glutamic acid in E. coli [Ashiuchi et al., Biochem. Biophy. Res. Communications, 263: 6-12 (1999)].
  • pgsB is a amide ligase of the complex-constituent protein, and the N-terminal specific amino acid of pgsB interacts with the cell membrane or cell wall, and in the case of pgsA, it has a hydrophilic specific amino acid sequence at the N-terminal and C-terminal.
  • these amino acid sequences have secretion signals and target and adhesion signals that can pass through the intracellular membrane.
  • the extracellular membrane protein involved in the synthesis of polygammaglutamic acid has many advantages as a surface-expressing parent that expresses foreign proteins on the cell surface due to its amino acid primary sequence structure and properties:
  • polygamma glutamic acid The extracellular membrane protein involved in the synthesis of polygamma glutamic acid can be expressed in large quantities on the cell surface for the synthesis and secretion of the extracellular
  • the extracellular membrane protein involved in the synthesis of the expressed polygamma glutamic acid is a cell cycle resting period In the case of pgsA, structurally, it protrudes on the cell surface.
  • the extracellular membrane protein involved in the synthesis of polygamma glutamic acid is a surface of Gram-positive bacteria. But it can be stably expressed on the surface of Gram-negative bacteria. There are advantages such.
  • An object of the present invention is to provide a useful vector capable of expressing a foreign protein on the surface of a bacterium by using the properties of an extracellular membrane protein involved in the synthesis of polygamma glutamic acid.
  • the surface expression vector of the target protein of the present invention includes a secretory signal and a target signal possessed on the primary sequence of the extracellular membrane protein involved in the synthesis of polygamma glutamic acid.
  • the present invention has an object to provide a method for expressing a foreign protein on the surface of a microorganism using a surface expression vector using the characteristics of an extracellular membrane protein involved in the synthesis of polygamma glutamic acid.
  • the present invention expresses a foreign protein on the surface of a microorganism by using an extracellular membrane protein involved in the synthesis of polygamma glutamic acid, so that the foreign protein can be efficiently used without going through a cell crushing or protein separation and purification process. It provides a method of manufacturing.
  • the "target protein” or “foreign protein” means a protein that cannot normally exist in a transformed host cell expressing the protein.
  • the protein is referred to as a foreign protein or a target protein.
  • the target protein preferably includes an infectious microorganism, an antigen derived from an immune disease or an antigen derived from a tumor, for example, a fungal pathogen, bacteria, parasites, intestinal parasites, helminths, viruses or allergens, etc. It may, but is not limited to this.
  • the antigen is tetanus toxoid (tetanus toxoid), influenza virus hemagglutinin (hemagglutinin) or nucleoprotein, diphtheria toxoid (diphtheria toxoid), gp120 or fragment of HIV, gag protein of HIV, IgA pro Protease, insulin peptide B, spongospora subterranea antigen, Vibriose antigen, Salmonella antigen, Pneumococcus, Respiratory syncytial virus (RSV) antigen , Hemophilus influenza outer membrane protein, Streptococcus pneumoniae antigen, Helicobacter pylori urease, Neisseria meningitidis pilin , Pilin of Neseria gonorrhoeae, melanoma-associated protein (TRP2, MAGE-1, MAGE-3, gp100, tyrosine) Human papillomavirus (te
  • the foreign protein produced by the surface expression method of the present invention can be provided for various uses.
  • This use includes effective production of antibodies and enzymes, as well as production of peptide libraries to screen for antigens, attached or adsorbed proteins, and new bioactive substances.
  • the surface expression vector using the synthetic gene of polygamma glutamic acid of the present invention can be applied to all strains to express foreign proteins on the surface of microorganisms, preferably Gram-negative bacteria, more preferably E. coli, Salmonella typhi , Salmonella typhimurium, Vibrimo cholera, Mycobacterium bovis, Shigella, and Gram-positive bacteria, preferably Bacillus, Lactobacillus, Lactococcus, Staphylococcus, Listeria monocytogenes, Strapococcus strain, etc. Can be applied. All foreign protein production methods using the above strains are included in the scope of the present invention.
  • various recognition sites of all or some restriction enzymes can be inserted into the N-terminus or C-terminus of the synthetic gene of polygamma glutamic acid, and the surface expression vectors into which these restriction enzyme sites are inserted are all within the scope of the present invention. Is included.
  • the present invention includes pgsA, a polygamma-glutamic acid synthetic gene derived from a strain of the genus Bacillus, and inserts a restriction enzyme recognition site at the C-terminus of pgsA, thereby making it possible to clone various foreign protein genes easily, surface expression vector pKV- Pald-pgsA1 to pKV-Pald-pgsA8 are provided.
  • the present invention is composed of pgsA, which is a complex of the extracellular membrane protein among the complexes of the extracellular membrane proteins involved in the synthesis of polygamma glutamic acid, and connects the N-terminus of the EGFP protein to the C-terminus of pgsA to convert the EGFP protein into a fusion protein form.
  • Surface expression vectors pKV-Pald-pgsA1 to pKV-Pald-pgsA8 that can be expressed on the surface of Gram-positive bacteria are provided.
  • the gene pgsA of the extracellular membrane protein involved in the synthesis of polygamma glutamic acid was obtained from Bacillus subtilis var. Chungkookjang (KCTC 0697BP), but the gene is all Bacillus producing polygamma glutamic acid. It is also included in the scope of the present invention to obtain a pgsA from the genus strain to prepare a vector or surface express a foreign protein. For example, using the pgsA gene derived from another strain having 80% or more homology to the base sequence of the pgsA gene present in Bacillus subtilis cheonggukjang, vector production or surface expression of foreign proteins will also be included in the scope of the present invention. .
  • enhanced green fluorescent protein was selected and confirmed as a model protein.
  • EGFP enhanced green fluorescent protein
  • "EGFP (enhanced green fluorescent protein) gene” is a gene that makes it easy to observe cells expressing the protein by emitting green light in vivo, and has an advantage that can be observed with a fluorescent microscope.
  • GFP is a green fluorescent protein originating from jellyfish (Aequorea Victoria) and has been used as an important marker of gene expression in various research fields.
  • EGFP is a mutant of GFP, replacing the original GFP's 64th phenylalanine amino acid sequence with Leucine, and the 65th located Serine amino acid sequence with Threonine, which is more than the original GFP. It has the advantage of emitting a strong fluorescent signal.
  • the present inventors prepared the surface expression vector by inserting the EGFP gene into the pKV-Pald-pgsA1 to pKV-Pald-pgsA8 recombinant vectors prepared above, transformed Lactobacillus casei, and cultured to induce expression by inducing the expression. Then, a certain amount of the culture solution was collected to obtain a protein. The obtained protein was analyzed by SDS-PAGE, and Western blotting was performed using an anti-EGFP antibody. As a result, the protein EGFP was added to the pKV-Pald-pgsA1 to pKV-Pald-pgsA8 recombinant vectors prepared above. Was successfully inserted and confirmed to be expressed on the cell surface.
  • EGFP protein was used as a foreign protein, but any other protein such as other enzymes, antigens, antibodies, adhesion proteins, or adsorption proteins may be foreign proteins.
  • the pgsA gene was used as a motif for producing a surface expression vector, but it was found that similar results can be obtained even when pgsB, pgsC or a combination thereof is used (WO2003 / 014360) It will be apparent to those skilled in the art as identified in.
  • Example 1 Securing a galactose mutarotase promoter derived from Lactobacillus casei
  • Lactobacillus casei is a basic medium, MRS medium (1% casein hydrolysate, 1.5% yeast extract, 2% dextrose, 0.2% ammonium citric acid, 0.5% sodium acetate, 0.01% magnesium sulfate, 0.05% manganese sulfate and Cultured in 0.2% dipotassium phosphate, Acumedia Manufacturers, Inc.), and the solution obtained by crushing the cultured Lactobacillus 1x10 9 cells was used as a PCR template.
  • MRS medium 1% casein hydrolysate, 1.5% yeast extract, 2% dextrose, 0.2% ammonium citric acid, 0.5% sodium acetate, 0.01% magnesium sulfate, 0.05% manganese sulfate and Cultured in 0.2% dipotassium phosphate, Acumedia Manufacturers, Inc.
  • Example 2 Construction of EGFP protein surface expression vector (pKV-Pgm-pgsA-EGFP) using a galactose mutarotase promoter
  • a vector having RepE capable of replicating in E. coli and Lactobacillus casei as a replication origin is a galactose mutaro derived from Lactobacillus casei
  • pgsA a surface expression parent derived from Bacillus subtilis var.
  • Chungkookjang is introduced downstream of the promoter, and restriction of BamHI and XbaI capable of inserting a target gene into the carboxy terminus of pgsA
  • the enzyme site was added to prepare a pKV-Pgm-pgsA vector containing the galactose mutarotase promoter.
  • the pgsA gene was used as disclosed in Korean Patent Registration No. 0469800.
  • the EGFP gene was obtained after PCR using the synthetic EGFP gene fragment as a template and using SEQ ID NO: 4 and SEQ ID NO: 5 as primers.
  • Example 3 Confirmation of expression and induction intensity of target protein through Western blotting
  • the pKV-Pgm-pgsA-EGFP expression vector prepared in Example 2 was transformed with Lactobacillus casei, and the transformed recombinant Lactobacillus casei was cultured to confirm expression of the EGFP protein.
  • an EGFP gene as a reporter gene is linked to each promoter to construct an expression vector, and Lactobacillus casei Each was transformed. And the amount of EGFP expression was compared by Western blotting.
  • the recombinant Lactobacillus casei transformed with the surface expression vector of the present invention was incubated at 30 ° C in MRS medium (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA) to induce surface expression of EGFP protein.
  • MRS medium Libacillus MRS, Becton Dickinson and Company Sparks, USA
  • the whole cells of the cultured Lactobacillus casei were subjected to SDS-polyacrylamide gel electrophoresis and Western blotting using specific antibodies against EGFP to confirm the expression of the fusion protein.
  • a sample was prepared by denaturing the transformed recombinant Lactobacillus casei cells in which expression was induced with a protein obtained at the same cell concentration, and analyzing this by SDS-polyacrylamide gel electrophoresis, followed by fractionation. Proteins were transferred to PVDF (polyvinylidene-difluoride membranes, Bio-Rad) membranes. The PVDF membrane transferred with the proteins was blocked in a blocking buffer solution (50 mM Tris-HCl, 5% skim milk, pH 8.0) for 1 hour, and then the polyclonal primary antibody derived from each rabbit against EGFP was blocked. Diluted 1000 times in a buffer solution and reacted for 1 hour.
  • a blocking buffer solution 50 mM Tris-HCl, 5% skim milk, pH 8.0
  • the membrane was washed with a buffer solution, and the secondary antibody against the HRP (Horseradish Peroxidase) -conjugated rabbit-derived antibody was diluted 10000 times in a blocking buffer solution and reacted for 1 hour.
  • HRP Haseradish Peroxidase
  • the membrane is washed with a buffer solution, and a substrate (Lumigen PS-3 acridan, H 2 0 2 ) is added to the washed membrane for about 2 minutes to develop color. The binding was confirmed.
  • Figure 3 shows the results of performing Western blotting to confirm the expression level of the EGFP protein in the recombinant Lactobacillus casei cells transformed with the cell surface expression vector of the present invention.
  • Lane SM is Protein size marker
  • Lane 1 is Lactobacillus casei (empty vector)
  • Lane 2 and 3 are Lactobacillus casei (pKV-Pgm-pgsA-EGFP)
  • Lane 4 is Lactobacillus casei (pKV-Pald-pgsA-EGFP), respectively. Expression.
  • the expression of the target protein was confirmed in the expression vector of pKV-Pgm-pgsA-EGFP (Lane 2 and 3) of the present invention as well as the expression amount. It was confirmed that it was more excellent.
  • the galactose mutarotase promoter of the present invention stably expresses a target protein in an expression vector and can express it more strongly compared to the Aldoalse promoter (FIG. 3).
  • Example 4 Confirmation of microbial surface expression of two target proteins using a confocal fluorescence microscope
  • the fluorescence image was observed through a confocal microscope (Confocal microscopy, Carl Zeiss LSM800).
  • Recombinant Lactobacillus casei transformed with the surface expression vector (pKV-Pgm-pgsA-EGFP) of the present invention is cultured on MRS medium (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), and subjected to static incubation at 30 ° C. Expression was induced. Then, after binding with a specific antibody of EGFP, immunostaining with Alexa488 (green) confirmed cell surface expression of EGFP under a confocal microscope.
  • the expression vector of the present invention can be utilized in the production of a microbial vaccine because transformation of lactic acid bacteria does not require a step of detoxification or non-toxication of the strain, unlike the conventional vaccine production method, and expresses the target protein more strongly. It is expected to be.
  • EGFP expression vector a gene encoding EGFP protein was inserted into the C-terminal of PgsA using a surface expression vector prepared in pKV-Pald-PgsA-E7 (refer to Korean Patent No. 10-1471043).
  • a vector pKV-Pald-PgsA-EGFP capable of surface expression in lactic acid bacteria was obtained.
  • the HPV16 E7 gene fused with pgsA was removed from the pKV-Pald-PgsA-E7 vector and a gene encoding EGFP was inserted. It was obtained by performing PCR using the synthetic EGFP gene fragment as a template using SEQ ID NO: 6 and SEQ ID NO: 7 as primers.
  • a segment of 755 bp containing the EGFP gene was obtained, the 5 'end of the segment contained a BamHI restriction enzyme site, and the 3' end of the segment contained an XbaI restriction enzyme site.
  • the obtained DNA fragment was digested with BamHI and XbaI restriction enzymes to obtain a 741 bp fragment.
  • pKV-Pald-PgsA-E7 was cut with BamHI and XbaI to remove the HPV16 E7 gene portion and secure the vector portion.
  • the pKV-Pald-PgsA-EGFP was completed by linking the DNA fragment containing the E7 gene digested with BamHI and XbaI with the vector digested with the same restriction enzyme (FIG. 5).
  • the surface expression vector prepared in Example 5 (pKV-Pald-PgsA-EGFP) was used to improve the PgsA gene as a fragment so that it can more stably exhibit high expression rates in lactic acid bacteria hosts.
  • a surface expression vector (pKV-Pald-PgsA-EGFP) ) was obtained by performing PCR using the following primer as a template.
  • PgsA motif 1-80 a.a
  • each PgsA1 to A5 motif fragment has the following nucleotide sequence.
  • PgsA 1-60 a a fragment sequence (PgsA1)
  • PgsA 1-70 a fragment sequence (PgsA2)
  • PgsA 1-80 a fragment sequence (PgsA3)
  • PgsA 1-100 a.a fragment sequence (PgsA4)
  • PgsA 1-188 a a fragment sequence (PgsA5)
  • the pKV-Pald-PgsA-EGFP was cleaved with SphI and BamHI to obtain a vector portion from which the aldolase promoter and the PgsA gene portion were removed.
  • the improved vector was completed by linking the DNA fragment containing each PgsA motif fragment gene with a vector digested with the same restriction enzyme (Figs. 6 to 10).
  • a surface expression vector (pKV-Pald-PgsA-EGFP) was used as a template using the following primers. PCR was performed to obtain.
  • each PgsA motif fragment has the following nucleotide sequence.
  • PgsA 25-60 a a fragment sequence (PgsA6)
  • the pKV-Pald-PgsA-EGFP was cut with EcoRV and BamHI to obtain a vector portion from which the PgsA gene portion was removed.
  • Lactobacillus casei was transformed with the PgsA motif improved surface expression vector prepared in Example 5, and the transformed recombinant Lactobacillus casei was cultured to confirm expression of EGFP protein.
  • the expression of the EGFP protein fused with any of the fragments pgsA1 to A8 improved in the transformed recombinant Lactobacillus casei was examined.
  • Recombinant Lactobacillus casei transformed with the PgsA motif fragment surface expression vector is statically cultured at 30 ° C at MRS medium (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), and any of the gene fragments pgsA1 to A8 synthesizing polygamma glutamic acid at 30 ° C. Surface expression of EGFP protein fused with one C-terminus was induced.
  • the whole cells of the cultured Lactobacillus casei were subjected to Western blotting using SDS-polyacrylamide gel electrophoresis and specific antibodies against EGFP to confirm expression of the fusion protein.
  • a sample was prepared by denaturing the transformed recombinant Lactobacillus casei cells in which expression was induced with a protein obtained at the same cell concentration, and analyzing this by SDS-polyacrylamide gel electrophoresis, followed by fractionation. Proteins were transferred to PVDF (polyvinylidene-difluoride membranes, Bio-Rad) membranes. The PVDF membrane on which the proteins have been transferred is blocked by shaking in a blocking buffer solution (50 mM Tris hydrochloric acid, 5% skim milk, pH 8.0) for 1 hour, followed by blocking buffer of a polyclonal primary antibody derived from rabbit against EGFP The solution was diluted 1000-fold and reacted for 1 hour.
  • a blocking buffer solution 50 mM Tris hydrochloric acid, 5% skim milk, pH 8.0
  • the membrane was washed with a buffer solution, and the secondary antibody against HRP-conjugated rabbit was diluted 10000 times in a blocking buffer solution and reacted for 1 hour.
  • the membrane is washed with a buffer solution, and a substrate (lumigen PS-3 acridan, H202) is added to the washed membrane for about 2 minutes to develop color.
  • a substrate lumigen PS-3 acridan, H202
  • FIG. 14 shows the expression pattern (lane 6 and 11) in the Lactobacillus casei according to the pKV-Pald-pgsA recombinant expression vector into which the unmodified pgsA set as a control was compared with the present invention (lane 6 and 11) and the improved pgsA1 according to the present invention
  • the expression patterns (lanes 1 to 5 and lanes 7 to 10) in Lactobacillus casei according to the pKV-Pald-pgsA1 to A8 recombinant expression vector into which A8 is inserted are shown.
  • lane 1 in FIG. 14 is a transformed recombinant Lactobacillus casei expressing EGFP on PgsA motif 1-60 aa
  • lane 2 is PgsA motif 1-70 aa
  • lane 3 is PgsA motif 1-80 aa
  • Lane 4 is the expression of recombinant Lactobacillus casei transformed with EGFP on PgsA motif 1-100 aa
  • Lane 5 shows protein expression of recombinant Lactobacillus casei transformed with EGFP on PgsA motif 1-188 a.a.
  • Lane 6 shows protein expression of recombinant Lactobacillus casei transformed with pKV-Pald-PgsA-EGFP.
  • lane 7 in FIG. 14 is a transformed recombinant Lactobacillus casei expressing EGFP on PgsA motif 25-60 aa
  • lane 8 is PgsA motif 25-70 aa
  • lane 9 is EGFP on PgsA motif 25-100 aa Is the expression of the transformed recombinant Lactobacillus casei.
  • Lane 10 shows protein expression of recombinant Lactobacillus casei transformed with EGFP on PgsA motif 1-188 a.a.
  • Lane 11 shows protein expression of recombinant Lactobacillus casei transformed with pKV-Pald-PgsA-EGFP.
  • the present invention uses a Lactobacillus casei derived galactose mutarotase (galactose mutarotase) promoter and an extracellular membrane protein (pgsA) involved in the synthesis of polygamma glutamic acid derived from a strain of the genus Bacillus (pgsA)
  • the vector contains a gene that surface-expresses the target protein, so in the transformant using the vector, the target protein can be effectively expressed on the surface of the cell, thereby vaccinating lactic acid bacteria
  • It can be used as a carrier, and the surface expression vector of the target protein can stably express the target protein, and the surface expression vector according to the present invention constantly expresses the target protein while simultaneously expressing the target protein in need Antigen production for vaccine production
  • the industrial applicability in that it can exist useful.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터 및 그 용도에 관한 것으로, 보다 상세하게는, 서열번호 1의 염기서열을 가지는 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터, 상기 프로모터를 함유하는 발현벡터 및 상기 발현벡터로 형질전환된 미생물에 관한 것으로, 본 발명에 따른 프로모터를 함유하는 발현벡터로 형질전환된 미생물은 목적단백질을 균체 표면에 효과적으로 발현시킬 수 있으므로 백신 전달체 등으로 유용하고, 또한 본 발명은 pgsA를 가지는 표면발현벡터, 폴리감마글루탐산 합성효소를 코딩하는 유전자 및 상기 벡터를 이용하여 미생물 표면에서 목적 단백질을 발현하는 방법에 관한 것으로, 외래 유전자들이 삽입된 상기 벡터는 미생물을 형질전환시키고 외래 단백질이 미생물의 표면에서 안정하게 발현되도록 한다.

Description

락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용
본 발명은 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터에 관한 것으로, 보다 상세하게는, 서열번호 1의 염기서열로 표시되는 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터, 상기 프로모터를 함유하는 발현벡터 및 상기 발현벡터로 형질전환된 미생물에 관한 것이다.
또한, 본 발명은 바실러스 속 균주 유래의 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질(pgsA)을 이용하여 외래 단백질을 미생물의 표면에 효과적으로 발현시키는 새로운 벡터에 관한 것이고, 나아가 본 발명은 바실러스속 균주 유래의 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질을 이용하여 외래단백질을 미생물의 표면에 발현시키는 단백질의 제조방법에 관한 것이다.
식품미생물 중 가장 중요한 미생물군인 유산균(lactic acid bacteria)은 다양한 식품에 이용되어 오면서 안전성이 입증된(GRAS: generally recognized as safe) 미생물이며, 플라스미드, 박테리오파아지, 트랜스포존 등을 지니고 있어 유전자 도입을 위한 자체 벡터개발이 가능하고, 또한 당업계에서 통상적으로 사용되는 방법에 의한 형질전환이 용이하며, 식용 선택마커 유전자들도 확보되어 있기 때문에 식용으로 사용하기에 가장 적합한 균주라 할 수 있다. 또한, 유산균은 장내 유해균 억제 작용 및 정장작용, 혈중 콜레스테롤 감소 기능, 영양학적 가치 증진, 병원체감염 억제 작용, 간경화 개선 작용, 항암작용, 노화억제 작용, 대식세포 활성화를 통한 면역 증강 작용 등의 효능을 가지고 있다.
유산균에서 유용한 외래 단백질을 생산하기 위해서는 고효율의 프로모터(J. M. van der Vossen et al., Appl. Environ. Microbial., Vol.53, pp 2452-2457, 1987; Teija Koivula et al., Appl. Environ. Microbial., Vol.57, pp 333-340, 1991; Pascalle G. G. A. et al., Appl. Environ. Microbial., Vol.62, pp 3662-3667, 1996)의 확보가 필요 하지만, 현재까지의 유산균 유전체에 대한 연구진행 상황은 매우 미흡한 실정이다. 유산균의 유전체는 현재까지 비피도박테리움 론검(Bifidobacterium longum NCC 2705), 엔터로코커스 패칼리스 (Enterococcus faecalis V583), 락토바실러스 플란타럼(Lactobacillus plantarum WFCS1)에 대해서만 유전체 염기서열이 해독된 상태이며, 현재 다양한 종의 유산균의 유전체 해독연구가 진행되고 있으며, 더불어 지금까지 유산균에서 분리된 프로모터로는 스트렙토코커스 써모필러스 A054, 락토코커스 락티스 MG1614, 락토코커스 크레모티스 Wg2의 게놈 유래의 항시발현 프로모터(Philippe Slos et al., Appl. Environ. Microbial., Vol. 57, pp 1333-1339,1991; Teija Koivula et al., Appl. Environ. Microbial., Vol.57, pp 333-340, 1991; J. M. van der Vossen et al., Appl. Environ. Microbial., Vol.53, pp 2452-2457, 1987)만이 알려져 있다.
최근 들어 미국 및 유럽에서 유산균을 이용한 라이브 백신 개발, 유용한 호르몬제의 장내 운반체에 대한 연구 및 이를 위한 효율적인 유전자원의 확보와 유산균용 삽입 벡터 개발에 대한 연구가 진행되고 있다. 특히, 유산균에 함유된 다량의 구성성분인 비메틸화된(unmethylated) CpG DNA, 지질타이코산(lipoteichoic acid), 펩티도글리칸 등이 면역상승제(adjuvant)로서의 역할을 한다고 알려져 있기 때문에 유산균이 백신전달체(vehicle)로서의 유용성이 높이 평가되고 있다. 또한 유산균은 담즙산 및 위산에 저항성을 나타내어 장까지의 항원전달이 가능하기 때문에 장내 점막면역을 유도할 수 있다는 점에서 많은 장점을 가지고 있다(Jos F. M. K. Seegers, Trends Biotechnol., Vol. 20, pp 508-515, 2002).
그러나 유산균의 백신전달체로 사용하기 위해서는 질병 예방용 항체 생성을 위한 항원단백질을 균체의 내부 또는 외부에 제시되어 항원항체반응이 원활하게 이루어지도록 하는 기술의 개발이 필요하며, 실제로 HPV(Human papilloma virus)의 L1 단백질이 내부발현되는 유산균을 이용한 항체 유도능 확인(Karina Araujo Aires et al., Appl. Environ. Microbiol. Vol. 72, pp 745-752, 2006) 및 IL-2(Interleukin-2)의 유산균 분비발현 균주를 이용한 질병 치료 효능 확인(Lothar Steidler et al., Nat. Biotechnol. Vol. 21, pp 785-789, 2003) 등 이밖에도 유산균이 벡신전달체로서 적합함을 규명한 다양한 연구 결과들이 발표되고 있다.
상기에서 기술한 바와 같이 목적단백질을 발현하는 유산균에 대한 다양한 용도 개발과 학문적 연구가 활발하게 이루어지고 있으나, 아직까지는 발현되는 목적단백질의 발현양이 불충분하다는 문제점과 유도적 발현 프로모터를 이용했을 때 체내 투여 시의 지속적인 발현이 불가할 수도 있다는 등의 문제가 있다.
또한, 세포 표면발현은 단백질이나 펩타이드 등을 적절한 표면발현 모체(anchoring motif)와 융합시켜서 그람 음성, 양성균, 곰팡이, 효모, 동물세포의 표면에 발현시키는 기술을 말한다 (Lee S. Y., et al., Trends Biotechnol., 21:4552, 2003). 최초의 세포 표면발현 기술은 1980년대 상대적으로 표면이 단순한 파지를 이용하여 펩타이드나 작은 단백질을 필라멘터스 파지(filamentous phage)의 pIII와 융합하여 발현시켜 이를 표면발현 시스템(surface-expression system)이라고 하였다. 파아지를 이용한 세포 표면발현은 항체의 스크리닝이나, epitope, high-affinity ligand 등의 스크리닝에 사용되었으나, 파아지의 표면에 발현될 수 있는 단백질의 크기가 상대적으로 제한되어 있어서 한계점을 드러내게 되었다. 따라서, 그 대안으로 박테리아를 이용한 세포 표면발현이 개발되었다. 박테리아나 효모와 같은 미생물의 표면 단백질을 표면발현 모체(surface anchoring motif)로 사용하여 외래 단백질을 미생물 표면에 안정적으로 발현시키는 분야이다.
특정 유기체의 외막단백질을 이용하여 외래단백질을 세포표면에 발현시키기 위해서는 적당한 표면단백질과 외래단백질을 유전자 수준에서 서로 연결하여 융합단백질이 생합성되도록 하고, 이들이 안정하게 세포내막을 통과하여 세포표면에 부착되어 유지되도록 해야 한다. 이를 위해서는 다음과 같은 성질을 갖는 단백질을 표면발현의 모체로 사용하는 것이 바람직하다: 첫째, 세포내막을 통과할 수 있는 분비신호(secretion signal)를 N-말단에 가지고 있고, 둘째, 세포 외막 표면에 안정적으로 부착될 수 있는 표적신호(targeting signal)를 가져야 하며, 셋째, 세포의 성장에 악영향을 끼치지 않는 범위 내에서 세포표면에 다량으로 발현되어 단백질의 활성이 높게 나타날 수 있으면서, 마지막으로, 단백질의 크기에 관계없이 안정적으로 발현되어 다양한 반응에 이용될 수 있어야 한다 (Georgiou et al., TIBTECH, 11:6, 1993). 이러한 표면발현 모체는 숙주세포의 표면에 외막단백질의 N-말단이나 C-말단, 또는 단백질의 중앙에 삽입되도록 유전적으로 조작할 필요도 있다 (Lee et al., TIBTECH, 21:45, 2003)
세균의 표면에 단백질이 발현되기 위해서는, 세포 내에서 생합성된 단백질이 세포막을 통과할 수 있는 분비신호(secretion signal)가 그 단백질의 일차 서열상에 있어야 한다. 또한 그람음성 세균인 경우는 세포내막과 세포막공간을 통과하여 세포외막에 삽입 부착되어 막 외부로 돌출되게 안착되어야 한다. 세균의 경우 이러한 분비신호와 세포 표면에 안착하게 하는 표적신호(targeting signal)를 갖고 있는 단백질로는 표면단백질, 특수한 효소, 독소단백질 등을 예로 들 수 있다. 실제로 이들 단백질이 갖는 분비신호와 표적신호 등을 적당한 프로모터와 함께 사용하면 세균의 표면에 단백질을 성공적으로 발현시킬 수 있다. 외래 단백질의 표면 발현에 사용된 세균의 표면단백질은 세포외막 단백질, 지질단백질(lipoprotein), 분비단백질, 세포 표면기관 단백질 등 크게 4가지로 나눌 수 있다. 현재까지 주로 그람음성 세균에 존재하는 표면단백질, 예를들면, LamB, PhoE, OmpA 등을 이용하여 필요한 외래단백질을 세균의 표면에 발현시키려는 시도가 이루어졌다. 이들 단백질을 이용한 경우 외래단백질을 세포표면에 돌출한 루프(loop)에 삽입시키므로 구조적으로 삽입할 수 있는 단백질의 크기가 제한된다. 또한 삽입될 외래단백질의 C-말단과 N-말단이 입체적으로 가깝게 위치하여야 하므로, 그 거리가 멀 경우에는 연결 펩타이드로 두 말단 사이를 가깝게 하여야 하는 문제가 있다.
실제로 LamB 나 PhoE를 이용한 경우 50-60개 이상의 아미노산으로 이루어진 외래 폴리펩타이드를 삽입하면 구조적 제한을 가져와 안정한 막단백질을 형성하지 못하였다 [Charbit et al., J. Immunol., 139: 1658-1664 (1987) ; Agterberg et al., Vaccine, 8: 85-91 (1990)]. OmpA를 사용하여 외래단백질을 돌출된 루프에 삽입한 경우도 있지만 구조적 제한을 극복하기 위하여 세포외막에 안착하게 할 수 있는 최소한의 표적신호를 포함하는 일부 OmpA 단편만을 사용하였다. 이러한 방법으로 베타락타머제(-lactamase)를 OmpA 표적신호 C-말단에 연결하여 세포표면에 발현시킨 사례가 있다.
또한 최근에 알려진 표면발현에 사용된 그람음성 세균의 세포외막 단백질로 슈도모나스(Pseudomonas)속 유래의 빙핵활성 단백질(Ice-nucleation protein, INP)을 이용한 표면 발현이 시도되었다 [Jung et al., Nat, Biotechnol, 16: 576-560 (1998), Jung et al., Enzyme Microb. Technol, 22(5): 348-354 (1998), Lee et al., Nat. Biotechnol, 18: 645-648 (2000)]. 정(Jung) 등은 N-말단, 중앙의 반복구간 그리고 C-말단으로 구성된 빙핵활성 단백질의 C-말단에 레반슈크레이즈 (levansucrase)를, 그리고 중앙의 반복구간이 삭제된 N-말단 그리고 C-말단으로 구성된 빙핵활성 단백질의 C-말단에 카복실메틸셀룰레이즈(carboxymethylcellulase)를 융합하여 각각을 표면 발현시켜 효소 활성을 측정 확인하였다. 이(Lee) 등은 역시 N-말단, 혹은 N-말단과 C-말단으로 구성된 빙핵활성 단백질의 각각의 말단에 B형 간염 바이러스의 표면항원과 C형 간염바이러스의 코아(core) 항원을 대장균 또는 살모넬라 타이피 Ty21a (Salmonella typhi Ty21a) 균주의 표면에 발현시킨 다음 이들이 복합 생백신으로서 사용될 수 있음을 확인하였다.
지질단백질도 표면단백질로서 표면 발현에 이용되고 있다. 특히 대장균의 지질단백질은 그 N-말단에 분비신호를 갖고 세포내막을 통과할 수 있으며, 말단의 시스테인(L-cysteine)이 공유결합으로 세포외막 지질 또는 세포내막 지질과 직접 부착되어 있다. 주 지질단백질인 Lpp는 N-말단은 세포외막에, C-말단은 세포벽(peptidoglycan, PG)에 결합되어 있어 세포외막 단백질 OmpA 단편과 연결될 경우 안정적으로 외래단백질을 세포외막까지 분비하여 표면 발현할 수 있다[Francisco et al., Proc. Natl. Acad. Sci. USA, 489: 2713-2717 (1992)]. 또 다른 지질단백질인 TraT는 지질단백질의 이러한 특성을 이용하여 폴리오바이러스의 C3 에피톱과 같은 펩타이드를 표면발현 하는데 사용되었다[Felici et al., J. Mol. Biol., 222: 301-310 (1991)]. 또한 아직 정확한 기능은 밝혀지지 않은 세포벽 부착형 지질단백질(Peptidoglycan-associated lipoprotein, PAL)도 재조합 항체의 표면발현에 사용되었다[Fuchs et al., Bio/Technology, 9: 1369-1372(1991)], 이 경우 PAL의 C-말단은 세포벽에 연결되고 N-말단은 재조합 항체에 연결되어 융합단백질이 표면 발현되었다.
세포외막을 통과하는 분비단백질도 표면단백질로서 이용될 수 있으나 그람음성 세균의 경우 분비단백질이 발달되어 있지 않으며, 몇몇 분비단백질의 경우만 그 특유의 분비기작에 관여하는 단백질들이 존재하여 세포외막 통과를 돕고 있다. 예를 들어 클랩시엘라(Klebsiella) 속의 풀룰란아제 (pullulanase)는 지질단백질로 그의 N-말단이 지방질로 치환되어 세포외막에 부착되어 있다가 완전히 세포 배양액 중으로 분비된다. 코낵커(Kornacker)등이 풀룰란아제의 N-말단 단편을 이용하여 베타락타머제를 세포 표면에 발현시켰으나 발현된 풀룰란아제-베타락타머제 융합단백질은 잠시 세포 표면에 부착되어있다가 세포 배양액 중으로 유리되는 단점이 있었다. 또한 이를 이용하여 세포막 공간(periplasmic space) 단백질인 알칼린 포스파타제(alkaline phosphatase)를 발현시킨 경우, 이의 분비를 위해서는 적어도 14개 이상의 단백질이 관련되므로 안정적으로 표면 발현되지 않았다[Kornacker et al., Mol. Microl., 4: 1101-1109 (1990)].
독특한 분비체계를 갖고 있는 병원 미생물 나이세리아(Neisseria) 유래의 IgA 프로테아제는 C-말단에 존재하는 단편에 N-말단에 존재하는 프로테아제를 세포외막에 안착하게 하는 신호를 갖고 있다. 일단 세포외막에 도달하여 세포 표면에 돌출한 프로테아제는 자신의 가수분해능에 의해 세포 배양액으로 분비된다. 크라우저(Klauser) 등은 이 IgA 프로테아제 -단편을 이용하여 약 12kDa의 콜레라 독소 B 소단위를 안정적으로 세포 표면에 발현시켰다 [Klauser et al., EMBO J., 9:1991-1999 (1990)]. 그러나 분비과정 중 세포막 공간에서 일어난 단백질의 접힘 (protein folding)에 의해 융합단백질의 분비는 억제되었다.
이외에도 그람음성 세균의 경우 세포 표면에 존재하여 표면 발현에 응용할 수 있는 세포기관으로는 편모(Flagella), 필리(Pili) 및 핌브리아(Fimbriae) 등이 있다. 편모의 구성 소단위인 편모단백질(Flagellin)을 이용하여 콜레라 독소 B소단위와 B형 간염 바이러스로부터 유래한 펩타이드가 안정적으로 발현되었으며 이들은 그에 대한 항체와 강력하게 반응하였다[Newton et al., Science, 244: 70-72 (1989)]. 세포 표면에 실처럼 생긴 핌브리아의 구성단백질인 핌브린(fimbrilin)을 이용하여 외래 펩타이드의 발현을 시도한 결과 작은 펩타이드의 경우만 성공적으로 발현되었다[Hedegaard et al.,Gene, 85:115-124 (1989)].
위와 같은 그람음성 세균의 표면단백질에 의한 표면 발현 시도 외에 그람양성 세균의 표면단백질을 이용한 표면 발현이 최근에 시도되었다[Samuelson et al., J. Bacteriol., 177:1470-1476 (1995)]. 이 경우도 세포 내막을 통과할 수 있는 분비신호와 세포막에 부착되는 표면발현 모체를 필요로 한다. 실제로 스타필로코쿠스 (Staphylococcus hyicus) 유래의 리파제를 분비신호로 사용하고, 스타필로코쿠스 아우레우스(Staphylococcus aureus) 유래의 프로테인A를 막 부착 모체로 사용하여 80개 아미노산으로 이루어진 말라리아 항원(malaria blood stage antigen)과 스트렙토코쿠스 단백질G 유래의 알부민 부착 단백질을 효과적으로 그람양성 세균의 표면에 발현시킨 사례가 있다.
상기한 그람음성 및 양성 세균의 표면 발현에 대한 연구를 통해 많은 유용한 단백질 발현 시스템이 개발되어 미국, 유럽과 일본 등에서 출원된 바 있다. 이중에서 특히 그람음성 세균의 세포외막 단백질을 이용한 경우가 5건(WO9504069, WO9324636, WO9310214, EP603672, US5356797) 보고 되었고, 세포 표면 기관인 필리(pili)를 이용한 경우가 한 건(WO9410330)이 있으며, 또한 세포 표면 지질단백질(lipoprotein)을 이용한 경우도 한 건(WO9504079)이 보고되었다.
이상과 같이 세균의 세포외막 단백질을 이용하여 외래단백질을 세포 표면에 발현시키기 위해서는 적당한 세포외막 단백질과 외래단백질을 유전자수준에서 서로 연결하여 융합단백질이 생합성되도록 유도하고, 이들이 안정하게 세포내막을 통과하여 세포외막에 부착되어 유지되도록 해야 한다. 하지만 위의 조건을 모두 만족시키는 표면발현 모체는 아직까지 개발되지 않은 상태이고 현재까지는 상기한 경우의 단점을 보완하는 수준이다.
한편, 본 발명자들은 바실러스(Bacillus subtilis var. Chungkookjang) 속 균주 유래의 폴리감마글루탐산의 합성 복합체 유전자(pgsBCA)를 새로운 표면발현 모체로 활용하여, 외래단백질을 미생물의 표면에 효과적으로 발현시키는 새로운 벡터와 상기 벡터로 형질전환된 미생물의 표면에 목적단백질을 발현시키는 방법을 개발한바 있다(대한민국 특허등록 제0469800호).
이에 본 발명자들은 상기 특허에 기재된 표면발현 모체를 이용하여 항원 또는 항원결정기를 유산균에서 안정적으로 고발현 시킬 수 있는 벡터가 개발된다면, 항원이 유산균의 표면에 노출되기 때문에 인체 친화적이며 효율적으로 면역반응을 유도할 수 있는 백신의 제조가 가능할 것으로 판단하고, 목적단백질을 유산균에서 고발현 시킬 수 있는 프로모터를 선별하는 과정을 수행한 결과, 기존에 사용하던 프로모터에 비해, 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용할 경우, 유전자 발현이 향상되는 것을 확인하였고, 나아가 바실러스 속 균주 유래의 폴리감마글루탐산의 합성 유전자(pgsA)를 새로운 표면발현 모체로 활용하는 것에 대하여 예의 검토하고 연구한 바, pgsA 유전자를 이용하여, 외래단백질을 미생물의 표면에 효과적으로 발현시키는 새로운 벡터, 및 미생물의 표면에 외래단백질을 다량 발현시키는 방법을 개발하여 본 발명을 완성하게 되었다.
본 발명의 주된 목적은 목적유전자의 발현상승을 유도하는 락토바실러스 카제이(Lactobacillus casei) 유래 프로모터를 제공하는데 있다.
본 발명의 다른 목적은 상기 프로모터 및 목적단백질을 코딩하는 유전자가 연결되어 있는 것을 특징으로 하는 발현벡터를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 발현벡터로 형질전환된 미생물 및 상기 형질전환된 미생물을 이용하여 목적단백질의 제조방법을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 형질전환된 미생물을 이용하여 미생물 백신을 제조하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 미생물의 표면에 외래단백질을 대량 발현 시킬 수 있는 표면 발현모체로서 바실러스 속 균주에서 유래한 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질을 선택하고, 이를 이용하여 외래단백질이나 펩타이드를 미생물 표면에 발현시킬 수 있는 목적단백질의 표면발현벡터를 제조하고, 이것으로 형질전환된 다양한 형질전환체에서 외래단백질이 효율적으로 형질전환체의 표면에 발현시키는 방법을 제공하고자 한다.
상기 목적을 달성하기 위하여, 본 발명은 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터를 제공한다.
본 발명에 있어서, 상기 프로모터는 서열번호 1로 표시되는 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 프로모터의 말단에 목적유전자가 연결되어 있는 것을 특징으로 하는 발현벡터 및 상기 발현벡터로 형질전환된 미생물을 제공한다.
본 발명은 또한, 상기 프로모터, 폴리감마글루탐산 합성효소 복합체 유전자 및 목적단백질을 코딩하는 유전자가 연결되어 있는 미생물 표면 발현벡터 및 상기 표면 발현벡터로 형질전환된 미생물을 제공한다.
본 발명에 있어서, 상기 목적단백질은 항원인 것을 특징으로 할 수 있다. 구체적으로 목적 단백질은 호르몬, 호르몬 유사체, 효소, 효소저해제, 신호전달 단백질 혹은 그 일부분, 항체 혹은 그 일부분, 단쇄항체, 결합단백질, 결합도메인, 펩타이드, 항원, 부착단백질, 구조단백질, 조절단백질, 독소단백질, 사이토카인, 전사조절 인자, 혈액응고 인자 및 식물 생체방어 유도 단백질로 구성된 그룹으로부터 선택되는 어느 하나인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 폴리감마글루탐산 합성효소 복합체 유전자는 pgsA, pgsB 및 pgsC 중 어느 하나 이상인 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 형질전환된 미생물을 배양하는 것을 특징으로 하는 목적단백질을 미생물 표면에 발현시키는 방법을 제공한다.
본 발명은 또한, (a) 상기 미생물 표면 발현벡터로 형질전환된 미생물을 배양하여 미생물 표면에 항원을 표면발현하는 단계; 및 (b) 상기 항원이 표면발현된 미생물을 회수하는 단계를 포함하는 미생물 백신의 제조방법을 제공한다.
상기 목적을 달성하기 위하여, 본 발명은 폴리감마글루탐산 합성효소 복합체를 코드하는 유전자 pgsA와 목적단백질을 코드하는 유전자를 포함하는 목적단백질의 표면발현벡터를 제공한다.
본 발명에 있어서, 상기 유전자 pgsA는 폴리감마글루탐산을 생산하는 바실러스 속 균주에서 유래한 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 폴리감마글루탐산 합성효소 복합체를 코드하는 유전자 pgsA는 서열번호 18 내지 22 및 29 내지 31 중 어느 하나의 염기서열을 가지는 것을 특징으로 할 수 있다. 바람직하게는 상기 폴리감마글루탐산 합성효소 복합체를 코드하는 유전자 pgsA는 서열번호 18 내지 21 및 29 내지 31 중 어느 하나의 염기서열을 가지는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 유전자 pgsA의 말단부위에 링커가 삽입되어 있고, 상기 삽입된 링커에 목적단백질을 코딩하는 유전자가 삽입되어 있는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 목적단백질은 표면발현에 유리하도록 목적단백질의 아미노산 서열 중 일부분이 제거되거나 위치 특이적으로 돌연변이된 것임을 특징으로 할 수 있다.
본 발명은 또한, 상기 표면발현벡터로 형질전환된 미생물을 제공한다. 본 발명에 있어서, 형질전환에 사용된 미생물은 목적단백질의 세포 표면발현에 유리하도록, 발현된 목적단백질을 분해하는데 관련된 세포 내 또는 세포 외의 단백질 분해효소를 생산하지 못하도록 변형된 것임을 특징으로 할 수 있다.
본 발명에 있어서, 상기 미생물은 유산균인 것을 특징으로 할 수 있다. 본 발명에서 상기 유산균은 락토바실러스 속, 스트렙토코커스 속 및 비피도박테리움 속을 포함할 수 있다. 대표적으로 락토바실러스 속은 락토바실러스 아시도필러스(L. acidophilus), 락토바실러스 카제이(L. casei), 락토바실러스 플란타룸(L. plantarum), 락토바실러스 퍼멘툼(L. ferementum), 락토바실러스 델브루엑키(L. delbrueckii), 락토바실러스 존스니(L. johnsonii LJI), 락토바실러스 료터리(L. reuteri) 및 락토바실러스 불가리커스(L. bulgaricus); 스트렙토코커스 속은 스트렙토코커스 서모필러스(S. thermophilus); 비피도박테리움 속은 비피도박테리움 인판티스(B. infantis), 비피도박테리움 비피덤(B. bifidum), 비피도박테리움 론검(B. longum), 비피도박테리움 슈도론검(B. psuedolongum), 비피도박테리움 브레브(B. breve), 비피도박테리움 락티스 Bb-12(B. lactis Bb-12) 및 비피도박테리움 아돌레센티스(B. adolescentis) 등을 숙주로 사용할 수 있으며, 보다 바람직하게는 락토바실러스 속이다.
본 발명은 또한, 상기 형질전환된 미생물을 배양하여 목적단백질을 세포표면에 발현하는 단계 및 목적단백질이 표면에 발현된 세포를 회수하는 단계를 포함하는 목적단백질의 세포표면 발현방법을 제공한다.
본 발명에 있어서, 목적단백질은 호르몬, 호르몬 유사체, 효소, 효소저해제, 신호전달 단백질 혹은 그 일부분, 항체 혹은 그 일부분, 단쇄항체, 결합단백질, 결합도메인, 펩타이드, 항원, 부착단백질, 구조단백질, 조절단백질, 독소단백질, 사이토카인, 전사조절 인자, 혈액응고 인자 및 식물 생체방어 유도 단백질로 구성된 그룹으로부터 선택되는 어느 하나인 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 방법에 의해 제조되고, 항원이 표면에 발현된 세포를 인간을 제외한 척추동물에 투여하여 체액성 면역 또는 세포성 면역을 유도하는 것을 특징으로 하는 방법을 제공한다.
본 발명은 또한, 상기 방법에 의해 제조되고, 항원이 표면에 발현된 세포를 인간을 제외한 척추동물에 투여하여 면역반응을 유도하고, 상기 면역반응에 의해 생성된 항체를 회수하는 것을 특징으로 하는 척추동물에서 항체를 제조하는 방법을 제공한다.
본 발명은 또한, 상기 벡터는 그람음성균 또는 그람양성균에 적용되는 것을 특징으로 하는 목적단백질의 표면발현벡터를 제공한다.
본 발명은 또한, (a) 미생물 표면발현용 벡터에 목적단백질을 코드하는 유전자를 삽입하여 재조합 벡터를 제조하는 단계; (b) 상기 재조합 벡터로 그람음성 또는 그람양성 숙주세포를 형질전환하는 단계; 및 (c) 상기 형질전환된 숙주세포를 배양하여 목적단백질을 숙주세포 표면에 발현하는 단계를 포함하는 것을 특징으로 하는 그람음성 또는 그람양성 숙주세포의 표면에 목적단백질을 발현시키는 방법을 제공한다.
본 발명은 목적단백질을 유산균에서 고발현 시킬 수 있는 락토바실러스 카세이(Lactobacillus casei) 유래의 갈락토오스 뮤타로테이즈(galactose mutarotase) 프로모터 및 상기 프로모터를 이용한 발현용 벡터를 제공하는 효과가 있다. 상기 벡터는 목적단백질을 표면 발현시키는 유전자를 함유하고 있기 때문에 상기 벡터를 이용한 형질전환체에서는 목적단백질을 효과적으로 균체 표면에 발현시킬 수 있어 유산균을 백신 전달체로서 활용할 수 있다.
또한 본 발명에 따른, 목적단백질의 표면발현벡터는 목적단백질을 안정하게 발현시킬 수 있으며, 본 발명에 따른 표면발현벡터는 목적단백질을 항시적으로 발현시키면서, 동시에 재조합 미생물에 표면발현시켜 필요로 하는 백신제조용 항원 제작 등에 유용하게 쓰일 수 있다.
도 1. 본 발명의 갈락토오스 뮤타로테이즈 (galactose mutarotase) 프로모터를 수득하는 방법을 나타낸 것이다.
도 2. 본 발명의 갈락토오스 뮤타로테이즈 (galactose mutarotase) 프로모터를 이용하여 구축된 표면 발현용 벡터의 유전자 지도를 나타낸 것이다.
도 3. 본 발명의 발현벡터로 형질전환시킨 유산균과 비교하여 각 프로모터 간의 목적단백질 발현 정도를 웨스턴 블러팅을 통해 나타낸 것이다.
도 4. Confocal 형광현미경을 이용하여 본 발명의 발현벡터로 목적단백질이 미생물 표면에 발현 하는 것을 확인한 것이다.
도 5. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터, pKV-Pald-PgsA-EGFP의 유전자 지도를 나타낸 것이다.
도 6. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA1), PgsA motif 1-60 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 7. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA2), PgsA motif 1-70 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 8. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA3), PgsA motif 1-80 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 9. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA5), PgsA motif 1-100 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 10. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA5), pKV-PgsA 1-188 a.a-EGFP의 유전자 지도를 나타낸 것이다.
도 11. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA6), PgsA motif 25-60 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 12. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA7), PgsA motif 25-70 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 13. 본 발명에 의한 락토바실러스 카제이를 숙주로 하는 표면발현벡터(pKV-Pald-pgsA8), PgsA motif 25-100 a.a -EGFP의 유전자 지도를 나타낸 것이다.
도 14. 본 발명의 표면발현벡터 pKV-Pald-pgsA1 내지 pKV-Pald-pgsA8로 형질 전환시킨 락토바실러스 카제이에서 EGFP 단백질의 표면발현을 보여주는 웨스턴 블러팅 사진을 나타낸 것이다.
실시예 2: 갈락토오스 뮤타로테이즈 프로모터를 이용한 EGFP 단백질 표면발현 벡터(pKV-Pgm-pgsA-EGFP)의 구축
갈락토오스 뮤타로테이즈 프로모터에 의해 발현 유도되는 EGFP 단백질의 발현벡터를 제조하기 위해, 대장균 및 락토바실러스 카세이에서 복제가 가능한 RepE를 복제원점(replication origin)으로 가지는 벡터에 락토바실러스 카세이 유래의 갈락토오스 뮤타로테이즈 프로모터를 삽입한 다음, 상기 프로모터의 다운스트림에 바실러스(Bacillus subtilis var. Chungkookjang) 유래의 표면발현 모체인 pgsA를 도입하고, pgsA의 카르복시 말단에 목적유전자를 삽입할 수 있는 BamHI, XbaI의 제한효소 사이트를 추가하여 갈락토오스 뮤타로테이즈 프로모터를 포함하는 pKV-Pgm-pgsA 벡터를 제조하였다. 상기 pgsA 유전자는 대한민국 특허등록 제0469800호에 개시된 것을 사용하였다.
EGFP 유전자는 합성 EGFP 유전자 단편을 주형으로 서열번호 4와 서열번호 5를 프라이머로 하여 PCR을 수행한 후 수득하였다.
서열번호 4: 5'-TGGTGGATCCGTGAGCAAGGGCGAGGAGCTG-3'
서열번호 5: 5'-TGACTCTAGAACTAGTGTCGACGGTACCTTACTTGTACAGCTCGTCC-3'
그 결과, 5'말단에는 BamHI 제한효소 부위를 포함하고 있고, 3'말단에는 XbaI 제한효소 부위를 포함하고 있는 DNA 절편을 확보하였다. EGFP 유전자를 포함하고 있는 755bp의 확보된 DNA 절편을 BamHI 과 XbaI으로 절단하여 pKV-Pgm-pgsA 벡터의 pgsA C 말단에 연결함으로써, 유산균 숙주에 형질전환 했을 경우 EGFP 단백질을 균체 외부에 표면 발현할 수 있는 발현벡터 pKV-Pgm-pgsA-EGFP를 완성하였다 (도 2).
본 발명은, 일 관점에서, 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터에 관한 것이다.
본 발명에서는 갈락토오스 뮤타로테이즈 유전자의 프로모터를 수득하기 위하여, PCR 방법으로 락토바실러스 카제이(Lactobacillus casei)의 genome에서 증폭하고, 유전자 클로닝 기술을 이용하여 락토바실러스 카제이 유래 700 bp의 프로모터(서열번호 1)를 분리하였다. 본 발명의 갈락토오스 뮤타로테이즈 프로모터는 락토바실러스 카제이에 존재하는 갈락토오스 뮤타로테이즈 유전자의 발현을 유도하는 프로모터이다. 일반적으로 프로모터는 RNA 중합효소가 결합하여 전사개시를 유도하는 부분을 포함하며 프로모터의 염기서열에 따라 RNA 합성 정도가 결정되기 때문에 프로모터에 따라 유전자의 발현강도가 다를 수 있다.
본 발명의 프로모터에 의한 발현유도 능력을 측정하기 위하여 상기 프로모터를 포함하는 발현벡터와 기존의 알돌레이즈 (aldolase) 프로모터를 포함하는 발현벡터에 각각 EGFP 유전자를 삽입하고, 상기 제작된 벡터들을 사용하여 락토바실러스 카제이를 형질전환 시킨 다음, 각 프로모터에 의해 발현 유도된 EGFP의 발현 정도를 웨스턴 블러팅을 통해 비교하였다. 그 결과 갈락토오스 뮤타로테이즈 (galactose mutarotase) 프로모터를 포함하는 벡터의 형질전환체에서 EGFP의 발현 정도가 효과적으로 증가한 것이 확인되었으며, 본 발명 프로모터의 발현유도 세기 또한 기존의 알돌레이즈 프로모터에 비해 강하다는 사실을 확인하였다.
본 발명은, 다른 관점에서, 상기 갈락토오스 뮤타로테이즈 프로모터와 목적단백질을 코딩하는 유전자를 함유하는 발현벡터 및 상기 발현벡터로 형질전환된 미생물에 관한 것이다.
발현벡터는 통상적으로 전사를 가능하게 하는 프로모터, 프로모터의 다운스트림에 목적단백질을 발현하는 유전자, 미생물 내에서 자기 복제하여 증폭할 수 있는 유전자 및 목적하는 벡터를 선별하기 위한 선택마커 유전자가 최소한 필요하며, 목적유전자를 제외한 상기 유전자들은 벡터의 백본(backbone) 및 선택된 숙주에 따라 달라질 수 있다. 벡터 제작에 있어서 상기 최소한으로 필요한 유전자들은 당업자에게는 널리 알려져 있으며, 유전자 발현 조건 및 목적에 따라 용이하게 선택할 수 있다. 통상적으로 상기 벡터의 백본은 pWV01, pAMβ1의 replication origin을 가진 것 등을 사용할 수 있으며, 이에 한정된 것은 아니다.
목적유전자뿐만 아니라 추가적으로 조절 부위를 포함하는 유전자 발현을 목적으로 하는 벡터 또는 DNA 서열을 적합한 숙주세포에 삽입하기 위해 다양한 방법 및 수단을 사용할 수 있다. 예를 들면, 트렌스포메이션 (transformation), 트렌스팩션 (transfection), 콘쥬게이션 (conjugation), 원형질체 융합법 및 칼슘 포스페이트 침전법과 같은 생화학적 방법이나, DEAE(diethylminoehtyl) 덱스트란, 또는 일렉트로포레이션 (electroporation) 등의 물리적인 방법을 사용할 수 있다.
발현벡터를 적절한 숙주세포에 삽입한 다음, 당업계에 알려진 통상의 기술을 사용하여 형질전환체만을 선별할 수 있는 항생물질을 포함하는 숙주의 생장에 적합한 선택배지를 사용하여 목적유전자를 발현할 수 있는 벡터를 함유하는 형질전환체를 선별할 수 있다.
본 발명은, 또 다른 관점에서, 상기 갈락토오스 뮤타로테이즈 프로모터, 폴리감마글루탐산 합성효소 복합체 유전자 및 목적단백질을 코딩하는 유전자가 연결되어 있는 미생물 표면 발현벡터 및 상기 표면발현 벡터로 형질전환된 미생물에 관한 것이다.
상기 프로모터의 다운스트림에는 표면발현 모체인 폴리감마글루탐산 합성효소 복합체의 유전자를 포함하는데, 상기 표면발현 모체는 벡터의 DNA 서열상에서 프로모터와 목적유전자의 사이에 위치한다. 상기 표면발현 모체의 유전자는 아미노산으로 코딩된 이후에는 목적단백질의 전반부에 연결되어 발현된 단백질이 세포막의 지질과의 결합하도록 유도하는 작용을 하기 때문에 목적단백질이 표면 발현되는데 결정적인 역할을 한다. 상기 표면발현 모체의 유전자를 프로모터 및 목적유전자와 연결하는 방법은 PCR (polymerase chain reaction), 제한효소 절단 (restriction enzyme digestion) 및 라이게이션법 (ligation) 등 당업자에 의해 용이하게 실시될 수 있는 통상의 기술을 사용할 수 있다.
본 명세서에서 '숙주', 또는 '미생물'은 프로바이오틱(probiotic)의 그람양성균인 유산균을 의미하며, 일반적인 프로바이오틱 미생물의 선별기준에는 (i) 인간유래의 미생물일 것; (ii) 담즙, 산, 효소 및 산소에 안정적일 것; (iii) 장내 점막에 부착하는 능력이 있을 것; (iv) 소화기관 내에서 콜로니를 형성할 수 있는 능력이 있을 것; (v) 항박테리아성 물질을 생산할 수 있을 것; 및 (vi) 효능이나 안정성이 증명될 수 있을 것 등의 조건이 포함되어 있다. 상기 조건을 근거로 유산균은 인체 내에서의 생장이 친화적, 무해한 균이라는 것이 명백하다. 따라서, 유산균을 숙주로 하는 형질전환체를 인체에 적용시켜 질병의 예방 또는 치료를 위한 유전자 전달 또는 단백질 전달 등의 용도로 사용할 경우, 균주를 사용하는 통상의 백신제조 방법과는 달리 균주의 비독성화 또는 무독성화의 단계가 요구되지 않는다.
본 발명에서 상기 미생물은 락토바실러스 속, 스트렙토코커스 속 및 비피도박테리움 속을 포함할 수 있다. 대표적으로 락토바실러스 속은 락토바실러스 아시도필러스(L. acidophilus), 락토바실러스 카제이(L. casei), 락토바실러스 플란타룸(L. plantarum), 락토바실러스 퍼멘툼(L. ferementum), 락토바실러스 델브루엑키(L. delbrueckii), 락토바실러스 존스니(L. johnsonii LJI), 락토바실러스 료터리(L. reuteri) 및 락토바실러스 불가리커스(L. bulgaricus); 스트렙토코커스 속은 스트렙토코커스 서모필러스(S. thermophilus); 비피도박테리움 속은 비피도박테리움 인판티스(B. infantis), 비피도박테리움 비피덤(B. bifidum), 비피도박테리움 론검(B. longum), 비피도박테리움 슈도론검(B. psuedolongum), 비피도박테리움 브레브(B. breve), 비피도박테리움 락티스 Bb-12(B. lactis Bb-12) 및 비피도박테리움 아돌레센티스(B. adolescentis) 등을 숙주로 사용할 수 있으며, 보다 바람직하게는 락토바실러스 속이다.
본 발명에서는 상기 프로모터와 표면발현 모체인 pgsA가 연결된 염기서열을 포함하고, 목적유전자로서 EGFP 유전자의 발현할 수 있는 발현벡터(pKV-Pgm-pgsA-EGFP)를 제작하였으며, 상기 발현벡터를 락토바실러스 카제이에 삽입하여 EGFP를 발현하는 형질전환체를 제조하였다.
본 발명의 향상된 유전자 발현능력을 가지는 프로모터로 발현되는 목적단백질은 균체 표면에 발현되며, 따라서 본 발명의 형질전환된 미생물은 백신(vaccine)으로 사용할 수 있다.
본 발명은, 또 다른 관점에서, 상기 표면 발현벡터로 형질전환된 유산균을 이용하는 것을 특징으로 하는 미생물 백신의 제조방법에 관한 것이다.
백신은 질병에 대한 예방의 목적으로 생유기물을 사용하여 면역 시스템을 자극시키는데 사용되는 약제이다. 면역 활성화는 유기체 내에서 항체 생성, T-림프구의 자극, 또는 다른 면역세포(예: 대식세포)를 자극하여 항원을 효율적으로 제거하기 위한 과정을 의미한다. 상기에 대한 자세한 면역학의 개관은 당업계의 통상의 기술을 가진 자들은 쉽게 이해된다(Barrett, J. T., Textbook of Immunology, 1983).
항원으로서의 목적단백질을 발현하는 형질전환된 미생물 백신의 투여대상은 포유동물일 수 있으며, 보다 바람직하게는 인간일 수 있다.
상기 백신 조성물의 제법은 표준 기법을 사용하여 실시할 수 있으며, 투여자에게 적합한 투여량은 유전자 생성물의 항원성에 따라 변하며 존재하는 백신의 전형적인 면역 반응을 유도하기에 충분한 양이면 되며 일상적 실험 과정을 거쳐 필요량을 쉽게 판단할 수 있다. 전형적인 초기의 백신 용량은 체중kg당 항원 0.001 내지 1mg이며, 바람직한 수준의 보호를 제공하기에 필요에 따라 양을 증가하거나 다중 용량을 사용한다. 상기의 양은 당해 기술분야에 속하는 전문가에 의해 결정될 수 있고, 제제화 방법, 투여 방식, 투여자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해서도 다양하게 처방될 수 있다.
백신이 항체를 생성함에 있어 효과적이기 위해서는, 항원성 물질이 백신 처리된 대상의 항체-생성 기전이 실현될 수 있도록 체내로 유입되어야 한다. 따라서 면역반응을 위해서는 유전자 산물의 미생물 운반체가 체내에 우선 도입되어야 한다. 본 발명의 형질전환체에서 제시되는 항원에 의한 바람직한 반응을 자극하기 위해서는, 정맥주사, 근육주사, 피하주사 등과 같은 투여방법이 가능하지만, 경구 투여, 위 삽입에 의해 또는 분무제 형태로 장 또는 폐로 직접 투여함이 바람직하다.
백신 조성물을 투여자에게 경구 투여하기 위해서는 친액성 형태, 예를 들면 캡슐 형태로 제공되는 것이 유용하다. 상기 캡슐은 Eudragate S, Eudragate L, 셀룰로오즈 아세테이트, 셀룰로오즈 프탈레이트 또는 히드록시 프로필메틸 셀룰로오즈를 포함하는 장용피복으로 제공된다. 상기 캡슐류는 그 자체로 사용하거나 투여하기 전에 현탁액과 같이 친액성 물질을 재조성하여 사용할 수도 있다. 재조성은 형질전환된 미생물의 생존에 적합한 pH의 완충액에서 수행하는 것이 효과적이다. 위산으로부터 상기 형질전환된 미생물 및 백신을 보호하기 위하여 매회 백신 투여 이전에 중탄산나트륨 제제를 투여하는 것이 유용할 수 있다. 선택적으로 백신은 비경구투여, 비내투여 또는 유선내 투여용으로 제조될 수 있다.
본 발명의 프로모터를 포함하며 항원으로서 작용할 수 있는 목적단백질을 발현하는 유전자를 함유하고 있는 형질전환된 유산균은 소화기관 내 점막에서 콜로니를 형성하면서 목적하는 효능이 얻어질 수 있도록 하며, 상기의 유산균이 목적하는 형질 전환성질을 유지하며, 원활한 콜로니 형성을 위해 벡터 내 선택 항생물질을 동시에 투여할 수 있으며, 상기의 수단으로써 형질전환체가 분열하는 과정에서 파생될 수 있는 벡터를 가지지 않은 목적하지 않는 유산균의 발생을 제어할 수 있다. 상기의 선별방법은 당업계의 통상의 기술로 용이하게 수행될 수 있으며, 상기 과정에서 사용될 수 있는 선택항생물질은 발현벡터 내 포함되어 있는 항생물질 유전자에 따라 달라질 수 있다.
또한, 하기 실시예 5에서 제조된 표면발현 벡터(pKV-Pald-PgsA-EGFP)를 사용해서 유산균 숙주에서 보다 안정적으로 높은 발현율을 나타낼 수 있도록 PgsA의 유전자를 단편으로 하는 개량을 실시하였다.
먼저, PgsA 단편 중 1-60 a.a, 1-70 a.a, 1-80 a.a, 1-100 a.a, 1-188 a.a를 포함하는 PgsA 단편을 확보하기 위하여, 표면발현 벡터 (pKV-Pald-PgsA-EGFP)을 주형으로 서열번호 8 내지 17의 프라이머를 사용해서 PCR을 수행하여 수득하였다.
그 결과, 알돌레이즈 프로모터를 포함하며, 각각의 PgsA motif 단편을 포함하는 DNA 절편을 확보 하였으며, 상기 절편의 5' 말단에는 SphI 제한효소를 포함하고 있으며, 상기 절편의 3' 말단에는 BamHI 제한효소 부위를 포함하고 있다. 확보된 DNA 절편에 SphI과 BamHI을 처리하여 절편을 확보하였다. 또한, 각각의 PgsA1 내지 A5 motif 단편이 서열번호 18 내지 22의 염기서열을 갖는 것을 확인하였다.
한편, PgsA 단편 중 25-60 a.a, 25-70 a.a, 25-100 a.a를 포함하는 PgsA 단편을 확보하기 위하여, 표면발현 벡터 (pKV-Pald-PgsA-EGFP)을 주형으로 서열번호 23 내지 28의 프라이머를 사용하여 PCR을 수행하여 수득하였다.
그 결과, 각각의 PgsA motif 단편을 포함하는 DNA 절편을 확보 하였으며, 상기 절편의 5' 말단에는 EcoRV 제한효소를 포함하고 있으며, 상기 절편의 3' 말단에는 BamHI 제한효소 부위를 포함하고 있다. 확보된 DNA 절편에 EcoRV와 BamHI을 처리하여 절편을 확보하였다. 또한, 각각의 PgsA motif 단편이 서열번호 29 내지 31의 염기서열을 갖는 것을 확인하였다.
본 발명은 미생물의 표면에 외래단백질을 대량 발현 시킬 수 있는 새로운 표면 발현모체로서 바실러스 속 균주에서 유래한 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질을 선택하고, 이를 이용하여 외래단백질이나 펩타이드를 미생물 표면에 발현 시킬 수 있는 표면발현벡터를 제조하고, 이것으로 형질전환된 다양한 형질전환체에서 외래단백질이 효율적으로 형질전환체의 표면에 발현시키는 방법을 제공하는 것을 목적으로 한다.
상기 목적을 달성하기 위하여 본 발명은, 폴리감마글루탐산 합성효소 복합체를 이루는 유전자 pgsA를 포함하는 미생물 표면발현벡터 및 상기 벡터에 의해 형질전환된 균주를 제공한다.
본 발명은 또한, 상기 목적을 달성하기 위하여, 상기 미생물 표면발현벡터를 이용하여 외래 단백질을 형질전환균주의 표면에 발현시키는 방법을 제공한다.
유전자 pgsA가 코딩하는 단백질은 바실러스 속에 존재하는 세포외막 단백질로서 바실러스 서브틸리스(Bacillus subtilis IFO3336; 낫또균; Biochem. Biophy. Research Comm., 263, 6-12, 1999), 바실러스 리체니포미스(Bacillus licheniformis ATCC9945; Biotech. Bioeng. 57(4), 430-437, 1998), 바실러스 안쓰라시스(Bacillus anthracis; J. Bacteriology, 171, 722-730, 1989) 등으로부터 생산되는 식용, 수용성, 음이온성, 생분해성 고분자물질인 폴리감마글루탐산의 합성에 관여하는 단백질이다.
낫또균(Bacillus subtilis IFO3336)의 경우, 세균으로부터 분리된 세포외막 단백질은 총 922개의 아미노산으로 이루어진 단백질로 pgsB, pgsC 및 pgsA로 이루어져 있으며, pgsB는 393 아미노산으로, pgsC는 149 아미노산으로 그리고 pgsA는 380 아미노산으로 구성이 되어 있다. 아시우찌(Ashiuchi) 등은 바실러스 낫또균 유래의 폴리감마글루탐산의 합성 유전자획 클로닝하고 대장균에 형질전환하여 대장균에서의 폴리감마글루탐산의 합성을 관찰한 바 있다[Ashiuchi et al., Biochem. Biophy. Res. Communications, 263: 6-12 (1999)].
그러나 상기 폴리감마글루탐산 합성효소 복합체를 이루는 단백질 pgsA의 구체적인 역할 및 기능은 아직 밝혀지지 않았다. 다만, 복합체 구성 단백질 중 pgsB는 아마이드 리게이즈계로서 pgsB의 N-말단의 특이 아미노산이 세포막 혹은 세포벽과 상호작용을 하고, pgsA의 경우 N-말단과 C-말단에 친수성의 특이 아미노산 서열을 갖고 있어서, pgsB의 도움과 더불어 이들 아미노산 서열이 세포내막을 통과할 수 있는 분비신호 와 표적 및 부착신호를 갖고 있는 것으로 추측된다.
본 발명자들의 연구결과, 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질은 그의 아미노산 일차 서열 구조와 특성상 외래단백질을 세포 표면에 발현시키는 표면발현 모체로서 많은 장점이 있음이 밝혀졌다: 첫째, 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질은 폴리감마글루탐산의 합성 및 세포외로의 분비를 위해서 세포 표면에 다량 발현될 수 있고, 둘째, 발현된 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질은 세포 주기상 휴지기에서도 안정하게 유지되며, 셋째, 구조적으로 특히 pgsA의 경우 세포 표면에 돌출되어 있으며, 넷째로는 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질은 그 기원이 그람양성 세균의 표면으로 다양한 그람양성 세균 뿐만이 아니라 그람음성 세균의 표면에서 안정되게 발현될 수 있다는 점등의 장점이 있다.
본 발명은 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질의 특성을 이용하여 외래단백질을 세균의 표면에 발현할 수 있는 유용한 벡터를 제공하는데 그 목적이 있다. 특히, 본 발명의 목적단백질의 표면발현벡터는 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질의 일차 서열상에 갖고 있는 분비신호와 표적신호를 포함한다.
또한, 본 발명은 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질의 특성을 이용한 표면발현벡터를 사용하여 외래단백질을 미생물의 표면에 발현시키는 방법을 제공하는데 그 목적이 있다. 특히, 본 발명은 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질을 이용하여 외래단백질을 미생물의 표면에 발현시킴으로 세포의 파쇄 또는 단백질의 분리정제 과정을 거치지 않고 효율적으로 외래단백질을 이용할 수 있는 외래단백질의 제조방법을 제공한다.
또한, 본 발명에서 상기 "목적단백질"또는 "외래단백질"은 상기 단백질을 발현하는 형질전환된 숙주세포에서는 정상적으로는 존재할 수 없는 단백질을 의미한다. 예를 들면, 유산균에서 바이러스 유래 또는 종양 유래 단백질을 인위적으로 발현하도록 조작하였을 경우, 상기 단백질을 외래단백질 또는 목적단백질이라 한다.
보다 구체적으로, 상기 목적단백질은 바람직하게는 감염성 미생물, 면역질환 유래 항원 또는 종양 유래의 항원, 예를 들면 진균성 병원체, 박테리아, 기생충, 장내 기생충(helminth), 바이러스 또는 알러지 유발물질 등을 포함할 수 있으며, 이에 한정된 것은 아니다. 보다 상세하게는, 상기 항원은 파상풍 톡소이드(tetanus toxoid), 인플루엔자 바이러스의 헤마어글루티닌(hemagglutinin) 또는 핵단백질, 디프테리아 톡소이드(diphtheria toxoid), HIV의 gp120 또는 그 단편, HIV의 gag 단백질, IgA 프로티나아제(protease), 인슐린 펩티드 B, 스폰고스포라 서브테라네(Spongospora subterranea) 항원, 비브리오즈(Vibriose) 항원, 살모넬라(Salmonella) 항원, 뉴모코쿠스 항원(Pmeumococcus), RSV(Respiratory syncytial virus) 항원, 헤모필러스 인플루엔자(Hemophilus influenza) 외막 단백질, 스트렙토코쿠스 누모니애(Streptococcus pneumoniae) 항원, 헬리코박터 파이로리(Helicobacter pylori)의 우레아제(urease), 네세리아 메닝기티디스(Neisseria meningitidis)의 필린(pilin), 네세리아 고노로에아(N. gonorrhoeae)의 필린(pilin), 멜라노마-관련 단백질(melanoma associated antigens: TRP2, MAGE-1, MAGE-3, gp100, 티로신아제, MART-1, HSP-70, beta-HCG), HPV-16, -18, -31, --35, 또는 -45에서 유래하는 E1, E2, E6 및 E7을 포함하는 인간파필로마바이러스(Human papillomma virus)의 항원, CEA 종양항원, 정상 또는 변이된 ras 단백질, 정상 또는 변이된 p53, Muc1, pSA 등을 포함하며, 또한, 콜레라, 디프테리아, 헤모필러스(Haemophilus), A형 간염, B형 간염, 인플루엔자, 홍역, 뇌염, 이하선염, 백일해, 수두, 폐렴(pneumococcal pneumonia), 소아마비, 공수병, 루벨라(rubella), 파상풍, 결핵, 애디슨병(Addison's disease), 면역반응 유발물질(immunogen), 알레르기 유발 물질(allergen), 고형 종양 및 혈액종양을 포함하는 암, 후천성 면역결핍증, 신장, 심장, 이자, 폐 뼈, 간 등의 이식 거부 시 관여하는 인자 등에서 유래하는 당업계 알려진 항원 및 자가면역을 유발하는 항원 등을 포함할 수 있다.
따라서, 본 발명의 표면 발현 방법으로 생산된 외래단백질을 다양한 용도에 제공할 수 있다. 본 용도에는 항체 및 효소의 효과적인 생산이 있으며, 이외에도 항원, 부착 또는 흡착 단백질 및 새로운 생리 활성 물질을 스크리닝하기 위한 펩티드라이브러리의 생산 등이 포함된다.
바실러스 속 균주에서 유래한 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질을 포함한 모든 종류의 폴리감마글루탐산의 합성에 관여하는 유전자를 이용한 표면발현벡터는 모두 본 발명의 범위에 포함된다.
또한 본 발명의 폴리감마글루탐산의 합성 유전자를 이용한 표면발현벡터는 외래단백질을 미생물의 표면에 발현하기 위해 모든 균주에 적용할 수 있고, 바람직하게는 그람음성 세균, 더욱 바람직하게는 대장균, 살모넬라 타이피, 살모넬라 타이피뮤리움, 비브리모 콜레라, 마이코박테리움 보비스, 시겔라, 그리고 그람양성 세균, 바람직하게는 바실러스, 락토바실러스, 락토코커스, 스테필로코커스, 리스테리아 모노싸이토제네스, 스트랩토코커스 균주 등에 적용할 수 있다. 상기 균주를 이용한 모든 외래단백질의 제조방법은 본 발명의 범위에 포함된다.
필요에 따라 폴리감마글루탐산의 합성 유전자의 N-말단 혹은 C-말단에 모든 또는 일부 제한 효소의 다양한 인식 부위를 삽입할 수 있고, 이들 제한효소 부위가 삽입된 표면발현벡터는 모두 본 발명의 범위에 포함된다.
구체적으로 본 발명은 바실러스 속 균주에서 유래한 폴리감마글루탐산 합성 유전자인 pgsA를 포함하고, pgsA의 C-말단에 제한효소 인식부위를 삽입하여 다양한 외래단백질 유전자를 손쉽게 클로닝할 수 있는 표면발현벡터 pKV-Pald-pgsA1 내지 pKV-Pald-pgsA8를 제공한다.
본 발명은 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질의 복합체중 세포외막 단백질의 복합체인 pgsA로 구성되어 pgsA의 C-말단에 EGFP 단백질의 N-말단을 연결하여, EGFP 단백질을 융합단백질 형태로 그람양성균의 표면에 발현할 수 있는 표면발현벡터 pKV-Pald-pgsA1 내지 pKV-Pald-pgsA8을 제공한다.
특히 일 실시예에 따르면, 바실러스 서브틸리스 청국장(Bacillus subtilis var. chungkookjang, KCTC 0697BP)로부터 폴리감마글루탐산 합성에 관여하는 세포외막 단백질의 유전자 pgsA를 획득하였으나, 유전자는 폴리감마글루탐산을 생산하는 모든 바실러스 속 균주로부터 pgsA를 획득하여 벡터를 제조하거나 외래 단백질을 표면발현시키는 것도 본 발명의 범위에 포함될 것이다. 예컨대, 바실러스 서브틸리스 청국장에 존재하는 pgsA 유전자의 염기서열과 80% 이상의 상동성을 갖는 타 균주 유래의 pgsA 유전자를 사용하여 벡터를 제조하거나 외래 단백질을 표면발현시키는 것도 본 발명의 범위에 포함될 것이다.
본 발명의 다른 일 실시예에 따르면, 단백질이 효율적으로 대장균 세포표면에 발현되는지 알아보기 위하여 향상된 녹색형광단백질(enhanced Green fluorescent protein, EGFP)을 모델 단백질로 선택하여 확인하였다. "EGFP(enhanced green fluorescent protein) 유전자"는 생체 내에서 녹색 빛을 내 해당 단백질을 발현하는 세포를 쉽게 관찰하게 해주는 유전자로, 형광 현미경으로 관찰이 가능한 이점이 있다. GFP는 jellyfish(Aequorea Victoria)에서 기원한 초록 형광 단백질로써 여러 연구분야에서 유전자 발현의 중요한 마커로 이용되고 있다. EGFP는 GFP의 돌연변이체로써 본래 GFP의 64번째 페닐알라닌(Phenylalanine) 아미노산 서열이 류신(Leucine)으로, 65번째에 위치되어 있는 세린(Serine) 아미노산 서열은 트레오닌(Threonine)으로 교체함으로써 본래의 GFP보다 더 강한 형광신호를 발광하는 장점이 있다.
본 발명자들은 상기 제작된 pKV-Pald-pgsA1 내지 pKV-Pald-pgsA8 재조합 벡터에 EGFP 유전자를 삽입하여 표면발현벡터를 제작하고, 이를 이용하여 락토바실러스 카제이를 형질변환시킨 다음, 배양하여 발현을 유도하고, 배양액을 일정량 채취하여 단백질을 수득하였다. 수득한 상기 단백질을 SDS-PAGE로 분석하고, 항-EGFP 항체를 이용하여 웨스턴 블로팅(western blotting)을 수행한 결과, 상기 제작된 pKV-Pald-pgsA1 내지 pKV-Pald-pgsA8 재조합 벡터에 단백질 EGFP가 성공적으로 삽입되어 세포표면에 발현되었음을 확인하였다.
또한, 상기 실시예에서는 EGFP 단백질을 외래 단백질로 사용하였으나, 기타 다른 효소, 항원, 항체, 부착단백질 또는 흡착단백질 등 어떠한 단백질도 외래 단백질이 될 수 있을 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
특히, 하기 실시예에서는 표면발현벡터를 제작하기 위한 모티프로 pgsA 유전자를 사용하였으나, 이외에도 pgsB, pgsC 또는 이들의 조합을 사용한 경우에도 유사한 결과를 얻을 수 있다는 것은 본 출원인의 선행특허(WO2003/014360)에서 확인된 바와 같이 당업자에게 자명하다 할 것이다.
또한, 하기 실시예에서는 그람양성균에 적용되는 표면발현벡터를 제조하고, 숙주세포로 락토바실러스 카제이를 사용하였으나, 락토바실러스 카제이 이외의 여하한 그람양성균을 숙주세포로 활용할 수 있을 것이며, 그람양성균 이외에 여하한 그람음성균 및 그 밖의 세균들로 형질전환시키는 것도 당업자에게는 자명할 것이다.
실시예 1: 락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 프로모터의 확보
락토바실러스 카제이 (Lactobacillus casei)의 genome으로부터 갈락토오스 뮤타로테이즈 유전자의 프로모터 부위에 해당하는 700 bp의 DNA 단편을 PCR방법을 통해 확보하였다.
락토바실러스 카제이는 기본 배지인 MRS 배지(1% 카제인하이드로라이세이트, 1.5% 이스트추출물, 2% 덱스트로즈, 0.2% 암모니움시트르산, 0.5% 소디움아세테이트, 0.01% 마그네슘설페이트, 0.05% 망간설페이트 및 0.2% 디포타시움포스페이트, Acumedia Manufacturers, Inc.)에서 배양하였으며, 배양된 락토바실러스 1x109 개의 균체를 파쇄하여 얻어진 용액을 PCR의 주형으로 사용하였다.
유전자 클로닝 시 벡터 내 삽입이 용이하도록 SphI와 XhoI의 절단부위가 프라이머(서열번호 2 및 서열번호 3)의 각 말단에 위치하도록 제작하였으며, 상기의 프라이머를 이용하여 PCR을 수행한 결과, 총 길이 700 bp(서열번호 1)의 증폭 산물을 확보하였으며, PCR 증폭산물은 pGEM-Teasy vector (Promega Co., USA)에 클로닝하여 염기서열을 분석하였다(도 1).
서열번호 2: 5'-TACGGCATGCTTGAATTGGTTTCTTACGAT-3'
서열번호 3: 5'-TACGCTCGAGGTTGAATTACCTCCTAATAG-3'
실시예 2: 갈락토오스 뮤타로테이즈 프로모터를 이용한 EGFP 단백질 표면발현 벡터(pKV-Pgm-pgsA-EGFP)의 구축
갈락토오스 뮤타로테이즈 프로모터에 의해 발현 유도되는 EGFP 단백질의 발현벡터를 제조하기 위해, 대장균 및 락토바실러스 카세이에서 복제가 가능한 RepE를 복제원점(replication origin)으로 가지는 벡터에 락토바실러스 카세이 유래의 갈락토오스 뮤타로테이즈 프로모터를 삽입한 다음, 상기 프로모터의 다운스트림에 바실러스(Bacillus subtilis var. Chungkookjang) 유래의 표면발현 모체인 pgsA를 도입하고, pgsA의 카르복시 말단에 목적유전자를 삽입할 수 있는 BamHI, XbaI의 제한효소 사이트를 추가하여 갈락토오스 뮤타로테이즈 프로모터를 포함하는 pKV-Pgm-pgsA 벡터를 제조하였다. 상기 pgsA 유전자는 대한민국 특허등록 제0469800호에 개시된 것을 사용하였다.
EGFP 유전자는 합성 EGFP 유전자 단편을 주형으로 서열번호 4와 서열번호 5를 프라이머로 하여 PCR을 수행한 후 수득하였다.
서열번호 4: 5'-TGGTGGATCCGTGAGCAAGGGCGAGGAGCTG-3'
서열번호 5: 5'-TGACTCTAGAACTAGTGTCGACGGTACCTTACTTGTACAGCTCGTCC-3'
그 결과, 5'말단에는 BamHI 제한효소 부위를 포함하고 있고, 3'말단에는 XbaI 제한효소 부위를 포함하고 있는 DNA 절편을 확보하였다. EGFP 유전자를 포함하고 있는 755bp의 확보된 DNA 절편을 BamHI 과 XbaI으로 절단하여 pKV-Pgm-pgsA 벡터의 pgsA C 말단에 연결함으로써, 유산균 숙주에 형질전환 했을 경우 EGFP 단백질을 균체 외부에 표면 발현할 수 있는 발현벡터 pKV-Pgm-pgsA-EGFP를 완성하였다 (도 2).
실시예 3: 웨스턴 블러팅을 통한 목적단백질의 발현여부 및 발현유도 세기 확인
본 실시예에서는 실시예 2에서 제작된 pKV-Pgm-pgsA-EGFP 발현벡터로 락토바실러스 카제이를 형질전환 시키고, 상기 형질전환된 재조합 락토바실러스 카제이를 배양하여 EGFP 단백질의 발현을 확인하였다.
신규 갈락토오스 뮤타로테이즈 프로모터의 발현유도 세기를 기존 알돌레이즈 프로모터와 비교하여 신규 프로모터의 발현유도력을 확인하기 위하여 각 프로모터에는 리포터 유전자로서 EGFP 유전자를 연결하여 발현벡터를 구축하고 락토바실러스 카제이에 각각 형질전환 하였다. 그리고 EGFP 발현 양을 웨스턴 블러팅을 통해 비교하였다.
먼저, 본원발명의 표면발현벡터로 형질전환된 재조합 락토바실러스 카제이를 MRS배지 (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), 30℃에서 정치배양하여 EGFP 단백질의 표면발현을 유도하였다.
상기 배양된 락토바실러스 카제이의 전세포를 SDS-폴리아크릴아미드 젤 전기영동 및 EGFP에 대한 특이 항체를 이용한 웨스턴 블러팅을 수행하여 상기 융합단백질의 발현을 확인하였다.
구체적으로 발현이 유도된 형질전환된 재조합 락토바실러스 카제이 전세포를 동일한 세포농도에서 얻은 단백질로 디네이쳐(denature)시켜 시료를 준비하고, 이를 SDS-폴리아크릴아미드 젤 전기영동으로 분석한 다음 분획된 단백질들을 PVDF (polyvinylidene-difluoride membranes, Bio-Rad) 멤브레인에 옮겼다. 단백질들이 옮겨진 PVDF 멤브레인을 블로킹 완충용액(50 mM Tris-HCl, 5 % 스킴 밀크(skim milk), pH 8.0)에서 1시간 동안 블로킹 시킨 다음, EGFP에 대한 각 토끼 유래의 폴리클론 1차 항체를 블로킹 완충용액에 1000배 희석하여 1시간 동안 반응시켰다. 반응이 끝난 멤브레인은 완충용액으로 세척하고 HRP (Horseradish Peroxidase)가 접합된 토끼 유래 항체에 대한 2차 항체를 블로킹 완충용액에 10000배 희석하여 1시간 동안 반응시켰다. 반응이 끝난 멤브레인은 완충용액으로 세척하고 세척된 멤브레인에 기질(Lumigen PS-3 acridan, H202)을 첨가하여 약 2분간 발색시키고 CCD 카메라로 EGFP에 대한 특이 항체와 상기 융합단백질간의 특이적인 결합을 확인하였다.
도 3은 본원발명의 세포표면발현벡터로 형질전환된 재조합 락토바실러스 카제이 전세포에서 EGFP 단백질의 발현양을 확인하기 위해 웨스턴 블러팅을 수행한 결과를 나타낸 것이다. 각각 Lane SM은 Protein size marker, Lane 1은 Lactobacillus casei (empty vector), Lane 2 및 3은 Lactobacillus casei (pKV-Pgm-pgsA-EGFP), Lane 4는 Lactobacillus casei (pKV-Pald-pgsA-EGFP)의 발현을 나타낸다.
목적단백질의 발현벡터 pKV-Pald-pgsA-EGFP(Lane 4)와 대비하여 본원발명의 pKV-Pgm-pgsA-EGFP(Lane 2 및 3) 발현벡터에서 목적단백질의 발현이 확인되었을 뿐 아니라 발현양에 있어 더욱 뛰어난 것을 확인하였다. 이는 본원발명의 갈락토오스 뮤타로테이즈(galactose mutarotase) 프로모터가 발현벡터 내에서 목적단백질을 안정적으로 발현시키며 알돌레이즈(Aldoalse) 프로모터와 대비하여 더욱 강하게 발현시킬 수 있음을 나타낸다(도 3).
실시예 4: Confocal 형광 현미경을 이용한 두 목적단백질의 미생물 표면 발현 확인
본원발명의 표면발현벡터의 발현정도를 확인하기 위해 형광이미지를 공초점 현미경(Confocal microscopy, Carl Zeiss LSM800)을 통해 관찰하였다.
본원발명의 표면발현벡터(pKV-Pgm-pgsA-EGFP)로 형질전환된 재조합 락토바실러스 카제이를 MRS배지 (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), 30℃에서 정치배양하여 EGFP 단백질의 표면발현을 유도하였다. 그리고 EGFP의 특이 항체로 binding 시킨 후 Alexa488 (green)로 immunostaining 하여 공초첨 현미경으로 EGFP의 세포 표면발현을 확인 하였다.
그 결과, 도 4에 도시된 바와 같이, 본원발명의 발현벡터로 형질전환된 재조합 락토바실러스 카제이에서 안정적으로 형광이 발현되는 것을 확인할 수 있었다.
따라서, 본원발명의 발현벡터는 유산균에 형질전환을 통해 통상의 백신제조 방법과는 달리 균주의 비독성화 또는 무독성화의 단계가 요구되지 않으며 목적단백질을 보다 강하게 발현하므로 미생물 백신의 제조에 활용될 수 있을 것으로 기대된다.
실시예 5 : 표면발현벡터 pKV-Pald-pgsA-EGFP의 제조
상기 EGFP 발현 벡터를 제조하기 위하여 pKV-Pald-PgsA-E7 (대한민국 등록특허 제10-1471043호 참조)에서 제조된 표면발현 벡터를 사용해서 PgsA의 C-terminal에 EGFP 단백질을 코딩하는 유전자를 삽입시켜서 유산균에서 표면발현할 수 있는 벡터 pKV-Pald-PgsA-EGFP을 확보하였다.
먼저, pKV-Pald-PgsA-E7 벡터에서 pgsA와 융합된 HPV16 E7 유전자를 제거하고 EGFP를 코딩하는 유전자를 삽입하였다. 합성 EGFP 유전자 단편을 주형으로 서열번호 6과 서열번호 7을 프라이머로 사용해서 PCR을 수행하여 수득하였다.
서열번호 6: 5' TGGTGGATCCGTGAGCAAGGGCGAGGAGCTG 3'
서열번호 7: 5' TGACTCTAGAACTAGTGTCGACGGTACCTTACTTGTACAGCTCGTCC 3'
그 결과, EGFP 유전자를 포함하고 있는 755bp의 절편을 확보하였으며, 상기 절편의 5'말단에는 BamHI 제한효소 부위를 포함하고 있으며, 상기절편의 3'말단에는 XbaI 제한효소 부위를 포함하고 있다. 확보된 DNA 절편에 BamHI과 XbaI 제한효소를 처리하여 절단하여 741bp 절편을 확보하였다.
pKV-Pald-PgsA-E7를 BamHI과 XbaI으로 절단하여 HPV16 E7 유전자 부분을 제거하고 벡터부분을 확보하였다.
BamHI과 XbaI으로 절단한 E7 유전자를 함유하고 있는 DNA 단편을 같은 제한효소로 절단한 벡터와 연결하여 pKV-Pald-PgsA-EGFP을 완성하였다 (도 5).
실시예 6: 표면발현벡터 PgsA motif 개량
본 실시예에서는 실시예 5에서 제조된 표면발현 벡터(pKV-Pald-PgsA-EGFP)를 사용해서 유산균 숙주에서 보다 안정적으로 높은 발현율을 나타낼 수 있도록 PgsA의 유전자를 단편으로 하는 개량을 실시하였다.
먼저, PgsA 단편 중 1-60 a.a, 1-70 a.a, 1-80 a.a, 1-100 a.a, 1-188 a.a를 포함하는 PgsA 단편을 확보하기 위하여, 표면발현 벡터 (pKV-Pald-PgsA-EGFP)을 주형으로 아래의 프라이머를 사용해서 PCR을 수행하여 수득하였다.
PgsA motif 1-60 a.a
서열번호 8:
5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT 3'
서열번호 9: 5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGAGAGTACGTCGTCAGAATACGTT 3'
PgsA motif 1-70 a.a
서열번호 10:
5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT3'
서열번호 11:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTCCCATCATAATATCGCCTACAAAT 3'
PgsA motif 1-80 a.a
서열번호 12:
5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT3'
서열번호 13:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTTTTTGCTCCGTTACTTTTTCAACA 3'
PgsA motif 1-100 a.a
서열번호 14:
5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT3'
서열번호 15:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGCTACATAATCCGAGGCTCTAAAG 3'
PgsA motif 1-188 a.a
서열번호 16:
:5 TCGAGCATGCAATACCCACTTATTGCGATTTGCT 3'
서열번호 17:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCGACTTTCTGGTACGAAATTTTCTTT 3'
그 결과, 알돌레이즈 프로모터를 포함하며, 각각의 PgsA motif 단편을 포함하는 DNA 절편을 확보 하였으며, 상기 절편의 5' 말단에는 SphI 제한효소를 포함하고 있으며, 상기 절편의 3' 말단에는 BamHI 제한효소 부위를 포함하고 있다. 확보된 DNA 절편에 SphI과 BamHI을 처리하여 절편을 확보하였다. 또한, 각각의 PgsA1 내지 A5 motif 단편이 아래와 같은 염기서열을 갖는 것을 확인하였다.
PgsA 1-60 a.a 단편서열(PgsA1)
서열번호 18:
5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCA 3'
PgsA 1-70 a.a 단편서열(PgsA2)
서열번호 19:
5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGA 3'
PgsA 1-80 a.a 단편서열(PgsA3)
서열번호 20:
5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAA 3'
PgsA 1-100 a.a 단편서열(PgsA4)
서열번호 21:
5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAAGGGGCAGACAGTATTTTTCAATATGTTGAACCGATCTTTAGAGCCTCGGATTATGTAGCA 3'
PgsA 1-188 a.a 단편서열(PgsA5)
서열번호 22:
5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAAGGGGCAGACAGTATTTTTCAATATGTTGAACCGATCTTTAGAGCCTCGGATTATGTAGCAGGAAACTTTGAAAACCCGGTAACCTATCAAAAGAATTATAAACAAGCAGATAAAGAGATTCATCTGCAGACGAATAAGGAATCAGTGAAAGTCTTGAAGGATATGAATTTCACGGTTCTCAACAGCGCCAACAACCACGCAATGGATTACGGCGTTCAGGGCATGAAAGATACGCTTGGAGAATTTGCGAAGCAAAACCTTGATATCGTTGGAGCGGGATACAGCTTAAGTGATGCGAAAAAGAAAATTTCGTACCAGAAAGTC 3'
상기 pKV-Pald-PgsA-EGFP를 SphI과 BamHI으로 절단하여 알돌레이즈 프로모터와 PgsA 유전자 부분을 제거한 벡터부분을 확보하였다.
SphI과 BamHI으로 절단한 알돌레이즈 프로모터를 포함하며, 각각의 PgsA motif 단편 유전자를 함유하고 있는 DNA 단편을 같은 제한효소로 절단한 벡터와 연결하여 개량된 벡터를 완성하였다(도 6 내지 도 10).
한편, PgsA 단편 중 25-60 a.a, 25-70 a.a, 25-100 a.a를 포함하는 PgsA 단편을 확보하기 위하여, 표면발현 벡터 (pKV-Pald-PgsA-EGFP)을 주형으로 아래의 프라이머를 사용하여 PCR을 수행하여 수득하였다.
PgsA motif 25-60 a.a
서열번호 23:
5' CGCTGGATATCTACATGCACGTATTTATTGCCATTCCG 3'
서열번호 24:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGAGAGTACGTCGTCAGAATACGTT 3'
PgsA motif 25-70 a.a
서열번호 25:
5' CGCTGGATATCTACATGCACGTATTTATTGCCATTCCG 3'
서열번호 26:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTCCCATCATAATATCGCCTACAAAT 3'
PgsA motif 25-100 a.a
서열번호 27:
5' CGCTGGATATCTACATGCACGTATTTATTGCCATTCCG 3'
서열번호 28:
5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGCTACATAATCCGAGGCTCTAAAG 3'
그 결과, 각각의 PgsA motif 단편을 포함하는 DNA 절편을 확보 하였으며, 상기 절편의 5' 말단에는 EcoRV 제한효소를 포함하고 있으며, 상기 절편의 3' 말단에는 BamHI 제한효소 부위를 포함하고 있다. 확보된 DNA 절편에 EcoRV와 BamHI을 처리하여 절편을 확보하였다. 또한, 각각의 PgsA motif 단편이 아래와 같은 염기서열을 갖는 것을 확인하였다.
PgsA 25-60 a.a 단편서열(PgsA6)
서열번호 29:
5'CACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCA 3'
PgsA 25-70 a.a 단편서열(PgsA7)
서열번호 30:
5'CACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGA 3
PgsA 25-100 a.a 단편서열(PgsA8)
서열번호 31:
5'CACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAAGGGGCAGACAGTATTTTTCAATATGTTGAACCGATCTTTAGAGCCTCGGATTATGTAGCA 3'
pKV-Pald-PgsA-EGFP를 EcoRV와 BamHI으로 절단하여 PgsA 유전자 부분을 제거한 벡터부분을 확보하였다.
EcoRV와 BamHI으로 절단한 각각의 PgsA motif 단편 유전자를 함유하고 있는 DNA 단편을 같은 제한효소로 절단한 벡터와 연결하여 개량된 벡터를 완성하였다(도 11 내지 도 13).
실시예 7: PgsA motif 개량 표면발현벡터 형질전환체의 발현 확인
본 실시예에서는 실시예 5에서 제작된 PgsA motif 개량 표면발현벡터로 락토바실러스 카제이를 형질전환 시키고, 상기 형질전환된 재조합 락토바실러스 카제이를 배양하여 EGFP 단백질의 발현을 확인하였다. 형질전환된 재조합 락토바실러스 카제이에서 개량된 단편 pgsA1 내지 A8 중 어느 하나와 융합된 EGFP 단백질의 발현 여부를 조사하였다.
PgsA motif 단편 표면발현벡터로 형질전환된 재조합 락토바실러스 카제이를 MRS배지 (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), 30℃에서 정치배양하여 폴리감마글루탐산을 합성하는 유전자 단편 pgsA1 내지 A8 중 어느 하나의 C-말단과 융합된 EGFP 단백질의 표면발현을 유도하였다.
상기 배양된 락토바실러스 카제이의 전세포를 SDS-폴리아크릴아미드 젤 전기영동 및 EGFP에 대한 특이 항체를 이용한 웨스턴블럿팅을 수행하여 상기 융합단백질의 발현을 확인하였다.
구체적으로 발현이 유도된 형질전환된 재조합 락토바실러스 카제이 전세포를 동일한 세포농도에서 얻은 단백질로 디네이쳐(denature)시켜 시료를 준비하고, 이를 SDS-폴리아크릴아미드 젤 전기영동으로 분석한 다음 분획된 단백질들을 PVDF (polyvinylidene-difluoride membranes, Bio-Rad) 멤브레인에 옮겼다. 단백질들이 옮겨진 PVDF 멤브레인을 블로킹 완충용액(50 mM 트리스 염산, 5 % 스킴 밀크(skim milk), pH 8.0)에서 1시간 동안 흔들어 블로킹시킨 다음, EGFP에 대한 토끼 유래의 폴리클론 1차 항체를 블로킹 완충용액에 1000배 희석하여 1시간 동안 반응시켰다. 반응이 끝난 멤브레인은 완충용액으로 세척하고 HRP가 접합된 토끼에 대한 2차 항체를 블로킹 완충용액에 10000배 희석하여 1시간 동안 반응시켰다. 반응이 끝난 멤브레인은 완충용액으로 세척하고 세척된 멤브레인에 기질(lumigen PS-3 acridan, H202)을 첨가하여 약 2분간 발색시키고 CCD 카메라로 EGFP에 대한 특이 항체와 상기 융합단백질간의 특이적인 결합을 확인하였다 (도 14).
도 14는 본원발명과 비교하여 대조군으로 설정된 개량되지 않은 pgsA가 삽입된 pKV-Pald-pgsA 재조합 발현벡터에 따른 락토바실러스 카제이에서의 발현양상(lane 6 및 11) 및 본원발명에 따른 개량된 pgsA1 내지 A8가 삽입된 pKV-Pald-pgsA1 내지 A8 재조합 발현벡터에 따른 락토바실러스 카제이에서의 발현양상(lane 1 내지 5 및 lane 7 내지 10)을 나타낸다.
구체적으로, 도 14의 lane 1은 PgsA motif 1-60 a.a에 EGFP를 발현시킨 형질전환된 재조합 락토바실러스 카제이이고, lane 2은 PgsA motif 1-70 a.a, lane 3은 PgsA motif 1-80 a.a, lane 4는 PgsA motif 1-100 a.a에 EGFP를 형질전환된 재조합 락토바실러스 카제이의 발현이다. lane 5는 PgsA motif 1-188 a.a에 EGFP가 형질전환된 재조합 락토바실러스 카제이의 단백질 발현을 나타낸다. lane 6은 pKV-Pald-PgsA-EGFP가 형질전환된 재조합 락토바실러스 카제이의 단백질 발현을 나타낸다.
또한, 도 14의 lane 7은 PgsA motif 25-60 a.a에 EGFP를 발현시킨 형질전환된 재조합 락토바실러스 카제이이고, lane 8은 PgsA motif 25-70 a.a, lane 9는 PgsA motif 25-100 a.a에 EGFP를 형질전환된 재조합 락토바실러스 카제이의 발현이다. lane 10는 PgsA motif 1-188 a.a에 EGFP가 형질전환된 재조합 락토바실러스 카제이의 단백질 발현을 나타낸다. lane 11은 pKV-Pald-PgsA-EGFP가 형질전환된 재조합 락토바실러스 카제이의 단백질 발현을 나타낸다.
개량되지 아니한 pKV-Pald-pgsA-EGFP 표면발현벡터에 의한 EGFP 융합단백질의 발현과 비교하면 개량된 PgsA motif 단편을 포함하는 EGFP 융합 단백질이 더 강하게 발현됨을 확인하였다.
본 발명은 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터 및 바실러스 속 균주 유래의 폴리감마글루탐산의 합성에 관여하는 세포외막 단백질(pgsA)을 이용하여 외래 단백질을 미생물의 표면에 효과적으로 발현시키는 새로운 벡터에 관한 것으로, 상기 벡터는 목적단백질을 표면 발현시키는 유전자를 함유하고 있기 때문에 상기 벡터를 이용한 형질전환체에서는 목적단백질을 효과적으로 균체 표면에 발현시킬 수 있어 유산균을 백신 전달체로서 활용할 수 있고, 또한 목적단백질의 표면발현벡터는 목적단백질을 안정하게 발현시킬 수 있으며, 본 발명에 따른 표면발현벡터는 목적단백질을 항시적으로 발현시키면서, 동시에 재조합 미생물에 표면발현시켜 필요로 하는 백신제조용 항원 제작 등에 유용하게 쓰일 수 있는 점에서 산업상 이용가능성이 존재한다.
서열번호 1
5` ttgaattggt ttcttacgat ggtaagacca acgaaactgg tacagctgca tgggctaaag ctaagcctga aaaggtcatc aagatcacca aggaattcag caagccgcaa tacaatgttt ctgttttgaa gcttgaagtt ccagttgatc aaaagtttgt tgaaggctac accgatgacg gcgttacccc tgtttacagc aaggaagaag ccgctaagta ttacaaggaa cagtcagatg caacggatct cccattcatc ttcctgtccg ctggtgtcac caacgaattg ttccttgaag aactcaagtt tgctaagcaa gcaggttcag cctttaatgg tgttctctgt ggccgtgcaa cttggaagcc gggtgttaag ccatatgctg ctgaaggcga agctgctggt aagaagtggc tgcagaccga aggcaaggct aacattgatc gtttgaacaa ggtgcttgca gaaactgcaa ccccttggac tgacaaagtt gaaggttaat ctttaaccat agttgcaaga aaggaccgat tatgatgatc ggttcttttt ttatgactgc ggacatgttt ttgtgaccac tgcaaacatc aaatgaagt tcgaaaaact tgctaacaat cattacaggt cagtgatcca gtggtagact gtattgaat gcgttttcgt ctattaggag gtaattcaac 3`
서열번호 2
5` tacggcatgc ttgaattggt ttcttacgat 3`
서열번호 3
5` tacgctcgag gttgaattac ctcctaatag 3`
서열번호 4
5` tggtggatcc gtgagcaagg gcgaggagct g 3`
서열번호 5
5` tgactctaga actagtgtcg acggtacctt acttgtacag ctcgtcc 3`
서열번호 6
5`tggtggatcc gtgagcaagg gcgaggagct g 3`
서열번호 7
5` tgactctaga actagtgtcg acggtacctt acttgtacag ctcgtcc 3`
서열번호 8
5` tcgagcatgc aatacccact tattgcgatt tgct 3`
서열번호 9
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gagagtacgt cgtcagaata cgtt 3`
서열번호 10
5` tcgagcatgc aatacccact tattgcgatt tgct 3`
서열번호 11
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct cccatcataa tatcgcctac aaat 3`
서열번호 12
5` tcgagcatgc aatacccact tattgcgatt tgct 3`
서열번호 13
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct ttttgctccg ttactttttc aaca 3`
서열번호 14
5` tcgagcatgc aatacccact tattgcgatt tgct 3`
서열번호 15
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gctacataat ccgaggctct aaag 3`
서열번호 16
5` tcgagcatgc aatacccact tattgcgatt tgct 3`
서열번호 17
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccaccg actttctggt acgaaatttt cttt 3`
서열번호 18
5` atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 3`
서열번호 19
5` atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca gcctcatttg taggcgatat tatgatggga 3`
서열번호 20
5` atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa 3`
서열번호 21
5` atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa ggggcagaca gtatttttca atatgttgaa ccgatcttta gagcctcgga ttatgtagca 3`
서열번호 22
5` atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa ggggcagaca gtatttttca atatgttgaa ccgatcttta gagcctcgga ttatgtagca ggaaactttg aaaacccggt aacctatcaa aagaattata aacaagcaga taaagagatt catctgcaga cgaataagga atcagtgaaa gtcttgaagg atatgaattt cacggttctc aacagcgcca acaaccacgc aatggattac ggcgttcagg gcatgaaaga tacgcttgga gaatttgcga agcaaaacct tgatatcgtt ggagcgggat acagcttaag tgatgcgaaa aagaaaattt cgtaccagaa agtc 3`
서열번호 23
5` cgctggatat ctacatgcac gtatttattg ccattccg 3`
서열번호 24
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gagagtacgt cgtcagaata cgtt 3`
서열번호 25
5` cgctggatat ctacatgcac gtatttattg ccattccg 3`
서열번호 26
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct cccatcataa tatcgcctac aaat 3`
서열번호 27
5` cgctggatat ctacatgcac gtatttattg ccattccg 3`
서열번호 28
5` tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gctacataat ccgaggctct aaag 3`
서열번호 29
5` cacgtattta ttgccattcc gatcgttttt gtccttatgt tcgctttcat gtgggcggga aaagcggaaa cgccgaaggt caaaacgtat tctgacgacg tactctca 3`
서열번호 30
5` cacgtattta ttgccattcc gatcgttttt gtccttatgt tcgctttcat gtgggcggga aaagcggaaa cgccgaaggt caaaacgtat tctgacgacg tactctcagc ctcatttgta ggcgatatta tgatggga 3`
서열번호 31
5` cacgtattta ttgccattcc gatcgttttt gtccttatgt tcgctttcat gtgggcggga aaagcggaaa cgccgaaggt caaaacgtat tctgacgacg tactctcagc ctcatttgta ggcgatatta tgatgggacg ctatgttgaa aaagtaacgg agcaaaaagg ggcagacagt atttttcaat atgttgaacc gatctttaga gcctcggatt atgtagca 3`

Claims (25)

  1. 락토바실러스 카제이(Lactobacillus casei) 유래 갈락토오스 뮤타로테이즈(galactose mutarotase) 유전자의 프로모터.
  2. 제1항에 있어서, 서열번호 1의 염기서열을 가지는 것을 특징으로 하는 프로모터.
  3. 제1항의 프로모터 및 목적단백질을 코딩하는 유전자를 포함하는 발현벡터.
  4. 제3항의 발현벡터로 형질전환된 미생물.
  5. 제1항의 프로모터, 폴리감마글루탐산 합성효소 복합체 유전자 및 목적단백질을 코딩하는 유전자가 연결되어 있는 것을 특징으로 하는 미생물 표면 발현벡터.
  6. 제5항에 있어서, 목적단백질은 항원인 것을 특징으로 하는 미생물 표면 발현벡터.
  7. 제5항에 있어서, 폴리감마글루탐산 합성효소 복합체 유전자는 pgsA, pgsB 및 pgsC 중 어느 하나 이상인 것을 특징으로 하는 미생물 표면 발현벡터.
  8. 제5항 내지 제7항 중 어느 한 항의 미생물 표면 발현벡터로 형질전환된 미생물.
  9. 제8항에 있어서, 미생물은 유산균인 것을 특징으로 하는 미생물.
  10. 제5항에 있어서, 상기 폴리감마글루탐산 합성효소 복합체를 코드하는 유전자는 pgsA이고, 서열번호 18 내지 21 및 29 내지 31 중 어느 하나의 염기서열을 가지는 것을 특징으로 하는 목적단백질의 표면발현벡터.
  11. 제10항에 있어서, 상기 유전자 pgsA는 폴리감마글루탐산을 생산하는 바실러스 속 균주에서 유래한 것을 특징으로 하는 목적단백질의 표면발현벡터.
  12. 제10항에 있어서, 상기 폴리감마글루탐산 합성효소 복합체를 코드하는 유전자 pgsA는 서열번호 22의 염기서열을 가지는 것을 특징으로 하는 목적단백질의 표면발현벡터.
  13. 제10항에 있어서, 상기 유전자 pgsA의 말단부위에 링커가 삽입되어 있고, 상기 삽입된 링커에 목적단백질을 코딩하는 유전자가 삽입되어 있는 것을 특징으로 하는 목적단백질의 표면발현벡터.
  14. 제10항에 있어서, 상기 목적단백질은 표면발현에 유리하도록 목적단백질의 아미노산 서열 중 일부분이 제거되거나 위치 특이적으로 돌연변이된 것임을 특징으로 하는 목적단백질의 표면발현벡터.
  15. 제10항 내지 제14항 중 어느 한 항에 있어서, 상기 벡터는 그람음성균 또는 그람양성균에 적용되는 것을 특징으로 하는 목적단백질의 표면발현벡터.
  16. 제10항 내지 제14항 중 어느 한 항의 표면발현벡터로 형질전환된 미생물.
  17. 제16항에 있어서, 형질전환에 사용된 미생물은 목적단백질의 세포 표면발현에 유리하도록, 발현된 목적단백질을 분해하는데 관련된 세포 내 또는 세포 외의 단백질 분해효소를 생산하지 못하도록 변형된 것임을 특징으로 하는 형질전환된 미생물.
  18. 제16항에 있어서, 미생물은 유산균인 것을 특징으로 하는 형질전환된 미생물.
  19. 제8항의 형질전환된 미생물을 배양하는 것을 특징으로 하는 목적단백질을 미생물 표면에 발현시키는 방법.
  20. 다음 단계를 포함하는 미생물 백신의 제조방법:
    (a) 제6항의 미생물 표면 발현벡터로 형질전환된 미생물을 배양하여 미생물 표면에 항원을 표면발현하는 단계;
    및
    (b) 상기 항원이 표면발현된 미생물을 회수하는 단계.
  21. 제20항에 있어서, 미생물은 유산균인 것을 특징으로 하는 방법.
  22. 제16항의 형질전환된 미생물을 배양하여 목적단백질을 세포표면에 발현하는 단계 및 목적단백질이 표면에 발현된 세포를 회수하는 단계를 포함하는 목적단백질의 세포표면 발현방법.
  23. 제22항에 있어서, 목적단백질은 호르몬, 호르몬 유사체, 효소, 효소저해제, 신호전달 단백질 혹은 그 일부분, 항체 혹은 그 일부분, 단쇄항체, 결합단백질, 결합도메인, 펩타이드, 항원, 부착단백질, 구조단백질, 조절단백질, 독소단백질, 사이토카인, 전사조절 인자, 혈액응고 인자 및 식물 생체방어 유도 단백질로 구성된 그룹으로부터 선택되는 어느 하나인 것을 특징으로 하는 방법.
  24. 제23항의 방법에 의해 제조되고, 항원이 표면에 발현된 세포를 인간을 제외한 척추동물에 투여하여 체액성 면역 또는 세포성 면역을 유도하는 것을 특징으로 하는 방법.
  25. 하기의 단계를 포함하는 것을 특징으로 하는 그람음성 또는 그람양성 숙주세포의 표면에 목적단백질을 발현시키는 방법 :
    (a) 제24항의 목적단백질의 표면발현벡터에 목적단백질을 코드하는 유전자를 삽입하여 재조합 벡터를 제조하는 단계;
    (b) 상기 재조합 벡터로 그람음성 또는 그람양성 숙주세포를 형질전환하는 단계; 및
    (c) 상기 형질전환된 숙주세포를 배양하여 목적단백질을 숙주세포 표면에 발현하는 단계.
PCT/KR2019/013260 2018-10-10 2019-10-10 락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용 WO2020076078A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US17/281,743 US20220033812A1 (en) 2018-10-10 2019-10-10 Surface expression vector for constitutive high-expression using promoter of galactose mutarotase gene derived from lactobacillus casei, and use thereof
JP2021518738A JP7147060B2 (ja) 2018-10-10 2019-10-10 ラクトバチルス・カゼイ由来ガラクトース・ムタロターゼ遺伝子のプロモーターを用いた常時的高発現表面発現ベクターおよびその利用
EP19871372.9A EP3865578A4 (en) 2018-10-10 2019-10-10 SURFACE EXPRESSION VECTOR FOR CONSTITUTIVE HIGH EXPRESSION USING A GALACTOSE MUTAROTASE GENE PROMOTER DERIVED FROM LACTOBACILLUS CASEI, AND USE THEREOF
CN201980075582.0A CN113330119A (zh) 2018-10-10 2019-10-10 使用源自干酪乳杆菌的半乳糖变旋酶基因启动子用于组成型高表达的表面表达载体及其用途
KR1020217010523A KR102594583B1 (ko) 2018-10-10 2019-10-10 락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0120546 2018-10-10
KR20180120546 2018-10-10

Publications (1)

Publication Number Publication Date
WO2020076078A1 true WO2020076078A1 (ko) 2020-04-16

Family

ID=70164212

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/013260 WO2020076078A1 (ko) 2018-10-10 2019-10-10 락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용

Country Status (6)

Country Link
US (1) US20220033812A1 (ko)
EP (1) EP3865578A4 (ko)
JP (1) JP7147060B2 (ko)
KR (1) KR102594583B1 (ko)
CN (1) CN113330119A (ko)
WO (1) WO2020076078A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7170129B2 (ja) * 2018-10-10 2022-11-11 バイオリーダース コーポレイション ラクトバチルス・カゼイ由来の二種類のプロモーターを用いた二種の目的タンパク質の同時表面発現ベクター、およびこれを用いたタンパク質の微生物表面発現方法

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993010214A1 (en) 1991-11-15 1993-05-27 George Georgiou Expression of proteins on bacterial surface
WO1993024636A1 (en) 1992-05-29 1993-12-09 The University Of British Columbia Use of protein oprf for bacterial cell surface expression of oligopeptides
WO1994010330A1 (en) 1992-11-03 1994-05-11 Rea, Teresa, Stanek Fibronectin binding protein as well as its preparation
EP0603672A2 (de) 1992-12-23 1994-06-29 BEHRINGWERKE Aktiengesellschaft Verfahren zur Herstellung von rekombinanten und synthetischen Peptiden und deren Verwendung
US5356797A (en) 1991-11-15 1994-10-18 Board Of Regents, The University Of Texas Membrane expression of heterologous genes
WO1995004069A1 (en) 1993-07-30 1995-02-09 Affymax Technologies N.V. Biotinylation of proteins
WO2003014360A1 (en) 2001-08-10 2003-02-20 Bioleaders Corporation SURFACE EXPRESSION VECTORS HAVING pgsBCA, THE GENE CODING POLY-GAMMA-GLUTAMATE SYNTHETASE, AND A METHOD FOR EXPRESSION OF TARGET PROTEIN AT THE SURFACE OF MICROORGANISM USING THE VECTOR
KR20080086161A (ko) * 2007-03-22 2008-09-25 주식회사 바이오리더스 신규 항시적 고발현 프로모터 및 그 용도
WO2010001363A1 (en) * 2008-07-04 2010-01-07 Terranol A/S Microorganism expressing aldose-1-epimerase
KR101471043B1 (ko) 2009-01-08 2014-12-09 주식회사 바이오리더스 안정적인 항시적 고발현 자궁경부암 치료백신용 벡터 및 그에 의해 형질전환된 재조합 유산균
KR20150092921A (ko) * 2014-02-06 2015-08-17 단국대학교 천안캠퍼스 산학협력단 담즙산에 의해 발현이 유도되는 프로모터를 포함하는 셔틀벡터 및 이를 포함하는 조성물

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7255855B2 (en) * 2004-02-27 2007-08-14 Bioleaders Corporation Surface expression method of peptides P5 and Anal3 using the gene encoding poly-gamma-glutamate synthetase
KR100784261B1 (ko) * 2006-01-02 2007-12-11 한국과학기술원 탄저균의 포자외막 단백질을 이용한 목적단백질의 미생물표면발현방법
US20140045235A1 (en) * 2012-08-12 2014-02-13 Wisconsin Alumi Research Foundation Construction of a lactobacillus casei ethanologen
JP6553963B2 (ja) 2014-09-05 2019-07-31 花王株式会社 改変スターメレラ属微生物
KR20200000972A (ko) * 2018-06-26 2020-01-06 주식회사 바이오리더스 바실러스 속 균주 유래의 폴리감마글루탐산 합성유전자를 이용한 표면발현벡터 및 이를 이용한 단백질의 미생물표면 발현 방법
JP7170129B2 (ja) * 2018-10-10 2022-11-11 バイオリーダース コーポレイション ラクトバチルス・カゼイ由来の二種類のプロモーターを用いた二種の目的タンパク質の同時表面発現ベクター、およびこれを用いたタンパク質の微生物表面発現方法
CN114702559A (zh) * 2022-04-02 2022-07-05 江西师范大学 枯草芽孢杆菌蛋白PgsA及其在表面展示系统中的应用

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993010214A1 (en) 1991-11-15 1993-05-27 George Georgiou Expression of proteins on bacterial surface
US5356797A (en) 1991-11-15 1994-10-18 Board Of Regents, The University Of Texas Membrane expression of heterologous genes
WO1993024636A1 (en) 1992-05-29 1993-12-09 The University Of British Columbia Use of protein oprf for bacterial cell surface expression of oligopeptides
WO1994010330A1 (en) 1992-11-03 1994-05-11 Rea, Teresa, Stanek Fibronectin binding protein as well as its preparation
EP0603672A2 (de) 1992-12-23 1994-06-29 BEHRINGWERKE Aktiengesellschaft Verfahren zur Herstellung von rekombinanten und synthetischen Peptiden und deren Verwendung
WO1995004069A1 (en) 1993-07-30 1995-02-09 Affymax Technologies N.V. Biotinylation of proteins
WO2003014360A1 (en) 2001-08-10 2003-02-20 Bioleaders Corporation SURFACE EXPRESSION VECTORS HAVING pgsBCA, THE GENE CODING POLY-GAMMA-GLUTAMATE SYNTHETASE, AND A METHOD FOR EXPRESSION OF TARGET PROTEIN AT THE SURFACE OF MICROORGANISM USING THE VECTOR
KR100469800B1 (ko) 2001-08-10 2005-02-02 주식회사 바이오리더스 바실러스 속 균주 유래의 폴리감마글루탐산 합성유전자를이용한 표면 발현용 벡터 및 이를 이용한 단백질의 미생물표면 발현 방법
KR20080086161A (ko) * 2007-03-22 2008-09-25 주식회사 바이오리더스 신규 항시적 고발현 프로모터 및 그 용도
WO2010001363A1 (en) * 2008-07-04 2010-01-07 Terranol A/S Microorganism expressing aldose-1-epimerase
KR101471043B1 (ko) 2009-01-08 2014-12-09 주식회사 바이오리더스 안정적인 항시적 고발현 자궁경부암 치료백신용 벡터 및 그에 의해 형질전환된 재조합 유산균
KR20150092921A (ko) * 2014-02-06 2015-08-17 단국대학교 천안캠퍼스 산학협력단 담즙산에 의해 발현이 유도되는 프로모터를 포함하는 셔틀벡터 및 이를 포함하는 조성물

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
AGTERBERG ET AL., VACCINE, vol. 8, 1990, pages 85 - 91
ASHIUCHI ET AL., BIOCHEM. BIOPHY. RES. COMMUNICATIONS, vol. 263, 1999, pages 6 - 12
BARRETT, J. T., TEXTBOOK OF IMMUNOLOGY, 1983
BIOTECH. BIOENG., vol. 57, no. 4, 1998, pages 430 - 437
CHARBIT ET AL., J. IMMUNOL., vol. 139, 1987, pages 1658 - 1664
DATABASE NCBI 27 February 2015 (2015-02-27), Database accession no. FM177140.1 *
FELICI ET AL., J. MOL. BIOL., vol. 222, 1991, pages 301 - 310
FRANCISCO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 489, 1992, pages 2713 - 2717
FUCHS ET AL., BIO/TECHNOLOGY, vol. 9, 1991, pages 1369 - 1372
GEORGIOU ET AL., TIBTECH, vol. 11, 1993, pages 6
HEDEGAARD ET AL., GENE, vol. 85, 1989, pages 115 - 124
J. BACTERIOLOGY, vol. 171, 1989, pages 722 - 730
J. M. VAN DER VOSSEN ET AL., APPL. ENVIRON. MICROBIAL., vol. 53, 1987, pages 2452 - 2457
JOS F. M. K. SEEGERS, TRENDS BIOTECHNOL., vol. 20, 2002, pages 508 - 515
JUNG ET AL., ENZYME MICROB. TECHNOL, vol. 22, no. 5, 1998, pages 348 - 354
JUNG ET AL., NAT, BIOTECHNOL, vol. 16, 1998, pages 576 - 560
KARINA ARAUJO AIRES ET AL., APPL. ENVIRON. MICROBIOL., vol. 72, 2006, pages 745 - 752
KLAUSER ET AL., EMBO J, vol. 9, 1990, pages 1991 - 1999
KORNACKER ET AL., MOL. MICROL., vol. 4, 1990, pages 1101 - 1109
LEE ET AL., NAT. BIOTECHNOL, vol. 18, 2000, pages 645 - 648
LEE ET AL., TIBTECH, vol. 21, 2003, pages 45 - 52
LEE S. Y. ET AL., TRENDS BIOTECHNOL., vol. 21, 2003, pages 4552
LOTHAR STEIDLER ET AL., NAT. BIOTECHNOL., vol. 21, 2003, pages 785 - 789
NATTO, BIOCHEM. BIOPHY. RESEARCH COMM., vol. 263, 1999, pages 6 - 12
NEWTON ET AL., SCIENCE, vol. 244, 1989, pages 70 - 72
PASCALLE G. G. A. ET AL., APPL. ENVIRON. MICROBIAL., vol. 62, 1996, pages 3662 - 3667
PHILIPPE SLOS ET AL., APPL. ENVIRON. MICROBIAL., vol. 57, 1991, pages 1333 - 1339
SAMUELSON ET AL., J. BACTERIOL., vol. 177, 1995, pages 1470 - 1476

Also Published As

Publication number Publication date
US20220033812A1 (en) 2022-02-03
EP3865578A1 (en) 2021-08-18
KR102594583B1 (ko) 2023-10-27
CN113330119A (zh) 2021-08-31
JP2022504335A (ja) 2022-01-13
EP3865578A4 (en) 2022-08-24
KR20210046810A (ko) 2021-04-28
JP7147060B2 (ja) 2022-10-04

Similar Documents

Publication Publication Date Title
WO2020076079A2 (ko) 락토바실러스 카제이 유래의 두 종류 프로모터를 이용한 두 가지 목적단백질의 동시 표면발현벡터 및 이를 이용한 단백질의 미생물표면 발현 방법
WO2018040537A1 (zh) 人pd-1基因敲除的cldn18.2 特异性嵌合抗原受体t细胞的制备方法以及应用
WO2010079991A2 (ko) 안정적인 항시적 고발현 자궁경부암 치료백신용 벡터 및 그에 의해 형질전환된 재조합 유산균
WO2017217768A1 (ko) 온타겟 및 오프타겟의 다중 타겟 시스템을 이용하는, 표적 특이적 유전자 가위 스크리닝 방법 및 이의 용도
CN101328210A (zh) Hiv肽，抗原，疫苗组合物，检测hiv所诱导的抗体的免疫测定试剂盒及方法
WO2018074884A1 (ko) 재조합 단백질 및 그의 용도
WO2019209079A1 (en) Nucleic acid molecules inserted expression regulation sequences, expression vector comprising nucleic acid moleclues and pharmaceutical use thereof
WO2019031939A2 (ko) 암 치료를 위한 t 세포의 활성화 방법
WO2011043584A2 (ko) 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법
WO2020076078A1 (ko) 락토바실러스 카제이 유래 갈락토오스 뮤타로테이즈 유전자의 프로모터를 이용한 항시적 고발현 표면발현벡터 및 그 이용
WO2020004877A1 (ko) 바실러스 속 균주 유래의 폴리감마글루탐산 합성유전자를 이용한 표면발현벡터 및 이를 이용한 단백질의 미생물표면 발현 방법
WO2015199387A2 (ko) 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용
WO2022065913A1 (ko) 요산산화효소-알부민 접합체, 그 제조방법 및 용도
WO2015199386A1 (ko) 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용
WO2012176981A1 (en) Enhanced heterologous protein production in kluyveromyces marxianus
WO2018182361A1 (ko) CRISPR/Cas 시스템과 재조합 효소 및 단일가닥 올리고디옥시리보핵산을 이용한 코리네박테리움 변이균주 제조방법
WO2020235974A9 (ko) 단일염기 치환 단백질 및 이를 포함하는 조성물
WO2019022463A2 (ko) 면역원성시스템 및 이를 포함한 동물 백신
WO2010079982A2 (ko) ｒｅｐＥ 변이유전자를 함유하는 항시적 고발현 벡터
EP3334755A1 (en) Improved cell-permeable reprogramming factor (icp-rf) recombinant protein and use thereof
WO2020218657A1 (ko) 표적 특이적 crispr 변이체
WO2023140697A1 (ko) Cas 단백질 또는 이의 변이체의 스크리닝 방법, 및 이를 이용하여 제조된 Cas 단백질 또는 이의 변이체
WO2023101381A1 (ko) 구제역 바이러스 유사 입자를 생산하기 위한 백신 플랫폼
WO2024049280A1 (ko) 수퍼옥시드 디스뮤타제를 발현하는 바실러스 종 균주, 바실러스 종 균주 포자 및/또는 수퍼옥시드 디스뮤타제 및 이의 섬유화 질환 예방 또는 치료용 용도
WO2023244001A1 (ko) 면역활성 부위 융합 단백질을 포함하는 결핵 백신 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19871372

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021518738

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20217010523

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019871372

Country of ref document: EP

Effective date: 20210510