WO2019104279A1 - Adeno-associated virus variant capsids and use for inhibiting angiogenesis - Google Patents

Adeno-associated virus variant capsids and use for inhibiting angiogenesis Download PDF

Info

Publication number
WO2019104279A1
WO2019104279A1 PCT/US2018/062478 US2018062478W WO2019104279A1 WO 2019104279 A1 WO2019104279 A1 WO 2019104279A1 US 2018062478 W US2018062478 W US 2018062478W WO 2019104279 A1 WO2019104279 A1 WO 2019104279A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
aav
capsid protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/062478
Other languages
English (en)
French (fr)
Inventor
David Kirn
Melissa KOTTERMAN
David Schaffer
Paul Szymanski
Peter Francis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
4D Molecular Therapeutics Inc
Original Assignee
4D Molecular Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP18881166.5A priority Critical patent/EP3717636B1/en
Priority to EP23152950.4A priority patent/EP4219695A3/en
Priority to AU2018372235A priority patent/AU2018372235B9/en
Priority to BR112020010674-7A priority patent/BR112020010674A2/pt
Priority to CA3083472A priority patent/CA3083472A1/en
Priority to KR1020257011121A priority patent/KR20250052478A/ko
Priority to KR1020207017143A priority patent/KR102793696B1/ko
Priority to ES18881166T priority patent/ES2946747T3/es
Priority to UAA202003841A priority patent/UA127831C2/uk
Priority to US16/765,758 priority patent/US11766489B2/en
Priority to SG11202004545XA priority patent/SG11202004545XA/en
Priority to DK18881166.5T priority patent/DK3717636T5/da
Priority to FIEP18881166.5T priority patent/FI3717636T3/fi
Priority to RU2020121215A priority patent/RU2773756C2/ru
Priority to PE2020000575A priority patent/PE20210915A1/es
Priority to CR20200282A priority patent/CR20200282A/es
Priority to NZ765038A priority patent/NZ765038B2/en
Priority to JP2020528888A priority patent/JP7184894B2/ja
Application filed by 4D Molecular Therapeutics Inc filed Critical 4D Molecular Therapeutics Inc
Priority to CN201880087687.3A priority patent/CN111770999A/zh
Priority to EP23186524.7A priority patent/EP4272728A3/en
Priority to MX2020005451A priority patent/MX2020005451A/es
Publication of WO2019104279A1 publication Critical patent/WO2019104279A1/en
Priority to IL274712A priority patent/IL274712A/en
Priority to PH12020550706A priority patent/PH12020550706A1/en
Anticipated expiration legal-status Critical
Priority to AU2022203494A priority patent/AU2022203494B2/en
Priority to JP2022101767A priority patent/JP2022121534A/ja
Priority to US18/466,517 priority patent/US20240335560A1/en
Priority to JP2023205214A priority patent/JP2024015194A/ja
Priority to AU2024220028A priority patent/AU2024220028A1/en
Priority to JP2025272541A priority patent/JP2026040557A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors

Definitions

  • the invention disclosed herein relates generally to the field of adeno-associated virus (AAV) virions comprising variant capsid proteins and the generation of such variant capsids using directed evolution techniques.
  • AAV adeno-associated virus
  • Inherited retinal diseases encompass a large group of heterogenous genetic diseases that affect approximately 1 in 3000 people (greater than 2 million people worldwide) and are a major source of severe vision loss or blindness.
  • Complex, multifactoral retinal diseases such as wet age related macular degeneration (wAMD) and diabetic retinopathy (DR) impact even more individuals, with 1.7 million Americans currently living with severe central vision loss associated with wAMD and almost one-third of adults over age 40 years with diabetes being visually impaired.
  • wAMD wet age related macular degeneration
  • DR diabetic retinopathy
  • These diseases are typically associated with the dysfunction or death of one or more types of cell of the retina, in some instances due to the absence of expression or function of a key protein, e.g.
  • RPE65 in LCA2 in other instances due to gene mutations that create toxic gene products, e.g. dominant mutations that affect rhodopsin protein folding, or in yet other instances due to changes in retinal physiology induced by the ectopic expression of a protein, e.g. VEGF in wAMD.
  • AAV gene- based adeno-associated virus
  • rAAV recombinant adeno associated virus
  • AAV-based clinical gene therapy has been increasingly successful, it is still fraught with shortcomings with regard to viral vector properties, including, for example, targeting the desired cells of the retina with high efficiency.
  • multiple homologous primate AAV serotypes and numerous nonhuman primate serotypes have been identified and characterized, with AAV2 being the best characterized among the AAV serotypes and the first to be adapted as a gene delivery vehicle in the eye.
  • these AAVs (including AAV2) have not been reported to be effective at transducing the deeper cell types of the retina when delivered via intravitreal administration.
  • Naturally occurring AAV is a single stranded DNA virus that contains three open reading frames, rep, cap, and aap.
  • the first gene, rep encodes four proteins necessary for genome replication (Rep78, Rep68, Rep52, and Rep40)
  • the second, cap expresses three structural proteins (VP 1-3) that assemble to form the viral capsid
  • the third expresses the assembly activating protein (AAP) that is essential for capsid assembly.
  • AAV is dependent upon the presence of a helper virus, such as an adenovirus or herpesvirus, for active replication. In the absence of a helper virus, AAV establishes a latent state in which its genome is maintained episomally or integrated into the host chromosome in the AAVS1 locus.
  • Directed evolution is a capsid engineering approach that emulates natural evolution through iterative rounds of genetic diversification and selection processes, thereby enabling the accumulation of beneficial mutations that progressively improve the function of a biomolecule such as an AAV -based virion.
  • wild-type AAV cap genes are diversified to create large genetic libraries that are packaged to generate libraries of viral particles, and selective pressure is applied to isolate unique variants with superior phenotypes that can overcome gene delivery barriers.
  • AAV variants have been disclosed in, for example, in United States Patent Numbers 9,193,956; 9;186;419; 8,632,764; 8,663,624; 8,927,514; 8,628,966; 8,263,396; 8,734,809; 8,889,641; 8,632,764; 8,691,948; 8,299,295; 8,802,440;
  • variant adeno-associated virus (AAV) capsid proteins having one or more modifications in amino acid sequence relative to a parental AAV capsid protein, which, when present in an AAV virion, confer increased infectivity of one or more types of retinal cells as compared to the infectivity of the retinal cells by an AAV virion comprising an unmodified parental AAV capsid protein.
  • AAV adeno-associated virus
  • AAV virions and pharmaceutical compositions thereof comprising a variant AAV capsid protein as described herein, methods of making variant rAAV capsid proteins and virions, and methods for using these rAAV capsid proteins and virions in research and in clinical practice, for example in the delivery of nucleic acid sequences to one or more cells of the retina for the treatment of retinal disorders and diseases.
  • variant adeno-associated virus (AAV) capsid proteins are provided, these variant AAV capsid proteins having one or more modifications in amino acid sequence relative to a parental AAV capsid, which, when present in an AAV virion, confer increased infectivity of one or more types of retinal cells (e.g. a photoreceptor cell (e.g. rods; cones), a retinal ganglion cell (RGC), a glial cell (e.g.
  • retinal cells e.g. a photoreceptor cell (e.g. rods; cones), a retinal ganglion cell (RGC), a glial cell (e.g.
  • a Miiller glial cell a microglial cell
  • a bipolar cell an amacrine cell
  • a horizontal cell a retinal pigmented epithelium (RPE) cell
  • RPE retinal pigmented epithelium
  • recombinant AAV (rAAV) virions comprising a variant capsid protein as described herein, wherein the rAAV virions exhibit increased infectivity of one or more types of retinal cells (e.g. a photoreceptor cell (e.g. rods; cones), a retinal ganglion cell (RGC), a glial cell (e.g.
  • retinal cells e.g. a photoreceptor cell (e.g. rods; cones), a retinal ganglion cell (RGC), a glial cell (e.g.
  • the rAAV virion exhibits increased infectivity of all retinal cells relative to the AAV virion comprising the parental AAV capsid protein.
  • the rAAV virion exhibits increased infectivity of certain cell types of the retina but not others relative of the AAV virion comprising the parental AAV capsid protein.
  • the rAAV virion exhibits increased infectivity that is preferential for certain cell types of the retina but not others, e.g. the rAAV demonstrates a preferentially increased infectivity of one or more cell types selected from photoreceptor cells, retinal ganglion cells, glial cells, bipolar cells, amacrine cells, horizontal cells, and/or retinal pigmented epithelium (RPE) cells, but does not demonstrate increased infectivity of all cell types.
  • the rAAV demonstrates a preferentially increased infectivity of one or more cell types selected from photoreceptor cells, retinal ganglion cells, glial cells, bipolar cells, amacrine cells, horizontal cells, and/or retinal pigmented epithelium (RPE) cells, but does not demonstrate increased infectivity of all cell types.
  • RPE retinal pigmented epithelium
  • the rAAV virion comprises a heterologous nucleic acid.
  • the heterologous nucleic acid encodes an RNA that encodes a polypeptide.
  • the heterologous nucleic acid sequence encodes an RNA that does not encode a polypeptide, e.g. the heterologous nucleic acid sequence encodes an RNA interference agent, a guide RNA for a nuclease, etc.
  • compositions comprising the subject infectious rAAV virions and a pharmaceutically acceptable carrier.
  • an rAAV virion comprising a variant capsid protein as herein described in a method of delivering a heterologous nucleic acid to a target cell (such as a retinal cell) by contacting the target cell with the rAAV virion.
  • a target cell such as a retinal cell
  • the target cell is in vivo, such as in the eye of an individual in need of treatment for an ocular disease.
  • the target cell is in vitro.
  • an isolated nucleic acid comprising a sequence encoding a variant AAV capsid protein as described herein and a host cell comprising the isolated nucleic acid.
  • the isolated nucleic acid and/or isolated host cell comprises the rAAV.
  • the variant AAV capsid protein comprises an insertion of from about 5 amino acids to about 20 amino acids (a“heterologous peptide”, or“peptide insertion”) in the GH-loop of the capsid protein, relative to a corresponding parental AAV capsid protein, wherein the variant capsid protein, when present in an AAV virion, confers increased infectivity of a retinal cell compared to the infectivity of a retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein.
  • the peptide comprises the sequence selected from the group consisting of QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITKNI (SEQ ID NO: 17), HPDTTKN (SEQ ID NO: 18), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), QANANEN (SEQ ID NO:22), GKSKVID (SEQ ID NO:23), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25), KDRAPST (SEQ ID NO:26), LAQADTTKNA (SEQ ID NO:27), LAISDQTKHA (SEQ ID NO:28), LGISDQTKHA (SEQ ID NO:29), LAASDSTKAA (SEQ ID NO:30), LANQDYTKTA (SEQ ID NO
  • LAHQDTTKNA (SEQ ID NO: 34), LANKTTNKDA (SEQ ID NO: 35),
  • LPISNENEHA (SEQ ID NO:36), LPQANANENA (SEQ ID NO:37),
  • LAGKSKVIDA SEQ ID NO:38
  • LATNRTSPDA SEQ ID NO:39
  • the peptide consists essentially of the sequence selected from the group consisting of QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITKNI (SEQ ID NO: 17), HPDTTKN (SEQ ID NO:l8), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), QANANEN (SEQ ID NO:22), GKSKVID (SEQ ID NO:23), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25), KDRAPST (SEQ ID NO:26), LAQADTTKNA (SEQ ID NO:27), LAISDQTKHA (SEQ ID NO:28), L
  • LANKTTNKDA SEQ ID NO:35
  • LPISNENEHA SEQ ID NO:36
  • the variant AAV capsid protein comprises one or more amino acid substitutions relative to a corresponding parental AAV capsid protein, wherein the variant capsid protein, when present in an AAV virion, confers increased infectivity of a retinal cell compared to the infectivity of a retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein.
  • the variant AAV capsid protein comprises a peptide insertion and one or more amino acid substitutions relative to a corresponding parental AAV capsid protein, wherein the variant capsid protein, when present in an AAV virion, confers increased infectivity of a retinal cell compared to the infectivity of a retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein.
  • variant AAV capsid protein comprising the heterologous peptide LAISDQTKHA (SEQ ID NO:28) and a P34A substitution relative to AAV2.
  • an infectious recombinant AAV comprising a variant AAV capsid protein at least 90% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising a sequence encoding a VEGF inhibitor, preferably a VEGFa inhibitor, and a pharmaceutical composition comprising the same.
  • the heterologous nucleic acid sequence encoding a VEGF inhibitor is selected from a sequence encoding Aflibercept, Ranibizumab, a single-chain version of Ranibizumab (sc-Ranibizumab LH or HL), Brolucizumab, sc-Ranibizumab fused to the IgG Fc domain (sc-Ranibizumab-Fc), or Brolucizumab fused to the IgG Fc domain (Brolucizumab-Fc).
  • the recombinant AAV comprises a heterologous nucleic acid comprising two or more sequences, each of which encodes a VEGFa inhibitor (e.g.
  • the heterologous nucleic acid sequence has a sequence of any one of SEQ ID NOs:65, 67, 69, 70, 72, 74, 76 or a sequence at least 90% identical thereto.
  • a method for treating a patient with an eye disease associated with elevated intraocular VEGFa levels comprising administering to the patient, preferably via intravitreal injection, an effective amount of an infectious recombinant AAV comprising a variant AAV capsid protein at least 90% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising a sequence encoding a VEGF inhibitor.
  • AAV capsid protein comprising the heterologous peptide LAISDQTKHA (SEQ ID NO:28) and amino acid substitutions N312K, N449D, N551S, I698V, and L735Q relative to AAV2.
  • kits comprising an rAAV comprising a variant AAV capsid as disclosed herein and for use in methods described herein.
  • the AAV virion comprising the variant capsid protein in the preceding paragraphs may incorporate any of the preceding or subsequently disclosed embodiments. Indeed, it is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub combinations of the various embodiments and elements thereof are also specifically embraced by the invention and are disclosed herein just as if each and every such sub combination was individually and explicitly disclosed herein.
  • Figure 1 depicts embodiments of a directed evolution methodology.
  • Step (a) depicts the generation of a viral capsid library comprising combinations of DNA mutation techniques and cap genes.
  • Step (b) depicts the packaging of the viruses such that each viral particle is composed of a mutant capsid surrounding the cap gene encoding that capsid and purified.
  • the capsid library is then placed under selective pressure in vitro or in vivo.
  • tissues or cellular material of interest are harvested for isolation of AAV variants that have successfully infected that target, and the successful viruses are recovered.
  • Step (c) depicts the Stage 1 enrichment of successful clones through repeated selection.
  • Step (d) depicts the Stage 2 enrichment of selected cap genes which undergo re-diversification and further selection steps to iteratively increase viral fitness.
  • Step (e) depicts the variants, identified as hits during Vector Selection Stages 1 and 2, which will be manufactured as recombinant AAV vectors and characterized for the level of transduction of various cell types and tissue targets.
  • Figure 2 provides a retinal flat mount schematic showing where samples from which viral genomes are amplified, are collected across a broad area of the retina.
  • Figure 3 shows a PCR amplification of viral genomes from the ganglion cell layer (GCL), inner nuclear layer (INL), photoreceptor/outer nuclear layer (ONL), and retinal pigment epithelia (RPE) layer retinal tissue from a representative round of selection. Both the right eye (top image) and left eye (bottom image) were injected with library. Inner retina (in), middle retina (mid), and outer/peripheral retina (out) were sampled. Bands within red boxes represent successful amplification of viral genomes.
  • GCL ganglion cell layer
  • INL inner nuclear layer
  • ONL photoreceptor/outer nuclear layer
  • RPE retinal pigment epithelia
  • Figure 4A-4D shows frequency of motifs within sequencing analysis.
  • Figure 4A provides Round 3 sequencing analysis.
  • Figure 4B provides Round 4 sequencing analysis.
  • Figure 4C provides Round 5 sequencing analysis.
  • Figure 4D provides Round 6 sequencing analysis.
  • Figure 5 provides a representative three-dimensional model of AAV2 containing a random heptamer following amino acid 587.
  • Figure 6A-6W provides an alignment of wild-type AAV SEQ ID NOS: 1-11 showing amino acid locations between and across the wild-type (naturally occurring) serotypes AAV1, AAV2, AAV3A, AAV3B, and AAV4-10.
  • Figure 7 provides fundus fluorescence images taken with a Heidelberg SpectralisTM of the retina of an African Green monkey following intravitreal administration of 2x10 11 vector genomes (vg) of AAV2 delivering a GFP transgene under the control of the CMV promoter (AAV2.CMV.GFP). Images were taken at baseline (A) and at 14 days (B), 28 days (C), and 42 days (D) after injection.
  • Figure 8 provides fundus fluorescence images taken with a Heidelberg SpectralisTM the retina of an African Green monkey following intravitreal administration of 2xlO n vector genomes (vg) of the novel AAV variant LAISDQTKHA+P34A delivering a GFP transgene under the control of the CMV promoter (LAISDQTKHA+P34A.CMV.GFP). Images taken at baseline (A) and at 14 days (B), 28 days (C), and 42 days (D) after injection.
  • Figure 9 provides fundus fluorescence images taken with a Heidelberg SpectralisTM of the retinas of Cynomolgus monkeys following intravitreal administration of the novel AAV variant LAISDQTKHA+P34A delivering a GFP transgene under the control of the CAG promoter (LAISDQTKHA+P34A.CAG.EGFP).
  • A The retina of a monkey injected intravitreally with 2x10 11 vg of vector, imaged 14 days (Al), 21 days (A2), and 28 days (A3) after injection.
  • Figures 10A-10E provide the results of immunohistochemical analysis of the retina of a monkey injected intravitreally with lxlO 12 vg of the novel AAV variant LAISDQTKHA+P34A delivering a GFP transgene under the control of the CAG promoter, analyzed three weeks after injection. All immunohistochemistry is provided alongside the corresponding fundus fluorescence image, with a red box to denote approximately where in the retina the analysis was performed.
  • Figure 10A Robust retinal pigment epithelium (RPE) and photoreceptor transduction was observed using a GFP-specific antibody (red). Cone photoreceptor immunostaining using an M/L opsin antibody is shown in white.
  • RPE retinal pigment epithelium
  • red cone photoreceptor immunostaining using an M/L opsin antibody is shown in white.
  • Figures 10B and 10C Robust rod and cone photoreceptor (Figure 10B) and RPE (Figure 10C) transduction was observed by direct EGFP fluorescence (green) and by immunohistochemistry using a GFP-specific antibody (red). Melanosomes in RPE appear black in the image.
  • Figure 10D Transduction of cone photoreceptors (identified by M/L opsin, white) and retinal ganglion cells (RGC) in and around the fovea was observed by direct EGFP fluorescence (green) and by immunohistochemistry using a GFP-specific antibody (red). Images in the middle panels are a higher magnification (63X) of the area denoted by a white box in the left panel.
  • FIG 10E Transduction of retinal ganglion cells (RGC) and the retinal ganglion cell layer was observed by direct EGFP fluorescence (right panels, green; lower right panel is a 63X magnification of the upper right panel); top left panel shows the region under brightfield illumination.
  • FIGS 11A-11F provides data on the transduction of human retinal pigment epithelial (RPE) cells in vitro by recombinant AAV virus comprising the novel AAV variant LAISDQTKHA+P34A capsid and a GFP transgene under the control of the CAG promoter.
  • RPE retinal pigment epithelial
  • Figures 11A and 11C Cells that were differentiated into RPE cells from a human embryonic stem cell line ( Figures 11A and 11C) or from human fibroblast- derived induced pluripotent stem cells (FB-iPSC) ( Figures 11B and 11D) were infected with novel AAV variant LAISDQTKHA+P34A.CAG.GFP or wild type control AAV2.CAG.GFP.
  • FB-iPSC human fibroblast- derived induced pluripotent stem cells
  • Figures 11A and 11B Immunofluorescence imaging of the cell cultures 7 days after infection at an MOI of 500 demonstrates that the novel AAV variant capsid (left panels) transduces RPE cells better than wild type AAV2 capsid (right panels).
  • Figures 11C and 11D Quantification of the percent of GFP-positive RPE cells in each culture by flow cytometry reveals that the novel AAV variant capsid provides for a significant, dose-dependent improvement in the number of cells transduced over wild type AAV2 capsid regardless of cell source.
  • Figures 11E and 11F Quantification of the amount of GFP in each culture by Western blot reveals that the novel AAV variant provides for significant improvement in expression of the transgene over wild type capsid regardless of cell source.
  • Figures 12A-12F depict embodiments of anti-VEGF proteins.
  • Fig. 12A depicts the Aflibercept design, which consists of the human Fltl signal peptide, VEGFR1 domain 2, and VEGFR2 domain 3 fused to the Fc region of human IgGl.
  • Figs. 12B-C depict the Ranibizumab designs, which include a flexible protein linker to convert the two-chain antigen-binding fragment (Fab) into a single-chain Fab (scFab).
  • Fab two-chain antigen-binding fragment
  • scFab single-chain Fab
  • FIG. 12B depicts the Light-Heavy (LH) form, which consists of the human Ig kappa light chain signal peptide, the variable light, constant light, variable heavy, and constant heavy 1 domains of Ranibizumab linked by the flexible peptide.
  • Fig. 12C depicts the Heavy-Light (HL) form, which is similar except the signal peptide is derived from the human IgG heavy chain and the heavy and light domains are on opposite sides of the linker as compared to the LH form.
  • Fig. 12D depicts the Brolucizumab design, which includes variable light and variable heavy domains linked by a flexible peptide.
  • FIG. 12E depicts the sc-Ranibizumab LH-Fc design consists of the scFab LH form fused to the Fc region of human IgGl.
  • Fig. 12F depicts the Brolucizumab-Fc design, which consists of the Brolucizumab fused to the Fc region of human IgGl. Red stripes represent complementarity-determining regions (CDRs).
  • Genes were codon-optimized for improved expression from human cells and synthesized by GeneArt or GenScript and inserted into pAAV-CAG-SV40 pA vector between the CAG promoter and the SV40 polyA signal.
  • Figures 13A-B show the result of an ELISA to detect proteins that bind to VEGF.
  • Fig. 13A shows VEGF-binding activity was detected in media from HEK293T cells transfected with Aflibercept (SEQ ID NO:65) or single-chain (sc) Ranibizumab (SEQ ID NOs:67, 69, and 70) expression plasmids but not from those mock-transfected or transfected with a GFP expression vector.
  • Fig. 13A shows VEGF-binding activity was detected in media from HEK293T cells transfected with Aflibercept (SEQ ID NO:65) or single-chain (sc) Ranibizumab (SEQ ID NOs:67, 69, and 70) expression plasmids but not from those mock-transfected or transfected with a GFP expression vector.
  • Fig. 13A shows VEGF-binding activity was detected in media from HEK293T cells transfected with Af
  • FIG. 13B shows VEGF-binding activity was detected in media from HEK293T cells transfected with Aflibercept (SEQ ID NO:65), sc-Ranibizumab LH1 (SEQ ID NO:69), or Brolucizumab (SEQ ID NO:74) expression plasmids but not from those transfected with a GFP expression vector.
  • Aflibercept SEQ ID NO:65
  • sc-Ranibizumab LH1 SEQ ID NO:69
  • Brolucizumab SEQ ID NO:74
  • Figures 14A-B provide representative Western blots of media from HEK293T cells transfected with anti-VEGF constructs.
  • Fig. 14A shows Aflibercept (SEQ ID NO:65) or sc-Ranibizumab (SEQ ID NOs:67, 69, and 70) expression plasmids. Both the clinical Eylea and the Aflibercept sample are reduced to separate halves of the dimer, of apparent molecular mass of 58 kD (including glycosylation). The clinical Lucentis is reduced into separate light and heavy chains of 24 kD, whereas the sc-Ranibizumab proteins are not separated and migrate at approximately 48 kD.
  • FIG. 14B shows Aflibercept (SEQ ID NO:65), sc-Ranibizumab LH1 (SEQ ID NO:69), or Brolucizumab (SEQ ID NO:74) expression plasmids.
  • the signal with Brolucizumab is low, most likely due to poor recognition by the detection antibody.
  • the protein migrates at the correct molecular mass of 26 kD. There was no signal in any of the mock transfection or GFP negative control sample.
  • Figures 15A-B show the result of a competition ELISA to detect free VEGF after incubation with media from HEK293T cells transfected with anti- VEGF constructs.
  • Fig. 15A shows Aflibercept (SEQ ID NO:65) or sc-Ranibizumab (SEQ ID NOs:67, 69, and 70) expression plasmids.
  • the inhibition curves of the four anti-VEGF proteins from the transfected samples were very similar to the clinical comparator proteins Eylea and Lucentis.
  • Aflibercept and Eylea competed for VEGF more strongly than the sc-Ranibizumab variants and Lucentis. All three forms of sc- Ranibizumab were nearly identical.
  • Fig. 15B shows Aflibercept (SEQ ID NO: 65), sc- Ranibizumab LH1 (SEQ ID NO:69), or Brolucizumab (SEQ ID NO:74) expression plasmids. There was no competition activity from the GFP negative control sample. Error bars represent the standard deviation of duplicate transfection wells.
  • Figure 16 shows the result of a cellular VEGF neutralization assay.
  • the assay uses HEK293 cells expressing VEGF receptor/beta-galactosidase fusion proteins that produce active beta-galactosidase upon VEGF binding.
  • the cells are incubated with mixtures of VEGF and various dilutions of media from HEK293T cells transfected with Aflibercept (SEQ ID NO:65) or sc-Ranibizumab (SEQ ID NO:69) expression plasmids.
  • the inhibition curves of the anti-VEGF proteins from the transfected samples demonstrate that the anti-VEGF proteins neutralize VEGF activity at levels equal to the clinical comparator proteins. Error bars represent the standard deviation of duplicate assay wells.
  • Figures 17A-B shows the result of a cellular VEGF neutralization assay performed with equal volumes of media from HEK293T cells transfected with anti-VEGF plasmids.
  • Fig. 17A shows GFP, Aflibercept (SEQ ID NO:65), sc- Ranibizumab HL (SEQ ID NO:67), or sc-Ranibizumab LH1 (SEQ ID NO:69) expression plasmids. All anti-VEGF constructs evaluated neutralized VEGF.
  • Fig. 17A shows GFP, Aflibercept (SEQ ID NO:65), sc- Ranibizumab HL (SEQ ID NO:67), or sc-Ranibizumab LH1 (SEQ ID NO:69) expression plasmids. All anti-VEGF constructs evaluated neutralized VEGF.
  • Fig. 17A shows GFP, Aflibercept (SEQ ID NO:65), sc- Ranibizumab HL (
  • FIG. 17B shows GFP, Aflibercept (SEQ ID NO:65), sc-Ranibizumab LH1 (SEQ ID NO:69), and Brolucizumab (SEQ ID NO: 74) expression plasmids. All anti-VEGF constructs evaluated neutralized VEGF. There was a slight matrix effect from the GFP control sample at the dilutions assayed. Error bars represent the standard deviation of duplicate transfection wells.
  • Figure 18 shows the result of an ELISA to detect VEGF in media from RPE cells transfected with Aflibercept (SEQ ID NO:65) or sc-Ranibizumab (SEQ ID NOs:67, 69, and 70) expression plasmids.
  • Aflibercept SEQ ID NO:65
  • sc-Ranibizumab SEQ ID NOs:67, 69, and 70 expression plasmids.
  • a reduction in VEGF levels by both Aflibercept expression and sc-Ranibizumab expression was observed.
  • the effect on VEGF levels by all three sc-Ranibizumab forms was similar. Error bars represent the standard deviation of quadruplicate transfection wells.
  • Figure 19 shows the result of an ELISA to detect VEGF in media collected from RPE cells six or ten days after transduction with the R100 capsid (having the amino acid sequence set forth as SEQ ID NO:42) expressing Aflibercept (SEQ ID NO:65), sc-Ranibizumab (SEQ ID NOs:67 and 69), or Brolucizumab (SEQ ID NO:74) transgenes.
  • the endogenous level of VEGF as indicated by the cells transduced with a GFP control vector was 4,500 to 8,300 pg/ml.
  • Transduction with all of the anti-VEGF vectors resulted in undetectable levels of VEGF in the media. Error bars represent the standard deviation of quadruplicate transduction wells.
  • Figure 20 shows the result of an ELISA to detect proteins that bind to VEGF in media collected from RPE cells six or ten days after transduction with the R100 capsid (having the amino acid sequence set forth as SEQ ID NO:42) expressing anti-VEGF transgenes.
  • VEGF-binding activity was detected in media from cells transduced with Aflibercept (SEQ ID NO:65), sc-Ranibizumab (SEQ ID NOs:67 and 69), or Brolucizumab (SEQ ID NO:74) expression vectors but not from those transduced with a GFP expression vector.
  • the signal with Brolucizumab is very low, most likely due to poor recognition by the detection antibody. Error bars represent the standard deviation of quadruplicate transduction wells.
  • Figure 21 provides a representative Western blot of media collected from RPE cells six or ten days after transduction with the R100 capsid (having the amino acid sequence set forth as SEQ ID NO:42) expressing anti-VEGF transgenes.
  • R100 capsid having the amino acid sequence set forth as SEQ ID NO:42
  • SEQ ID NO: 65 Both the clinical Eylea and the Aflibercept (SEQ ID NO: 65) sample are reduced to separate halves of the dimer, of apparent molecular mass of 60 kD (including glycosylation), as indicated by the black arrow. There was no band of the correct mobility in the GFP negative control sample.
  • the clinical Lucentis is reduced into separate light and heavy chains of 24 kD, whereas sc-Ranibizumab HL and LH (SEQ ID NOs:67 and 69) are not separated and migrate at apparent molecular mass of 58 kD, as indicated by the gray arrow.
  • the signal with Brolucizumab (SEQ ID NO:74) is low, most likely due to poor recognition by the detection antibody.
  • the protein migrates at the correct molecular mass of 26 kD, as indicated by the stippled arrow.
  • Figure 22 shows the result of a competition ELISA to detect free VEGF after incubation with media collected from RPE cells six or ten days after transduction with the R100 capsid (having the amino acid sequence set forth as SEQ ID NO:42) expressing anti-VEGF transgenes. All anti-VEGF constructs competed for VEGF. There was no competition activity from the GFP negative control sample. Free VEGF levels are higher in the lowest dilutions due to the endogenous VEGF produced by the RPE cells. Error bars represent the standard deviation of duplicate assay wells.
  • Figure 23 shows the result of a cellular VEGF neutralization assay performed with media collected from RPE cells six days after transduction with the R100 capsid (having the amino acid sequence set forth as SEQ ID NO:42) expressing anti-VEGF transgenes. All anti-VEGF constructs evaluated neutralized VEGF. There was no VEGF neutralization observed with media from the GFP control transduction. Error bars represent the standard deviation of duplicate assay wells.
  • Adeno-associated virus is a nonpathogenic parvovirus composed of a 4.7 kb single-stranded DNA genome within a non-env eloped, icosahedral capsid.
  • the genome contains three open reading frames (ORF) flanked by inverted terminal repeats (ITR) that function as the viral origin of replication and packaging signal.
  • the rep ORF encodes four nonstructural proteins that play roles in viral replication, transcriptional regulation, site-specific integration, and virion assembly.
  • the cap ORF encodes three structural proteins (VP 1-3) that assemble to form a 60-mer viral capsid.
  • an ORF present as an alternate reading frame within the cap gene produces the assembly- activating protein (AAP), a viral protein that localizes AAV capsid proteins to the nucleolus and functions in the capsid assembly process.
  • AAP assembly- activating protein
  • wild-type serotypes There are several naturally occurring (“wild-type”) serotypes and over 100 known variants of AAV, each of which differs in amino acid sequence, particularly within the hypervariable regions of the capsid proteins, and thus in their gene delivery properties. No AAV has been associated with any human disease, making recombinant AAV attractive for clinical applications.
  • AAV adeno-associated virus
  • virus including, without limitation, the virus itself and derivatives thereof. Except where otherwise indicated, the terminology refers to all subtypes or serotypes and both replication-competent and recombinant forms.
  • AAV includes, without limitation, AAV type 1 (AAV-l or AAV1), AAV type 2 (AAV-2 or AAV2), AAV type 3 A (AAV-3A or AAV3A), AAV type 3B (AAV-3B or AAV3B), AAV type 4 (AAV-4 or AAV4), AAV type 5 (AAV- 5 or AAV5), AAV type 6 (AAV-6 or AAV6), AAV type 7 (AAV-7 or AAV7), AAV type 8 (AAV- 8 or AAV8), AAV type 9 (AAV-9 or AAV 9), AAV type 10 (AAV- 10 or AAV10 or AAVrhlO), avian AAV, bovine AAV, canine AAV, caprine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV.
  • Primary AAV refers to AAV that infect primates
  • non-primate AAV refers to AAV that infect non-prim
  • GenBank Accession Numbers NC_002077. l AAV1
  • AF063497.1 AAV1
  • NC_00l40l.2 AAV2
  • AF043303.1 AAV2
  • J01901.1 AAV2
  • U48704.1 AAV3A
  • AAV1 SEQ ID NO: l
  • AAV2 SEQ ID NO:2
  • AAV3A SEQ ID NO:3
  • AAV3B SEQ ID NO:4
  • AAV4 SEQ ID NO:5
  • AAV5 SEQ ID NO:6
  • AAV 7 SEQ ID NO:8
  • AAV 8 SEQ ID NO:9
  • AAV9 SEQ ID NO: 10
  • AAV 10 SEQ ID NO: 11
  • AAVrhlO SEQ ID NO: 12
  • variant AAV capsid protein refers to an AAV capsid protein comprising an amino acid sequence that includes at least one modification or substitution (including deletion, insertion, point mutation, etc.) relative to a naturally existing or“wild-type” AAV capsid protein sequence, e.g. as set forth in SEQ ID NO:l-l2 herein.
  • a variant AAV capsid protein may have about 80% identity or more to the amino acid sequence of a wild type capsid protein, for example, 85% identity or more, 90% identity or more, or 95% identity or more to the amino acid sequence of the wild type capsid protein, for example, 98% or 99% identity to the wild type capsid protein.
  • a variant AAV capsid protein may not be a wild type capsid protein.
  • AAV virion or “AAV viral particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated AAV polynucleotide.
  • rAAV recombinant adeno-associated virus
  • Recombinant as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature.
  • a recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.
  • rAAV vector encompasses rAAV virions (i.e., rAAV viral particles) (e.g., an infectious rAAV virion), which by definition include an rAAV polynucleotide; and also encompasses polynucleotides encoding rAAV (e.g., a single stranded polynucleotide encoding rAAV (ss-rAAV); a double stranded polynucleotide encoding rAAV (ds- rAAV), e.g., plasmids encoding rAAV; and the like).
  • rAAV virions i.e., rAAV viral particles
  • infectious rAAV virion infectious rAAV virion
  • an AAV virion comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome, e.g., a transgene to be delivered to a target cell, an RNAi agent or CRISPR agent to be delivered to a target cell, etc.), it is typically referred to as a "recombinant AAV (rAAV) virion" or an "rAAV viral particle.”
  • the heterologous polynucleotide is flanked by at least one, and generally by two, AAV inverted terminal repeat sequences (ITRs).
  • AAV rep and cap genes refer to polynucleotide sequences encoding replication and encapsidation proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes.”
  • helper virus refers to a virus that allows AAV (e.g. wild-type AAV) to be replicated and packaged by a mammalian cell.
  • a variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia.
  • the adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used.
  • Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC.
  • Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.
  • HSV herpes simplex viruses
  • EBV Epstein-Barr viruses
  • CMV cytomegaloviruses
  • PRV pseudorabies viruses
  • helper virus function(s) refers to function(s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein).
  • helper virus function may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function(s) to a producer cell in trans.
  • a plasmid or other expression vector comprising nucleotide sequences encoding one or more adenoviral proteins is transfected into a producer cell along with an rAAV vector.
  • infectious virus or viral particle is one that comprises a competently assembled viral capsid and is capable of delivering a polynucleotide component into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus.
  • Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art.
  • Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Methods of determining the ratio of infectious viral particle to total viral particle are known in the art. See, e.g., Grainger et al. (2005) Mol. Ther. 11 : S337 (describing a TCID50 infectious titer assay); and Zolotukhin et al. (1999) Gene Ther. 6:973. See also the Examples.
  • tropism refers to the preferential targeting by a virus (e.g., an AAV) of cells of a particular host species or of particular cell types within a host species.
  • a virus e.g., an AAV
  • a virus that can infect cells of the heart, lung, liver, and muscle has a broader (i.e., increased) tropism relative to a virus that can infect only lung and muscle cells.
  • Tropism can also include the dependence of a virus on particular types of cell surface molecules of the host. For example, some viruses can infect only cells with surface glycosaminoglycans, while other viruses can infect only cells with sialic acid (such dependencies can be tested using various cells lines deficient in particular classes of molecules as potential host cells for viral infection).
  • the tropism of a virus describes the virus's relative preferences. For example, a first virus may be able to infect all cell types but is much more successful in infecting those cells with surface glycosaminoglycans.
  • a second virus can be considered to have a similar (or identical) tropism as the first virus if the second virus also prefers the same characteristics (e.g., the second virus is also more successful in infecting those cells with surface glycosaminoglycans), even if the absolute transduction efficiencies are not similar.
  • the second virus might be more efficient than the first virus at infecting every given cell type tested, but if the relative preferences are similar (or identical), the second virus can still be considered to have a similar (or identical) tropism as the first virus.
  • the tropism of a virion comprising a subject variant AAV capsid protein is not altered relative to a naturally occurring virion.
  • the tropism of a virion comprising a subject variant AAV capsid protein is expanded (i.e., broadened) relative to a naturally occurring virion.
  • the tropism of a virion comprising a subject variant AAV capsid protein is reduced relative to a naturally occurring virion.
  • replication-competent virus e.g. a replication- competent AAV
  • replication competence generally requires the presence of functional AAV packaging genes.
  • rAAV vectors as described herein are replication-incompetent in mammalian cells (especially in human cells) by virtue of the lack of one or more AAV packaging genes.
  • rAAV vector preparations as described herein are those which contain few if any replication competent AAV (rcAAV, also referred to as RCA) (e.g., less than about 1 rcAAV per 10 2 rAAV particles, less than about 1 rcAAV per 10 4 rAAV particles, less than about 1 rcAAV per 10 rAAV particles, less than about 1 rcAAV per 10 12 rAAV particles, or no rcAAV).
  • rcAAV also referred to as RCA
  • polynucleotide refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • polynucleotide refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment herein that comprises a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double- stranded form.
  • a polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at ncbi.nlm.nih.gov/BLAST/. Another alignment algorithm is FASTA, available in the Genetics Computing Group (GCG) package, from Madison, Wisconsin, USA, a wholly owned subsidiary of Oxford Molecular Group, Inc.
  • GCG Genetics Computing Group
  • RNA refers to a polynucleotide that performs a function of some kind in the cell.
  • a gene can contain an open reading frame that is capable of encoding a gene product.
  • a gene product is a protein, which is transcribed and translated from the gene.
  • RNA e.g. a functional RNA product, e.g., an aptamer, an interfering RNA, a ribosomal RNA (rRNA), a transfer RNA (tRNA), a non-coding RNA (ncRNA), a guide RNA for nucleases, etc., which is transcribed but not translated.
  • Gene expression product or “gene product” is a molecule resulting from expression of a particular gene, as defined above.
  • Gene expression products include, e.g., a polypeptide, an aptamer, an interfering RNA, a messenger RNA (mRNA), an rRNA, a tRNA, a non-coding RNA (ncRNA), and the like.
  • siRNA agent small interfering or “short interfering RNA” (or siRNA) is an RNA duplex of nucleotides that is targeted to a gene interest (a "target gene”).
  • An “RNA duplex” refers to the structure formed by the complementary pairing between two regions of a RNA molecule, forming a region of double stranded RNA (dsRNA).
  • siRNA is "targeted” to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to a nucleotide sequence of the targeted gene.
  • the length of the duplex of siRNAs is less than 30 nucleotides.
  • the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length.
  • siRNA-mediated gene targeting is accomplished through the use of DNA-directed RNA interference (ddRNAi) which is a gene silencing technique that utilizes DNA constructs to activate an animal cell’s endogenous RNA interference (RNAi) pathways.
  • ddRNAi DNA-directed RNA interference
  • RNAi endogenous RNA interference
  • DNA constructs are designed to express self complementary double-stranded RNAs, typically short-hairpin RNAs (shRNA), that once processed bring about silencing of a target gene or genes.
  • RNA duplex portion of an siRNA agent can be part of a short hairpin structure referred to as shRNA.
  • the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex.
  • the loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length.
  • the hairpin structure can also contain 3' or 5' overhang portions. In some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.
  • the level of expression product (e.g., mRNA, polypeptide, etc.) of a target gene is reduced by an siRNA agent (e.g., an siRNA, an shRNA, etc.) that contains specific double stranded nucleotide sequences that are complementary to at least a 19-25 nucleotide long segment (e.g., a 20-21 nucleotide sequence) of the target gene transcript, including the 5' untranslated (UT) region, the ORF, or the 3' UT region.
  • siRNA agent e.g., an siRNA, an shRNA, etc.
  • short interfering RNAs are about l9-25nt in length.
  • siRNA and/or shRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter.
  • the nucleic acid sequence can also include a polyadenylation signal.
  • the polyadenylation signal is a synthetic minimal polyadenylation signal.
  • antisense RNA encompasses RNA that is complementary to a gene expression product.
  • an antisense RNA targeted to a specific mRNA is an RNA-based agent (or can be a modified RNA) that is complementary to the mRNA, where hybridization of the antisense RNA to the mRNA alters the expression of the mRNA (e.g., via altering the stability of the RNA, altering the translation of the RNA, etc.).
  • RNA-based agent or can be a modified RNA
  • nucleic acids encoding an antisense RNA.
  • CRISPR encompasses Clustered regularly interspaced short palindromic repeats/CRISPR- associated (Cas) systems that evolved to provide bacteria and archaea with adaptive immunity against viruses and plasmids by using CRISPR RNAs (crRNAs) to guide the silencing of invading nucleic acids.
  • the Cas9 protein (or functional equivalent and/or variant thereof, i.e., Cas9-like protein) naturally contains DNA endonuclease activity that depends on association of the protein with two naturally occurring or synthetic RNA molecules called crRNA and tracrRNA (also called guide RNAs).
  • the two molecules are covalently linked to form a single molecule (also called a single guide RNA (“sgRNA”)).
  • a single molecule also called a single guide RNA (“sgRNA”).
  • the Cas9 or Cas9-like protein associates with a DNA-targeting RNA (which term encompasses both the two-molecule guide RNA configuration and the single-molecule guide RNA configuration), which activates the Cas9 or Cas9-like protein and guides the protein to a target nucleic acid sequence.
  • the Cas9 or Cas9-like protein retains its natural enzymatic function, it will cleave target DNA to create a double-strand break, which can lead to genome alteration (i.e., editing: deletion, insertion (when a donor polynucleotide is present), replacement, etc.), thereby altering gene expression.
  • Some variants of Cas9 (which variants are encompassed by the term Cas9-like) have been altered such that they have a decreased DNA cleaving activity (in some cases, they cleave a single strand instead of both strands of the target DNA, while in other cases, they have severely reduced to no DNA cleavage activity).
  • Cas9-like proteins with decreased DNA- cleavage activity can still be guided to a target DNA to block RNA polymerase activity.
  • the Cas9 or Cas9-like protein may be modified by fusing a VP64 transcription activation domain to the Cas9 protein and codelivering the fusion protein with a MS2-P65-HSF1 helper protein and a single guide RNA comprising MS2 RNA aptamers at the tetraloop and stem-loop to form a Synergistic Activation Mediator (Cas9-SAM) complex in the cell that activates transcription.
  • Cas9-SAM Synergistic Activation Mediator
  • CRISPR/Cas9 agents encompasses all forms of CRISPR/Cas9 as described above or as known in the art.
  • CRISPR agents can be found, for example in (a) Jinek et. al, Science. 2012 Aug 17;337(6096):816-21 : "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity"; (b) Qi et al, Cell.
  • CRISPR agent encompasses any agent (or nucleic acid encoding such an agent), comprising naturally occurring and/or synthetic sequences, that can be used in the Cas9-based system (e.g., a Cas9 or Cas9-like protein; any component of a DNA- targeting RNA, e.g., a crRNA-like RNA, a tracrRNA-like RNA, a single guide RNA, etc.; a donor polynucleotide; and the like).
  • a Cas9 or Cas9-like protein e.g., a Cas9 or Cas9-like protein
  • any component of a DNA- targeting RNA e.g., a crRNA-like RNA, a tracrRNA-like RNA, a single guide RNA, etc.
  • a donor polynucleotide e.g., a donor polynucleotide, and the like.
  • ZFNs Zinc-finger nucleases
  • ZFNs artificial DNA endonucleases generated by fusing a zinc finger DNA binding domain to a DNA cleavage domain.
  • ZFNs can be engineered to target desired DNA sequences and this enables zinc-finger nucleases to cleave unique target sequences.
  • ZFNs can be used to edit target DNA in the cell (e.g., the cell's genome) by inducing double strand breaks.
  • ZFN agent encompasses a zinc finger nuclease and/or a polynucleotide comprising a nucleotide sequence encoding a zinc finger nuclease.
  • Transcription activator-like effector nuclease or “TALEN” agents refers to Transcription activator-like effector nucleases (TALENs) are artificial DNA endonucleases generated by fusing a TAL (Transcription activator like) effector DNA binding domain to a DNA cleavage domain.
  • TALENS can be quickly engineered to bind practically any desired DNA sequence and when introduced into a cell, TALENs can be used to edit target DNA in the cell (e.g., the cell's genome) by inducing double strand breaks.
  • TALENs Transcription activator-like effector nucleases
  • TALEN agent encompasses a TALEN and/or a polynucleotide comprising a nucleotide sequence encoding a TALEN.
  • control element refers to a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide.
  • the regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature.
  • Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers.
  • a promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter. Promoters may be ubiquitously acting, i.e. active in many cell types, e.g. CAG or CMV promoters; or tissue or cell specific, e.g. the rho promoter, which is active in rods, or the opsin promoter, which is active in cones.
  • operatively linked refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner.
  • a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.
  • expression vector encompasses a vector comprising a polynucleotide region which encodes a polypeptide of interest, and is used for effecting the expression of the protein in an intended target cell.
  • An expression vector may also comprise control elements operatively linked to the encoding region to facilitate expression of the protein in the target.
  • control elements and a gene or genes to which they are operably linked for expression is sometimes referred to as an "expression cassette," a large number of which are known and available in the art or can be readily constructed from components that are available in the art.
  • heterologous means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared.
  • a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide.
  • a promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter.
  • an rAAV that includes a heterologous nucleic acid sequence encoding a heterologous gene product is an rAAV that includes a polynucleotide not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild type AAV.
  • genetic alteration and “genetic modification” (and grammatical variants thereof), are used interchangeably herein to refer to a process wherein a genetic element (e.g., a polynucleotide) is introduced into a cell other than by mitosis or meiosis.
  • a genetic element e.g., a polynucleotide
  • the element may be heterologous to the cell, or it may be an additional copy or improved version of an element already present in the cell.
  • Genetic alteration may be effected, for example, by transfecting a cell with a recombinant plasmid or other polynucleotide through any process known in the art, such as electroporation, calcium phosphate precipitation, or contacting with a polynucleotide-liposome complex. Genetic alteration may also be effected, for example, by transduction or infection with a DNA or RNA virus or viral vector. Generally, the genetic element is introduced into a chromosome or mini-chromosome in the cell; but any alteration that changes the phenotype and/or genotype of the cell and its progeny is included in this term.
  • the terminology “genetically modified” or “transformed” or “transfected” or“transduced” by exogenous DNA refers to when such DNA has been introduced inside the cell.
  • the presence of the exogenous DNA results in permanent or transient genetic change.
  • the transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
  • a “clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • a cell is said to be “stably” altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro and/or for an extended period of time in vivo.
  • a cell is “heritably” altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell.
  • polypeptide refers to polymers of amino acids of any length.
  • the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component.
  • Polypeptides such as anti-angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a gene product to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein.
  • references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a gene product to a mammalian subject include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.
  • an "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, protein, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from.
  • an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this disclosure are increasingly more isolated.
  • An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.
  • treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.
  • Treatment covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease (and/or symptoms caused by the disease) from occurring in a subject which may be predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease (and/or symptoms caused by the disease), i.e., arresting its development; and (c) relieving the disease (and/or symptoms caused by the disease), i.e., causing regression of the disease (and/or symptoms caused by the disease), i.e., ameliorating the disease and/or one or more symptoms of the disease.
  • the subject compositions and methods may be directed towards the treatment of retinal disease.
  • Nonlimiting methods for assessing retinal diseases and the treatment thereof include measuring retinal function and changes thereof, e.g. changes in visual acuity (e.g. best-corrected visual acuity [BCVA], ambulation, navigation, object detection and discrimination), changes in visual field (e.g. static and kinetic visual field perimetry), clinical examination (e.g. slit lamp examination of the anterior and posterior segments of the eye), electrophysiological responsiveness to all wavelengths of light and dark (e.g.
  • visual acuity e.g. best-corrected visual acuity [BCVA], ambulation, navigation, object detection and discrimination
  • changes in visual field e.g. static and kinetic visual field perimetry
  • clinical examination e.g. slit lamp examination of the anterior and posterior segments of the eye
  • electrophysiological responsiveness to all wavelengths of light and dark e.g.
  • ERG electroretinography
  • VEP visual evoked potential
  • EOG electrooculography
  • color vision dark adaptation and/or contrast sensitivity
  • OCT Optical Conherence Tomography
  • OCT fundus photography
  • adaptive optics scanning laser ophthalmoscopy fluorescence and/or autofluorescence
  • measuring ocular motility and eye movements e.g.
  • nystagmus fixation preference, and stability
  • measuring reported outcomes patient-reported changes in visual and non-visually-guided behaviors and activities, patient-reported outcomes [PRO], questionnaire-based assessments of quality-of-life, daily activities and measures of neurological function (e.g. functional Magnetic Resonance Imaging (MRI)).
  • MRI Magnetic Resonance Imaging
  • the terms "individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, humans; non-human primates, including simians; mammalian sport animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).
  • the individual is a human who has previously been naturally exposed to AAV and as a result harbors anti-AAV antibodies (i.e., AAV neutralizing antibodies).
  • the individual is a human who has previously been administered an AAV vector (and as a result may harbor anti-AAV antibodies) and needs re-administration of vector for treatment of a different condition or for further treatment of the same condition. Based on positive results in clinical trials involving AAV gene delivery to, for example, liver, muscle, and retina - all tissues affected by neutralizing antibodies against this vehicle - there are many such therapeutic applications/disease targets.
  • an effective amount is an amount sufficient to effect beneficial or desired clinical results.
  • An effective amount can be administered in one or more administrations.
  • an effective amount of a compound e.g., an infectious rAAV virion
  • an effective amount of an infectious rAAV virion is an amount that is sufficient to palliate, ameliorate, stabilize, reverse, prevent, slow or delay the progression of (and/or symptoms associated with) a particular disease state (e.g., a retinal disease).
  • an effective amount of an infectious rAAV virion is an amount of the infectious rAAV virion that is able to effectively deliver a heterologous nucleic acid to a target cell (or target cells) of the individual.
  • Effective amounts may be determined preclinically by, e.g., detecting in the cell or tissue the gene product (RNA, protein) that is encoded by the heterologous nucleic acid sequence using techniques that are well understood in the art, e.g. RT-PCR, western blotting, ELISA, fluorescence or other reporter readouts, and the like. Effective amounts may be determined clinically by, e.g. detecting a change in the onset or progression of disease using methods known in the art, e.g. fundus autofluorescence, fluorescein angiography, OCT, microperimetry, adaptive optics, etc. and the like, as described herein and as known in the art.
  • retinal cell refers herein to any of the cell types that comprise the retina, such as, without limitation, retinal ganglion (RG) cells, amacrine cells, horizontal cells, bipolar cells, photoreceptor cells, Miiller glial cells, microglial cells, and retinal pigmented epithelium (RPE).
  • RG retinal ganglion
  • photoreceptor cells refers herein to, without limitation, rod cells or“rods” and cone cells or“cones”.
  • the terminology“Miiller cells” or“Miiller glia” refers to glial cells that support neurons in the vertebrate retina.
  • directed evolution refers to a capsid engineering methodology, in vitro and/or in vivo, which emulates natural evolution through iterative rounds of genetic diversification and selection processes, thereby accumulating beneficial mutations that progressively improve the function of a biomolecule.
  • Directed evolution often involves an in vivo method referred to as “biopanning” for selection of AAV variants from a library which variants possess a more efficient level of infectivity of a cell or tissue type of interest.
  • Adeno-associated viruses are a family of parvoviruses with a 4.7 kb single-stranded DNA genome contained inside a non-enveloped capsid.
  • the viral genome of a naturally occurring AAV has 2 inverted terminal repeats (ITR) - which function as the viral origin of replication and packaging signal - flanking 2 primary open reading frames (ORF): rep (encoding proteins that function in viral replication, transcriptional regulation, site-specific integration, and virion assembly) and cap.
  • ITR inverted terminal repeats
  • ORF primary open reading frames
  • rep encoding proteins that function in viral replication, transcriptional regulation, site-specific integration, and virion assembly
  • the cap ORF codes for 3 structural proteins that assemble to form a 60-mer viral capsid.
  • Many naturally occurring AAV variants and serotypes have been isolated, and none have been associated with human disease.
  • Recombinant versions of AAV can be used as gene delivery vectors, where a marker or therapeutic gene of interest is inserted between the ITRs in place of rep and cap. These vectors have been shown to transduce both dividing and non-dividing cells in vitro and in vivo and can result in stable transgene expression for years in post-mitotic tissue. See e.g., Knipe DM, Howley PM. Fields’ Virology. Lippincott Williams & Wilkins, Philadelphia, PA, USA, 2007; Gao G-P, Alvira MR, Wang L, Calcedo R, Johnston J, Wilson JM. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy.
  • AAV Recombinant AAV
  • AAV Recombinant AAV
  • wild-type AAV cap genes are diversified by several approaches to create large genetic libraries that are packaged to generate libraries of viral particles, and selective pressure is then applied to isolate novel variants that can overcome gene delivery barriers.
  • the mechanistic basis underlying a gene delivery problem does not need to be known for directed evolution of function, which can thus accelerate the development of enhanced vectors.
  • the variants disclosed herein were generated through use of an AAV library and/or libraries.
  • Such an AAV library or libraries is/are generated by mutating the cap gene, the gene which encodes the structural proteins of the AAV capsid, by a range of directed evolution techniques known by and readily available to the skilled artisan in the field of viral genome engineering. See e.g., Bartel et al. Am. Soc. Gene Cell Ther. l5 th Annu. Meet. 20, S140 (2012); Bowles, D. et al. J. Virol. 77, 423-432 (2003); Gray et al. Mol. Ther. 18, 570-578 (2010); Grimm, D. et al. J. Virol.
  • Such techniques are as follows: i) Error-prone PCR to introduce random point mutations into the AAV cap open reading frame (ORF) at a predetermined, modifiable rate; ii) In vitro or in vivo viral recombination or“DNA shuffling” to generate random chimeras of AAV cap genes to yield a gene library with multiple AAV serotypes; iii) Random peptide insertions at defined sites of the capsid by ligation of degenerate oligonucleotides in the cap ORF; iv) Defined insertions of peptide-encoding sequences into random locations of the AAV cap ORF using transposon mutagenesis; v) Replacing surface loops of AAV capsids with libraries of peptide sequences bioinformationally designed based on the level of conservation of each amino acid position among natural AAV serotypes and variants to generate“loop-swap” libraries; vi) Random amino acid substitution at positions
  • DNA shuffling generates chimeras which combine their parental properties in unique and, often beneficial, ways; however, some may be incapable of packaging which, in effect, reduces the diversity of the library.
  • Diversity concentration of the library is achieved through peptide insertion techniques such as, without limitation, iii-iv) above.
  • Diversity of the library is also concentrated in techniques such as v) above, and such concentration is directed onto multiple hypervariable regions, which he on surface exposed loops, of the AAV capsid. While many of the techniques generate variant capsids with only a small area of the capsid mutated, these techniques can be paired with additional mutagenesis strategies to modify the full capsid.
  • viruses are then packaged, such that each AAV particle is comprised of a mutant capsid surrounding a cap gene encoding that capsid, and purified.
  • Variants of the library are then subjected to in vitro and/or in vivo selective pressure techniques known by and readily available to the skilled artisan in the field of AAV. See e.g., Maheshri, N. et al. Nature Biotech. 24, 198-204 (2006); Dalkara, D. et al. Sci. Transl. Med. 5, l89ra76 (2013); Lisowski, L. et al. Nature. 506, 382-286 (2013); Yang, L. et al. PNAS.
  • AAV variants can be selected using i) affinity columns in which elution of different fractions yields variants with altered binding properties; ii) primary cells - isolated from tissue samples or immortal cell lines that mimic the behavior of cells in the human body - which yield AAV variants with increased efficiency and/or tissue specificity; iii) animal models - which mimic a clinical gene therapy environment - which yield AAV variants that have successfully infected target tissue; iv) human xenograft models which yield AAV variants that have infected grafted human cells; and/or a combination of selection techniques thereof.
  • viruses may be recovered by known techniques such as, without limitation, adenovirus-mediated replication, PCR amplification, Next Generation sequencing and cloning, and the like. Virus clones are then enriched through repeated rounds of the selection techniques and AAV DNA is isolated to recover selected variant cap genes of interest. Such selected variants can be subjected to further modification or mutation and as such serve as a new starting point for further selection steps to iteratively increase AAV viral fitness. However, in certain instances, successful capsids have been generated without additional mutation.
  • the AAV variants disclosed herein were generated at least in part through the use of in vivo directed evolution methodology, such as the techniques described above, involving the use of primate retinal screens following intravitreal administration.
  • the AAV variant capsids disclosed herein comprise one or more modifications in amino acid sequence that confer more efficient transduction of primate retinal cells than a corresponding parental AAV capsid protein.
  • a“corresponding parental AAV capsid protein” refers to an AAV capsid protein of the same wild-type or variant AAV serotype as the subject variant AAV capsid protein but that does not comprise the one or more amino acid sequence modifications of the subject variant AAV capsid protein.
  • the subject variant AAV capsid protein comprises a heterologous peptide of from about 5 amino acids to about 20 amino acids inserted by covalent linkage into an AAV capsid protein GH loop, or loop IV, relative to a corresponding parental AAV capsid protein.
  • the“GH loop,” or loop IV, of the AAV capsid protein it is meant the solvent-accessible portion referred to in the art as the GH loop, or loop IV, of AAV capsid protein.
  • the GH loop/loop IV of AAV capsid see, e.g., van Vliet et al. (2006) Mol. Ther. 14:809; Padron et al. (2005) J Virol.
  • the insertion site can be within about amino acids 411-650 of an AAV VP1 capsid protein.
  • the insertion site can be within amino acids 571-612 of AAV1 VP1, amino acids 570-611 of AAV2 VP1, within amino acids 571-612 of AAV3A VP1, within amino acids 571-612 of AAV3B VP1, within amino acids 569- 610 of AAV4 VP1, within amino acids 560-601 of AAV5 VP1, within amino acids 571 to 612 of AAV6 VP1, within amino acids 572 to 613 of AAV7 VP1, within amino acids 573 to 614 of AAV8 VP1, within amino acids 571 to 612 of AAV9 VP1, or within amino acids 573 to 614 of AAV10 VP1, or the corresponding amino acids of any variant thereof.
  • the insertion site is a single insertion site between two adjacent amino acids located between amino acids 570-614 of VP1 of any wild-type AAV serotype or AAV variant, e.g., the insertion site is between two adjacent amino acids located in amino acids 570-610, amino acids 580-600, amino acids 570-575, amino acids 575-580, amino acids 580-585, amino acids 585-590, amino acids 590-600, or amino acids 600-614, of VP1 of any AAV serotype or variant.
  • the insertion site can be between amino acids 580 and 581, amino acids 581 and 582, amino acids 583 and 584, amino acids 584 and 585, amino acids 585 and 586, amino acids 586 and 587, amino acids 587 and 588, amino acids
  • the insertion site can be between amino acids 575 and 576, amino acids 576 and 577, amino acids 577 and 578, amino acids 578 and 579, or amino acids 579 and 580.
  • the insertion site can be between amino acids 590 and 591, amino acids 591 and 592, amino acids 592 and 593, amino acids 593 and 594, amino acids 594 and 595, amino acids 595 and 596, amino acids 596 and 597, amino acids 597 and 598, amino acids 598 and 599, or amino acids 599 and 600.
  • the insertion site can be between amino acids 587 and 588 of AAV2, between amino acids 590 and 591 of AAV1, between amino acids 588 and
  • AAV3A between amino acids 588 and 589 of AAV3A, between amino acids 588 and 589 of AAV3B, between amino acids 584 and 585 of AAV4, between amino acids 575 and 576 of AAV5, between amino acids 590 and 591 of AAV6, between amino acids 589 and 590 of AAV7, between amino acids 590 and 591 of AAV8, between amino acids 588 and 589 of AAV9, or between amino acids 588 and 589 of AAV10.
  • a peptide insertion disclosed herein has a length of 5 amino acids, 6 amino acids, 7 amino acids, 8 amino acids, 9 amino acids, 10 amino acids, 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 16 amino acids, 17 amino acids, 18 amino acids, 19 amino acids, or 20 amino acids.
  • a peptide insertion disclosed herein comprises from 1 to 4 spacer amino acids at the amino terminus (N-terminus) and/or at the carboxyl terminus (C-terminus) of any one of the peptide insertions disclosed herein.
  • spacer amino acids include, without limitation, leucine (L), alanine (A), glycine (G), serine (S), threonine (T), and proline (P).
  • a peptide insertion comprises 2 spacer amino acids at the N-terminus and 2 spacer amino acids at the C-terminus. In other embodiments, a peptide insertion comprises 2 spacer amino acids at the N-terminus and 1 spacer amino acids at the C-terminus.
  • the peptide insertions disclosed herein have not been previously described and/or inserted into an AAV capsid. Without wishing to be bound by theory, the presence of any of the disclosed peptide insertions may act to lower the variant capsid’s affinity for heparin sulfate which likely reduces binding to the extracellular matrix in the front of the primate retina. In addition, the peptide insertion motifs disclosed herein may confer enhanced transduction of primate retinal cells through the addition of a cell surface receptor binding domain.
  • the insertion peptide comprises an amino acid sequence of any one of the formulas below.
  • an insertion peptide can be a peptide of 7 to 10 amino acids in length, of Formula la:
  • each of Y 1 -Y 3 is independently selected from Ala, Leu, Gly, Ser, Thr, Pro
  • Xi is selected from Gln, Asn, His, Ile, and Ala
  • X 2 is selected from Ala, Gln, Asp, Ser, Lys, and Pro
  • X 3 is selected from Asp, Ile, Thr and Asn
  • X 4 is selected from Thr, Ser, Tyr, Gln, Glu, and Ala
  • X 5 is selected from Thr, Lys, and Asn X is selected from Lys, Asn, and Glu
  • X 7 is selected from Asn, Thr, Ile, His, Asp, and Ala.
  • the insertion peptide of Formula la comprises an amino acid sequence selected from QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ NO: 16), HDITKNI (SEQ ID NO: 17), HPDTTKN (SEQ ID NO: 18), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), and QANANEN (SEQ ID NO: 22).
  • an insertion peptide can be a peptide of 7 to 10 amino a acids in length, of Formula lb:
  • each of Y 1 -Y 3 is independently selected from Ala
  • Xi is selected from Gln, Asn, His, and Ile
  • X 2 is selected from Ala, Gln, Asp, and Ser
  • X 3 is selected from Asp and Ile
  • X 4 is selected from Thr, Tyr, and Gln
  • X 5 is selected from Thr and Lys
  • X 6 is selected from Lys and Asn
  • X 7 is selected from Asn, Thr, Ile, and His
  • the insertion peptide of Formula lb comprises an amino acid sequence selected from QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: l4), NQDYTKT (SEQ NO: l6), HDITKNI (SEQ ID NOT7), and HQDTTKN (SEQ ID NO: 19).
  • an insertion peptide can be a peptide of 7 to 10 amino acids in length, of Formula lc
  • each of Y 1 -Y 3 is independently selected from Ala
  • Xi is selected from Gln, Asn, His, and Ile
  • X 2 is selected from Ala, Gln, and Ser
  • X 3 is selected from Thr, Tyr, and Gln
  • X 4 is selected from Asn, Thr, and His [00117]
  • the insertion peptide of Formula lc comprises an amino acid sequence selected from QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), NQDYTKT (SEQ NO: 16), and HQDTTKN (SEQ ID NO: 19).
  • an insertion peptide can be a peptide of 7 to 10 amino acids in length, of Formula ld:
  • each of Y 1 -Y 3 is independently selected from Ala
  • Xi is selected from Gln and Ile
  • X 2 is selected from Ala and Ser
  • X 3 is selected from Thr and Gln
  • X 4 is selected from Asn and His
  • the insertion peptide of Formula ld comprises an amino acid sequence selected from QADTTKN (SEQ ID NO: 13) and ISDQTKH (SEQ ID NO: 14).
  • an insertion peptide can be a peptide of 7 to 11 amino acids in length, of Formula Ie
  • each of Y 1 -Y 3 is independently selected from Ala
  • Xi is selected from Gln and Ile
  • X 2 is selected from Ala and Ser
  • X 3 is selected from Glu and Ala
  • X 4 is selected from Asn and His
  • an insertion peptide of Formula le comprises an amino acid sequence selected from ISNENEH (SEQ ID NO:2l), and QANANEN (SEQ ID NO: 22).
  • an insertion peptide can be a peptide of 7 to 11 amino acids in length, of Formula Ila:
  • each of Y 1 -Y 3 is independently selected from Ala,
  • Xi is selected from Q, N, A, H, and I;
  • X 2 is selected from Q, A, P, and S;
  • X 3 is selected from T, Y, S, and Q;
  • X 4 is selected from T, N, A, and H.
  • the peptide insertion is selected from the group consisting of QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA, NQDYTKT (SEQ NO: 16), HQDTTKN (SEQ ID NO: 19), and HPDTTKN (SEQ ID NO: 18).
  • an insertion peptide can be a peptide of 7 to 11 amino acids in length, of Formula lib:
  • each of Y 1 -Y 3 is independently selected from Ala, Leu, Gly, Ser, Thr, Pro
  • Xi is selected from N, A, and H;
  • X 2 is selected from Q, P, and S;
  • X 3 is selected from T, Y, and S;
  • X 4 is selected from T, N, and A.
  • the peptide insertion is selected from the group consisting of ASDSTKA, NQDYTKT (SEQ NO: 16), HQDTTKN (SEQ ID NO: 19), and HPDTTKN (SEQ ID NO: 18).
  • the insertion peptide comprises an amino acid sequence selected from KDRAPST (SEQ ID NO:26), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25) and GKSKVID (SEQ ID NO:23).
  • the insertion peptide comprises an amino acid sequence selected from ASDSTKA (SEQ ID NO: 15), QANANEN (SEQ ID NO:22), QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), NQDYTKT (SEQ ID NO: l6), HDITKNI (SEQ ID NO: l7), HPDTTKN (SEQ ID NOT8), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), GKSKVID (SEQ ID NO:23), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25) and KDRAPST (SEQ ID NO:26).
  • ASDSTKA SEQ ID NO: 15
  • QANANEN SEQ ID NO:22
  • QADTTKN SEQ ID NO: 13
  • ISDQTKH SEQ ID NO: 14
  • NQDYTKT SEQ ID NO:
  • the insertion peptide has from 1 to 3 spacer amino acids (Y 1 -Y 3 ) at the amino and/or carboxyl terminus of an amino acid sequence selected from QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITKNI (SEQ ID NO: 17), HPDTTKN (SEQ ID NO: 18), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), QANANEN (SEQ ID NO:22), GKSKVID (SEQ ID NO:23), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25) and KDRAPST (SEQ ID NO:26).
  • the insertion peptide is selected from the group consisting of: LAQADTTKNA (SEQ ID NO: 13), ISDQTKH (
  • LAASDSTKAA (SEQ ID NO:30), LANQDYTKTA (SEQ ID NO:3l),
  • LAHDITKNIA SEQ ID NO:32
  • LAHPDTTKNA SEQ ID NO:33
  • LAHQDTTKNA (SEQ ID NO: 34), LANKTTNKDA (SEQ ID NO: 35),
  • LPISNENEHA (SEQ ID NO:36), LPQANANENA (SEQ ID NO:37),
  • LAGKSKVIDA SEQ ID NO:38
  • LATNRTSPDA SEQ ID NO:39
  • LAPNSTHGSA SEQ ID NO:40
  • LAKDRAPSTA SEQ ID NO:4l
  • the subject variant AAV capsid protein does not include any other amino acid sequence modifications other than a peptide insertion of from about 5 amino acids to about 20 amino acids in the GH loop, or loop
  • the subject variant AAV capsid protein comprises a peptide insertion comprising an amino acid sequence selected from the group consisting of QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITKNI (SEQ ID NO: 17), HPDTTKN (SEQ ID NO: 18), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), QANANEN (SEQ ID NO:22), GKSKVID (SEQ ID NO:23), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25), KDRAPST (SEQ ID NO:26), LAQADTTKNA (SEQ ID NO:27), LAISDQTKHA (SEQ ID NO:28), LGISDQTKHA (SEQ ID NO:29
  • LAASDSTKAA (SEQ ID NO:30), LANQDYTKTA (SEQ ID NO:3l),
  • LAHDITKNIA SEQ ID NO:32
  • LAHPDTTKNA SEQ ID NO:33
  • LAHQDTTKNA (SEQ ID NO: 34), LANKTTNKDA (SEQ ID NO: 35),
  • LPISNENEHA (SEQ ID NO:36), LPQANANENA (SEQ ID NO:37),
  • LAGKSKVIDA SEQ ID NO:38
  • LATNRTSPDA SEQ ID NO:39
  • the variant AAV capsid does not include any other amino acid substitutions, insertions, or deletions (i.e., the variant AAV capsid protein comprises said insertion and is otherwise identical to the corresponding AAV capsid protein). Put another way, the variant AAV capsid protein comprising said insertion is otherwise identical to the parental AAV capsid protein into which the peptide has been inserted.
  • the subject variant AAV capsid protein comprises a peptide insertion having an amino acid sequence selected from QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITKNI (SEQ ID NO: 17), HPDTTKN (SEQ ID NO: 18), HQDTTKN (SEQ ID NO: 19), NKTTNKD (SEQ ID NO:20), ISNENEH (SEQ ID NO:2l), QANANEN (SEQ ID NO:22), GKSKVID (SEQ ID NO:23), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25), KDRAPST (SEQ ID NO:26), LAQADTTKNA (SEQ ID NO:27), LAISDQTKHA (SEQ ID NO:28), LGISDQTKHA (SEQ ID NO:29), LAASDSTKAA (SEQ ID NO:
  • LAHDITKNIA SEQ ID NO:32
  • LAHPDTTKNA SEQ ID NO:33
  • LAHQDTTKNA (SEQ ID NO: 34), LANKTTNKDA (SEQ ID NO: 35),
  • LPISNENEHA (SEQ ID NO:36), LPQANANENA (SEQ ID NO:37),
  • LAGKSKVIDA SEQ ID NO:38
  • LATNRTSPDA SEQ ID NO:39
  • LAPNSTHGSA SEQ ID NO:40
  • LAKDRAPSTA SEQ ID NO:4l
  • the peptide insertion is located between amino acids 587 and 588 of the VP1 of the AAV2 capsid or the corresponding amino acids of a VP1 of another parental AAV, e.g. between amino acids 588 and 589 of VP1 of AAV1, AAV3A, AAV3B, AAV6 or AAV9, between amino acids 586 and 587 of VP1 of AAV4, between amino acids 577 and 578 of VP1 of AAV5, between amino acids 589 and 590 of VP1 of AAV7, between amino acids 590 to 591 of VP1 of AAV8 or AAV 10, etc.
  • the variant AAV capsid protein sequence is otherwise identical to the corresponding parental AAV capsid protein sequence, e.g. any one of SEQ ID NOs: l-l2.
  • the subject variant AAV capsid protein in addition to comprising a peptide insertion, e.g. as disclosed herein or as known in the art, in the GH loop, comprises from about 1 to about 100 amino acid substitutions or deletions, e.g. 1 to about 5, from about 2 to about 4, from about 2 to about 5, from about 5 to about 10, from about 10 to about 15, from about 15 to about 20, from about 20 to about 25, from about 25-50, from about 50-100 amino acid substitutions or deletions compared to the parental AAV capsid protein.
  • a subject variant capsid protein comprises an amino acid sequence having a sequence identity of 85% or more, 90% or more, 95% or more, or 98% or more, e.g. or 99% identity to the corresponding parental AAV capsid, e.g. a wild type capsid protein as set forth in SEQ ID NOs:l-l2.
  • the one or more amino acid substitutions are at amino acid residue(s) 1, 15, 34, 57, 66, 81, 101, 109, 144, 164, 176, 188, 196, 226, 236, 240, 250, 312, 363, 368, 449, 456, 463, 472, 484, 524, 535, 551, 593, 698, 708, 719, 721, and/or 735 of AAV2 VP1 capsid protein as numbered prior to insertion of the peptide, or the corresponding amino acid residue(s) of another AAV capsid protein.
  • the one or more amino acid substitutions are selected from the group consisting of M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, and L735Q of AAV2 VP1 capsid protein as numbered prior to the insertion of the peptide, or the corresponding amino acid residue(s) of another AAV capsid protein .
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from ISDQTKH (SEQ ID NO: 14), LGISDQTKHA (SEQ ID NO:29) and LAISDQTKHA (SEQ ID NO:28), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof.
  • the one or more amino acid substitutions are selected from the group consisting of: M1L+L15P+P535S, P34A, P34A+S721L, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, Q164K+V708I, T176P, L188I, S196Y, G226E, G236V, I240T, N312K, N312K+N449D+D472N+N551S+I698V+L735Q, P363L,
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO: 14) or comprising, consisting essentially of, or consisting of the amino acid sequence LAISDQTKHA (SEQ ID NO:28) or LGISDQTKHA (SEQ ID NO:29) between amino acids 587 and 588 of VP1 of AAV2 or the corresponding amino acids of another AAV capsid, and further comprises a P34A amino acid substitution at residue 34 relative to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding residue of another AAV capsid.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO: 2 or the corresponding parental AAV capsid.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:42)
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO: 14) or comprising, consisting essentially of, or consisting of the amino acid sequence LAISDQTKHA (SEQ ID NO:28) or LGISDQTKHA (SEQ ID NO:29) between amino acids 587 and 588 of AAV2 capsid protein or the corresponding position in the capsid protein of another AAV serotype and comprises an N312K amino acid substitution compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype and optionally further comprises N449D, D472N, N551S, I698V and/or L735Q amino acid substitutions compared to the amino acid sequence of AAV2 capsid or the corresponding substitutions in another AAV parental serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO: 14) or comprising, consisting essentially of, or consisting of the amino acid sequence LAISDQTKHA (SEQ ID NO:28) or LGISDQTKHA (SEQ ID NO:29) between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype and comprises N312K, N449D, D472N, N551S, I698V and L735Q amino acid substitutions compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or substitutions at the corresponding residues in another AAV parental serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • a variant AAV capsid protein comprising a) a peptide insertion located between amino acids 588 and 589 of VP1 of AAV1, AAV3A, AAV3B, AAV6 or AAV9, amino acids 586 and 587 of AAV4, amino acids 577 and 578 of AAV5, amino acids 589 and 590 of AAV7, or amino acids 590 to 591 of AAV8 or AAV10, the peptide insertion comprising an amino acid sequence selected from ISDQTKH (SEQ ID NO: 14), LGISDQTKHA (SEQ ID NO:29) and LAISDQTKHA (SEQ ID NO:28), and b) a valine to isoleucine substitution at amino acid 709 of AAV3A or AAV3B, an alanine to isoleucine substitution at position 709 of AAV1 or AAV6, an asparagine to isoleucine substitution at amino acid 707 of AAV4 or amino acid 709 of
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO: 14) or comprising, consisting essentially of, or consisting of the amino acid sequence LAISDQTKHA (SEQ ID NO:28) or LGISDQTKHA (SEQ ID NO:29) between amino acids 587 and 588 of AAV2 capsid and b) a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2, wherein the variant capsid protein comprises from 2 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions.
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO: 14) or comprising, consisting essentially of, or consisting of the amino acid sequence LAISDQTKHA (SEQ ID NO:28) or LGISDQTKHA (SEQ ID NO:29) between amino acids 587 and 588 of AAV2 capsid and b) a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2 and is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO: 14) or comprising, consisting essentially of, or consisting of the amino acid sequence LAISDQTKHA (SEQ ID NO:28) or LGISDQTKHA (SEQ ID NO:29) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:44)
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from QADTTKN (SEQ ID NO: 13) and LAQADTTKNA (SEQ ID NO:27), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V719M, S721L, L735Q and a combination thereof, preferably selected from S109T, P250S, A524T, A593E, I698V, V708I, and/or V719M.
  • the peptide insertion site is preferably located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence QADTTKN (SEQ ID NO: 13) or comprising, consisting essentially of, or consisting of the amino acid sequence LAQADTTKNA (SEQ ID NO:27) between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype and comprises an I698V amino acid substitution compared to the amino acid sequence of AAV2 or the corresponding substitution in another AAV parental serotype, wherein the substituted amino acid(s) do not naturally occur at the corresponding position.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the corresponding amino acid substitution is an I699V amino acid substitution compared to the amino acid sequence of AAV3A, AAV3B or AAV9 capsid, an I687V substitution compared to the amino acid sequence of AAV5 capsid, an I700V substitution compared to the amino acid sequence of AAV7, an I701V substitution compared to the amino acid sequence of AAV8 or AAV 10.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence QADTTKN (SEQ ID NO: 13) or comprising, consisting essentially of, or consisting of the amino acid sequence LAQADTTKNA (SEQ ID NO:27) between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype and comprises a V719M amino acid substitution and optionally a V708I substitution compared to the amino acid sequence of AAV2 or the corresponding substitution in another AAV parental serotype, wherein the substituted amino acid(s) do not naturally occur at the corresponding position.
  • a variant AAV capsid protein comprising a) a peptide insertion located between amino acids 588 and 589 of VP1 of AAV1, AAV3A, AAV3B, AAV6 or AAV9, amino acids 586 and 587 of AAV4, amino acids 577 and 578 of AAV5, amino acids 589 and 590 of AAV7, or amino acids 590 to 591 of AAV8 or AAV10, the peptide insertion comprising an amino acid sequence selected from QADTTKN (SEQ ID NO: 13) and LAQADTTKNA (SEQ ID NO:27), and b) a valine to isoleucine substitution at amino acid 709 of AAV3A or AAV3B, an alanine to isoleucine substitution at position 709 of AAV1 or AAV6, an asparagine to isoleucine substitution at amino acid 707 of AAV4 or amino acid 709 of AAV9 or a threonine to isole
  • a variant AAV capsid protein comprising a) a peptide insertion located between amino acids 588 and 589 of VP1 of AAV1, AAV3A, AAV3B, AAV6 or AAV9, amino acids 586 and 587 of AAV4, amino acids 577 and 578 of AAV5, amino acids 589 and 590 of AAV7, or amino acids 590 to 591 of AAV8 or AAV10, the peptide insertion comprising an amino acid sequence selected from QADTTKN (SEQ ID NO: 13) and LAQADTTKNA (SEQ ID NO:27), and b) a serine to threonine amino acid substitution at position 109 compared to the amino acid sequence of AAV1, AAV3A, AAV3B, AAV4, AAV7, AAV8, AAV9, or AAV 10 or at position 108 compared to the amino acid sequence of AAV5 or AAV6.
  • QADTTKN SEQ ID NO: 13
  • LAQADTTKNA SEQ ID NO:
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence QADTTKN (SEQ ID NO: 13) or comprising, consisting essentially of, or consisting of the amino acid sequence LAQADTTKNA (SEQ ID NO:27) between amino acids 587 and 588 of AAV2 capsid and comprises a serine to threonine substitution at amino acid 109 (S109T) or a valine to isoleucine amino acid substitution at amino acid 708 (V708I) compared to the amino acid sequence of AAV2, wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions and is preferably at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence QADTTKN (SEQ ID NO: 13) or comprising, consisting essentially of, or consisting of the amino acid sequence LAQADTTKNA (SEQ ID NO:27) between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype and comprises a serine to threonine substitution at amino acid 109 and a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2.
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence QADTTKN (SEQ ID NO: 13) or comprising, consisting essentially of, or consisting of the amino acid sequence LAQADTTKNA (SEQ ID NO:27) between amino acids 587 and 588 of AAV2 capsid and b) at least one amino acid substitution, wherein the amino acid sequence of the variant capsid does not comprise a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2 and does not comprise a serine to threonine substitution at amino acid 109 compared to the amino acid sequence of AAV2.
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence QADTTKN (SEQ ID NO: 13) or comprising, consisting essentially of, or consisting of the amino acid sequence LAQADTTKNA (SEQ ID NO:27) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from HDITKNI (SEQ ID NO: 17), IAHDITKNIA (SEQ ID NO: 60) and LAHDITKNIA (SEQ ID NO:32), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, R389S, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof.
  • the AAV capsid protein comprises one or more amino acid substitutions selected from S109T, R389S, A593E and/or V708I.
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence HDITKNI (SEQ ID NO: 17) or comprising, consisting essentially of, or consisting of the amino acid sequence IAHDITKNIA (SEQ ID NO:60) or LAHDITKNIA (SEQ ID NO:32) between amino acids 587 and 588 of AAV2 capsid and comprises an S109T amino acid substitution compared to the amino acid sequence of AAV2 capsid or the corresponding substitution in another AAV parental serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence HDITKNI (SEQ ID NO: 17) or comprising, consisting essentially of, or consisting of the amino acid sequence IAHDITKNIA (SEQ ID NO:60) or LAHDITKNIA (SEQ ID NO:32) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:46)
  • the variant capsid comprises a) a peptide insertion comprising, consisting essentially of, or consisting of the amino acid sequence LAHDITKNIA between amino acids 587 and 588 of AAV2 capsid and b) at least one amino acid substitution, wherein the amino acid sequence of the variant capsid does not comprise a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2.
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence DITKNIA (SEQ ID NO:6l) or comprising, consisting essentially of or consisting of the amino acid sequence sequence IAHDITKNIA (SEQ ID NO: 60) or LAHDITKNIA (SEQ ID NO:32) between amino acids 587 and 588 of AAV2 capsid and b) a V708I substitution compared to the amino acid sequence of AAV2.
  • the variant capsid comprises a) a peptide insertion comprising, consisting essentially of, or consisting of the amino acid sequence LAHDITKNIA (SEQ ID NO:32) between amino acids 587 and 588 of AAV2 capsid and b) two or more amino acid substitutions, wherein the amino acid sequence of the variant capsid comprises a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2.
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from NQDYTKT (SEQ ID NO: 16) and LANQDYTKTA (SEQ ID NO:3l), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof.
  • the AAV capsid protein comprises one or more amino acid substitutions selected from S109T, S109T+S463Y, D368H and V708I.
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence NQDYTKT (SEQ ID NO: 16) or comprising, consisting essentially of, or consisting of the amino acid sequence LANQDYTKTA (SEQ ID NO:3l) between amino acids 587 and 588 of AAV2 capsid and comprises a V708I amino acid substitution compared to the amino acid sequence of AAV2 capsid or the corresponding substitution in another AAV parental serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence NQDYTKT (SEQ ID NO: 16) or comprising, consisting essentially of, or consisting of the amino acid sequence LANQDYTKTA (SEQ ID NO:3l) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence NQDYTKT (SEQ ID NO: 16) or comprising, consisting essentially of, or consisting of the amino acid sequence LANQDYTKTA (SEQ ID NO:3l) between amino acids 587 and 588 of AAV2 capsid and b) an S109T amino acid substitution compared to the sequence of SEQ ID NO:2 and optionally an S463Y amino acid substitution, wherein the variant capsid is at least about 85%, at least about 90%, at least about 95%, at least about 98% identical to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence NQDYTKT (SEQ ID NO: 16) or comprising, consisting essentially of, or consisting of the amino acid sequence LANQDYTKTA (SEQ ID NO:3l) between amino acids 587 and 588 of AAV2 capsid and b) an S109T amino acid substitution compared to the amino acid sequence of SEQ ID NO:2 and is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • a variant AAV capsid protein comprising a) a peptide insertion located between amino acids 588 and 589 of VP1 of AAV1, AAV3A, AAV3B, AAV6 or AAV9, amino acids 586 and 587 of AAV4, amino acids 577 and 578 of AAV5, amino acids 589 and 590 of AAV7, or amino acids 590 to 591 of AAV8 or AAV10, the peptide insertion comprising an amino acid sequence selected from NQDYTKT (SEQ ID NO: 16) and LANQDYTKTA (SEQ ID NO:3l), and b) an asparagine to lysine amino acid substitution at position 313 compared to the amino acid sequence of AAV1 or AAV6, or at position 314 compared to the amino acid sequence of AAV9, or a serine to lysine substitution at position 312 of AAV3A or AAV3B or at position 315 of AAV8 or AAV 10, or an argin
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence NQDYTKT (SEQ ID NO: 16) or comprising, consisting essentially of, or consisting of the amino acid sequence LANQDYTKTA (SEQ ID NO:3l) between amino acids 587 and 588 of AAV2 capsid and b) an N312K amino acid substitution, wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions.
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from PNSTHGS (SEQ ID NO:25) and LAPNSTHGSA (SEQ ID NO:40), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • the substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence PNSTHGS (SEQ ID NO:25) or comprising, consisting essentially of, or consisting of the amino acid sequence LAPNSTHGSA (SEQ ID NO:40) between amino acids 587 and 588 of AAV2 capsid and comprises a V708I amino acid substitution compared to the amino acid sequence of AAV2 capsid or the corresponding substitution in another AAV parental serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence PNSTHGS (SEQ ID NO:25) or comprising, consisting essentially of, or consisting of the amino acid sequence LAPNSTHGSA (SEQ ID NO:40) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ IDNO:48)
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from NKTTNKDA (SEQ ID NO:62) and LANKTTNKDA (SEQ ID NO:35), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • the substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid comprises a peptide insertion comprising the amino acid sequence NKTTNKDA (SEQ ID NO:62) or comprising, consisting essentially of, or consisting of the amino acid sequence LANKTTNKDA (SEQ ID NO:35) between amino acids 587 and 588 of AAV2 capsid and comprises an N449D amino acid substitution compared to the amino acid sequence of AAV2 capsid or the corresponding substitution in another AAV parental serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a) a peptide insertion comprising the amino acid sequence NKTTNKDA (SEQ ID NO:62) or comprising, consisting essentially of, or consisting of the amino acid sequence LANKTTNKDA (SEQ ID NO:35) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from TNRTSPD (SEQ ID NO: 24) and LATNRTSPDA (SEQ ID NO: 39), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V719M, S721L, L735Q and a combination thereof.
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • a variant AAV capsid protein comprising a) a peptide insertion located between amino acids 588 and 589 of VP1 of AAV1, AAV3A, AAV3B, AAV6 or AAV9, amino acids 586 and 587 of AAV4, amino acids 577 and 578 of AAV5, amino acids 589 and 590 of AAV7, or amino acids 590 to 591 of AAV8 or AAV10, the peptide insertion comprising an amino acid sequence selected from TNRTSPD (SEQ ID NO:24) and LATNRTSPDA (SEQ ID NO:39), and b) a valine to isoleucine substitution at amino acid 709 of AAV3A or AAV3B, an alanine to isoleucine substitution at position 709 of AAV1 or A
  • the variant capsid protein comprises a) a peptide insertion comprising, consisting essentially of, or consisting of the amino acid sequence LATNRTSPDA (SEQ ID NO: 39) between amino acids 587 and 588 of AAV2 capsid and b) a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2, wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions.
  • LATNRTSPDA SEQ ID NO: 39
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence TNRTSPD (SEQ ID NO:24) between amino acids 587 and 588 of AAV2 capsid and b) a valine to isoleucine amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid protein comprises a) a peptide insertion comprising the amino acid sequence TNRTSPD (SEQ ID NO:24) or comprising, consisting essentially of, or consisting of the amino acid sequence LATNRTSPDA (SEQ ID NO:39) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:50)
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from GKSKVID (SEQ ID NO:23) and LAGKSKVIDA (SEQ ID NO:38), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • the substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid comprises a peptide insertion located between amino acids 587 and 588 of AAV2 capsid comprising the amino acid sequence GKSKVID (SEQ ID NO:23) or comprising, consisting essentially of, or consisting of the amino acid sequence LAGKSKVIDA (SEQ ID NO:38) and is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • the variant AAV capsid comprises a) a peptide insertion comprising, consisting essentially of, or consisting of the amino acid sequence LAGKSKVIDA (SEQ ID NO: 38) between amino acids 587 and 588 of AAV2 capsid and comprises at least one amino acid substitution.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:5l)
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from ASDSTKA (SEQ ID NO: 15) and LAASDSTKAA (SEQ ID NO:30), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof.
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a peptide insertion comprising the amino acid sequence ASDSTKA (SEQ ID NO: 15) or comprising, consisting essentially of, or consisting of the amino acid sequence LAASDSTKAA (SEQ ID NO:30) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:52)
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from KDRAPST (SEQ ID NO: 26) and LAKDRAPTSA (SEQ ID NO:4l), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • the substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a peptide insertion comprising the amino acid sequence KDRAPST (SEQ ID NO:26) or comprising, consisting essentially of, or consisting of the amino acid sequence LAKDRAPTSA (SEQ ID NO:4l) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from HQDTTKN (SEQ ID NO: 19) and LAHQDTTK A (SEQ ID NO: 34), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at one or more of the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof.
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a peptide insertion comprising the amino acid sequence HQDTTKN (SEQ ID NO: 19) or comprising, consisting essentially of, or consisting of the amino acid sequence LAHQDTTKNA (SEQ ID NO:34) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from ISNENEH (SEQ ID NO:2l) and LPISNENEHA (SEQ ID NO:36), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • substituted amino acid(s) do not naturally occur at one or more of the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof.
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a peptide insertion comprising the amino acid sequence ISNENEH (SEQ ID NO:2l) or comprising, consisting essentially of, or consisting of the amino acid sequence LPISNENEHA (SEQ ID NO:36) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • NGVYSEPRPIGTRYLTRNL (SEQ ID NO:55)
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from QANANEN (SEQ ID NO:22) and LPQANANENA (SEQ ID NO:37), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • the substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a peptide insertion comprising the amino acid sequence QANANEN (SEQ ID NO:22) or comprising, consisting essentially of, or consisting of the amino acid sequence LPQANANENA (SEQ ID NO:37) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • a variant AAV capsid protein comprising a) a peptide insertion in the GH-loop of the capsid protein, wherein the peptide insertion comprises an amino acid sequence selected from HPDTTKN (SEQ ID NO: 18) and LAHPDTTKNA (SEQ ID NO:33), and b) one or more of the following amino acid substitutions compared to the amino acid sequence of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV parental serotype (i.e.
  • the substituted amino acid(s) do not naturally occur at the corresponding positions: M1L, L15P, P34A, N57D, N66K, R81Q, Q101R, S109T, R144K, R144M, Q164K, T176P, L188I, S196Y, G226E, G236V, I240T, P250S, N312K, P363L, D368H, N449D, T456K, S463Y, D472N, R484C, A524T, P535S, N551S, A593E, I698V, V708I, V719M, S721L, L735Q and a combination thereof
  • the peptide insertion site is located between amino acids 587 and 588 of AAV2 capsid or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid may have at least about 85%, at least about 90%, at least about 95%, at least about 98%, or greater amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid comprises a peptide insertion comprising the amino acid sequence HPDTTKN (SEQ ID NO: 18) or comprising, consisting essentially of, or consisting of the amino acid sequence LAHPDTTKNA (SEQ ID NO:33) between amino acids 587 and 588 of AAV2 capsid and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant AAV capsid has an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to or is 100% identical to the following amino acid sequence:
  • a variant AAV capsid protein comprising one or more amino acid substitutions relative to a corresponding parental AAV capsid protein, wherein the variant capsid protein, when present in an AAV virion, confers increased infectivity of a retinal cell compared to the infectivity of a retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein.
  • a variant AAV capsid protein comprises a P34A amino acid substitution compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or a P33A amino acid substitution compared to the amino acid sequence of AAV5 capsid (SEQ ID NO:6).
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:6 and comprises a P34A or P33A amino acid substitution compared to the amino acid sequence of AAV2 or AAV5 capsid respectively.
  • the variant capsid protein comprises an amino acid sequence comprising a P34A amino acid substitution compared to the amino acid sequence set forth in SEQ ID NO 2 and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid protein comprises a P34A amino acid substitution compared to the amino acid sequence of SEQ ID NO:2, wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions compared to the amino acid sequence of an AAV2 capsid protein set forth in SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 164 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2), wherein the substituted amino acid does not naturally occur at the corresponding position.
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 164 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the rAAV virion comprises a glutamine to lysine amino acid substitution at amino acid 164 compared to amino acid sequence of AAV1, AAV2 or AAV6 or at amino acid 165 compared to the amino acid sequence of AAV7, AAV8, or AAV 10; or comprises a serine to lysine substitution at amino acid 160 of AAV5 or comprises an alanine to lysine substitution at amino acid 164 of AAV9.
  • the variant capsid protein comprises an amino acid substitution at amino acid 164 (e.g.
  • the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions compared to the amino acid sequence of an AAV2 capsid protein set forth in SEQ ID NO:2.
  • the variant capsid protein comprises an amino acid sequence comprising a Q164K amino acid substitution compared to the amino acid sequence set forth in SEQ ID NO:2 and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid protein comprises Q164K and V708I amino acid substitutions compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding substitutions in another AAV parental serotype (i.e. other than AAV2) and is at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 698 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2), wherein the substituted amino acid does not naturally occur at the corresponding position.
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 698 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the rAAV virion comprises an isoleucine to valine amino acid substitution at amino acid 698 compared to amino acid sequence of AAV2, or at amino acid 699 compared to the amino acid sequence of AAV3A, AAV3B, or AAV9, or at amino acid 687 of AAV5, or at amino acid 700 of AAV7, or at amino acid 701 of AAV8 or AAV 10.
  • the variant capsid protein comprises an amino acid substitution at amino acid 699 (e.g.
  • the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions compared to the amino acid sequence of an AAV2 capsid protein set forth in SEQ ID NO:2.
  • the variant capsid protein comprises an amino acid sequence comprising an I698V amino acid substitution compared to the amino acid sequence set forth in SEQ ID NO:2 and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 109 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2).
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 109 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the variant capsid protein comprises a serine to threonine amino acid substitution at position 109 compared to the amino acid sequence of AAV1, AAV3A, AAV3B, AAV4, AAV7, AAV8, AAV9 , or AAV10 or at position 108 compared to the amino acid sequence of AAV5 or AAV6.
  • the variant capsid protein comprises an S109T amino acid substitution compared to the amino acid sequence AAV2, wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions.
  • the variant capsid protein comprises an S109T amino acid substitution and an A593E amino acid substitution compared to the amino acid sequence of AAV2.
  • the variant capsid protein comprises S109T and A493V and optionally A593E and/or V708I amino acid substitutions compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding substitutions in another AAV parental serotype (i.e. other than AAV2) and has at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2.
  • the variant capsid protein comprises S109T, A493V, A593E and V708I amino acid substitutions compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding substitutions in another AAV parental serotype (i.e. other than AAV2) and is at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2.
  • the variant capsid protein comprises S109T and V708I amino acid substitutions compared to the amino acid sequence of AAV2 capsid and has at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 or is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 593 compared to the amino acid sequence of AAV2 capsid (SEQ ID N0:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2).
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 593 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the variant capsid protein comprises a glycine to glutamate amino acid substitution at amino acid 594 compared to the amino acid sequence of AAV1, AAV3A, AAV6, or AAV9, or at amino acid 583 of AAV5, or at amino acid 596 of AAV8 or AAV10, or an arginine to glutamate amino acid substitution at amino acid 594 of AAV3B, or an aspartate to glutamate amino acid substitution at amino acid 592 of AAV4 or a glutamine to glutamate amino acid substitution at position 595 of AAV7.
  • the variant capsid protein comprises an A593E amino acid substitution compared to the amino acid sequence of AAV2 and does not comprise one or more of the following amino acid substitutions compared to the amino acid sequence of AAV 2: I19V, V369A, K26R, N215D, G355S, V46A and S196P.
  • the variant capsid protein comprises A593E and N596D amino acid substitutions compared to the amino acid sequence of AAV2 and has at least about 85%, at least about 90%, at least about 95%, at least about 98% or at least about 99% identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2.
  • the variant capsid comprises A593E and N596D amino acid substitutions compared to the amino acid sequence of AAV2 and is otherwise identical to the amino acid sequence of AAV2.
  • the variant capsid comprises A593E and V708I amino acid substitutions compared to the amino acid sequence of AAV2 and has at least about 85%, at least about 90%, at least about 95%, at least about 98% or at least about 99% identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2.
  • the variant capsid comprises A593E and V708I amino acid substitutions compared to the amino acid sequence of AAV2 and is otherwise identical to the amino acid sequence of AAV2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2) wherein the substituted amino acid does not naturally occur at the corresponding position.
  • the rAAV virion does not comprise a proline to serine substitution at amino acid 250 compared to AAV2 or a corresponding amino acid in another AAV parental serotype.
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 708 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the variant capsid protein comprises a valine to isoleucine (V708I) substitution at amino acid 708 compared to the amino acid sequence of AAV2 capsid and has at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 or is otherwise identical to the amino acid sequence of SEQ ID NO:2, wherein the variant capsid protein does not comprise a P250S amino acid substitution.
  • V708I valine to isoleucine
  • the variant capsid protein comprises a valine to isoleucine substitution at amino acid 709 of AAV3A or AAV3B, an alanine to isoleucine substitution at position 709 of AAV1 or AAV6, an asparagine to isoleucine substitution at amino acid 707 of AAV4 or amino acid 709 of AAV9 or a threonine to isoleucine substitution at amino acid 710 of AAV7 or amino acid 711 of AAV8 or AAV 10 or a glutamine to isoleucine substitution at amino acid 697 of AAV5.
  • the variant capsid protein comprises a V708I amino acid substitution compared to the amino acid sequence of AAV2, wherein the variant capsid protein comprises from 2 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions and wherein the variant capsid protein does not comprise a P250S amino acid substitution.
  • the variant capsid protein comprises a V708I amino acid substitution and also comprises an A593E and/or an S109T amino acid substitution compared to the amino acid sequence of AAV2.
  • the variant capsid comprises V708I and A593E amino acid substitutions compared to the amino acid sequence of AAV2, wherein the variant capsid protein is otherwise identical to the amino acid sequence of AAV2.
  • the variant capsid comprises V708I and S109T amino acid substitutions compared to the amino acid sequence of AAV2, wherein the variant capsid protein is otherwise identical to the amino acid sequence of AAV2.
  • the variant capsid protein comprises V708I and V719M amino acid substitutions compared to the amino acid sequence of AAV2 and has at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 or is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • the variant capsid protein comprises V708I and R733C amino acid substitutions compared to the amino acid sequence of AAV2 and has at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 or is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • the variant capsid protein comprises V708I and G727D amino acid substitutions compared to the amino acid sequence of AAV2 and has at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 or is otherwise identical to the amino acid sequence of SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 196 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2), wherein the substituted amino acid does not naturally occur at the corresponding position and is optionally other than proline.
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 196 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) and is optionally other than an S196P substitution.
  • the variant capsid protein comprises a serine to tyrosine amino acid substitution at amino acid 196 of AAV2 or AAV9 or at amino acid 197 of AAV7, AAV8 or AAV10 or at amino acid 186 of AAV5; or an alanine to tyrosine substitution at amino acid 196 of AAV1 or AAV6; or a methionine to tyrosine substitution at amino acid 191 of AAV4; or a threonine to tyrosine substitution at amino acid 196 of AAV3A or AAV3B.
  • the variant capsid protein comprises an amino acid sequence comprising an S196Y amino acid substitution compared to the amino acid sequence set forth in SEQ ID NO:2 and is otherwise identical to the amino acid sequence set forth in SEQ ID NO:2.
  • the variant capsid protein comprises an amino acid substitution at amino acid 196 other than an S196P substitution (e.g. comprises an S196Y substitution) compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2), wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions compared to the amino acid sequence of an AAV2 capsid protein set forth in SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 175 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2), wherein the substituted amino acid does not naturally occur at the corresponding position.
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 175 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the variant capsid comprises a Q175H amino acid substitution compared to the amino acid sequence of AAV2 as set forth in SEQ ID NO:2 or a glutamine to histidine substitution at the corresponding position in another AAV parental serotype.
  • the variant capsid protein comprises an amino acid substitution at amino acid 175 (e.g. Q175H) compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2), wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions compared to the amino acid sequence of an AAV2 capsid protein set forth in SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid substitution at amino acid 64 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2) or the corresponding position in another AAV parental serotype (i.e. other than AAV2), wherein the substituted amino acid does not naturally occur at the corresponding position.
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO 2 and comprises an amino acid substitution at amino acid 64 compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2).
  • the rAAV virion comprises a P64S amino acid substitution compared to the amino acid sequence of AAV2 as set forth in SEQ ID NO:2 or a proline to serine substitution at the corresponding position in another AAV parental serotype.
  • the variant capsid protein comprises an amino acid substitution at amino acid 64 (e.g. P64S) compared to the amino acid sequence of AAV2 capsid (SEQ ID NO:2), wherein the variant capsid protein comprises from 1 to 5, from 5 to 10, or from 10 to 15 amino acid substitutions compared to the amino acid sequence of an AAV2 capsid protein set forth in SEQ ID NO:2.
  • a variant AAV capsid protein comprises an amino acid sequence at least 85%, at least 90%, at least 95% or at least 98% identical to a wild-type AAV capsid sequence selected from the group consisting of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 10,11 and 12 and also comprises i) one or more amino acid substitutions selected from the group consisting of P34A, S109T+V708I, A593E+N596D, V708I+V719M, V708I+G727D, S109T+A493V+A593E+V708I, V708I+R733C, Q164K, and I698V and/or (ii) a peptide insertion selected from the group consisting of QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITK
  • LAASDSTKAA SEQ ID NO:30
  • LAHDITKNIA SEQ ID NO:32
  • LPQANANENA SEQ ID NO:37
  • LANQDYTKTA SEQ ID NO:3l
  • LATNRTSPDA (SEQ ID NO:39), LAPNSTHGSA (SEQ ID NO:40),
  • LAKDRAPSTA SEQ ID NO:4l
  • LAHQDTTKNA SEQ ID NO:34
  • LAHPDTTKNA (SEQ ID NO:33), LANKTTNKDA (SEQ ID NO:35),
  • the variant AAV capsid comprises the specified one or more amino acid substitutions and/or peptide insertions and is otherwise identical to a sequence selected from the group consisting of SEQ ID NOS: 1-12.
  • a variant AAV capsid protein is an ancestral capsid protein.
  • an ancestral capsid protein it is meant an evolutionary ancestor of a capsid protein that is found in nature today, e.g. AAV1, AAV2, AAV3, AAV4, AAV 5, AAV6, AAV 7, AAV8, AAV9, AAVrhlO, AAV11, AAV 12, AAV 13, which is generated in silico by random amino acid substitution at positions of degeneracy between AAV capsid proteins that are found in nature today.
  • the ancestral capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence set forth in SEQ ID NO:58. In some embodiments, the ancestral capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence of AAV2, e.g. as set forth in SEQ ID NO 2.
  • the ancestral capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, or greater, amino acid sequence identity to the entire length of the amino acid sequence of the ancestral sequence disclosed in SEQ ID NO:58 or in SEQ ID NO:2 and comprises one or more amino acid residues selected from the group consisting of: Alanine (A) at 264, Alanine (A) at 266, Serine (S) at 268, Alanine (A) at 448, Threonine (T) at 459, Arginine (R) at 460, Alanine (A) at 467, Serine (S) at 470, Asparagine (N) at 471, Alanine (A) at 474, Serine (S) at 495, Asparagine (D) at 516, Asparagine (D) at 533, Glutamine (Q) at 547, Alanine (A) at 551, Alaninet (A) at 555, Gluta
  • the variant capsid protein comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, in some instances 100% amino acid sequence identity to the entire length of the following amino acid sequence and comprises one or more amino acid residues selected from the group consisting of: Alanine (A) at 264, Alanine (A) at 266, Serine (S) at 268, Alanine (A) at 448, Threonine (T) at 459, Arginine (R) at 460, Alanine (A) at 467, Serine (S) at 470, Asparagine (N) at 471, Alanine (A) at 474, Serine (S) at 495, Asparagine (D) at 516, Asparagine (D) at 533, Glutamine (Q) at 547, Alanine (A) at 551, Alanine (A) at 555, Glutamic acid (E) at 557, Methionine (M) at 56
  • a variant AAV capsid protein comprises an amino acid sequence at least 85%, at least 90%, at least 95% or at least 98% identical to a wild-type AAV capsid sequence selected from the group consisting of the ancestral variant disclosed herein as SEQ ID NO:58, comprises one or more amino acid residues selected from the group consisting of: Alanine (A) at 264, Alanine (A) at 266, Serine (S) at 268, Alanine (A) at 448, Threonine (T) at 459, Arginine (R) at 460, Alanine (A) at 467, Serine (S) at 470, Asparagine (N) at 471, Alanine (A) at 474, Serine (S) at 495, Asparagine (D) at 516, Asparagine (D) at 533, Glutamine (Q) at 547, Alanine (A) at 551, Alanine (A) at 555, Glutamic acid (E) at 557, Me
  • N at 718
  • Glutamic acid (E) at 719
  • Serine (S) at 723
  • P34A amino acid substitutions selected from the group consisting of P34A, S109T+V708I, A593E+N596D, V708I+V719M, V708I+G727D,
  • a peptide insertion selected from the group consisting of QADTTKN (SEQ ID NO: 13), ISDQTKH (SEQ ID NO: 14), ASDSTKA (SEQ ID NO: 15), NQDYTKT (SEQ ID NO: 16), HDITKNI (SEQ ID NO: 17), PQANANEN (SEQ ID NO:63), TNRTSPD (SEQ ID NO:24), PNSTHGS (SEQ ID NO:25), KDRAPST (SEQ ID NO:26), HQDTTKN (SEQ ID NO: 19), HPDTTKN (SEQ ID NO: 18), NKTTNKD (SEQ ID NO:20), GKSKVID (SEQ ID NO:23), PISNENEH (SEQ ID NO:64), LAQADTTKNA (SEQ ID NO:27), LAISDQTKHA (SEQ ID NO:31), LAISDQTKHA (SEQ ID NO:31), LAISDQTKHA (SEQ ID NO:27), LAISDQTKHA (SEQ
  • LAHPDTTKNA (SEQ ID NO:33), LANKTTNKDA (SEQ ID NO:35),
  • the variant AAV capsid comprises the specified one or more amino acid substitutions and/or peptide insertions and is otherwise identical to SEQ ID NO:59.
  • the variant capsid proteins disclosed herein when present in an AAV virion, confer increased transduction of a retinal cell compared to the transduction of the retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein or wild-type AAV.
  • the variant capsid proteins disclosed herein when present in an AAV virion, confer more efficient transduction of primate retinal cells than AAV virions comprising the corresponding parental AAV capsid protein or wild- type AAV capsid protein, e.g.
  • the retinal cells take up more AAV virions comprising the subject variant AAV capsid protein than AAV virions comprising the parental AAV capsid protein or wild-type AAV.
  • the AAV variant virion or variant rAAV exhibits at least 2-fold, at least 5-fold, at least 10-fold, at least l5-fold, at least 20-fold, at least 25-fold, at least 50-fold, or more than 50-fold, increased transduction of a retinal cell, compared to the transduction of the retinal cell by a wild-type AAV virion or rAAV comprising the corresponding parental AAV capsid protein.
  • the variant capsid proteins disclosed herein when present in an AAV virion, confer broader transduction of the primate retinal cells than AAV virions comprising the corresponding parental AAV capsid protein or wild type AAV capsid protein.
  • the variant AAV virion transduces cell types not transduced by virions comprising the corresponding parental AAV capsid protein, and hence more types of cells in the retina than the corresponding parental AAV virion.
  • the AAV variant virion preferentially transduces a retinal cell, e.g., a subject rAAV virion infects a retinal cell with 2-fold, 5- fold, 10-fold, 15-fold, 20-fold, 25-fold, 50-fold, or more than 50-fold, specificity than another retinal cell or a non-retinal cell, e.g., a cell outside the eye.
  • the transduced retinal cell is a photoreceptor cell (e.g., rods; cones).
  • the retinal cell is a retinal ganglion cell (RGC).
  • the retinal cell is a retinal epithelial cell (RPE cell).
  • the retinal cell is a Miiller glial cell. In some embodiments, the retinal cell is a microglial cell. In some embodiments, the retinal cell is an amacrine cell. In some embodiments, the retinal cell is a bipolar cell. In some embodiments, the retinal cell is a horizontal cell.
  • An increase in transduction of a retinal cell e.g. increased efficiency of transduction, broader transduction, more preferential transduction, etc. may be readily assessed in vitro or in vivo by any number of methods in the art for measuring gene expression.
  • the AAV may be packaged with a genome comprising an expression cassette comprising a reporter gene, e.g.
  • the AAV may be packaged with a genome comprising a bar coded nucleic acid sequence, and the extent of transduction assessed by detecting the nucleic acid sequence by, e.g., PCR.
  • the AAV may be packaged with a genome comprising an expression cassette comprising a therapeutic gene for the treatment of a retinal disease, and the extent of transduction assessed by detecting the treatment of the retinal disease in an afflicted patient that was administered the AAV.
  • Ocular diseases that can be treated using a variant rAAV vector or virion and/or method disclosed herein include, but are not limited to, monogenic diseases, complex genetic diseases, acquired diseases, and traumatic injuries.
  • monogenic diseases include, but are not limited to, Bardet-Biedl syndrome; Batten’s Disease; Bietti’s Crystalline Dystrophy; choroideremia; chorioretinal atrophy; chorioretinal degeneration; cone or cone-rod dystrophies (autosomal dominant, autosomal recessive, and X-linked); congenital stationary night blindness (autosomal dominant, autosomal recessive, and X-linked); disorders of color vision, including achromatopsia (including ACHM2, ACHM3, ACHM4, and ACHM5), protanopia, deuteranopia, and tritanopia; Friedreich’s ataxia; Leber’s congenital amaurosis (autosomal dominant and autosomal recessive),
  • complex genetic diseases include, but are not limited to, glaucoma (open angle, angle-closure, low-tension, normal-tension, congenital, neovascular, pigmentary, pseudoexfoliation); age-related and other forms of macular degeneration, both exudative and non-exudative forms (autosomal dominant and autosomal recessive), such as acute macular degeneration, vitelliform macular degeneration; retinopathy of prematurity; and Vogt Koyanagi-Harada (VKH) syndrome.
  • glaucoma open angle, angle-closure, low-tension, normal-tension, congenital, neovascular, pigmentary, pseudoexfoliation
  • age-related and other forms of macular degeneration both exudative and non-exudative forms (autosomal dominant and autosomal recessive), such as acute macular degeneration, vitelliform macular degeneration; retinopathy of prematurity; and Vogt Koyanagi-H
  • acquired diseases include, but are not limited to, acute macular neuroretinopathy; anterior ischemic optic neuropathy and posterior ischemic optic neuropathy; Behcet's disease; branch retinal vein occlusion; choroidal neovascularization; diabetic retinopathy, including proliferative diabetic retinopathy and associated complications; diabetic uveitis; edema, such as macular edema, cystoid macular edema and diabetic macular edema; epiretinal membrane disorders; macular telangiectasia; multifocal choroiditis; non-retinopathy diabetic retinal dysfunction; ocular tumors; optic atrophies; retinal detachment; retinal disorders, such as central retinal vein occlusion, proliferative vitreoretinopathy (PVR), retinal arterial and venous occlusive disease, vascular occlusion, uveitic retinal disease; uveal effusion; retinal infective and in
  • traumatic injuries include, but are not limited to, histoplasmosis; optic nerve trauma; ocular trauma which affects a posterior ocular site or location; retinal trauma; viral infection of the eye; viral infection of the optic nerve; a posterior ocular condition caused by or influenced by an ocular laser treatment; posterior ocular conditions caused by or influenced by a photodynamic therapy; photocoagulation, radiation retinopathy; and sympathetic ophthalmia.
  • a variant capsid disclosed herein comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product such as, without limitation, an interfering RNA, a long non-coding RNA, a short non-coding RNA, an antisense RNA, an aptamer, a polypeptide, a secreted antibody, a single chain antibody, a V HH domain, a soluble receptor, an affibody, a knottin, a DARPin, a centurin, a chaperone, a site-specific nuclease that provides for site-specific knock-down of gene function or a modified site-specific nuclease that provides for gene-specific activation of transcription.
  • a gene product such as, without limitation, an interfering RNA, a long non-coding RNA, a short non-coding RNA, an antisense RNA, an aptamer, a polypeptide, a secreted antibody, a single
  • a rAAV variant virion disclosed herein comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.
  • the gene product is an interfering RNA.
  • the gene product is a long non-coding RNA.
  • the gene product is a short non-coding RNA.
  • the gene product is an antisense RNA.
  • the gene product is an aptamer.
  • the gene product is a polypeptide.
  • the gene product is a secreted antibody.
  • the gene product is a single chain antibody.
  • the gene product is a V HH domain.
  • the gene product is a soluble receptor. In some embodiments, the gene product is an affibody. In some embodiments, the gene product is a knottin. In some embodiments, the gene product is a DARPin. In some embodiments, the gene product is a centurin. In some embodiments, the gene product is a chaperone. In some embodiments, the gene product is a site-specific nuclease that provide for site-specific knock-down of gene function.
  • the uses of the gene product include, but are not limited to, enhancing the level of a factor in a cell, enhancing the level of a factor in a neighboring cell through secretion of a factor, decreasing the level of a factor in a cell, or decreasing the level of a factor in a neighboring cell through secretion of a factor.
  • the gene product can be designed to supplement the level of a defective of missing gene product, decrease the level of a defective of missing gene product, introduce a new supporting gene product, supplement the level of a supporting gene product, decrease the level of a hindering gene product, or both decrease the level of a hindering gene product and introduce or supplement the level of a supporting gene product.
  • Gene products delivered by the subject AAV variants can be used to alter the level of gene products or gene product activity directly or indirectly linked to retinal diseases and trauma.
  • Genes whose gene products are directly or indirectly linked to genetic diseases include, e.g., ADP-ribosylation factor-like 6 (ARL6); BBSome interacting protein 1 (BBIP1); BBSome protein 1 (BBS1); BBSome protein 2 (BBS2); BBSome protein 4 (BBS4); BBSome protein 5 (BBS5); BBSome protein 7 (BBS7); BBSome protein 9 (BBS9); BBSome protein 10 (BBS10); BBSome protein 12 (BBS12); centrosomal protein 290 kDa (CEP290); intraflagellar transport protein 172 (IFT172); intraflagellar transport protein 27 (IFT27); inositol polyphosphate-5-phosphatase E (INPP5E); inwardly-rectifying potassium channel subfamily J member 13 (KCNJ13); le
  • elegans uncl 19 protein (UNCI 19); ATP-binding cassette transporter - retinal (ABCA4); ADAM meiallopeptidase domain 9 (ADAM9); activating transcription factor 6 (ATF6); chromosome 21 open reading frame 2 (C21orf2); chromosome 8 open reading frame 37 (C8orf37); calcium channel; voltage-dependent; alpha 2/delta subunit 4 (CACNA2D4); cadherin-related family member 1 (protocadherin 21) (CDHR1); ceramide kinase-like protein (CERKL); cone photoreceptor cGMP-gated cation channel alpha subunit (CNGA3); cone cyclic nucleotide-gated cation channel beta 3 subunit (CNGB3); cyciin M4 (CNNM4); guanine nucleotide binding protein (G protein); alpha transducing activity polypeptide 2 (GNAT2); potassium channel subfamily V member 2
  • TMEM126A TMEM126A
  • TIMM8A CA4); HK1); KLHL7); NR2E3); NRL); OR2W3); PRPF3); PRPF4); PRPF6); PRPF8); PRPF31); ROM1); retinitis pigmentosa protein 1 (RP1); RP9); SNRNP200); SPP2); TOPORS); ARL2BP); C2orf7l); CLRN1); CNGA1); CNGB1); CYP4V2); DHDDS); DHX38); EMC1); EYS); FAM161A); GPR125); HGSNAT); IDH3B); IMPG2); KIAA1549); KIZ); MAK); MERTK); MVK); NEK2); NEUROD1); PDE6A); PDE6G); PRCD); RBP3); RLBP1); SLC7A14); USH2A); ZNF408); ZNF513); OFD1); RP2);
  • Pro-apoptotic genes Genes whose gene products induce or promote apoptosis are referred to herein as“pro-apoptotic genes” and the products of those genes (niRNA; protein) are referred to as “pro-apoptotic gene products.”
  • Pro-apoptotic targets include, e.g., Bax gene products; Bid gene products; Bak gene products; Bad gene products; Bcl-2; Bcl-Xl .
  • Anti-apoptotic gene products include X-hnked inhibitor of apoptosis.
  • Pro-angiogenic genes Genes whose gene products induce or promote angiogenesis are referred to herein as“pro-angiogenic genes” and the products of those genes (mRNA; protein) are referred to as“pro-angiogenic gene products.”
  • Pro-angiogenic targets include, e.g., vascular endothelial growth factor (VEGFa, VEGFb, VEGFc, VEGFd); vascular endothelial growth factor receptor 1 (VEGFR1); vascular endothelial growth factor receptor 2 (VEGFR2); Fms-Related Tyrosine Kinase 1 (Fltl); placenta growth factor (PGF); Platelet-derived growth factor (PDGF); angiopoietins; sonic hedgehog.
  • VEGFa, VEGFb, VEGFc, VEGFd vascular endothelial growth factor receptor 1
  • VEGFR2 vascular endothelial growth factor receptor 2
  • Anti-angiogenic genes Genes whose gene products inhibit angiogenesis are referred to herein as “anti-angiogenic genes” and the products of those genes (mRNA; protein) are referred to as “anti-angiogenic gene products.”
  • Anti-angiogenic gene products include endostatin; tumstatin; angiostatin; pigment epithelium-derived factor (PEDF), and fusion proteins or antibodies that are specific for pro-angiogenic targets and/or their receptors, e.g. the anti-VEGF fusion proteins sFLTl or Eylea, the YEGF-specific antibodies LucentisTM and AvastinTM, etc.
  • the gene product(s) delivered by the subject AAV variants act to inhibit angiogenesis.
  • the gene product(s) delivered by the subject AAV variants act to inhibit the activity of one or more mammalian VEGF proteins selected from the group consisting of VEGFa, VEGFb, VEGFc, VEGFd and PGF.
  • the gene product(s) delivered by the subject AAV variants inhibit the activity of VEGFa.
  • VEGFa has 9 isoforms generated by alternative splicing, the most physiologically relevant of which is VEGF 165.
  • VEGFa levels have been found to be elevated in the vitreous of patients with wet age-related macular degeneration, diabetic macular edema and retinal vein occlusion.
  • Gene product(s) which inhibit the activity of VEGFa in the eye and which are therefore effective to treat patients with elevated vitreous VEGFa include, but are not limited to, Aflibercept, Ranibizumab, Brolucizumab, Bevacizumab, and soluble fms-like tyrosine kinase 1 (sFLTl) (GenBank Acc. No. U01134).
  • an infectious recombinant AAV (rAAV) virion comprising (i) a variant AAV capsid protein as herein described and (ii) a heterologous nucleic acid comprising multiple sequences, each of which encodes a distinct VEGFa inhibitor.
  • the gene product is Aflibercept.
  • Aflibercept (EYLEA®) is a recombinant fusion protein comprising extracellular domains of human VEGF receptors 1 and 2 fused to the Fc portion of human IgGl.
  • Aflibercept acts as a soluble decoy receptor that binds VEGFa and PGF with greater affinity than the native receptors.
  • the approved dose of intravitreal Aflibercept injection is 2.0 mg, the dosing of which varies according to indication.
  • Aflibercept is indicated for the treatment of neovascular (wet) age-related macular degeneration, macular edema following retinal vein occlusion, diabetic macular edema and diabetic retinopathy.
  • a novel codon-optimized nucleic acid sequence encoding Aflibercept (corresponding to Figure 12A) is provided comprising or consisting of: [00189] ATGGTTTCTTACTGGGACACCGGCGTGCTGCTGTGTGCCC TGCTTTCTTGTCTGCTGCTGACCGGCTCTAGCAGCGGCTCTGATACCGGCA GACCCTTCGTGGAAATGTACAGCGAGATCCCCGAGATCATCCACATGACC GAGGGCAGAGAGCTGGTCATCCCTTGCAGAGTGACAAGCCCCAACATCAC CGTGACTCTGAAGAAGTTCCCTCTGGACACACTGATCCCCGACGGCAAGA GAATCATCTGGGACAGCCGGAAGGGCTTCATCATCAGCAACGCCACCTAC AAAGAGATCGGCCTGCTGACCTGTGAAGCCACCGTGAATGGCCACCTGTA CAAGACCAACTACCTGACACACAGACAGACCAACACCATCATCGACGTGG TGCTGAGCCCTAGCCACGGCATTGAACTGTCT
  • a nucleic acid sequence encoding Aflibercept comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or greater, nucleic acid identity to the entire length of the nucleic acid sequence set forth in SEQ ID NO:65 or to nucleotides 79-1377 of SEQ ID NO:65 (without the underlined nucleotides encoding the Fltl signal sequence).
  • the gene product(s) delivered by the subject AAV variant(s) is encoded by a nucleic acid sequence consisting of or comprising the nucleic acid sequence of SEQ ID NO:65 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • the gene product(s) delivered by the subject AAV variants comprises an amino acid sequence at least about at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to the following amino acid sequence:
  • the AAV variant(s) comprises a heterologous nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to amino acids 27-458 of SEQ ID NO:66 (corresponding to the amino acid sequence of Aflibercept without the underlined signal peptide sequence).
  • the gene product is a single-chain version of Ranibizumab (sc-Ranibizumab).
  • Ranibizumab (LUCENTIS®) is a monoclonal IgGl antibody fragment (Fab) that binds to and blocks all isoforms of VEGFa.
  • LUCENTIS® is expressed in bacteria as two separate chains (light and heavy) which are joined by a disulfide bond between the constant light (CL) and constant heavy 1 (CH1) domains.
  • the approved dose of intravitreal Ranibizumab is either 0.3 or 0.5 mg in 0.05 mL depending on the indication.
  • Ranibizumab is approved for the treatment of wet age-related macular degeneration, macular edema following retinal vein occlusion, diabetic macular edema and diabetic retinopathy.
  • a novel codon-optimized nucleic acid sequence encoding a single chain Heavy-Light (HL) form of Ranibizumab (sc-Ranibizumab HL) corresponding to Figure 12C is provided, the nucleic acid sequence comprising or consisting of:
  • a nucleic acid sequence encoding sc- Ranibizumab HL comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or greater, nucleic acid identity to the entire length of the nucleic acid sequence set forth in SEQ ID NO: 67 or to nucleotides 58-1575 of SEQ ID NO:67 (without the underlined nucleotides encoding the Human IGHV7-8 signal sequence).
  • the gene product(s) delivered by the subject AAV variant(s) is encoded by a nucleic acid sequence consisting of or comprising the nucleic acid sequence of SEQ ID NO:67 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • the gene product(s) delivered by the subject AAV variant(s) comprises an amino acid sequence at least about at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to the following amino acid sequence:
  • the AAV variant(s) comprises a heterologous nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to amino acids 20-524 of SEQ ID NO: 68 (corresponding to the amino acid sequence of sc-Ranibizumab HL without the underlined signal peptide sequence).
  • a novel codon- optimized nucleic acid sequence encoding a single chain Light-Heavy (LH) form of Ranibizumab (sc-Ranibizumab LH) corresponding to Figure 12B is provided, the nucleic acid sequence comprising or consisting of:
  • a novel codon- optimized nucleic acid sequence encoding a single chain Light-Heavy (LH) form of Ranibizumab (sc-Ranibizumab LH) corresponding to Figure 12B is provided, the nucleic acid sequence comprising or consisting of:
  • a nucleic acid sequence encoding sc- Ranibizumab LH comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or greater, nucleic acid identity to the entire length of the nucleic acid sequence set forth in SEQ ID NO:69 or SEQ ID NO:70 or to nucleotides 61-1578 of SEQ ID NO:69 or SEQ ID NO:70 (without the underlined nucleotides encoding the Ig kappa signal sequence).
  • the gene product(s) delivered by the subject AAV variant(s) is encoded by a nucleic acid sequence consisting of or comprising the nucleic acid sequence of SEQ ID NO:69 or SEQ ID NO:70 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • the gene product(s) delivered by the subject AAV variant(s) comprises an amino acid sequence at least about at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to the following amino acid sequence:
  • the AAV variant(s) comprises a heterologous nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to amino acids 21-525 of SEQ ID NO:7l (corresponding to the amino acid sequence of sc-Ranibizumab LH without the underlined signal peptide sequence).
  • a novel nucleic acid sequence encoding a single chain Light-Heavy (LH) form of Ranibizumab fused to the Fc region of human IgGl (sc-Ranibizumab-Fc) corresponding to Figure 12E is provided, the nucleic acid sequence comprising or consisting of:
  • a nucleic acid sequence encoding sc- Ranibizumab-Fc comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or greater, nucleic acid identity to the entire length of the nucleic acid sequence set forth in SEQ ID NO:72 or to nucleotides 61-2277 of SEQ ID NO:72 (without the underlined nucleotides encoding the Ig kappa signal sequence).
  • the gene product(s) delivered by the subject AAV variants is encoded by a nucleic acid sequence consisting of or comprising the nucleic acid sequence of SEQ ID NO:72 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • the gene product(s) delivered by the subject AAV variant(s) comprises an amino acid sequence at least about at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to the following amino acid sequence:
  • the AAV variant(s) comprises a heterologous nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to amino acids 21-752 of SEQ ID NO:73 (corresponding to the amino acid sequence of sc-Ranibizumab-Fc without the underlined signal peptide sequence)
  • the gene product is Brolucizumab.
  • Brolucizumab (RTH258) is a single chain variable fragment (scFv) that binds to and blocks all isoforms of VEGFa.
  • Brolucizumab is currently in Phase III clinical studies evaluating 3 mg and 6 mg doses for the treatment of wet age- related macular degeneration.
  • a novel codon- optimized nucleic acid sequence encoding Brolucizumab (corresponding to Figure 12D) is provided, the nucleic acid sequence comprising or consisting of:
  • a nucleic acid sequence encoding Brolucizumab comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or greater, nucleic acid identity to the entire length of the nucleic acid sequence set forth in SEQ ID NO:74 or to nucleotides 61-816 of SEQ ID NO:74 (without the underlined nucleotides encoding the Ig kappa signal sequence).
  • the gene product(s) delivered by the subject AAV variants is encoded by a nucleic acid sequence consisting of or comprising the nucleic acid sequence of SEQ ID NO:74 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • the gene product(s) delivered by the subject AAV variants comprises an amino acid sequence at least about at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to the following amino acid sequence:
  • the AAV variant(s) comprises a heterologous nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to amino acids 21-271 of SEQ ID NO:75 (corresponding to the amino acid sequence of Brolucizumab without the underlined signal peptide sequence).
  • a novel nucleic acid sequence encoding Brolucizumab fused to the Fc region of human IgGl (Brolucizumab-Fc) corresponding to Figure 12F is provided, the nucleic acid sequence comprising or consisting of:
  • a nucleic acid sequence encoding Brolucizumab-Fc comprising a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or greater, nucleic acid identity to the entire length of the nucleic acid sequence set forth in SEQ ID NO:76 or to nucleotides 61-1530 of SEQ ID NO:76 (without the underlined nucleotides encoding the Ig kappa signal sequence).
  • the gene product(s) delivered by the subject AAV variants is encoded by a nucleic acid sequence consisting of or comprising the nucleic acid sequence of SEQ ID NO:76 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • the gene product(s) delivered by the subject AAV variant(s) comprises an amino acid sequence at least about at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to the following amino acid sequence.
  • the AAV variant(s) comprises a heterologous nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or 100% identical to amino acids 21-498 of SEQ ID NO: 77 (corresponding to the amino acid sequence of Brolucizumab-Fc without the underlined signal peptide sequence).
  • an infectious recombinant AAV (rAAV) virion comprising a variant AAV capsid protein comprising a peptide insertion in the GH-loop of the capsid protein relative to a corresponding parental AAV capsid protein, wherein the peptide insertion comprises the amino acid sequence ISDQTKH (SEQ ID NO: 14) or LAISDQTKHA (SEQ ID NO:28) and a heterologous nucleic acid encoding a polypeptide that inhibits the activity of VEGF, preferably VEGFa, wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the corresponding parental AAV capsid protein for the retinal cell.
  • rAAV infectious recombinant AAV
  • the insertion site is between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2) or the corresponding position in the capsid protein of another AAV serotype.
  • the variant AAV capsid protein also comprises a P34A amino acid substitution relative to VP1 capsid of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV serotype.
  • an rAAV virion comprising a variant AAV capsid protein comprising (i) a peptide insertion between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2), or the corresponding position in the capsid protein of another AAV serotype of the capsid protein relative to a corresponding parental AAV capsid protein, and (ii) a P34A amino acid substitution relative to VP1 capsid of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV serotype, and a heterologous nucleic acid comprising a sequence encoding Aflibercept.
  • the nucleic acid sequence encoding Aflibercept consists of or comprises the nucleic acid sequence of SEQ ID NO:65 or a nucleic acid at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • an rAAV virion comprising a variant AAV capsid protein having an amino acid sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising the nucleic acid sequence of SEQ ID NO:65, wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the corresponding parental AAV capsid protein for the retinal cell.
  • the heterologous nucleic acid further comprises one or more sequences each encoding an additional VEGFa inhibitor preferably selected from Ranibizumab, sc-Ranibizumab HL, sc- Ranibizumab LH, sc-Ranibizumab-Fc, Brolucizumab, and Brolucizumab-Fc.
  • an additional VEGFa inhibitor preferably selected from Ranibizumab, sc-Ranibizumab HL, sc- Ranibizumab LH, sc-Ranibizumab-Fc, Brolucizumab, and Brolucizumab-Fc.
  • a pharmaceutical composition comprising such an rAAV is provided.
  • a method for treating VEGFa-associated ocular disease comprising administering to a subject in need thereof an effective amount of an rAAV virion comprising a variant AAV capsid protein having an amino acid sequence at least 90% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising the nucleic acid sequence of SEQ ID NO:65 and optionally one or more additional nucleic acid sequences, each encoding a distinct VEGFa inhibitor.
  • the rAAV may be administered by subretinal, suprachoroidal, topical, intracameral or intravitreal injection, but is preferably administered via intravitreal injection.
  • the VEGFa-associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; macular edema following retinal vein occlusion; retinal neovascularization resulting from retinal vein occlusion; diabetic macular edema, diabetic retinopathy (including all stages of non-proliferative diabetic retinopathy and proliferative diabetic retinopathy), myopic macular degeneration, branch retinal vein occlusion, hemi-retinal vein occlusion, and central retinal vein occlusion; retinopathy of prematurity; idiopathic choroidal neovascularization; myopia macular degeneration and secondary retinal and choridal neovascularization; retinal telangiectasia; neovascular glaucoma; vitreous hemorrhage; retinal and choroidal neovascularization secondary to retinal diseases, including but
  • the VEGFa- associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; diabetic macular edema; macular edema following retinal vein occlusion; diabetic retinopathy; and myopic choroidal neovascularization.
  • an rAAV virion comprising a variant AAV capsid protein comprising (i) a peptide insertion between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2), or the corresponding position in the capsid protein of another AAV serotype of the capsid protein relative to a corresponding parental AAV capsid protein, and (ii) a P34A amino acid substitution relative to VP1 capsid of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV serotype, and a heterologous nucleic acid comprising a nucleotide sequence encoding Ranibizumab, sc-Ranibizumab HL, sc- Ranibizumab LH, or sc-Ranibizumab-Fc.
  • the nucleic acid sequence encoding a sc-Ranibizumab consists of or comprises the nucleic acid sequence set forth in any one of SEQ ID NOs:67, 69, 70 and 72, or is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • an rAAV virion comprising a variant AAV capsid protein having an amino acid sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising the nucleic acid sequence of any one of SEQ ID NOs: 67, 69, 70 and 72, wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the corresponding parental AAV capsid protein for the retinal cell.
  • the heterologous nucleic acid further comprises one or more additional nucleic acid sequences each encoding a distinct VEGFa inhibitor preferably selected from Aflibercept, Brolucizumab, and Brolucizumab-Fc.
  • a pharmaceutical composition comprising such an rAAV is provided.
  • a method for treating an eye disease associated with elevated intraocular VEGFa comprising administering to a subject in need thereof an effective amount of an rAAV virion comprising a variant AAV capsid protein having an amino acid sequence at least 90% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 67, 69, 70 and 72.
  • the rAAV is administered via intravitreal injection.
  • the VEGFa-associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; macular edema following retinal vein occlusion; retinal neovascularization resulting from retinal vein occlusion; diabetic macular edema, diabetic retinopathy (including all stages of non-proliferative diabetic retinopathy and proliferative diabetic retinopathy), myopic macular degeneration, branch retinal vein occlusion, hemi-retinal vein occlusion, and central retinal vein occlusion; retinopathy of prematurity; idiopathic choroidal neovascularization; myopia macular degeneration and secondary retinal and choridal neovascularization; retinal telangiectasia; neovascular glaucoma; vitreous hemorrhage; retinal and choroidal neovascularization secondary to retinal diseases, including but
  • the VEGFa- associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; diabetic macular edema; macular edema following retinal vein occlusion; diabetic retinopathy; and myopic choroidal neovascularization.
  • an rAAV virion comprising a variant AAV capsid protein comprising (i) a peptide insertion between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2), or the corresponding position in the capsid protein of another AAV serotype of the capsid protein relative to a corresponding parental AAV capsid protein, and (ii) a P34A amino acid substitution relative to VP1 capsid of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV serotype, and a heterologous nucleic acid comprising a nucleotide sequence encoding Brolucizumab or Brolucizumab-Fc.
  • the nucleotide sequence encoding Brolucizumab or Brolucizumab-Fc consists of or comprises the nucleic acid sequence set forth in SEQ ID NO:74 or SEQ ID NO:76 or is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.
  • an rAAV virion comprising a variant AAV capsid protein having an amino acid sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising the nucleic acid sequence of SEQ ID NO:74 or SEQ ID NO:76, wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the corresponding parental AAV capsid protein for the retinal cell.
  • the heterologous nucleic acid further comprises one or more nucleotide sequences each encoding a distinct VEGFa inhibitor preferably selected from Aflibercept, Ranibizumab, sc-Ranibizumab HL, sc-Ranibizumab LH, and sc-Ranibizumab-Fc.
  • a pharmaceutical composition comprising such an rAAV is provided.
  • a method for treating an eye disease associated with elevated intraocular VEGFa comprising administering to a subject in need thereof an effective amount of an rAAV virion comprising a variant AAV capsid protein having an amino acid sequence at least 90% identical to the sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO:74 or SEQ ID NO:76.
  • the rAAV is administered via intravitreal injection.
  • the VEGFa-associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; macular edema following retinal vein occlusion; retinal neovascularization resulting from retinal vein occlusion; diabetic macular edema, diabetic retinopathy (including all stages of non-proliferative diabetic retinopathy and proliferative diabetic retinopathy), myopic macular degeneration, branch retinal vein occlusion, hemi-retinal vein occlusion, and central retinal vein occlusion; retinopathy of prematurity; idiopathic choroidal neovascularization; myopia macular degeneration and secondary retinal and choridal neovascularization; retinal telangiectasia; neovascular glaucoma; vitreous hemorrhage; retinal and choroidal neovascularization secondary to retinal diseases, including but
  • the VEGFa-associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; diabetic macular edema; macular edema following retinal vein occlusion; diabetic retinopathy; and myopic choroidal neovascularization.
  • immunomodulatory genes Genes whose gene products function as immune modulators, e.g., complement factors, toll-like receptors, are called “immunomodulatory genes”.
  • immunomodulatory genes include cytokines, chemokines, and the fusion proteins or antibodies that are specific for them and/or their receptors, e.g. the anti-IL- 6 fusion protein Rilonacept 1M , the Complement Factor H-specific antibody lampamizumab, etc.
  • PDGFR platelet derived growth factor receptor
  • GDNF glial derived neurotrophic factor
  • RdCVF rod-derived con viability factor
  • FGF fibroblast growth factor
  • NTN neurturin
  • CNTF ciliar ' neurotrophic factor
  • NNF nerve growth factor
  • BDNF brain derived neurotrophic factor
  • opsin opsin; rhodopsin; channel rhodopsin; halo rhodopsin.
  • a gene product of interest is a site-specific endonuclease that provide for site-specific knock-down of gene function, e.g., where the endonuclease knocks out an allele associated with a retinal disease.
  • a site-specific endonuclease can be targeted to the defective allele and knock out the defective allele.
  • a site-specific nuclease in addition to knocking out a defective allele, can also be used to stimulate homologous recombination with a donor DNA that encodes a functional cop ⁇ ' of the protein encoded by the defective allele.
  • a subject rAAV virion can be used to deliver both a site-specific endonuclease that knocks out a defective allele, and can be used to deliver a functional copy of the defective allele, resulting in repair of the defective allele, thereby providing for production of a functional retinal protein (e.g., functional retmoschisin, functional RPE65, functional peripherin, etc.).
  • a rAAV virion disclosed herein comprises a heterologous nucleotide sequence that encodes a site-specific endonuclease; and a heterologous nucleotide sequence that encodes a functional copy of a defective allele, where the functional copy encodes a functional retinal protein.
  • Functional retinal proteins include, e.g., retmoschisin, RPE65, retinitis pigmentosa GTPase regulator (RGPR)- interacting protein- 1, peripherin, peripherin-2, and the like.
  • Site-specific endonucleases that are suitable for use include, e.g., meganucleases; zinc finger nucleases (ZFNs); transcription activator-like effector nucleases (TALENs); and Clustered regularly interspaced short palindromic repeats/CRISPR-associated (Cas), where such site-specific endonucleases are non- naturaliy occurring and are modified to target a specific gene.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • Cas Clustered regularly interspaced short palindromic repeats/CRISPR-associated
  • site-specific endonucleases can he engineered to cut specific locations within a genome, and non- homologous end j oining can then repair the break while inserting or deleting several nucleotides.
  • Such site-specific endonucleases also referred to as“INDELs” then throw the protein out of frame and effectively knock out the gene.
  • a nucleotide sequence encoding a gene product of interest is operably linked to a constitutive promoter.
  • Suitable constitutive promoters include e.g. cytomegalovirus promoter (CMV) (Stinski et al. (1985) Journal of Virology 55(2): 431-441), CMV early enhancer/chicken b-actin (CBA) promoter/rabbit b-globin intron (CAG) (Miyazaki et al. (1989) Gene 79(2): 269-277, CB SB (Jacobson et al.
  • CMV cytomegalovirus promoter
  • CBA CMV early enhancer/chicken b-actin
  • CAG CAG
  • a nucleotide sequence encoding a gene product of interest is operably linked to an inducible promoter.
  • a nucleotide sequence encoding a gene product of interest is operably linked to a tissue-specific or ceil type-specific regulatory element.
  • a nucleotide sequence encoding a gene product of interest is operably linked to a photoreceptor-specific regulatory element (e.g., a photoreceptor-specific promoter), e.g., a regulatory element that confers selective expression of the operably linked gene in a photoreceptor cell.
  • Suitable photoreceptor-specific regulatory elements include, e.g., a rhodopsm promoter; a rhodopsin kinase promoter (Young et al. (2003) Ophthalmol. Vis. Sci.
  • a beta phosphodiesterase gene promoter (Nicoud et al. (2007) J. Gene Fled.9: 1015); a retinitis pigmentosa gene promoter (Nicoud et al. (2007) supra); an interphotoreceptor retinoid-binding protein (IRBP) gene enhancer (Nicoud et al. (2007) supra); an IRBP gene promoter (Yokoyama et al. (1992) Exp Eye Res. 55:225), an opsin gene promoter (Tucker et al. (1994) PNAS 91 :2611-2615), a retinoschisin gene promoter (Park et al.
  • IRBP interphotoreceptor retinoid-binding protein
  • a nucleotide sequence encoding a gene product of interest is operably linked to a retinal pigment epithelia (RPE) cell-specific regulatory element (e.g., a RPE-specific promoter), e.g., a regulatory element that confers selective expression of the operably linked gene in a RPE cell.
  • RPE retinal pigment epithelia
  • Suitable RPE-specific regulatory elements include, e.g., an RPE65 gene promoter (Meur et al.
  • CRALBP retinaldehydebinding protein
  • PEDF pigment epithelium-derived factor
  • VMD2 vitelliform macular dystrophy
  • a nucleotide sequence encoding a gene product of interest is operabiy linked to a Midler glia cell-specific regulatory element (e.g., a glial- specific promoter), e.g., a regulatory element that confers selective expression of the operabiy linked gene in a retinal glial cell.
  • a glial-specific regulator ' elements include, e.g., a glial fibrillary acidic protein (GFAP) promoter (Besnard et al. (1991) Journal of Biological Chemistry 266(28): 18877-18883).
  • a nucleotide sequence encoding a gene product of interest is operabiy linked to a bipolar cell-specific regulatory element (e.g., a bipolar-specific promoter), e.g., a regulatory element that confers selective expression of the operabiy linked gene m a bipolar cell.
  • a bipolar cell-specific regulatory element e.g., a bipolar-specific promoter
  • Suitable bipolar-specific regulatory elements include, e.g., a GRM6 promoter (Cronin et al. (2014) CM BO Molecular Medicine 6(9): 1175-1190).
  • an isolated nucleic acid comprising a nucleotide sequence that encodes a variant AAV capsid protein as described above.
  • An isolated nucleic acid can be an AAV vector, e.g., a recombinant AAV vector.
  • the disclosure herein also provides a method of treating a retinal disease, the method comprising administering to an individual in need thereof an effective amount of a rAAV variant virion comprising a transgene of interest as described above and disclosed herein.
  • a rAAV variant virion comprising a transgene of interest as described above and disclosed herein.
  • One of ordinary skill in the art would be readily able to determine an effective amount of the subject rAAV virion and that the disease had been treated by testing for a change in one or more functional or anatomical parameters, e.g. visual acuity, visual field, electrophysiological responsiveness to light and dark, color vision, contrast sensitivity, anatomy, retinal health and vasculature, ocular motility, fixation preference, and stability.
  • Nonlimiting methods for assessing retinal function and changes thereof include assessing visual acuity (e.g. best-corrected visual acuity [BCVA], ambulation, navigation, object detection and discrimination), assessing visual field (e.g. static and kinetic visual field perimetry), performing a clinical examination (e.g. slit lamp examination of the anterior and posterior segments of the eye), assessing electrophysiological responsiveness to all wavelengths of light and dark (e.g. all forms of electroretinography (ERG) [full-field, multifocal and pattern], all forms of visual evoked potential (VEP), electrooculography (EOG), color vision, dark adaptation and/or contrast sensitivity).
  • visual acuity e.g. best-corrected visual acuity [BCVA], ambulation, navigation, object detection and discrimination
  • visual field e.g. static and kinetic visual field perimetry
  • performing a clinical examination e.g. slit lamp examination of the anterior and posterior segments of the eye
  • Nonlimiting methods for assessing anatomy and retinal health and changes thereof include Optical Conherence Tomography (OCT), fundus photography, adaptive optics scanning laser ophthalmoscopy (AO- SLO), fluorescence and/or autofluorescence; measuring ocular motility and eye movements (e.g. nystagmus, fixation preference, and stability), measuring reported outcomes (patient-reported changes in visual and non-visually-guided behaviors and activities, patient-reported outcomes [PRO], questionnaire-based assessments of quality-of-life, daily activities and measures of neurological function (e.g. functional Magnetic Resonance Imaging (MRI)).
  • OCT Optical Conherence Tomography
  • AO- SLO adaptive optics scanning laser ophthalmoscopy
  • FPS fluorescence and/or autofluorescence
  • measuring ocular motility and eye movements e.g. nystagmus, fixation preference, and stability
  • measuring reported outcomes patient-reported changes in visual and non-visually-guided behaviors and activities, patient-reported outcomes [PRO],
  • an effective amount of the subject rAAV virion results in a decrease in the rate of loss of retinal function, anatomical integrity, or retinal health, e.g. a 2-fold, 3-fold, 4-fold, or 5-fold or more decrease in the rate of loss and hence progression of disease, for example, a 10-fold decrease or more in the rate of loss and hence progression of disease.
  • the effective amount of the subject rAAV virion results in a gain in visual function, retinal function, an improvement in retinal anatomy or health, and/or an improvement in ocular motility and/or improvement in neurological function, e.g.
  • the dose required to achieve the desired treatment effect will typically be in the range of 1 x 10 8 to about 1 x 10 15 recombinant virions, typically referred to by the ordinarily skilled artisan as 1 x 10 8 to about 1 x 10 15 “vector genomes”.
  • a subject rAAV virion can be administered via intraocular injection, for example by intravitreal injection, by subretinal injection, by suprachoroidal injection, or by any other convenient mode or route of administration that will result in the delivery of the rAAV virion to the eye.
  • Other convenient mancestodes or routes of administration include, without limitation, intravenous, intra-arterial, periocular, intracameral, subconjunctival and sub-tenons injections and topical administration and intranasal.
  • the subject rAAV virion When administered via intravitreal injection, the subject rAAV virion is able to move through the vitreous and traverse the internal limiting membrane (also referred to herein as an inner limiting membrane, or“ILM”; a thin, transparent acellular membrane on the surface of the retina forming the boundary between the retina and the vitreous body, formed by astrocytes and the end feet of Miiller cells), and/or moves through the layers of the retina more efficiently, compared to the capability of an AAV virion comprising the corresponding parental AAV capsid protein.
  • ILM inner limiting membrane
  • a variant capsid protein disclosed herein is isolated, e.g., purified.
  • a variant capsid protein disclosed herein is included in an AAV vector or a recombinant AAV (rAAV) virion.
  • rAAV recombinant AAV
  • such AAV variant vectors and/or AAV variant virions are used in an in vivo or ex vivo method of treating ocular disease in the primate retina.
  • the disclosure herein further provides host cells such as, without limitation, isolated (genetically modified) host cells comprising a subject nucleic acid.
  • a host cell according to the invention disclosed herein can be an isolated cell, such as a cell from an in vitro cell culture. Such a host cell is useful for producing a subject rAAV variant virion, as described herein.
  • a host cell is stably genetically modified with a nucleic acid.
  • a host cell is transiently genetically modified with a nucleic acid.
  • nucleic acid is introduced stably or transiently into a host cell, using established techniques, including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and the like.
  • a nucleic acid will generally further include a selectable marker, e.g., any of several well-known selectable markers such as neomycin resistance, and the like.
  • selectable marker e.g., any of several well-known selectable markers such as neomycin resistance, and the like.
  • Such a host cell is generated by introducing a nucleic acid into any of a variety of cells, e.g., mammalian cells, including, e.g., murine cells, and primate cells (e.g., human cells).
  • Exemplary mammalian cells include, but are not limited to, primary cells and cell lines, where exemplary cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1/2 fibroblasts, CHO cells, and the like.
  • Exemplary host cells include, without limitation, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No.
  • Huh-7 cells BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RAT1 cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.
  • a host cell can also be made using a baculovirus to infect insect cells such as Sf9 cells, which produce AAV (see, e.g., U.S. Pat. No. 7,271,002; U.S. patent application Ser. No. 12/297,958).
  • a genetically modified host cell includes, in addition to a nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein, as described above, a nucleic acid that comprises a nucleotide sequence encoding one or more AAV rep proteins.
  • a host cell further comprises an rAAV variant vector.
  • An rAAV variant virion can be generated using such host cells. Methods of generating an rAAV virion are described in, e.g., U.S. Patent Publication No. 2005/0053922 and U.S. Patent Publication No. 2009/0202490.
  • the disclosure herein additionally provides a pharmaceutical composition
  • a pharmaceutical composition comprising: a) the rAAV variant virion, as described above and disclosed herein; and b) a pharmaceutically acceptable carrier, diluent, excipient, or buffer.
  • the pharmaceutically acceptable carrier, diluent, excipient, or buffer is suitable for use in a human or non-human patient.
  • excipients, carriers, diluents, and buffers include any pharmaceutical agent that can be administered without undue toxicity.
  • Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol and ethanol.
  • Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, surfactants, pH buffering substances, and the like, may be present in such vehicles.
  • mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like
  • organic acids such as acetates, propionates, malonates, benzoates, and the like
  • auxiliary substances such as wetting or emulsifying agents, surfactants, pH buffering substances, and the like, may be present in such vehicles.
  • the present invention provides a pharmaceutical composition comprising about 1 x 10 8 to about 1 x 10 15 recombinant viruses or 1 x 10 8 to about 1 x 10 15 vector genomes, wherein each said recombinant virus comprises a genome encoding one or more gene products.
  • a variant adeno-associated virus (AAV) capsid protein comprising a peptide insertion in the GH-loop of the capsid protein relative to a corresponding parental AAV capsid protein, wherein the peptide insertion comprises the amino acid sequence ISDQTKH (SEQ ID NO: 14), and wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the corresponding parental AAV capsid protein for the retinal cell.
  • variant AAV capsid protein of item 1 wherein the peptide insertion comprises the amino acid sequence Y I Y 2 ISDQTKHY 3 wherein each of Yi- Y 3 is independently selected from Ala, Leu, Gly, Ser, Thr, and Pro.
  • variant AAV capsid protein of item 2 wherein the peptide insertion comprises the amino acid sequence LAISDQTKHA (SEQ ID NO:28).
  • AAV capsid protein of any one of items 1-3 wherein the insertion site is between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2) or the corresponding position in the capsid protein of another AAV serotype.
  • AAV capsid protein of any one of items 1-4, wherein the capsid protein comprises one or more amino acid substitutions relative to VP1 capsid of AAV2 (SEQ ID NO:2) or one or more corresponding substitutions in another AAV serotype.
  • AAV capsid protein of any one of items 1-5 wherein the capsid protein comprises a P34A amino acid substitution relative to VP1 capsid of AAV2 (SEQ ID NO:2) or the corresponding substitution in another AAV serotype.
  • a recombinant AAV (rAAV) virion comprising a variant AAV capsid protein according to any one of items 1-8 and a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.
  • the rAAV of item 9 wherein the gene product is a polypeptide.
  • the heterologous nucleic acid comprises a nucleotide sequence encoding a polypeptide that inhibits the activity of vascular endothelial growth factor (VEGF).
  • VEGF vascular endothelial growth factor
  • nucleotide sequence is at least 90% identical, at least 95% identical or at least 99% identical to the nucleic acid sequence set forth as SEQ ID NO: 65 or to nucleotides 79-1377 of SEQ ID NO:65 and preferably encodes the amino acid sequence set forth as SEQ ID NO: 66 or amino acids 27-458 of SEQ ID NO:66.
  • the rAAV of item 11 wherein the nucleotide sequence encodes a monoclonal antibody or antigen binding fragment thereof.
  • nucleotide sequence comprises a sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence of SEQ ID NO:67 (sc-Ranibizumab HL) or to nucleotides 58-1575 of SEQ ID NO:67 and encodes the amino acid sequence set forth as SEQ ID NO:68 or (ii) encodes the amino acid sequence of amino acids 20-524 of SEQ ID NO:68.
  • nucleotide sequence (i) has a sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence of SEQ ID NO:69 (sc-Ranibizumab LH1) or SEQ ID NO:70 (sc- Ranibizumab LH2) or to nucleotides 61-1578 of SEQ ID NO:69 or SEQ ID NO:70 and encodes the amino acid sequence set forth as SEQ ID NO:7l or (ii) encodes the amino acid sequence of amino acids 21-525 of SEQ ID NO:7l.
  • nucleotide sequence (i) has a sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence of SEQ ID NO:72 (sc-Ranibizumab-Fc) or to nucleotides 61-2277 of SEQ ID NO:72 and encodes the amino acid sequence set forth as SEQ ID NO:73 or (ii) encodes the amino acid sequence of amino acids 21-752 of SEQ ID NO:73.
  • nucleotide sequence has a sequence at least 90% identical, at least 95% identical or at least 99% identical to the nucleic acid sequence set forth as SEQ ID NO:74 or to nucleotides 61-816 of SEQ ID NO:74 and preferably encodes the amino acid sequence set forth as SEQ ID NO:75 or the amino acid sequence of amino acids 21-271 of SEQ ID NO:75.
  • nucleotide sequence (i) has a sequence at least 90% identical, at least 95% identical or at least 99% identical to the sequence of SEQ ID NO:76 (Brolucizumab-Fc) or to nucleotides 61-1530 of SEQ ID NO:76 and encodes the amino acid sequence set forth as SEQ ID NO:77 or (ii) encodes the amino acid sequence of amino acids 21-498 of SEQ ID NO:77.
  • heterologous nucleic acid comprises (i) a sequence encoding Aflibercept, preferably wherein the sequence encoding aflibercept is at least 90% identical, at least 95% identical or at least 99% identical to the nucleic acid sequence set forth as SEQ ID NO: 65 and encodes the amino acid sequence set forth as SEQ ID NO:66 and (ii) a sequence encoding Brolucizumab, preferably wherein the sequence encoding Brolucizumab is at least 90% identical, at least 95% identical or at least 99% identical to the nucleic acid sequence set forth as SEQ ID NO: 74 or SEQ ID NO:76 and preferably encodes the amino acid sequence set forth as SEQ ID NO:75 or SEQ ID NO:77.
  • a pharmaceutical composition comprising an rAAV according to any of items 11-24 and a pharmaceutically acceptable carrier.
  • a method for delivering a VEGF inhibitor to a retinal cell, choroidal cell, lenticular cell, ciliary cell, iris cell, optic nerve cell and/or comeal cell in a subject comprising administering to the subject an rAAV virion according to any one of items 11-24 or a pharmaceutical composition according to item 24.
  • a method for treating a VEGFa-associated ocular disease selected from wet (neovascular, exudative) age-related macular degeneration; macular edema following retinal vein occlusion; retinal neovascularization resulting from retinal vein occlusion; diabetic macular edema, diabetic retinopathy (including all stages of non proliferative diabetic retinopathy and proliferative diabetic retinopathy); myopic macular degeneration; branch retinal vein occlusion, hemi-retinal vein occlusion, and central retinal vein occlusion; retinopathy of prematurity; idiopathic choroidal neovascularization; myopia macular degeneration and secondary retinal and choridal neovascularization; retinal telangiectasia; neovascular glaucoma; vitreous
  • retinal and choroidal neovascularization secondary to retinal diseases including but not limited to uvetis, trauma, retinal degenerative disorders, genetic retinal and/or choroidal disease, tumors of the eye, comeal and iris neovascularization in a subject in need of such treatment by administering to the subject an effective amount of an rAAV according to any one of items 11-24 or a pharmaceutical composition according to item 25.
  • VEGFa-associated ocular disease is selected from wet (neovascular, exudative) age-related macular degeneration; diabetic macular edema; macular edema following retinal vein occlusion; diabetic retinopathy; and myopic choroidal neovascularization.
  • rAAV comprises a capsid protein consisting essentially of the amino acid sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising a sequence encoding Aflibercept, preferably wherein the sequence encoding Aflibercept has the sequence set forth in SEQ ID NO:65.
  • rAAV comprises a capsid protein consisting essentially of the amino acid sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising a sequence encoding
  • the rAAV comprises a capsid protein consisting essentially of the amino acid sequence set forth as SEQ ID NO:42 and a heterologous nucleic acid comprising a sequence encoding brolicizumab or brolicizumab-Fc, preferably wherein the sequence encoding brolicizumab or brolicizumab-Fc has the sequence set forth in SEQ ID NO:74 or SEQ ID NO:76.
  • Euthanasia was performed by trained veterinary staff using 100 mg/kg pentobarbital sodium intravenous injection on day 14+3. Eyes were nucleated and stored at 4°C until dissection.
  • Tissue Dissection Eyes were cut along the ora serrata with a scalpel, and the anterior segment was removed . Relief cuts were made into the retina around the fovea to enable flat mounting of the retina, and the vitreous was removed. Six samples of the retina from each quadrant (superior, inferior, nasal, and temporal) were collected, as shown in Figure 2, and cellular material corresponding to RPE cells, photoreceptors, biopolar cells, amacrine cells, horizontal cells, and/or ganglion cells was isolated.
  • FIG. 1A-1E The directed evolution process is shown in Figure 1A-1E. Briefly, a viral capsid library comprising 20+ proprietary combinations of DNA mutation technique and cap genes is created ( Figure 1A). Viruses are then packaged ( Figure IB)— such that each particle is composed of a mutant capsid surrounding the cap gene encoding that capsid— and purified. The capsid library is placed under selective pressure in vivo. The tissue or cellular material of interest is harvested to isolate AAV variants that have successfully infected that target, and the successful viruses are recovered. Successful clones are enriched through repeated selection (Stage I - Figure ID).
  • Selected cap genes then undergo proprietary re- diversification and are enriched through further selection steps to iteratively increase viral fitness (Stage 2 - F gure ID). Variants identified during Vector Selection Stages 1 and 2 demonstrate the ability to transduce primate retina cells ( Figure IE).
  • Successful Recovery of AAV Capsid Genomes Rounds 1-6. The capsids recovered from each round of selection were used to package the library injected to initiate the subsequent round of selection. Recovery of capsid genes from tissue represents successful internalization of library vectors into the tissue of interest. Following Round 4, additional re-diversification of the library was incorporated prior to library packaging and injection for Round 5. Recovery of viral genomes from RPE, PR, inner nuclear layer (INL), and ganglion cell layer (GCL) retinal tissue from a representative round of selection are shown in Figure 3. Bands within boxes represent successful recovery of viral genomes.
  • Sequencing Analysis Rounds 3-6. During rounds 3-6, sequencing was performed on individual clones within the library to determine the frequency of variants within the population. Variants were evaluated for the presence of motifs within the sequencing data. Variants were grouped into motifs based on the presence of a unifying variation (for example, a specific point mutation or specific peptide insertion sequence in a consistent location within the capsid) that occurred in multiple sequences.
  • a unifying variation for example, a specific point mutation or specific peptide insertion sequence in a consistent location within the capsid
  • Motifs representing at least 5% of the sequenced population in two or more rounds of the selection or at least 10% of the sequenced population in one or more rounds of the selection are represented in Figure 4A (Round 3 sequencing analysis), 4B (Round 4 sequencing analysis), 4C (Round 5 sequencing analysis), and 4D (Round 6 sequencing analysis).
  • capsid having increased infectivity of one or more cells of the retina was a clone having the following ancestral VP1 capsid sequence:
  • This ancestral capsid variant is evolved from the ancestral capsid SEQ ID NO:58, in which the positions of degeneracy (residues 264, 266, 268, 448, 459, 460, 467, 470, 471, 474, 495, 516, 533, 547, 551, 555, 557, 561, 563, 577, 583, 593, 596, 661, 662, 664, 665, 710, 717, 718, 719, 723) evolved to comprise Alanine (A) at 264, Alanine (A) at 266, Serine (S) at 268, Alanine (A) at 448, Threonine (T) at 459, Arginine (R) at 460, Alanine (A) at 467, Serine (S) at 470, Asparagine (N) at 471, Alanine (A) at 474, Serine (S) at 495, Asparagine (D) at 516, Asparagine (D) at
  • AAV variant virions disclosed herein may incorporate reasonable rational design parameters, features, modifications, advantages, and variations that are readily apparent to those skilled in the art in the field of engineering AAV viral vectors.
  • Example 2
  • AAV adeno-associated virus
  • IVT intravitreal
  • the cell tropism following intravitreal administration of the novel AAV variant comprising a P34A substitution and the peptide LAISDQTKHA (SEQ ID NO:28) inserted at amino acid 588 (LAISDQTKHA+P34A; SEQ ID NO:42) was assessed in vivo in non-human primates (NHP) as a representative example of the ability of ISDQTKH (SEQ ID NO: l4)-containing AAV variants to transduce retinal cells.
  • Recombinant AAV virions comprising either an AAV2 capsid or the novel variant capsid LAISDQTKHA+P34A (SEQ ID NO:42) and a genome comprising a green fluorescent protein (GFP) transgene operably linked to a CMV promoter (AAV2.CMV.GFP and LAISDQTKHA+P34A.CMV.GFP, respectively) or a CAG promoter (AAV2.CAG.EGFP and LAISDQTKHA+P34A.CAG.EGFP, respectively) were manufactured using standard methods.
  • GFP green fluorescent protein
  • AAVs comprising the novel variant LAISDQTKHA+P34A (SEQ ID NO:42) resulted in broader and more robust transgene expression across the NHP retina than AAV2 ( Figures 7-9). Images reveal that the novel AAV variant capsid provides for robust expression within the center of the fovea (an area rich in cones); in the parafoveal ring (an area rich in retinal ganglion cells), and in the periphery (an area rich in many types of cells including rods, Muller glia, amacrine cells, bipolar cells) as early as 2 weeks after injection.
  • wild type AAV2 provides for weaker expression that is primarily in the parafoveal ring and can only be detected at later time points.
  • Immunohistochemical analysis of various regions of the retina performed 3 weeks after injection confirmed that many types of retinal cells, including retinal pigment epithelial cells, rod and cone photoreceptors, and retinal ganglion cells, had been successfully transduced throughout the retina ( Figures 10A- 10E).
  • RPE retinal pigment epithelial
  • PR photoreceptor
  • AAV virions comprising either an AAV2 capsid or the novel variant capsid LAISDQTKHA+P34A (SEQ ID NO:42) and a genome comprising a green fluorescent protein (EGFP) transgene operably linked to a CAG promoter (AAV2.CAG.EGFP and LAISDQTKHA+P34A.CAG.EGFP, respectively) were manufactured using standard methods.
  • Human RPE cell cultures were generated from the human embryonic stem cell line ESI-017 or human fibroblast-derived induced pluripotent stem cells (FB-iPSC) using a 45-day differentiation protocol.
  • RPE65 and BEST1 Maturation into RPE cells was confirmed by detecting the expression of mature RPE markers including RPE65 and BEST1; the synthesis of VEGF and PEDF; and the ability to phagocytose rod outer segments.
  • PR cultures were generated by a multi-step eye cup formation paradigm and confirmed to comprise PRs by detecting the expression of Recoverin and S Opsin after 179 days in culture.
  • LAISDQTKHA+P34A (SEQ ID NO:42) provided for significantly higher transduction efficiency of and transgene expression in human RPE cultures seven days post-infection as determined by immunofluorescence ( Figures 11A-B), flow cytometry (2.7-fold increase; Figures 11C-D) and Western blot analysis ( Figures 11E-F). Robust transduction and expression was likewise achieved using LAISDQTKHA+P34A.CAG.EGFP in human PR cultures by 32 days post-infection. This study illustrates the superior ability of ISDQTKH (SEQ ID NO: l4)-comprising variants to deliver genes to retinal cells.
  • Aflibercept consists of the human Fltl signal peptide, VEGFR1 domain 2, and VEGFR2 domain 3 fused to the Fc region of human IgGl ( Figure 12A; SEQ ID NO:66).
  • the amino acid sequences of the light and heavy chains of Ranibizumab were joined by a flexible protein linker to convert the two- chain antigen-binding fragment (Fab) into a single-chain Fab (scFab).
  • the Light- Heavy (LH) form consists of the human Ig kappa light chain signal peptide, the variable light, constant light, variable heavy, and constant heavy 1 domains of Ranibizumab linked by the flexible peptide ( Figure 12B; SEQ ID NO:7l).
  • the Heavy -Light (HL) form is similar except the signal peptide is derived from the human IgG heavy chain and the heavy and light domains are on opposite sides of the linker as compared to the LH form ( Figure 12C; SEQ ID NO:68).
  • the Brolucizumab design includes variable light and variable heavy domains linked by a flexible peptide, with the human Ig kappa light chain signal peptide for secretion from mammalian cells ( Figure 12D; SEQ ID NO: 75).
  • the open reading frames were codon-optimized for improved expression from human cells and synthesized by GeneArt or GenScript and provided in a standard plasmid cloning vector.
  • the DNA of interest was excised from this plasmid with the restriction enzymes Pstl and BglII and inserted into pAAV- CAG-SV40 pA plasmid between the CAG promoter and the SV40 polyA signal.
  • the sc-Ranibizumab-Fc design consists of the LH form of sc-Ranibizumab fused to the Fc region of human IgGl from the Aflibercept design ( Figure 12E; SEQ ID NO:73).
  • the Brolucizumab-Fc design consists of Brolucizumab fused to the Fc region of human IgGl from the Aflibercept design ( Figure 12F; SEQ ID NO:77).
  • the sc-Ranibizumab LH, Brolucizumab, and Fc regions were amplified by PCR from the initial cloning vectors with extensions containing a site for the TypellS restriction enzyme BsmBI at the 3’ end (sc-Ranibizumab LH and Brolucizumab) or 5’ end (Fc).
  • the resulting PCR products were digested with the restriction enzymes Pstl and BsmBI (sc-Ranibizumab LH and Brolucizumab) or BsmBI and BglII (Fc) and inserted into pAAV-CAG-SV40 pA plasmid between the CAG promoter and the SV40 polyA signal.
  • the ligation reactions were used to transform E. coli and positive clones were identified by restriction digest. Clones were then grown at a larger scale and plasmid DNA purified with the Qiagen Endo-Free Maxiprep kit. The identity of the plasmids was verified by restriction digest and sequencing.
  • the pAAV-CAG-SV40 poly A plasmid contains AAV2 inverted terminal repeats (ITRs), which allow the anti-VEGF sequences to be packaged inside AAV capsids and delivered to cells of interest in the retina via intravitreal administration.
  • HEK293T cells were mock transfected or transfected with plasmid containing either GFP or an anti-VEGF transgene (sc-RNBZ HL (SEQ ID NO:67), sc-RNBZ LH1 (SEQ ID NO:69) and SC-RNBZ-LH2 (SEQ ID NO:70), AFLB (SEQ ID NO:65), BRO (SEQ ID NO:74)) under the control of the CAG promoter using FuGene6 transfection reagent in two separate experiments. Media was collected at 48 hr post-transfection and assayed with the Aflibercept ELISA kit (Eagle Biosciences, Immunoguide IG-AA115).
  • Anti-VEGF proteins were detected by the HRP-anti-IgG Fc provided as a reagent in the kit (mock, GFP, and AFLB) or HRP-anti-IgG H+L (sc-RNBZ HL, sc-RNBZ LH1, and sc-RNBZ LH2). Concentrations were calculated relative to clinical Eylea (mock, GFP, and AFLB) or Lucentis (sc-RNBZ HL, sc- RNBZ LH1, sc-RNBZ LH2, and BRO).
  • Aflibercept expression was about 15 ug/ml and sc-Ranibizumab expression ranged from 1.6 to 2.8 ug/ml, with the LH forms expressing similar concentrations and the HL form expression approximately a two-fold lower concentration (Figure 13 A).
  • Aflibercept expression was about 50 ug/ml and sc-Ranibizumab LH1 expression was about 4.0 ug/ml ( Figure 13B).
  • the signal with Brolucizumab was very low, most likely due to poor recognition by the detection antibody. No VEGF binding activity was detected in media from mock or GFP transfections.
  • the blot was probed with HRP-conjugated goat anti-human IgG Fc (Thermo Cat# 31413, left panel) or goat anti-human IgG Fab (Thermo Cat# 31482, right panel) using an iBind Flex device, and visualized with SuperSignal West Dura Chemiluminescent Substrate (Thermo Cat# 34076). Images were captured with an iBright FL1000 imager.
  • the Aflibercept sample appears similar to the clinical comparator protein Eylea. There was no signal in the negative control samples.
  • the clinical comparator protein Lucentis is reduced into separate light and heavy chains of 24 kD whereas the sc-Ranibizumab proteins run at about 48 kD due to the existence of a polypeptide linker binding the light and heavy chains into a single protein.
  • a higher quantity of the LH forms of the protein are present compared to the HL form of the protein, consistent with the protein quantification obtained through ELISA ( Figure 13 A).
  • the Brolucizumab signal is low, most likely due to poor recognition by the detection antibody.
  • the protein migrates at the correct molecular mass of 24 kD.
  • VEGF competition ELISA was performed ( Figure 15). Clinical comparator proteins Eylea or Lucentis and media from transfected HEK293T cells were incubated with 13 pM VEGF at room temperature overnight. Samples were assayed for free VEGF using the Quantikine VEGF ELISA kit (R&D Systems Cat# DVE00). In the first of two experiments, the inhibition curves of the four anti-VEGF proteins from the transfected samples were very similar to the clinical Eylea and Lucentis. Aflibercept and Eylea competed for VEGF more strongly than the sc-Ranibizumab variants and Lucentis ( Figure 15A).
  • the inhibition curves of the anti-VEGF proteins from the transfected samples are equal to the clinical comparator proteins, demonstrating that the expressed proteins block VEGF function in a cell-based assay ( Figure 16).
  • the cellular VEGF neutralization assay was also performed with equal volumes of media from HEK293T cells transfected with anti -VEGF constructs.
  • GFP, Aflibercept (SEQ ID NO:65), sc-Ranibizumab HL (SEQ ID NO:67), or sc-Ranibizumab LH1 (SEQ ID NO:69) expression plasmids were evaluated. All anti-VEGF constructs evaluated neutralized VEGF (Figure 17A).
  • GFP, Aflibercept (SEQ ID NO:65), sc- Ranibizumab LH1 (SEQ ID NO:69), or Brolucizumab (SEQ ID NO:74) expression plasmids were mixed with 8 ng/ml VEGF and placed on PathHunter KDR cells (DiscoverX 93-0996Y1). The cells were lysed 18 hr later and assayed for beta- galactosidase activity. Again, all anti-VEGF constructs evaluated neutralized VEGF ( Figure 17B). There was a slight matrix effect from the GFP control sample at the dilutions assayed.
  • RPE Retinal pigment epithelia
  • AAV expression plasmids carrying genes for Aflibercept (SEQ ID NO:65), sc-Ranibizumab (SEQ ID NOs:67 and 69), or Brolucizumab (SEQ ID NO:74) were used to package viral DNA in the R100 variant capsid (having the amino acid sequence set forth as SEQ ID NO:42).
  • Mature RPE cells were transduced 30 days after seeding in l2-well plates at MOI 5,000 with these vectors in a volume of 1.0 ml X-VivolO media. Media was changed three days after transduction, collected and replaced six days after transduction, and collected and replaced again ten days after transduction.
  • the total concentration of VEGF in the media was assayed with the Quantikine VEGF ELISA kit (R&D Systems Cat# DVE00) to determine the effect of transduction with the anti-VEGF vectors on the level of free detectable endogenous VEGF secreted by the RPE cells into the media ( Figure 19).
  • the endogenous level of VEGF as indicated by the cells transduced with a GFP control vector was 4,500 pg/ml in the day 6 sample and 8,300 pg/ml in the day 10 sample. Transduction with all of the anti-VEGF vectors resulted in little to no detectable VEGF in the media.
  • sc-Ranibizumab expression ranged from 700 ng/ml for the HL (SEQ ID NO:67) day 6 sample to 1,700 ng/ml for the LH (SEQ ID NO:69) day 10 sample ( Figure 20).
  • the signal with Brolucizumab (SEQ ID NO:74) was very low, most likely due to poor recognition by the detection antibody. No VEGF binding activity was detected in media from the GFP transduction.
  • the blot was probed with HRP-conjugated goat anti-human IgG Fc (Thermo Cat# 31413, left panel) or goat anti -human IgG Fab (Thermo Cat# 31482, right panel) using an iBind Flex device, and visualized with SuperSignal West Dura Chemiluminescent Substrate (Thermo Cat# 34076). Images were captured with a ChemiDoc MP imager.
  • the Aflibercept (SEQ ID NO:65) samples appear similar to the clinical comparator protein Eylea (black arrow). There was no band of the correct mobility in the GFP negative control sample. The clinical Lucentis is reduced into separate light and heavy chains of 24 kD, whereas sc-Ranibizumab HL (SEQ ID NO:67) and LH (SEQ ID NO:69) are not separated and migrate at apparent molecular mass of 58 kD, as indicated by the gray arrow. The signal with Brolucizumab (SEQ ID NO:74) is low, most likely due to poor recognition by the detection antibody. The protein migrates at the correct molecular mass of 26 kD, as indicated by the stippled arrow. Protein levels are fairly similar in the day 6 and day 10 samples.
  • VEGF competition ELISA was performed ( Figure 22). Equal volumes of media from transduced RPE cells were incubated with 13 pM VEGF at room temperature overnight. Samples were assayed for free VEGF using the Quantikine VEGF ELISA kit (R&D Systems Cat# DVE00). Media from the cells transduced with all anti-VEGF constructs competed for VEGF. Results were similar for the day 6 and day 10 samples. There was no competition activity from the GFP negative control sample. Free VEGF levels are higher in the lowest dilutions due to the endogenous VEGF produced by the RPE cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
PCT/US2018/062478 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis Ceased WO2019104279A1 (en)

Priority Applications (29)

Application Number Priority Date Filing Date Title
NZ765038A NZ765038B2 (en) 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
AU2018372235A AU2018372235B9 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
BR112020010674-7A BR112020010674A2 (pt) 2017-11-27 2018-11-26 capsídeos de variante de vírus adeno-associado e uso para inibir a angiogênese
CA3083472A CA3083472A1 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
KR1020257011121A KR20250052478A (ko) 2017-11-27 2018-11-26 아데노-관련 바이러스 변이체 캡시드 및 혈관 신생을 억제하기 위한 용도
KR1020207017143A KR102793696B1 (ko) 2017-11-27 2018-11-26 아데노-관련 바이러스 변이체 캡시드 및 혈관 신생을 억제하기 위한 용도
ES18881166T ES2946747T3 (es) 2017-11-27 2018-11-26 Variantes de cápsides de virus adenoasociado y su utilización para inhibir la angiogénesis
UAA202003841A UA127831C2 (uk) 2017-11-27 2018-11-26 Капсид аденоасоційованого вірусу та його застосування для інгібування ангіогенезу
US16/765,758 US11766489B2 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
SG11202004545XA SG11202004545XA (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
DK18881166.5T DK3717636T5 (da) 2017-11-27 2018-11-26 Adeno-associeret-virus-variantcapsider og anvendelse til inhibering af angiogenese
FIEP18881166.5T FI3717636T3 (fi) 2017-11-27 2018-11-26 Adenoassosioidun viruksen kapsidivariantteja ja käyttö angiogeneesin estämisessä
RU2020121215A RU2773756C2 (ru) 2017-11-27 2018-11-26 Варианты капсидов аденоассоциированного вируса и их применение для ингибирования ангиогенеза
PE2020000575A PE20210915A1 (es) 2017-11-27 2018-11-26 Capsides variantes de virus adenoasociados y su uso para inhibir la angiogenesis
CR20200282A CR20200282A (es) 2017-11-27 2018-11-26 Cápsides variantes de virus adenoasociados y su uso para inhibir la angiogénesis
EP18881166.5A EP3717636B1 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
EP23152950.4A EP4219695A3 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
JP2020528888A JP7184894B2 (ja) 2017-11-27 2018-11-26 アデノ随伴ウイルス変異キャプシドおよび血管新生の阻害のための使用
CN201880087687.3A CN111770999A (zh) 2017-11-27 2018-11-26 腺相关病毒变体衣壳和用于抑制血管生成的应用
EP23186524.7A EP4272728A3 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
MX2020005451A MX2020005451A (es) 2017-11-27 2018-11-26 Capsides variantes de virus adenoasociados y uso para inhibir la angiogenesis.
IL274712A IL274712A (en) 2017-11-27 2020-05-17 Adeno-associated virus variant capsids and use to prevent angiogenesis
PH12020550706A PH12020550706A1 (en) 2017-11-27 2020-05-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
AU2022203494A AU2022203494B2 (en) 2017-11-27 2022-05-23 Adeno-Associated Virus Variant Capsids And Use For Inhibiting Angiogenesis
JP2022101767A JP2022121534A (ja) 2017-11-27 2022-06-24 アデノ随伴ウイルス変異キャプシドおよび血管新生の阻害のための使用
US18/466,517 US20240335560A1 (en) 2017-11-27 2023-09-13 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
JP2023205214A JP2024015194A (ja) 2017-11-27 2023-12-05 アデノ随伴ウイルス変異キャプシドおよび血管新生の阻害のための使用
AU2024220028A AU2024220028A1 (en) 2017-11-27 2024-09-24 Adeno-Associated Virus Variant Capsids And Use For Inhibiting Angiogenesis
JP2025272541A JP2026040557A (ja) 2017-11-27 2025-12-22 アデノ随伴ウイルス変異キャプシドおよび血管新生の阻害のための使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201762590976P 2017-11-27 2017-11-27
US62/590,976 2017-11-27
US201862664726P 2018-04-30 2018-04-30
US62/664,726 2018-04-30

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/765,758 A-371-Of-International US11766489B2 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis
US202318350273A Continuation 2017-11-27 2023-07-11

Publications (1)

Publication Number Publication Date
WO2019104279A1 true WO2019104279A1 (en) 2019-05-31

Family

ID=66631726

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/062478 Ceased WO2019104279A1 (en) 2017-11-27 2018-11-26 Adeno-associated virus variant capsids and use for inhibiting angiogenesis

Country Status (21)

Country Link
US (1) US11766489B2 (https=)
EP (3) EP3717636B1 (https=)
JP (4) JP7184894B2 (https=)
KR (2) KR102793696B1 (https=)
CN (1) CN111770999A (https=)
AU (3) AU2018372235B9 (https=)
BR (1) BR112020010674A2 (https=)
CA (1) CA3083472A1 (https=)
CL (1) CL2020001360A1 (https=)
CR (1) CR20200282A (https=)
DK (1) DK3717636T5 (https=)
ES (1) ES2946747T3 (https=)
FI (1) FI3717636T3 (https=)
IL (1) IL274712A (https=)
MX (1) MX2020005451A (https=)
PE (1) PE20210915A1 (https=)
PH (1) PH12020550706A1 (https=)
PT (1) PT3717636T (https=)
SG (1) SG11202004545XA (https=)
UA (1) UA127831C2 (https=)
WO (1) WO2019104279A1 (https=)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021084133A1 (en) * 2019-10-31 2021-05-06 Universität Bern Aav vector variants for ocular gene delivery
WO2021050614A3 (en) * 2019-09-09 2021-05-20 Massachusetts Eye And Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (aav) and the aav receptor (aavr) for altered bio-distribution of aav
US11066465B2 (en) 2015-12-30 2021-07-20 Kodiak Sciences Inc. Antibodies and conjugates thereof
US11149256B2 (en) 2018-09-26 2021-10-19 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
US11155610B2 (en) 2014-06-28 2021-10-26 Kodiak Sciences Inc. Dual PDGF/VEGF antagonists
WO2022126188A1 (en) * 2020-12-16 2022-06-23 Children's Medical Research Institute Aav capsids and vectors
WO2022126189A1 (en) * 2020-12-16 2022-06-23 Children's Medical Research Institute Adeno-associated virus capsids and vectors
US20220267739A1 (en) * 2017-12-19 2022-08-25 Akouos, Inc. Aav-mediated delivery of therapeutic antibodies to the inner ear
WO2022217110A1 (en) * 2021-04-09 2022-10-13 Avirmax, Inc. Compositions and methods for ocular transgene expression
WO2022223644A2 (en) 2021-04-20 2022-10-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions and methods for treating retinal degenerative disorders
WO2023089151A1 (en) * 2021-11-19 2023-05-25 The University Of Bristol Materials and methods for treatment of macular degeneration
WO2023173086A1 (en) * 2022-03-11 2023-09-14 Avirmax Biopharma Inc. Compositions and methods for expressing therapeutics
EP4028058A4 (en) * 2019-09-09 2023-09-27 The Regents of the University of California COMPOSITIONS AND METHODS FOR PRODUCING AND USING MULTISPECIFIC ANTIBODIES
US11912784B2 (en) 2019-10-10 2024-02-27 Kodiak Sciences Inc. Methods of treating an eye disorder
WO2024084075A1 (en) 2022-10-20 2024-04-25 Sparingvision Compositions and methods for treating retinal degenerative disorders
US11987801B2 (en) 2018-05-11 2024-05-21 Massachusetts Eye And Ear Infirmary Altering tissue tropism of adeno-associated viruses
WO2024102703A3 (en) * 2022-11-07 2024-06-27 The Regents Of The University Of California Zikv-based gene delivery system
US12071476B2 (en) 2018-03-02 2024-08-27 Kodiak Sciences Inc. IL-6 antibodies and fusion constructs and conjugates thereof
EP4185333A4 (en) * 2020-07-21 2024-09-04 Frontera Therapeutics, Inc. COMPOSITION AND METHOD FOR TREATING EYE DISEASES
US12116385B2 (en) 2021-10-08 2024-10-15 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
WO2025103416A1 (zh) * 2023-11-14 2025-05-22 上海朗昇生物科技有限公司 用于老年相关性黄斑变性的治疗的基因治疗药物
EP4330411A4 (en) * 2021-04-27 2025-06-04 4D Molecular Therapeutics Inc. COMPOSITIONS AND METHODS FOR THE TREATMENT OF AN EYE DISEASE ASSOCIATED WITH ANGIOGENESIS
EP4346767A4 (en) * 2021-06-03 2025-06-25 Dyno Therapeutics, Inc. CAPSIDE VARIANTS AND METHODS OF USE THEREOF
US12365726B2 (en) 2020-12-01 2025-07-22 Akouos, Inc. Anti-VEGF antibody constructs
RU2846105C1 (ru) * 2020-09-03 2025-08-29 Юниверсити Оф Массачусеттс Аденоассоциированный вирус для доставки kh902 (конберцепта) и его применения
US12480098B1 (en) 2024-10-18 2025-11-25 Aavatar Therapeutics Co., Ltd. Adeno-associated virus variant

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118718181A (zh) 2019-06-05 2024-10-01 里珍纳龙药品有限公司 用于精确剂量递送的装置及方法
CN113041360A (zh) * 2021-04-01 2021-06-29 深圳廷美奥生物技术有限公司 一种用于治疗年龄相关性黄斑变性的药物
MX2023014041A (es) * 2021-05-28 2023-12-15 Shanghai Regenelead Therapies Co Ltd Virus adenoasociado recombinante que tiene una capsida variante y su aplicacion.
CN113481237A (zh) * 2021-06-29 2021-10-08 厦门朔望医药科技有限公司 一种预防和治疗新生血管眼部疾病的基因药物
WO2023280157A1 (zh) * 2021-07-05 2023-01-12 武汉纽福斯生物科技有限公司 一种抗vegf抗体体内表达系统的构建和应用
AU2022340595A1 (en) * 2021-09-06 2024-04-18 Huidagene Therapeutics (Singapore) Pte. Ltd. Treatment of rpe65-associated eye diseases and disorders
CN114057840B (zh) * 2021-10-14 2022-09-20 和元生物技术(上海)股份有限公司 包含变异的aav9衣壳蛋白的重组腺相关病毒颗粒
WO2023072181A1 (en) * 2021-10-28 2023-05-04 Shanghai Vitalgen Biopharma Co., Ltd. Adeno-associated virus capsid
IL313832A (en) * 2021-12-28 2024-08-01 Chengdu Origen Biotechnology Co Ltd Modified AAV capsid protein and its use
KR20250017245A (ko) * 2022-06-07 2025-02-04 청두 오리젠 바이오테크놀로지 씨오., 엘티디. 아데노 관련 바이러스 약학적 조성물 및 이의 용도
CN115850392B (zh) * 2022-09-28 2026-04-17 苏州吉恒基因科技有限公司 衣壳蛋白融合细胞穿膜肽的腺相关病毒突变体及其应用
USD1120314S1 (en) 2022-11-30 2026-03-24 Regeneron Pharmaceuticals, Inc. Dose delivery device
CN116789738B (zh) * 2022-12-08 2023-12-19 广州派真生物技术有限公司 腺相关病毒突变体及其应用
CN115947796B (zh) * 2022-12-30 2026-01-09 衠奥生物技术(武汉)有限公司 一种重组腺相关病毒载体及其在基因递送中的应用
CN121285568A (zh) * 2023-03-30 2026-01-06 制药五有限责任公司 编码视杆细胞源性视锥细胞活力因子和人IgK信号序列的载体
KR20260016939A (ko) * 2023-05-23 2026-02-04 이노벡 바이오테라퓨틱스 아데노 부속 바이러스 캡시드 단백질, 이를 포함하는 아데노 부속 바이러스, 벡터 및 응용
CN117247434B (zh) * 2023-11-10 2024-02-02 上海朗昇生物科技有限公司 衣壳修饰型病毒载体及其制备和用途
WO2025103468A1 (zh) * 2023-11-15 2025-05-22 成都弘基生物科技有限公司 一种重组腺相关病毒药物组合物及其用途
CN120060370A (zh) * 2023-11-29 2025-05-30 上海科锐克医药科技有限公司 用于递送人vegf受体融合蛋白的基因递送载体及其应用
CN120230798A (zh) * 2023-12-29 2025-07-01 上海朗昇生物科技有限公司 用于视网膜基因递送的重组腺相关病毒载体及其应用
CN118903383B (zh) * 2024-10-09 2025-02-25 中山大学中山眼科中心 Vegf-b蛋白、vegf-b蛋白活性肽段在制备预防和/或治疗急性前葡萄膜炎的药物中的应用

Citations (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003054197A2 (en) 2001-12-21 2003-07-03 Medigene Ag A library of modified structural genes or capsid modified particles useful for the identification of viral clones with desired cell tropism
US20040002159A1 (en) 2002-04-05 2004-01-01 Weidong Xiao Methods for the production of chimeric adeno-associated virus (AAV) vectors, compositions of chimeric AAV vectors, and methods of use thereof
US20050053922A1 (en) 2003-06-30 2005-03-10 Schaffer David V. Mutant adeno-associated virus virions and methods of use thereof
EP1310571B1 (en) 2001-11-13 2006-02-15 The Trustees of The University of Pennsylvania A Method of identifying unknown adeno-associated virus (AVV) sequences and a kit for the method
US20060292117A1 (en) 2002-04-17 2006-12-28 Loiler Scott A Improved rAAv vectors
US7271002B2 (en) 2001-11-09 2007-09-18 United States Of America, Represented By The Secretary, Department Of Health And Human Services Production of adeno-associated virus in insect cells
EP1496944B1 (en) 2002-05-01 2008-08-20 University of Florida Research Foundation, Inc. Improved raav expression systems for genetic modification of specific capsid proteins
EP1664314B1 (en) 2003-06-11 2008-10-01 Müller, Dr., Oliver Improved adeno-associated virus (aav) vector for gene therapy
WO2008124015A1 (en) 2007-04-09 2008-10-16 The Regents Of The University Of California Methods for purifying adeno-associated virus virions
US20090202490A1 (en) 2003-06-30 2009-08-13 Schaffer David V Mutant adeno-associated virus virions and methods of use thereof
US20090215879A1 (en) 2008-02-26 2009-08-27 University Of North Carolina At Chapel Hill Methods and compositions for adeno-associated virus (aav) with hi loop mutations
US20090317417A1 (en) 2006-04-28 2009-12-24 The Trustees Of The University Of Pennsylvania Modified AAV Vectors Having Reduced Capsid Immunogenicity and Use Thereof
EP1135468B1 (en) 1998-11-10 2010-01-06 University Of North Carolina At Chapel Hill Virus vectors and methods of making and administering the same
EP1791858B1 (en) 2004-09-24 2010-04-21 Intercell AG Modified vp1-capsid protein of parvovirus b19
US20100203083A1 (en) 2007-05-31 2010-08-12 Medigene Ag Mutated structural protein of a parvovirus
US20100297177A1 (en) 2007-05-31 2010-11-25 Ludwig-Maximillians-Universitaet Mutated parvovirus structural proteins as vaccines
WO2011038187A1 (en) 2009-09-25 2011-03-31 The Trustees Of The University Of Pennsylvania Controlled adeno-associated virus (aav) diversification and libraries prepared therefrom
US20110171262A1 (en) 2008-06-17 2011-07-14 Andrew Christian Bakker Parvoviral capsid with incorporated gly-ala repeat region
US20110275529A1 (en) 2008-09-19 2011-11-10 Charite Universitatsmedizin Berlin Identification and characterisation of recombinant viral gene therapy vectors
US20110301073A1 (en) 2010-05-17 2011-12-08 Sangamo Biosciences, Inc. Novel DNA-binding proteins and uses thereof
US20120070899A1 (en) 2009-06-03 2012-03-22 Cedars-Sinai Medical Center Effective vector platform for gene transfer and gene therapy
US20120220492A1 (en) 2003-05-23 2012-08-30 Mount Sinai School Of Medicine Of New York University Viral Vectors with Improved Properties
US20130059732A1 (en) 2011-08-24 2013-03-07 The Board Of Trustees Of The Leland Stanford Junior University Aav capsid proteins for nucleic acid transfer
EP1668143B1 (en) 2003-09-30 2013-03-20 The Trustees of The University of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
US20130078249A1 (en) * 2011-08-23 2013-03-28 Oliver Ast Bispecific t cell activating antigen binding molecules
EP2357010B1 (en) 2005-04-07 2013-06-12 The Trustees of The University of Pennsylvania Method of increasing the function of an AAV vector
US20130195801A1 (en) 2010-04-23 2013-08-01 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
WO2013123503A1 (en) 2012-02-17 2013-08-22 The Children's Hospital Of Philadelphia Aav vector compositions and methods for gene transfer to cells, organs and tissues
US20130295614A1 (en) 2012-05-02 2013-11-07 Sangeetha Hareendran Nucleotide sequences, methods, kit and a recombinant cell thereof
US20130296409A1 (en) 2010-11-10 2013-11-07 Fred Hutchinson Cancer Research Center Compositions and methods for generating adeno-associated viral vectors with undetectable capsid gene contamination
WO2013170078A1 (en) 2012-05-09 2013-11-14 Oregon Health & Science University Adeno associated virus plasmids and vectors
WO2013174760A1 (en) 2012-05-25 2013-11-28 Deutsches Krebsforschungszentrum Optimized aav-vectors for high transduction rates in dendritic cells
US20130323226A1 (en) 2011-02-17 2013-12-05 The Trustees Of The University Of Pennsylvania Compositions and Methods for Altering Tissue Specificity and Improving AAV9-Mediated Gene Transfer
EP2692731A1 (en) 2012-07-31 2014-02-05 Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe Recombinant Adeno-Associated virus (AAV) vector particles displaying high-affinity ligands for cell-type specific gene delivery
US20140037585A1 (en) 2011-02-14 2014-02-06 The Children's Hospital Of Philadelphia AAV8 Vector with Enhanced Functional Activity and Methods of Use Thereof
US20140056854A1 (en) 2011-02-10 2014-02-27 The University Of North Carolina At Chapel Hill Viral vectors with modified transduction profiles and methods of making and using the same
WO2014052789A1 (en) 2012-09-28 2014-04-03 The University Of North Carolina At Chapel Hill Aav vectors targeted to oligodendrocytes
WO2014103957A1 (ja) 2012-12-25 2014-07-03 タカラバイオ株式会社 Aav変異体
US20140213769A1 (en) * 2011-06-10 2014-07-31 Knu-Industry Cooperation Foundation Fusion protein for suppressing cancer cell growth and suppressing vasculogenesis, and anticancer composition comprising same
WO2014124282A1 (en) 2013-02-08 2014-08-14 The Trustees Of The University Of Pennsylvania Enhanced aav-mediated gene transfer for retinal therapies
WO2014160092A1 (en) 2013-03-13 2014-10-02 The Children's Hospital Of Philadelphia Adeno-associated virus vectors and methods of use thereof
US20140359799A1 (en) 2011-12-23 2014-12-04 Case Western Reserve University Targeted gene modification using hybrid recombinant adeno-associated virus
WO2014194132A1 (en) 2013-05-31 2014-12-04 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
US20140364338A1 (en) 2011-04-22 2014-12-11 The Regents Of The University Of California Adeno-Associated Virus Virions with Variant Capsid and Methods of Use Thereof
US20150065562A1 (en) 2012-04-18 2015-03-05 The Children's Hospital Of Philadelphia Composition and methods for highly efficient gene transfer using aav capsid variants
EP1633772B1 (en) 2003-06-19 2015-11-18 Avigen, Inc. Aav virions with decreased immunoreactivity and uses therefor
WO2017197355A2 (en) 2016-05-13 2017-11-16 4D Molecular Therapeutics Inc. Adeno-associated virus variant capsids and methods of use thereof
WO2017218974A2 (en) 2016-06-16 2017-12-21 Adverum Biotechnologies, Inc. Treatment of amd using aav2 variant with aflibercept

Family Cites Families (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US608200A (en) 1898-08-02 Toy cannon
CA2265460A1 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services Aav4 vector and uses thereof
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US7323179B2 (en) 1997-12-19 2008-01-29 Naomi Balaban Methods and compositions for the treatment and prevention of Staphylococcus and other bacterial infections
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
EP1082413B1 (en) 1998-05-28 2008-07-23 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Aav5 vector and uses thereof
US6984517B1 (en) 1998-05-28 2006-01-10 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector and uses thereof
US6759237B1 (en) 1998-11-05 2004-07-06 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
CA2349838C (en) 1998-11-05 2011-06-07 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
DE19956568A1 (de) 1999-01-30 2000-08-17 Roland Kreutzer Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens
CN100523187C (zh) 1999-06-08 2009-08-05 里珍纳龙药品有限公司 具有改善的药物动力学特性的修饰嵌合多肽
CA2386270A1 (en) 1999-10-15 2001-04-26 University Of Massachusetts Rna interference pathway genes as tools for targeted genetic interference
PT1309726E (pt) 2000-03-30 2010-03-08 Whitehead Biomedical Inst Mediadores de interferência por rna específicos de sequência de rna
DK1289368T3 (da) 2000-05-23 2010-05-03 Univ Rochester Fremgangsmåde til fremstilling af herpes simplex virus ampliconer, deraf resulterende amplicober samt deres anvendelse
ATE513910T1 (de) 2000-05-30 2011-07-15 Johnson & Johnson Res Pty Ltd Methoden zur gensuppression mithilfe von rnai verstärkenden faktoren
AU2001284160A1 (en) 2000-08-19 2002-03-04 Axordia Limited Modulation of stem cell differentiation
WO2002029858A2 (en) 2000-09-29 2002-04-11 Infineon Technologies North America Corp. Deep trench etching method to reduce/eliminate formation of black silicon
WO2002061090A2 (en) 2000-12-14 2002-08-08 Genentech, Inc. Prokaryotically produced antibodies and uses thereof
US7749492B2 (en) 2001-01-05 2010-07-06 Nationwide Children's Hospital, Inc. AAV vectors and methods
AU2002248297A1 (en) 2001-01-05 2002-07-16 Children's Hospital, Inc. Aav2 vectors and methods
DK2359869T3 (en) 2001-12-17 2019-04-15 Univ Pennsylvania Sequences of adeno-associated virus (AAV) serotype 8, vectors containing these, and uses thereof
AU2002359284A1 (en) 2001-12-17 2003-06-30 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) serotype 9 sequences, vectors containing same, and uses therefor
US20040023390A1 (en) 2002-08-05 2004-02-05 Davidson Beverly L. SiRNA-mediated gene silencing with viral vectors
AU2003265855A1 (en) 2002-08-28 2004-03-19 University Of Florida Modified aav
US7186522B2 (en) 2003-03-31 2007-03-06 Cytyc Corporation Papanicolau staining process
US8071028B2 (en) 2003-06-12 2011-12-06 Abbott Diabetes Care Inc. Method and apparatus for providing power management in data communication systems
EP1828390B1 (en) 2004-12-15 2012-06-13 The University Of North Carolina At Chapel Hill Chimeric vectors
US8283151B2 (en) 2005-04-29 2012-10-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes
EP2311967B1 (en) 2005-10-20 2017-09-20 UniQure IP B.V. Improved AAV vectors produced in insect cells
US7867484B2 (en) 2006-01-27 2011-01-11 University Of North Carolina At Chapel Hill Heparin and heparan sulfate binding chimeric vectors
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
US20070274985A1 (en) * 2006-05-26 2007-11-29 Stefan Dubel Antibody
DK2191001T3 (en) 2007-04-09 2016-09-19 Univ Florida RAAV VECTOR COMPOSITIONS WITH TYROSIN MODIFIED CAPSIDE PROTEINS AND PROCEDURES FOR USE THEREOF
WO2009012176A2 (en) 2007-07-14 2009-01-22 The University Of Iowa Research Foundation Methods and compositions for treating brain diseases
US8632764B2 (en) 2008-04-30 2014-01-21 University Of North Carolina At Chapel Hill Directed evolution and in vivo panning of virus vectors
JP2010002479A (ja) 2008-06-18 2010-01-07 Crossfor:Kk メガネレンズ用装飾体およびメガネ用装飾体装着具
LT3216803T (lt) 2008-06-25 2020-06-10 Novartis Ag Stabilūs ir tirpūs antikūnai, slopinantys vegf
EP2396343B1 (en) 2009-02-11 2017-05-17 The University of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
WO2010138263A2 (en) 2009-05-28 2010-12-02 University Of Massachusetts Novel aav 's and uses thereof
US8299295B2 (en) 2009-10-15 2012-10-30 Johnson Matthey Public Limited Company Polymorphs of bromfenac sodium and methods for preparing bromfenac sodium polymorphs
US8263396B2 (en) 2010-04-01 2012-09-11 Weidong Xiao Methods and compositions for the production of recombinant virus vectors
US8927514B2 (en) 2010-04-30 2015-01-06 City Of Hope Recombinant adeno-associated vectors for targeted treatment
US8628966B2 (en) 2010-04-30 2014-01-14 City Of Hope CD34-derived recombinant adeno-associated vectors for stem cell transduction and systemic therapeutic gene transfer
US8663624B2 (en) 2010-10-06 2014-03-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
WO2012169822A2 (ko) * 2011-06-10 2012-12-13 강원대학교산학협력단 암세포 증식 억제와 혈관신생 억제를 위한 융합 단백질 및 이를 포함한 항암 조성물
BR112014008161A2 (pt) 2011-10-21 2017-04-11 Intervet Int Bv vírus da doença de marek não patogênico recombinante, método para a preparação do mesmo, molécula do ácido nucleico, célula hospedeira, vacina para aves domésticas, método para a preparação de uma vacina, uso de um vírus da doença de marek não patogênico recombinante, e, método de vacinação de aves domésticas
AU2014286996A1 (en) * 2013-07-12 2016-01-07 Iveric Bio, Inc. Methods for treating or preventing ophthalmological conditions
JP7046828B2 (ja) * 2016-04-15 2022-04-04 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 滲出型加齢性黄斑変性の治療のための組成物
WO2017186928A1 (en) * 2016-04-29 2017-11-02 Curevac Ag Rna encoding an antibody
CN110546257B (zh) * 2017-03-17 2024-03-01 阿德夫拉姆生物技术股份有限公司 用于增强基因表达的组合物和方法
SG11202002276VA (en) 2017-09-20 2020-04-29 4D Molecular Therapeutics Inc Adeno-associated virus variant capsids and methods of use thereof
AU2018350990A1 (en) * 2017-10-18 2020-05-21 Regenxbio Inc. Treatment of ocular diseases and metastatic colon cancer with human post-translationally modified VEGF-Trap

Patent Citations (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1135468B1 (en) 1998-11-10 2010-01-06 University Of North Carolina At Chapel Hill Virus vectors and methods of making and administering the same
US7271002B2 (en) 2001-11-09 2007-09-18 United States Of America, Represented By The Secretary, Department Of Health And Human Services Production of adeno-associated virus in insect cells
EP1456419B1 (en) 2001-11-13 2011-08-17 The Trustees of The University of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
EP1310571B1 (en) 2001-11-13 2006-02-15 The Trustees of The University of Pennsylvania A Method of identifying unknown adeno-associated virus (AVV) sequences and a kit for the method
EP2338900B1 (en) 2001-11-13 2014-01-01 The Trustees of The University of Pennsylvania Adeno-associated virus (AAV) Cy.5 sequences, vectors containing the same and uses thereof
EP2341068B1 (en) 2001-11-13 2013-09-25 The Trustees of The University of Pennsylvania Adeno-associated virus (AAV) serotype rh10
EP1456383B1 (en) 2001-12-21 2014-03-12 Medigene AG A library of modified structural genes or capsid modified particles useful for the identification of viral clones with desired cell tropism
WO2003054197A2 (en) 2001-12-21 2003-07-03 Medigene Ag A library of modified structural genes or capsid modified particles useful for the identification of viral clones with desired cell tropism
US20040002159A1 (en) 2002-04-05 2004-01-01 Weidong Xiao Methods for the production of chimeric adeno-associated virus (AAV) vectors, compositions of chimeric AAV vectors, and methods of use thereof
US20060292117A1 (en) 2002-04-17 2006-12-28 Loiler Scott A Improved rAAv vectors
EP1496944B1 (en) 2002-05-01 2008-08-20 University of Florida Research Foundation, Inc. Improved raav expression systems for genetic modification of specific capsid proteins
US20120220492A1 (en) 2003-05-23 2012-08-30 Mount Sinai School Of Medicine Of New York University Viral Vectors with Improved Properties
EP1664314B1 (en) 2003-06-11 2008-10-01 Müller, Dr., Oliver Improved adeno-associated virus (aav) vector for gene therapy
EP1633772B1 (en) 2003-06-19 2015-11-18 Avigen, Inc. Aav virions with decreased immunoreactivity and uses therefor
US20090202490A1 (en) 2003-06-30 2009-08-13 Schaffer David V Mutant adeno-associated virus virions and methods of use thereof
EP1660678B1 (en) 2003-06-30 2011-10-26 The Regents of The University of California Mutant adeno-associated virus virions and methods of use thereof
US20050053922A1 (en) 2003-06-30 2005-03-10 Schaffer David V. Mutant adeno-associated virus virions and methods of use thereof
EP1668143B1 (en) 2003-09-30 2013-03-20 The Trustees of The University of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
EP1791858B1 (en) 2004-09-24 2010-04-21 Intercell AG Modified vp1-capsid protein of parvovirus b19
EP2383346B1 (en) 2005-04-07 2014-10-08 The Trustees of the University of Pennsylvania Modified AAVrh.64 capsids, compositions containing same and uses thereof
EP2359867B1 (en) 2005-04-07 2014-10-08 The Trustees of The University of Pennsylvania Method of increasing the function of an AAV vector
EP2359865B1 (en) 2005-04-07 2013-10-02 The Trustees of The University of Pennsylvania Method of increasing the function of an AAV vector
EP2357010B1 (en) 2005-04-07 2013-06-12 The Trustees of The University of Pennsylvania Method of increasing the function of an AAV vector
EP2359866B1 (en) 2005-04-07 2013-07-17 The Trustees of The University of Pennsylvania Modified AAV rh48 capsids, compositions containing same and uses thereof
US20090317417A1 (en) 2006-04-28 2009-12-24 The Trustees Of The University Of Pennsylvania Modified AAV Vectors Having Reduced Capsid Immunogenicity and Use Thereof
WO2008124015A1 (en) 2007-04-09 2008-10-16 The Regents Of The University Of California Methods for purifying adeno-associated virus virions
US20100203083A1 (en) 2007-05-31 2010-08-12 Medigene Ag Mutated structural protein of a parvovirus
US20100297177A1 (en) 2007-05-31 2010-11-25 Ludwig-Maximillians-Universitaet Mutated parvovirus structural proteins as vaccines
US20090215879A1 (en) 2008-02-26 2009-08-27 University Of North Carolina At Chapel Hill Methods and compositions for adeno-associated virus (aav) with hi loop mutations
US20110171262A1 (en) 2008-06-17 2011-07-14 Andrew Christian Bakker Parvoviral capsid with incorporated gly-ala repeat region
US20110275529A1 (en) 2008-09-19 2011-11-10 Charite Universitatsmedizin Berlin Identification and characterisation of recombinant viral gene therapy vectors
US20120070899A1 (en) 2009-06-03 2012-03-22 Cedars-Sinai Medical Center Effective vector platform for gene transfer and gene therapy
WO2011038187A1 (en) 2009-09-25 2011-03-31 The Trustees Of The University Of Pennsylvania Controlled adeno-associated virus (aav) diversification and libraries prepared therefrom
US20130195801A1 (en) 2010-04-23 2013-08-01 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
US20140335054A1 (en) 2010-04-23 2014-11-13 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
US20110301073A1 (en) 2010-05-17 2011-12-08 Sangamo Biosciences, Inc. Novel DNA-binding proteins and uses thereof
US20130296409A1 (en) 2010-11-10 2013-11-07 Fred Hutchinson Cancer Research Center Compositions and methods for generating adeno-associated viral vectors with undetectable capsid gene contamination
US20140056854A1 (en) 2011-02-10 2014-02-27 The University Of North Carolina At Chapel Hill Viral vectors with modified transduction profiles and methods of making and using the same
US20140037585A1 (en) 2011-02-14 2014-02-06 The Children's Hospital Of Philadelphia AAV8 Vector with Enhanced Functional Activity and Methods of Use Thereof
US20130323226A1 (en) 2011-02-17 2013-12-05 The Trustees Of The University Of Pennsylvania Compositions and Methods for Altering Tissue Specificity and Improving AAV9-Mediated Gene Transfer
US20140364338A1 (en) 2011-04-22 2014-12-11 The Regents Of The University Of California Adeno-Associated Virus Virions with Variant Capsid and Methods of Use Thereof
US9193956B2 (en) 2011-04-22 2015-11-24 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US20140213769A1 (en) * 2011-06-10 2014-07-31 Knu-Industry Cooperation Foundation Fusion protein for suppressing cancer cell growth and suppressing vasculogenesis, and anticancer composition comprising same
US20130078249A1 (en) * 2011-08-23 2013-03-28 Oliver Ast Bispecific t cell activating antigen binding molecules
US20130059732A1 (en) 2011-08-24 2013-03-07 The Board Of Trustees Of The Leland Stanford Junior University Aav capsid proteins for nucleic acid transfer
US20140359799A1 (en) 2011-12-23 2014-12-04 Case Western Reserve University Targeted gene modification using hybrid recombinant adeno-associated virus
WO2013123503A1 (en) 2012-02-17 2013-08-22 The Children's Hospital Of Philadelphia Aav vector compositions and methods for gene transfer to cells, organs and tissues
US20150065562A1 (en) 2012-04-18 2015-03-05 The Children's Hospital Of Philadelphia Composition and methods for highly efficient gene transfer using aav capsid variants
US20130295614A1 (en) 2012-05-02 2013-11-07 Sangeetha Hareendran Nucleotide sequences, methods, kit and a recombinant cell thereof
WO2013170078A1 (en) 2012-05-09 2013-11-14 Oregon Health & Science University Adeno associated virus plasmids and vectors
WO2013174760A1 (en) 2012-05-25 2013-11-28 Deutsches Krebsforschungszentrum Optimized aav-vectors for high transduction rates in dendritic cells
EP2692731A1 (en) 2012-07-31 2014-02-05 Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe Recombinant Adeno-Associated virus (AAV) vector particles displaying high-affinity ligands for cell-type specific gene delivery
WO2014052789A1 (en) 2012-09-28 2014-04-03 The University Of North Carolina At Chapel Hill Aav vectors targeted to oligodendrocytes
WO2014103957A1 (ja) 2012-12-25 2014-07-03 タカラバイオ株式会社 Aav変異体
WO2014124282A1 (en) 2013-02-08 2014-08-14 The Trustees Of The University Of Pennsylvania Enhanced aav-mediated gene transfer for retinal therapies
WO2014160092A1 (en) 2013-03-13 2014-10-02 The Children's Hospital Of Philadelphia Adeno-associated virus vectors and methods of use thereof
WO2014194132A1 (en) 2013-05-31 2014-12-04 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
WO2017197355A2 (en) 2016-05-13 2017-11-16 4D Molecular Therapeutics Inc. Adeno-associated virus variant capsids and methods of use thereof
WO2017218974A2 (en) 2016-06-16 2017-12-21 Adverum Biotechnologies, Inc. Treatment of amd using aav2 variant with aflibercept

Non-Patent Citations (40)

* Cited by examiner, † Cited by third party
Title
"Immunology Methods Manual", 1997, ACADEMIC PRESS
"Pharmaceutical Dosage Forms and Drug Delivery Systems", 1999, LIPPINCOTT, WILLIAMS, & WILKINS
"Viral Vectors", 1995, ACADEMIC PRESS
A. GENNARO: "Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT, WILLIAMS, & WILKINS
ASURI ET AL., MOL THER., vol. 20, no. 2, February 2012 (2012-02-01), pages 329 - 38
BESNARD ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 266, no. 28, 1991, pages 18877 - 18883
BIBIKOVA ET AL., SCIENCE, vol. 300, no. 5620, 2 May 2003 (2003-05-02), pages 764
BOLLAG ET AL.: "Protein Methods", 1996, JOHN WILEY & SONS
CHIORINI ET AL., J. VIROLOGY, vol. 73, 1999, pages 1309
CRONIN ET AL., EMBO MOLECULAR MEDICINE, vol. 6, no. 9, 2014, pages 1175 - 1190
DOYLEGRIFFITHS: "Cell and Tissue Culture: Laboratory Procedures in Biotechnology", 1998, JOHN WILEY & SONS
EKKER ET AL., ZEBRAFISH 2008 SUMMER, vol. 5, no. 2, pages 121 - 3
FLISIKOWSKA ET AL., PLOS ONE., vol. 6, no. 6, 13 June 2011 (2011-06-13), pages e21045
GENE, vol. 91, no. 2, 1990, pages 217 - 223
GEURTS ET AL., SCIENCE, vol. 325, no. 5939, 24 July 2009 (2009-07-24), pages 433
GOLDBERG ET AL., CELL, vol. 140, no. 5, 5 March 2010 (2010-03-05), pages 678 - 91
HAUSCHILD ET AL., PROC NATL ACAD SCI USA., vol. 108, no. 29, 19 July 2011 (2011-07-19), pages 12013 - 7
HOCKEMEYER ET AL., NAT BIOTECHNOL., vol. 29, no. 8, 7 July 2011 (2011-07-07), pages 731 - 4
J. VIROL., vol. 79, 2005, pages 5047
J. VIROLOGY, vol. 71, 1998, pages 6823
JACOBSON ET AL., MOLECULAR THERAPY, vol. 13, no. 6, 2006, pages 1074 - 1084
JINEK, SCIENCE, vol. 337, no. 6096, 17 August 2012 (2012-08-17), pages 816 - 21
LI ET AL., NATURE, vol. 475, 2011, pages 217
LODERIO ET AL., PNAS, vol. 109, no. 17, 2012, pages 6513 - 6518
MIYAZAKI ET AL., GENE, vol. 79, no. 2, 1989, pages 269 - 277
MOORE, EXPERT OPIN BIOL THER., vol. 17, no. 10, October 2017 (2017-10-01), pages 1235 - 1244
NATURE REVIEW GENETICS, 20 May 2014 (2014-05-20)
OCHIAI ET AL., GENES CELLS., vol. 15, no. 8, August 2010 (2010-08-01), pages 875 - 85
QI ET AL., CELL, vol. 152, no. 5, 28 February 2013 (2013-02-28), pages 1173 - 83
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, HARBOR LABORATORY PRESS
SHEN ET AL., MOL. THER., vol. 15, 2007, pages 1955
SINGER-SAM ET AL., GENE, vol. 32, no. 3, 1984, pages 409 - 417
SRIVISTAVA ET AL., J. VIROLOGY, vol. 45, 1983, pages 555
STINSKI ET AL., JOURNAL OF VIROLOGY, vol. 55, no. 2, 1985, pages 431 - 441
TAKASU, INSECT BIOCHEM MOL BIOL., vol. 40, no. 10, October 2010 (2010-10-01), pages 759 - 65
TESSON ET AL., NAT BIOTECHNOL., vol. 29, no. 8, 5 August 2011 (2011-08-05), pages 699 - 700
VLIET ET AL., MOL. THER., vol. 14, 2006, pages 809
WOOD ET AL., SCIENCE, vol. 333, no. 6040, 15 July 2011 (2011-07-15), pages 307
YOUNG ET AL., PROC NATL ACAD SCI USA., vol. 108, no. 17, 26 April 2011 (2011-04-26), pages 7052 - 7
YU ET AL., CELL RES., vol. 21, November 2011 (2011-11-01), pages 1638 - 40

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11155610B2 (en) 2014-06-28 2021-10-26 Kodiak Sciences Inc. Dual PDGF/VEGF antagonists
US11066465B2 (en) 2015-12-30 2021-07-20 Kodiak Sciences Inc. Antibodies and conjugates thereof
US20220267739A1 (en) * 2017-12-19 2022-08-25 Akouos, Inc. Aav-mediated delivery of therapeutic antibodies to the inner ear
US11697801B2 (en) 2017-12-19 2023-07-11 Akouos, Inc. AAV-mediated delivery of therapeutic antibodies to the inner ear
US12275960B2 (en) 2017-12-19 2025-04-15 Akouos, Inc. AAV-mediated delivery of therapeutic antibodies to the inner ear
US12077783B2 (en) 2017-12-19 2024-09-03 Akouos, Inc. AAV-mediated delivery of antibodies to the inner ear
US12071476B2 (en) 2018-03-02 2024-08-27 Kodiak Sciences Inc. IL-6 antibodies and fusion constructs and conjugates thereof
US11987801B2 (en) 2018-05-11 2024-05-21 Massachusetts Eye And Ear Infirmary Altering tissue tropism of adeno-associated viruses
US11149256B2 (en) 2018-09-26 2021-10-19 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
US12049648B2 (en) 2018-09-26 2024-07-30 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
US12570998B2 (en) 2019-09-09 2026-03-10 Massachusetts Eye & Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (AAV) and the AAV receptor (AAVR) for altered bio-distribution of AAV
CN114667349A (zh) * 2019-09-09 2022-06-24 马萨诸塞眼科耳科诊所 用于调节腺相关病毒(aav)和aav受体(aavr)之间的相互作用以改变aav生物分布的方法和组合物
EP4028058A4 (en) * 2019-09-09 2023-09-27 The Regents of the University of California COMPOSITIONS AND METHODS FOR PRODUCING AND USING MULTISPECIFIC ANTIBODIES
WO2021050614A3 (en) * 2019-09-09 2021-05-20 Massachusetts Eye And Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (aav) and the aav receptor (aavr) for altered bio-distribution of aav
US11912784B2 (en) 2019-10-10 2024-02-27 Kodiak Sciences Inc. Methods of treating an eye disorder
US12509705B2 (en) 2019-10-31 2025-12-30 Universität Bern AAV vector variants for ocular gene delivery
JP7791546B2 (ja) 2019-10-31 2025-12-24 ウニベルジテート ベルン 眼遺伝子送達のためのaavベクター変異体
JP2023504773A (ja) * 2019-10-31 2023-02-07 ウニベルジテート ベルン 眼遺伝子送達のためのaavベクター変異体
WO2021084133A1 (en) * 2019-10-31 2021-05-06 Universität Bern Aav vector variants for ocular gene delivery
EP4185333A4 (en) * 2020-07-21 2024-09-04 Frontera Therapeutics, Inc. COMPOSITION AND METHOD FOR TREATING EYE DISEASES
RU2846105C1 (ru) * 2020-09-03 2025-08-29 Юниверсити Оф Массачусеттс Аденоассоциированный вирус для доставки kh902 (конберцепта) и его применения
US12365726B2 (en) 2020-12-01 2025-07-22 Akouos, Inc. Anti-VEGF antibody constructs
WO2022126189A1 (en) * 2020-12-16 2022-06-23 Children's Medical Research Institute Adeno-associated virus capsids and vectors
WO2022126188A1 (en) * 2020-12-16 2022-06-23 Children's Medical Research Institute Aav capsids and vectors
WO2022217110A1 (en) * 2021-04-09 2022-10-13 Avirmax, Inc. Compositions and methods for ocular transgene expression
WO2022223644A2 (en) 2021-04-20 2022-10-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions and methods for treating retinal degenerative disorders
US12599680B1 (en) 2021-04-27 2026-04-14 4D Molecular Therapeutics Inc. Treatments for ocular neovascularization
EP4330411A4 (en) * 2021-04-27 2025-06-04 4D Molecular Therapeutics Inc. COMPOSITIONS AND METHODS FOR THE TREATMENT OF AN EYE DISEASE ASSOCIATED WITH ANGIOGENESIS
EP4346767A4 (en) * 2021-06-03 2025-06-25 Dyno Therapeutics, Inc. CAPSIDE VARIANTS AND METHODS OF USE THEREOF
US12116385B2 (en) 2021-10-08 2024-10-15 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12331081B2 (en) 2021-10-08 2025-06-17 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12331082B2 (en) 2021-10-08 2025-06-17 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12528841B2 (en) 2021-10-08 2026-01-20 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
WO2023089151A1 (en) * 2021-11-19 2023-05-25 The University Of Bristol Materials and methods for treatment of macular degeneration
WO2023173086A1 (en) * 2022-03-11 2023-09-14 Avirmax Biopharma Inc. Compositions and methods for expressing therapeutics
WO2024084075A1 (en) 2022-10-20 2024-04-25 Sparingvision Compositions and methods for treating retinal degenerative disorders
WO2024102703A3 (en) * 2022-11-07 2024-06-27 The Regents Of The University Of California Zikv-based gene delivery system
WO2025103416A1 (zh) * 2023-11-14 2025-05-22 上海朗昇生物科技有限公司 用于老年相关性黄斑变性的治疗的基因治疗药物
US12480098B1 (en) 2024-10-18 2025-11-25 Aavatar Therapeutics Co., Ltd. Adeno-associated virus variant

Also Published As

Publication number Publication date
DK3717636T5 (da) 2024-08-26
JP2022121534A (ja) 2022-08-19
EP3717636A1 (en) 2020-10-07
AU2022203494A1 (en) 2022-06-09
CL2020001360A1 (es) 2020-09-11
IL274712A (en) 2020-07-30
SG11202004545XA (en) 2020-06-29
KR102793696B1 (ko) 2025-04-09
DK3717636T3 (da) 2023-05-30
NZ765038A (en) 2024-08-30
JP2021503914A (ja) 2021-02-15
RU2020121215A (ru) 2021-12-29
JP2026040557A (ja) 2026-03-09
PE20210915A1 (es) 2021-05-19
RU2020121215A3 (https=) 2021-12-29
EP4219695A2 (en) 2023-08-02
US20200282077A1 (en) 2020-09-10
EP4272728A2 (en) 2023-11-08
UA127831C2 (uk) 2024-01-17
US11766489B2 (en) 2023-09-26
JP7184894B2 (ja) 2022-12-06
FI3717636T3 (fi) 2023-06-01
AU2018372235B9 (en) 2022-03-10
AU2018372235A1 (en) 2020-06-11
EP4272728A3 (en) 2024-06-12
PT3717636T (pt) 2023-05-30
JP2024015194A (ja) 2024-02-01
EP3717636B1 (en) 2023-03-08
KR20200088853A (ko) 2020-07-23
BR112020010674A2 (pt) 2020-11-10
CR20200282A (es) 2021-02-18
EP3717636A4 (en) 2021-09-08
AU2018372235B2 (en) 2022-02-24
KR20250052478A (ko) 2025-04-18
AU2022203494B2 (en) 2024-08-01
ES2946747T3 (es) 2023-07-25
AU2024220028A1 (en) 2024-12-12
CN111770999A (zh) 2020-10-13
MX2020005451A (es) 2020-08-27
PH12020550706A1 (en) 2021-04-26
EP4219695A3 (en) 2024-01-17
CA3083472A1 (en) 2019-05-31

Similar Documents

Publication Publication Date Title
AU2022203494B2 (en) Adeno-Associated Virus Variant Capsids And Use For Inhibiting Angiogenesis
US11766487B2 (en) Treatments for retinal disease
US20240335560A1 (en) Adeno-associated virus variant capsids and use for inhibiting angiogenesis
RU2773756C2 (ru) Варианты капсидов аденоассоциированного вируса и их применение для ингибирования ангиогенеза

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18881166

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3083472

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020528888

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018372235

Country of ref document: AU

Date of ref document: 20181126

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207017143

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2020/0007671

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2018881166

Country of ref document: EP

Effective date: 20200629

WWE Wipo information: entry into national phase

Ref document number: MX/A/2020/005451

Country of ref document: MX

WWP Wipo information: published in national office

Ref document number: NC2020/0007671

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020010674

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020010674

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200527

WWG Wipo information: grant in national office

Ref document number: NC2020/0007671

Country of ref document: CO

WWG Wipo information: grant in national office

Ref document number: 000575-2020

Country of ref document: PE

WWD Wipo information: divisional of initial pct application

Ref document number: 1020257011121

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 1020257011121

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: MX/A/2020/005451

Country of ref document: MX

WWG Wipo information: grant in national office

Ref document number: 11202004545X

Country of ref document: SG

WWP Wipo information: published in national office

Ref document number: 11202004545X

Country of ref document: SG