WO2019039700A1 - 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물 - Google Patents
멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물 Download PDFInfo
- Publication number
- WO2019039700A1 WO2019039700A1 PCT/KR2018/005003 KR2018005003W WO2019039700A1 WO 2019039700 A1 WO2019039700 A1 WO 2019039700A1 KR 2018005003 W KR2018005003 W KR 2018005003W WO 2019039700 A1 WO2019039700 A1 WO 2019039700A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tumor
- cells
- macrophages
- composition
- melitin
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/56—Materials from animals other than mammals
- A61K35/63—Arthropods
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1767—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
Definitions
- the present invention relates to a composition for removing a type M2 tumor-associated macrophage (TAM) containing melittin as an active ingredient. More particularly, the present invention relates to a composition for removing M1 type tumor-associated macrophages and cancer cells, And inhibiting angiogenesis through regulating the microenvironment of cancer cells, thereby reducing the side effects of the conventional anticancer effect, and exhibiting the anticancer and metastasis suppressing effect.
- TAM tumor-associated macrophage
- Tumor microenvironment has been considered as a therapeutic goal by contributing to the proliferation and survival of malignant cells, angiogenesis, metastasis, abnormal adaptive immunity, and decreased response to hormone and chemotherapeutic agents.
- TAM tumor associated macrophage
- oxygen and nutrients are supplied to hypoxic tumor areas and are important regulators of angiogenesis essential for tumor progression. Therefore, it has been reported that a large number of tumor-associated macrophages in cancer patients are present around the tumor and the prognosis and survival rate of the patient is poor.
- the role of tumor-associated macrophages in the tumor microenvironment remains controversial.
- Tumor-associated macrophages are classified into two phenotypes: tumor suppressor M1 or tumor-bearing M2 macrophages.
- M1-type tumor-associated macrophages have a potent ability to present antigens and generally present CD86 and TNF-a.
- M2 type tumor-associated macrophages have low antigen presenting ability and high ability to cultivate.
- M2 type macrophages are known to promote immunosuppression, tumor formation and angiogenesis by releasing various extracellular matrix components, angiogenesis and chemotactic factors.
- M2 type tumor-associated macrophages are distinguished from M1 type tumor-associated macrophages by expressing some markers such as CD163, CD204, CD206, and IL-10.
- Melittin is a major constituent of bee venom (Apis mellifera L.) and is an amphipathic peptide with 26 amino acid residues. Melitin has membrane-perturbing effects such as pore formation, fusion and vesicle formation. Melitin has been used in tumor-bearing mouse studies because of its ability to inhibit cytotoxicity and cell growth to tumor cells or induce apoptosis and necrosis (Cancer Immunol Immunother. 2004; 53: 411-421.). However, melitin is a very nonspecific cytolytic peptide that can attack all lipid membranes and cause an off-target effect that destroys membranes of normal cells. On the other hand, low-dose melittin has been studied to prevent pore formation.
- a composition for treating arteriosclerosis containing melitin (Application No. 10-2011-0117789), a composition for inhibiting the activity of fibroblast-like-synovial cells containing melittin No. 10-2011-0117788).
- a pharmaceutical composition for treatment or prevention of a disease associated with abnormal control of T cell activity including bee venom-PLA2 as a technique related to immune cells of bee venom including melitin
- bee venom can be used for the treatment of diseases such as cancer, in which an angiogenesis-related disease containing bee venom extract as an active ingredient, a composition for preventing and treating lung cancer or pain (registration number: 10-1146718) The exact mechanism is unknown.
- melittin does not affect CD86 + tumor macrophages and cancer cells, which are M1 type tumor-associated macrophages, in a mouse model of Lewis lung carcinoma (LLC), and that M2 type tumor-associated macrophages CD206 + Confirming that only the relevant macrophages are inhibited, thereby completing the present invention in which adverse effects due to existing anticancer drugs are significantly reduced.
- LLC Lewis lung carcinoma
- TAM tumor associated macrophage
- Another object of the present invention is to provide a pharmaceutical composition for the treatment of tumor-associated macrophage-mediated diseases comprising melitin or a pharmaceutically acceptable salt thereof as an active ingredient.
- Another object of the present invention is to provide a method for removing tumor-associated macrophages, comprising the step of administering a composition comprising melitin or a pharmaceutically acceptable salt thereof as an active ingredient to a subject in need thereof.
- the present invention relates to a method for the prevention or treatment of tumor-associated macrophage-mediated diseases comprising the step of administering to a subject in need thereof a tumor-associated macrophage-removing composition comprising melitin or a pharmaceutically acceptable salt thereof as an active ingredient .
- the present invention is directed to the use of melittin or a pharmaceutically acceptable salt thereof for the manufacture of a pharmaceutical composition for the prevention or treatment of tumor-associated macrophage-mediated diseases.
- the present invention provides, as one embodiment, a composition for removing tumor-associated macrophages, in particular, a type M2 tumor-associated macrophage comprising melitin as an active ingredient.
- a pharmaceutical composition for treating tumor-associated macrophage-mediated diseases comprising melitin or a pharmaceutically acceptable salt thereof as an active ingredient.
- a method of removing tumor-associated macrophages comprising administering to a subject in need thereof a composition comprising melittin or a pharmaceutically acceptable salt thereof.
- a method of preventing or treating tumor-associated macrophage-mediated diseases comprising administering to a subject in need thereof a composition comprising melitin or a pharmaceutically acceptable salt thereof.
- a composition comprising melitin or a pharmaceutically acceptable salt thereof.
- melitin or a pharmaceutically acceptable salt thereof for the manufacture of a pharmaceutical composition for the prevention or treatment of tumor-associated macrophage-mediated diseases.
- the composition of the present invention is capable of sunthemically inhibiting only M2 type tumor-associated macrophages without affecting M1 type tumor-associated macrophages and cancer cells. That is, it is possible to increase the ratio (M1 / M2) of the M2 type tumor-associated macrophages to the M1 type tumor-associated macrophages by inhibiting the gene and protein expression of the M2 type phenotype marker without affecting the M1 type phenotype marker.
- the present invention can provide a composition for inhibiting tumor-associated macrophages that can inhibit angiogenesis through regulation of the microenvironment of cancer cells, thereby reducing the side effects of the conventional anticancer effects and exhibiting anticancer and metastasis suppressing effects.
- melittin is a peptide that constitutes a major component of bee venom.
- bee venom (BV) is a mixture of acidic and basic secretions produced in the abdomen of a bee (Apis mellifera), which is in the form of a colorless bitter liquid, the main component of which is melittin melittin, apamin, and mast cell degranulating (MCD) peptides and phospholipase A2 (phospholipase A2) (PLA2), and various other minor components.
- MCD mast cell degranulating
- the melitin of the present invention may be isolated from bee venom of the bee (Apis mellifera), but is not limited thereto.
- ablating means killing a cell of interest, and includes not only eliminating it in its entirety, but also removing some of it.
- tumor associated tumor is a macrophage that plays an important role in relation to the overall tumor microenvironment such as the growth and metastasis of cancer, and tumor-associated macrophages present around the tumor Tumor-associated macrophages are classified into two phenotypes: tumor-suppressed M1 or tumor-bearing M2 macrophages, and M2-type tumor-associated macrophages are ILs that promote cancer growth -10, TGF ⁇ , and CCL18, and inhibits the antitumor activity of T cells and NK cells through surface receptors.
- the tumor-associated macrophages include bone marrow, yolk sac, Or extramedullary hematopoiesis, especially of mononuclear cells and macrophages originating from the pancreas, and those that separate from the bone marrow But it may not be limited.
- melitin does not affect the cell cycle of tumor cells (Example 4-2), and the inhibitory effect of melitin on tumor growth is closely related to tumor-associated macrophages Example 6-2).
- the effect of selectively binding to and inhibiting M2 type tumor-associated macrophages is confirmed (Example 6-2), and the effect of lowering the proportion of M1 type tumor-associated macrophages / M2 type tumor-associated macrophages (Example 7). Therefore, it was confirmed that melitin selectively inhibits tumor growth and metastasis by selectively binding to M2 type tumor-associated macrophages without affecting tumor cells and other immune cells.
- vascular endothelial growth factor is a signaling protein that stimulates vasculogenesis and angiogenesis, and is part of a system that replenishes it when oxygen deficiency occurs in the blood vessels.
- the main function of this factor is to make blood vessels at the time of fetal development and to make new blood vessels to replace the damaged blood vessels. Excessive expression of the infertility causes breast cancer, external tumor and ovarian cancer.
- Mrc1 / CD205 is a form in which CD205 antibody binds to Mrc1 (mannose receptor C 1).
- Mrc1 used herein refers to a mannose receptor, a transmembrane intracellular receptor, present in monomers and having a repetitive structure of eight C-type lectin domains outside the cell.
- the mannose receptor is mainly present in mature macrophages and Mrc1 mediates phagocytosis by recognizing the sugar of the microorganism. These mannose receptors have a common extracellular domain structure, but they are differentiated in terms of their unique ligand binding properties and cell type expression.
- melittin in the bone marrow-derived macrophages reduces M2 gene expression, such as VEGF and Mrc1 / CD206, and does not alter the expression of the M1 gene of Vegf and flt1 / VEGFR in Lewis lung carcinoma cells, Can be selectively reduced, and has a potential anti-angiogenic effect. It was also confirmed that the treatment with melitin did not inhibit the functional properties of macrophages such as ROS production and phagocytosis (Examples 8-6).
- CD31 is also known as platelet endothelial cell adhesion molecule-1 (PECAM-1) and is a highly expressed form of early- and mature endothelial cells, platelets and most leukocyte subpopulations, It is a protein. Expression in endothelial cells is concentrated at the junction between adjacent cells. CD31 is also expressed in major populations of intramedullary macrophages / dendritic cell precursors. CD31 is known to play a variety of roles in vascular biology such as angiogenesis, platelet function, and thrombosis.
- PECAM-1 platelet endothelial cell adhesion molecule-1
- composition comprising the bee venom extract of the present invention may further comprise a pharmaceutically acceptable carrier.
- Such pharmaceutically acceptable carriers are those conventionally used in the field of manufacture and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, But are not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
- composition of the present invention may further contain lubricants, wetting agents, sweeteners, flavors, emulsifiers, suspending agents, preservatives, etc. in addition to the above components.
- Carriers and formulation with appropriate pharmaceutically acceptable are described in detail in Remington's Pharmaceutical Sciences (19 th ed ., 1995).
- the composition of the present invention may be prepared in a unit dose form by formulating it with a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs. Into a multi-dose container.
- the formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.
- administering means providing the subject invention with a composition of the invention in any suitable manner.
- composition of the present invention may be administered parenterally, and subcutaneous injection or topical administration through the skin (transdermal administration) is preferable, but not limited thereto.
- the appropriate dosage of the pharmaceutical composition of the present invention may vary depending on such factors as formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, route of administration, excretion rate, .
- the oral dose of the composition of the present invention is preferably 0.1 to 10 mg / kg (body weight) per day, more preferably 0.5 to 1 mg / kg (body weight), but is not limited thereto.
- the dose is preferably 0.01 ⁇ g / ml to 5 ⁇ g / m 2, more preferably 0.1 ⁇ g / ml to 2 ⁇ g / ml, It is not limited.
- phospholipase A2 is an enzyme that hydrolyzes glycerol at a second carbon position to produce fatty acids. The enzyme specifically recognizes the sn- Catalyzes the degradative activity to release arachidonic acid and lysophospholipids. PLA2 is commonly found in tissues of mammals as well as bacteria, insects and snakeheads.
- the present invention relates to a method for removing tumor-associated macrophages or a method for removing tumor-associated macrophages, comprising the step of administering to a subject in need thereof a tumor-associated macrophage-removing composition comprising melitin or a pharmaceutically acceptable salt thereof as an active ingredient
- a tumor-associated macrophage-removing composition comprising melitin or a pharmaceutically acceptable salt thereof as an active ingredient
- " therapeutically effective amount " as used herein refers to the amount of melittin effective in tumor-associated macrophage-mediated diseases.
- the method for the prevention or treatment of tumor-associated macrophage-mediated diseases of the present invention not only treats the disease itself before the manifestation of the symptoms but also inhibits its manifestation ≪ / RTI >
- the prophylactic or therapeutic dose of a particular active ingredient will vary depending on the nature and severity of the disease or condition, and the route by which the active ingredient is to be administered.
- the dose is preferably 0.1 to 10 mg / kg (body weight) per day, more preferably 0.5 to 1 mg / kg (body weight), but is not limited thereto.
- the dose is preferably 0.01 ⁇ g / ml to 5 ⁇ g / m 2, more preferably 0.1 ⁇ g / ml to 2 ⁇ g / ml But is not limited thereto.
- the above administration may be administered once a day or divided into several times. However, the frequency of dosages and dosages thereof will vary with the age, body weight, and response of the individual patient, and suitable dosing regimens can be readily selected by those of ordinary skill in the art which will of course consider these factors.
- individual as used herein means any animal such as a human, a monkey, a dog, a goat, a pig or a mouse having a disease in which the symptoms of various cancerous or inflammatory diseases can be improved by administering the composition of the present invention.
- the method for the prevention or treatment of tumor-associated macrophage-mediated diseases of the present invention may further comprise administration of a therapeutically effective amount of an additional active agent that is useful for treating diseases together with melittin, Together with the melittin, can exhibit a synergistic or supplementary effect.
- the present invention is directed to the use of melittin or a pharmaceutically acceptable salt thereof for the manufacture of a pharmaceutical composition for the prevention or treatment of tumor-associated macrophage-mediated diseases.
- the melittin for the manufacture of a medicament may be mixed with an acceptable adjuvant, diluent, carrier or the like, and may be prepared as a combined preparation together with other active agents to have a synergistic action of the active ingredients.
- a composition for removing a type M2 tumor-associated macrophage comprising melitin as an active ingredient does not directly kill cancer cells but selectively inhibits only M2 type tumor-associated macrophages without affecting M1 type tumor-associated macrophages Is associated with M2 type tumor-associated macrophages and is useful for the treatment of various cancers including lung cancer.
- TAM tumor-associated macrophage
- FIG. 1 shows antitumor effect of melitin in vivo. All data were expressed as mean ⁇ SEM (* P ⁇ 0.05, ** P ⁇ 0.01).
- Figure 1C is a hematological profiling result of collecting blood and analyzing parameters for bone marrow function.
- Figure 1D shows the percentage (left) of neutrophils and lymphocytes in blood leukocytes from tumor-bearing mice.
- Neutrophil / lymphocyte ratio (N / L ratio) was used to determine whether acute cytotoxicity occurred as a result of melittin treatment (right).
- Figure 2 shows the effect of melitin on the cell cycle of tumor cells in vitro. Results were expressed as mean ⁇ SEM (* P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001).
- Figures 2A-2B are histograms of cell cycle after detection by PI staining and gating of single cells. Representative replicates of three replicate samples for the cell cycle were shown, with peaks corresponding to G1 / G0, S and G2 / M steps.
- FIG. 3 shows the effect of selectively reducing tumor-associated macrophages upon treatment with melittin in tumor cells. All values were expressed as mean ⁇ SEM (** P ⁇ 0.01, *** P ⁇ 0.001).
- 3A is a CD4 T cells (CD3 + CD4 + CD8 -) , CD8 T cells (CD3 + CD8 + CD4 -) , regulatory T cells (TREG, CD4 + CD25 + Foxp3 +), B cells (B220), regulatable Spleen cells of tumor-bearing mice to detect B cells (BREG; B220 + CD19 + CD25 + ), dendritic cells (DC; CD45 + CD11b + CD11c + ) and macrophages (MAC; CD45 + F4 / 80 + And the ratio of each immune cell in the splenocytes was measured by flow cytometry.
- Fig. 3B the tumor-associated macrophage (TAM) of the tumor tissue is marked with CD11b + F4 / 80 + , and the gated CD45 + cells are gated on the entire surviving gated cells and then outlined. Right side is the result shown in a graph (right) bars the percentage of CD11b + F4 / 80 + cells in CD45 + cells.
- TAM tumor-associated macrophage
- Figure 3C is the result of measuring the binding of melittin to CD4 + , CD8 + and CD11b + cells in a mixed population of spleen cells.
- Figure 3D is by measuring the percentage of melittin + CD11b + cells in a total of CD11b + cells treated with DMSO or Saito collar new D (Cyto D) co-results confirming whether there is a connection with the functional dye is inoculated.
- FIG. 3E shows the results of confirming the melittin-binding subpopulation of CD11b + cells by F4 / 80 + macrophages, CD11c + dendritic cells and Gr-1 + neutrophils according to the gating strategy.
- Figure 3F shows the results of a subset of melittin-binding macrophages identified as CD86 + (M1) and CD206 + (M2). All plots consist of three replicate samples.
- FIGS. 4A-B are graphs showing the expression of M1 type tumor-associated macrophages infiltrating tumor cells with F4 / 80 + CD86 + (upper panel) and M2 type tumor-associated macrophages with F4 / 80 + CD206 + .
- Figures 4C-D show F4 / 80 + CD86 + and F4 / 80 + CD206 + macrophages of splenocytes.
- the M1 / M2 ratios were calculated based on the dot plots of CD86 + (M1) and CD206 + (M2) cells in F4 / 80 + macrophages. All plots were gated to CD45 + cells of whole viable gated cells.
- FIG. 5 shows the effect of modulation of CD206 and VEGF expression by melitin in type M2 tumor-associated macrophages in vitro. Values are mean and error bars indicate SEM. * P ⁇ 0.05, ** P ⁇ 0.01 and *** P ⁇ 0.001 indicate significant differences between LPS or IL-4 treated CON group and non-treated group. # P ⁇ 0.05, ## P ⁇ 0.01 and ### P ⁇ 0.001 show significant differences between the melitin treated group and the CON group. Data are presented as means ⁇ SEM.
- Figure 5A shows the qPCR results of M2 phenotypic markers (Vegf, Mrc1 / CD206, Il-10 and Tgf-beta) and the M1 phenotype marker (Tnf-a) in bone marrow derived macrophages (BMDM).
- BMDM bone marrow derived macrophages
- Figure 5B compares the relative mRNA levels of Vegf and flt1 / VEGFR1 from melitin treated tumor cells with PBS-treated controls and the fold-difference results.
- Figure 5C shows the results of TNF- [alpha], IL-10 and TGF- [beta] production in supernatants of bone marrow-derived macrophage cultures using ELISA.
- Figures 5D-E show VEGF and CD206 expression as measured by Western blot analysis. beta -actin was used as a loading control and representative blots of 4-5 experiments were shown. Unmarked data did not show a significant (ns) difference when compared to the CON group.
- FIG. 6 shows the effect of melitin on macrophage function.
- Mean ⁇ SEM for the three replicate samples (* P ⁇ 0.05, *** P ⁇ 0.0001).
- 6A-B are the results of measurement of intracellular ROS production of unstimulated (untreated) or M1-differentiated macrophages treated with PBS (CON) or melitin (MEL) by H2DCFDA staining, respectively.
- FIG. 6C shows the relative phagocytic activity index of melitin or cytochalasin D (cytoD) -treated bone marrow-derived macrophages compared to the control group through internalization of latex-bead fluorescence intensity.
- Figure 7 confirms the effect of melitin treatment on tumor angiogenesis networks. Data were expressed as mean ⁇ SEM (** P ⁇ 0.01, *** P ⁇ 0.001, total magnification, 400X. Scale bar, 50 relative to the corresponding control).
- Figure 7A is the result of visualizing VEGF (red) in paraffin-sectioned tumor with immunofluorescent staining. The nuclei were contrasted with DAPI (blue).
- Figure 7B shows the result of visualizing CD31 (green) positive cells as immunofluorescent staining in paraffin-sectioned tumors.
- the nuclei were contrasted with DAPI (blue).
- FIG. 7C is a result of quantifying the intensity of VEGF by image J.
- Fig. 8 shows the effect of PLA2, another component of bee venom, to induce the differentiation of M2 type macrophages.
- Wild type C57BL / 6 mice are SLC Japan Bred. Co. Ltd. (Shizuoka, Japan). This study was approved by Kyunghee University animal experiment ethics committee. All animals were maintained in a 12-hour light / dark cycle in a pathogen-free environment, allowing food and water to be consumed.
- Cells were harvested as previously described to generate mouse bone marrow-derived macrophages.
- Cells were cultured for 7 days in RPMI-1640 complete culture medium containing 10 ng / ml rat recombinant M-CSF (R & D systems, Minneapolis, MN, USA). After cells were differentiated into M0 macrophages, cells were plated into 6-well plates (1x10 6 cells / well) and incubated overnight with 100 ng / ml LPS or 20 ng / ml rat recombinant IL-4 (R & D system) Or M2 < / RTI > phenotype macrophages
- Blood was collected from the orbital posterior plexus of the mouse under anesthesia. Blood was immediately mixed with EDTA and analyzed with a Hemavet 950 auto-sampler (Drew scientific, Waterbury, CT, USA) according to the manufacturer's instructions. The parameters of white blood cells, red blood cells and platelets were measured and expressed as percentages.
- cancer cells were subcutaneously injected into C57BL / 6 mice and administered with 0.5 mg / kg melittin peptide or PBS every 2 days by intraperitoneal injection.
- the cancer growth rate in the control group was fast, but cancer growth in the melitin treated group was delayed
- Hematological profiling was performed to confirm the side effects of melitin on bone marrow function. Blood was collected via retro-orbital plexus during anesthesia. Treatment with 0.5 mg / kg or 1 mg / kg melittin did not cause significant changes in hematological parameters (WBC, RBC, Hgb, HCT, MCV and MCH) (FIG. Moreover, it did not lead to a significant change in neutrophil, lymphocyte and neutrophil-lymphocyte ratio (N / L ratio), suggesting that melitin does not cause acute cytotoxic damage (FIG. 1D).
- cells were plated on 6-well plates at a density of 5x10 5 / well and cultured for 24 hours with PBS or melittin 0.1, 0.5, 1, 2 ⁇ g / ml.
- Cells were collected, washed twice with PBS, fixed with 70% precooled ethanol and stored at -20 ° C overnight.
- the cells were washed and resuspended in 500 [mu] l PBS containing 0.1% Triton X-100 and 20 [mu] g / ml RNase. Then 50 ⁇ g / ml propidium iodide (PI) was added.
- the stained cells were incubated at 37 ° C for 20 minutes and then detected with a FACS Calibur flow cytometer (Becton Dickinson, San Jose, Calif., USA). Data were analyzed by Flow Jo software (Treestar, Inc., San Carlos, Calif., USA).
- Tumors were shaved and shaken in DNase I (1 U / ml; Roche, Indianapolis, Indianapolis, trypsin-EDTA (Gibco)) under DMEM (Welgene) preheated for 1 h at 37 ° C to dissociate the tissue.
- the tissue was mechanically dissociated in a 100 ⁇ m nylon mesh strainer, then the single cells were passed through a 40 ⁇ m nylon mesh strainer and mechanically dissociated from the spleen with a 40 ⁇ m nylon mesh strainer.
- RBCs were lysed in 1X Pharmlyse buffer for 5 minutes.
- Example 5 Melitin Treatment of tumor microenvironment On the number of macrophages Impact-in vivo
- Lewis lung carcinoma cells were mixed with Matrigel matrix (Corning, NY, USA) to generate tumor models.
- Male C57BL / 6 wild-type mice (6-8 weeks old) were inoculated subcutaneously in the right flank with 5x10 4 cells per mouse.
- Five days after tumor injection recombinant melittin (GenScript Corporation, Piscataway, NJ, USA) was intraperitoneally administered every 3 days (total 5 times).
- Three days before tumor injection macrophage depletion with clodronate liposomes (200 ⁇ l per mouse in the first dose and 100 ⁇ l in the abdominal cavity every 4 days) was performed.
- Claudeonate liposomes and control liposomes were purchased from FormuMax (Sunnyvale, CA, USA).
- the number of immune cells was examined by melittin treatment. Immunocyte screening was performed by flow cytometry on CD4 + T cells, CD8 + T cells, B cells, dendritic cells and macrophages from spleen cells of cancer-challenged mice. The flow cell count method was performed in the same manner as in Example 3-2.
- melitin acts specifically on tumor - associated macrophages in several immune cells (CD4 +, CD8 +, B cells, etc.
- Example 6 Melitin Of peptide Identification of selectivity for M2 type tumor-associated macrophages-in vitro
- Rhodamine-conjugated melittin peptides were purchased from GenScript (Piscataway, NJ, USA). The spleen cells were plated on a 6 well culture plate containing 0.5 [mu] g / ml rhodamine-bound melittin. After 1 hour, the cells were harvested and unbound peptides were washed twice. Cells were stained with APC-conjugated antibodies for 1 hour at 4 ° C to confirm that melittin binds to CD4 + and CD8 + T cells and CD11b + monocytes.
- Splenocytes were pretreated with 10 nM cytokarasin D or vehicle (DMSO) for 1 hour at 37 ° C in an incubator to determine whether the binding of melitin to CD11b + cells was related to phagocytosis.
- the cells were incubated with the rhodamine-bound peptide and stained with CD11b-APC antibody as described above.
- Mouse F4 / 80-FITC, CD11c-APCcy7 and Gr1-PEcy7 (e-bioscience) in order to observe the binding of melitin to CD11b + subpopulations in splenocytes, macrophages, dendritic cells and neutrophils .
- Annexin-V was added to the samples prior to data collection to distinguish dead cells.
- M1 of M2 type tumor-associated macrophages was stained with CD86-PEcy7 (e-bioscience) or CD206-PercpCy5.5 (Biolegend). Cells were detected in FACS Calibur or FACS CantoII.
- Binding tests were performed to determine if melittin could selectively bind to CD11b + macrophages.
- Splenocytes were incubated with rhodamine-conjugated melittin peptide and stained with CD4, CD8 and CD11b antibodies. Melitin binding was approximately 16% in CD11b + cells and 1% in CD4 + or CD8 + cells (Fig. 3C).
- spleen cells were pretreated with 10 nM cytochalasin D (Cyto D) and actin polymerization inhibitor prior to melittin treatment to inhibit phagocytosis.
- the amount of melitin + CD11b + double positive cells in the entire CD11b + cell population was not different between the DMSO control group and the CytoD treatment group. Therefore, it was confirmed that melittin had affinity for CD11b + cells and this affinity was not related to phagocytosis.
- melittin has an affinity for tumor-associated macrophages regardless of phagocytosis, and specifically binds specifically to M2-type tumor-associated macrophages.
- M1 and M2 tumor-associated macrophages are present in tumor tissues, tumor-associated tumor-associated macrophages are considered to be the M2 phenotype.
- F4 / 80 + CD86 + can not doejin increase, F4 / 80 +% of CD206 + in CD45 + cells was markedly reduced by from the control group (19.90 ⁇ 1.49) melittin treated group (9.53 ⁇ 0.63) (Figs. 4A and 4B).
- levels of M1 or M2 type macrophages in splenocytes were not altered by melitin treatment (Fig. 4C and Fig. 4B).
- Gapdh for: ACCCAGAAGACTGTGGATGG; rev: CACATTGGGGGTAGGAACAC
- Tnf- ⁇ for: TTCTG TCTACTGAACTTCGGGGTGATCGGTCC; rev: GTAT GAGATAGCAAATCGGCTGACGGTGTGGG
- Mrc1 / CD206 for: AGTGGCAGGTGGCTTATG; rev: GGTT CAGGAGTTGTTGTG
- Il-10 for: ATAACTGCAC CCACTTCCCA; rev: TCATTTCCGATAAGGCTTGG
- Tgf- ⁇ for: GAAGGCAGAGTTCAGGGTCTT; rev: GGTTCCTGTCTTTGTGGTGAA
- Vegf for: GGAGA TCCTTCGAGGAGCACTT; rev: GGCGATTTAGCAG CAGATATAAGAA]
- Flt1 / VEGFR1 for: ACATTGGTGGTGGCTGACTCTC; rev: CCTCTCCTT CGGCTGGCATC
- Total protein was extracted with melittin or PBS-treated bone marrow-derived macrophages using RIPA buffer and quantitated by Bio-Rad analysis. Twenty micrograms of protein were separated on 8% SDS tris-glycine gel and transferred to nitrocellulose membrane (Invitrogen). The following antibodies and diluents were used: VEGF goat polyclonal antibody (sc-1836, 1: 1000, Santa Cruz), actin goat polyclonal antibody (sc-1616, 1: 1000, Santa Cruz), rabbit anti- Anti-goat IgG conjugated to HRP (SA007, 1: 1000, GenDEPOT) and anti-rat IgG conjugated to HRP (405405, 1: 1000, Biolegend). Protein bands were visualized using ECL solution (GE healthcare) and measured with Image J software. The intensity of the protein was normalized above the actin intensity.
- Bone marrow-derived macrophages were plated on 24-well plates and treated with melittin or PBS for 24 hours. The cells were incubated at 37 ° C for 30 minutes with 5 ⁇ M C2 ', 7'-dichlorodehydrofluorescein diacetate (H2DCFDA; molecular probe). The H2DCFDA-containing medium was removed and the cells were washed twice with pre-warmed PBS. After harvesting the cells, the level of ROS production was immediately analyzed using flow cytometry.
- H2DCFDA 5 ⁇ M C2 ', 7'-dichlorodehydrofluorescein diacetate
- Cells were plated on 96-well plate and processed as described above. Cells were pretreated with or without cytokalase D for 30 min prior to treatment with latex bead-FITC (Sigma-Aldrich). After incubation for 2 hours, external particles were removed by washing with PBS three times. The fluorescence of the internalized beads was quenched at 485 nm excitation and tree blue in a fluorescent plate reader (Fluorskan Ascent FL) and then measured using emission at 527 nm.
- latex bead-FITC Sigma-Aldrich
- cytokine secretion in the culture medium was analyzed using an ELISA kit according to the procedure recommended by the supplier.
- Rat IL-10 and TNF- ⁇ were purchased from BD Biosciences and TGF- ⁇ was purchased from R & D systems. Results are expressed as pg of normalized cytokine per mg of total protein.
- BMDM Bone marrow-derived macrophages
- IL-10 in M2 type bone marrow-derived macrophages did not change to melitin treatment (Fig. 5A, 5B).
- melittin-treated M2 type bone marrow-derived macrophages showed significantly reduced mRNA levels for Vegf and Mrcl / Cd206 compared to the control (Fig. 5A).
- Levels of VEGF and CD206 protein expression reduced by melittin were further confirmed by Western blot (Fig. 5D, 5E).
- mRNA levels of Vegf and flt1 / VFGFR were examined in Lewis lung carcinoma cells. mRNA levels were not significantly different in the control and melitin treated groups (Fig. 5B).
- melitin reduces M2 gene expression such as Mrc1 / CD205 and Vegf and does not alter M1 gene expression such as Vegf and flt1 / VEGFR in Lewis lung carcinoma cells, - an effect of angiogenesis.
- Inflammatory-induced M1 type tumor-associated macrophages are required to have functional properties such as phagocytosis, encapsulation, cytokine secretion and ROS production, which aid in killing pathogens.
- phagocytic capacity was not changed by the melitin treatment, but the phagocytic action index was significantly lower in the cytochalasin D-treated group as an actin polymerization inhibitor (Fig. 6C). These results indicate that melittin treatment does not inhibit the functional properties of macrophages such as ROS production and phagocytosis.
- Tumors of the inoculated mice were fixed with paraformaldehyde overnight, dehydrated and then placed in paraffin. Sections (5 ⁇ m in thickness) of the inserted tissues were cut in a rotary microtome and deparaffinized. The slides were autoclaved with antigen in trisodium citrate buffer (pH 6) for 1 minute, washed with PBS and then blocked with 1.5% BSA containing 0.2% Triton X-100 for 1 hour. Slides were incubated overnight at 4 ° C with anti-VEGF and anti-CD31 primary antibodies (1: 200, Santa Cruz Biotechnology, Santa Cruz, CA, USA).
- Tumor-associated macrophages promote tumor angiogenesis by secreting various growth factors, angiogenic promoters and cytokines that stimulate angiogenesis and tumor growth.
- VEGF the most potent angiogenic protein, stimulates endothelial sprouting to induce angiogenesis, as well as maintaining the viability of new blood vessels in the tumor.
- CD31 PECAM
- VEGF and CD31 two major angiogenic markers, VEGF and CD31, to determine the effect of melitin on angiogenesis inhibition. Immunofluorescent staining showed a decreased level of VEGF and CD31 in melittin-treated tumor tissue compared to the PBS group ( Figures 7A and 7B).
- fetal bovine serum (Welgene, Gyeongsan, Korea), 100 U ml -1 penicillin and 100 ⁇ gml -1 streptomycin, RPMI 1640 medium was added (Invitrogen Life, Invitrogen Life) ( Welgene, Gyeongsan, Korea) Technologies, Rockville, MD, USA) maintained a murine BV-2 microglial cell line. Cells were cultured every 2-3 days until they became 80% confluent. In all experiments the cells were incubated at 37 ° C with 95% humidity and 5% CO 2 . For differentiation, the cells 5 x 10 5 cells are seeded (seeding) in 6-well plates at a density of / ml and treated the next day.
- the cells were washed twice with serum-free RPMI medium and supplemented with 2 ml of warm serum-free RPMI medium containing experimental treatment.
- the cells for 30 minutes, 0.1, 1 or 10 ⁇ gml - after pretreatment with 1 bvPLA2, 1 ⁇ gml - lipopolysaccharide of 1 (LPS) (Sigma-Aldrich , St Louis, MO, USA) or 20 ng ml - 1 Murine recombinant interleukin-4 (R & D Systems, Minneapolis, MN, USA) was added to each well.
- LPS 1 ⁇ gml - lipopolysaccharide of 1
- 20 ng ml - 1 Murine recombinant interleukin-4 R & D Systems, Minneapolis, MN, USA
- RNA quality and concentration were determined using a NanoDrop spectrophotometer (NanoDrop Technologies, Inc., ND-1000, Wilmington, DE, USA) and normalized to the lowest concentration by RNase-free water.
- Quantitative real-time PCR was performed using the SensiFAST SYBR No-ROX Kit (Bioline, Taunton, Mass., USA) and analyzed with a LightCycler 480 system (Roche Ltd, Basel, Switzerland). The PCR was carried out by denaturing at 95 ° C for 10 seconds, annealing at 72 ° C for 10 seconds, denaturing at 60 ° C for 10 seconds, and fluorescence at the end of each cycle. Data were expressed as 2- ⁇ CT for the experimental genes normalized to GAPDH and expressed as a multiple of change compared to the saline-treated control.
- TNF- ⁇ for: 5'-TTCTGTCTACTGAACTTCGGGGTGATCGGTCC-3 '
- TNF-a rev 5'-GTATGAGATAGCAAATCGGCTGACGGTGTGGG-3 '
- iNOS for: 5'-GGCAGCCTGTGAGACCTTTG-3 '
- iNOS rev 5'-CATTGGAA GTGAAGCGTTTCG-3 '
- Arg1 for: 5'-AGACAGCAGAGGAGGTG AAGAG-3 '
- Arg1 rev 5'-CGAAGCAAGCCAAGGTTAAAGC-3 '
- MMR for: 5'-AGTGGCAGGTGGCTTATG-3 '
- MMR rev 5'-GGT TCAGGAGTTGTTGTG-3 '
- GAPDH for: 5'-ACCCAGAAGACTGT GGATGG-3 '
- GAPDH for: 5'-ACCCAGAAGACTGT GGATGG-3 '
- GAPDH rev: 5'-CACATTGGGGG
- TNF-alpha Tumor necrosis factor alpha
- iNOS inducible nitric oxide synthase
- bvPLA2 effectively blocked the differentiation to the M1 phenotype of BV-2 cells in a dose-dependent manner during LPS exposure. No changes were observed in the M1 marker during IL-4 exposure. MMR was slightly increased, and Arg1 was significantly increased by IL-4 compared to the vehicle control. When cells were exposed to IL-4, both mRNA levels were significantly increased during bvPLA2 treatment. There was no significant difference in M2 marker during LPS exposure. Taken together, these results show that bvPLA2 promotes the differentiation of M2 microglia.
- PLA2 another major constituent, promotes differentiation into M2 type tumor-associated macrophages, and melittin selectively modulates M2 type tumor-associated macrophages to regulate the tumor microenvironment, Inhibition of metastasis and anticancer effects.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Insects & Arthropods (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims (15)
- 멜리틴을 유효성분으로 포함하는 종양관련 대식세포(TAM, tumor associated macrophage) 제거용 조성물.
- 제1항에 있어서, 상기 종양관련 대식세포는 M2형 종양관련 대식세포인, 종양관련 대식세포 제거용 조성물.
- 제1항 또는 제2항에 있어서, 상기 종양관련 제거용 조성물은 M1형 종양관련 대식세포 대비 M2형 종양관련 대식세포의 비율(M1/M2)을 높이는 것인, 종양관련 대식세포 제거용 조성물.
- 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 종양관련 대식세포 제거용 조성물은 M2형 골수 유래 대식세포에서 M2 표현형 마커의 유전자 및 단백질 발현을 억제하는 것인, 종양관련 대식세포 제거용 조성물.
- 제4항에 있어서, 상기 M2 표현형 마커는 Vegf(vascular endothelial growth factor), Mrc1/CD206(mannose receptor C type 1)으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 종양관련 대식세포 제거용 조성물.
- 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 종양관련 대식세포 제거용 조성물은 종양세포에서 혈관신생의 마커 수준을 감소시키는 것인, 종양관련 대식세포 제거용 조성물.
- 제6항에 있어서, 상기 혈관신생의 마커는 VEGF 또는 CD31인 것인, 종양관련 대식세포 제거용 조성물.
- 멜리틴 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 종양관련 대식세포 매개 질환의 치료용 약학적 조성물.
- 제8항에 있어서, 상기 멜리틴의 양은 0.5mg/kg 내지 1mg/kg의 용량으로 투여되는 것인, 종양관련 대식세포 매개 질환의 치료용 약학적 조성물.
- 제8항 또는 제9항에 있어서, 상기 질환은 루이스 폐암 또는 염증질환인 것인, 약학적 조성물.
- 멜리틴 또는 이의 약학적으로 허용가능한 염 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 종양관련 대식세포 제거 방법.
- 제11항에 있어서, 상기 투여되는 멜리틴의 농도는 0.1μg/ml 내지 2μg/ml인 것인, 종양관련 대식세포 제거 방법.
- 제11항 또는 제12항에 있어서, 상기 종양관련 대식세포는 M2형 종양관련 대식세포인, 종양관련 대식세포 제거 방법.
- 멜리틴 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 종양관련 대식세포 제거용 조성물을 이를 필요로 하는 개체에게 투여하는 단계를 포함하는 종양관련 대식세포 매개 질환의 예방 또는 치료방법.
- 종양관련 대식세포 매개 질환의 예방 또는 치료를 위한 약학 조성물의 제조를 위한, 멜리틴 또는 이의 약학적으로 허용가능한 염의 용도.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US16/641,121 US11571460B2 (en) | 2017-08-23 | 2018-04-30 | Composition including melittin for removing M2-type tumor-associated macrophage |
CA3073257A CA3073257A1 (en) | 2017-08-23 | 2018-04-30 | Composition including melittin for removing m2-type tumor-associated macrophage |
AU2018320102A AU2018320102B2 (en) | 2017-08-23 | 2018-04-30 | Composition including melittin for removing M2-type tumor-associated macrophage |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170106939A KR102073273B1 (ko) | 2017-08-23 | 2017-08-23 | 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물 |
KR10-2017-0106939 | 2017-08-23 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2019039700A1 true WO2019039700A1 (ko) | 2019-02-28 |
Family
ID=65439147
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2018/005003 WO2019039700A1 (ko) | 2017-08-23 | 2018-04-30 | 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물 |
Country Status (5)
Country | Link |
---|---|
US (1) | US11571460B2 (ko) |
KR (1) | KR102073273B1 (ko) |
AU (1) | AU2018320102B2 (ko) |
CA (1) | CA3073257A1 (ko) |
WO (1) | WO2019039700A1 (ko) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2019264092B2 (en) | 2018-05-04 | 2024-02-15 | Twinpigbiolab. Inc. | Targeting M2-like tumor-associated macrophages by using melittin-based pro-apoptotic peptide |
WO2022234346A1 (en) | 2021-05-07 | 2022-11-10 | Twinpig Biolab, Inc. | Peptides targeting macrophages, and conjugates, compositions, and uses thereof |
WO2023204329A1 (ko) * | 2022-04-22 | 2023-10-26 | 트윈피그바이오랩(주) | 신규 펩타이드 기반 면역항암제 |
-
2017
- 2017-08-23 KR KR1020170106939A patent/KR102073273B1/ko active IP Right Grant
-
2018
- 2018-04-30 CA CA3073257A patent/CA3073257A1/en active Pending
- 2018-04-30 WO PCT/KR2018/005003 patent/WO2019039700A1/ko active Application Filing
- 2018-04-30 US US16/641,121 patent/US11571460B2/en active Active
- 2018-04-30 AU AU2018320102A patent/AU2018320102B2/en active Active
Non-Patent Citations (9)
Title |
---|
DANTAS, C. G. ET AL.: "Pharmacological Evaluation of Bee Venom and Melittin", REVISTA BRASILEIRA DE FARMACOGNOSIA, vol. 24, 2014, pages 67 - 72, XP055579367, ISSN: 0102-695X, DOI: 10.1590/0102-695X20142413365 * |
LEE, C. ET AL.: "Melittin Suppresses Tumor Progression by Regulating Tumor-associated Macrophages in a Lewis Lung Carcinoma Mouse Model", JOURNAL OF IMMUNOLOGY 2017, 205.2, 12 May 2017 (2017-05-12), pages 690, XP055579458 * |
LEE, C. ET AL.: "Melittin Suppresses Tumor Progression by Regulating Tumor-associated Macrophages in a Lewis Lung Carcinoma Mouse Model", ONCOTARGET, vol. 8, no. 33, 27 June 2017 (2017-06-27), pages 54951 - 54965, XP055579369, ISSN: 1949-2553, DOI: 10.18632/oncotarget.18627 * |
LEE, C. ET AL.: "Melittin Suppresses Tumor Progression by Regulating Tumor-associated Macrophages in a Lewis Lung Carcinoma Mouse Model", THE JOURNAL OF IMMUNOLOGY, vol. 198, no. 1, 205.2, 1 May 2017 (2017-05-01), XP055579458 * |
LEE, C. ET AL.: "Melittin Suppresses Tumor Progression by Regulating Tumor-associated Macrophages in a Lewis Lung Carcinoma Mouse Model", THE JOURNAL OF IMMUNOLOGY, vol. 198, no. 1, 205.2, 12 June 2017 (2017-06-12), XP055579458 * |
LEE, C.: "Melittin Suppresses Tumor Progression and Angiogenesis by Regulating Tumor-associated Macrophages (TAMs) in Lewis Lung Carcinoma Mice Model", MASTER'S THESIS, GRADUATE SCHOOL OF KYUNG HEE UNIVERSITY, 2016, pages 1 - 51 * |
PARK, H. J. ET AL.: "Melittin Inhibits Inflammatory Target Gene Expression and Mediator Generation via Interaction with IkB Kinase", BIOCHEMICAL PHARMACOLOGY, vol. 7 3, no. 2, 2007 - 8 December 2006 (2006-12-08), pages 237 - 247, XP005798390 * |
TILSTRA, J. S. ET AL.: "Pharmacologic IKK/NF-kB Inhibition Causes Antigen Presenting Cells to Undergo TNFa Dependent ROS-mediated Programmed Cell Death", SCIENTIFIC REPORTS, vol. 4, no. 1, 10 January 2014 (2014-01-10), pages 1 - 1 1, XP055579360, DOI: 10.1038/srep03631 * |
WANG, C. ET AL.: "Melittin, a Major Component of Bee Venom, Sensitizes Human Hepatocellular Carcinoma Cells to Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL)-induced Apoptosis by Activating CaMKn-TAK1-JNK/p38 and Inhibiting IkBa Kinase-NFkB", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 284, no. 6, 2009, pages 3804 - 3813, XP055049376, ISSN: 0021-9258, DOI: 10.1074/jbc.M807191200 * |
Also Published As
Publication number | Publication date |
---|---|
US11571460B2 (en) | 2023-02-07 |
KR102073273B1 (ko) | 2020-03-02 |
AU2018320102B2 (en) | 2022-02-03 |
KR20190021765A (ko) | 2019-03-06 |
AU2018320102A1 (en) | 2020-03-05 |
CA3073257A1 (en) | 2019-02-28 |
US20200206311A1 (en) | 2020-07-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2015093854A1 (ko) | 전립선 암 치료용 조성물 | |
US20210401933A1 (en) | Immune checkpoint inhibitor combinations | |
WO2017078440A1 (ko) | 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물 | |
WO2015076621A1 (ko) | 혈관 신생 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물 | |
WO2016137162A1 (ko) | 청력 손상 방어용 펩타이드 및 이를 포함하는 조성물 | |
WO2019039700A1 (ko) | 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물 | |
WO2015060673A1 (ko) | 전립선 비대증 치료 및 예방용 조성물 | |
WO2019212324A1 (ko) | 멜리틴-기반 세포사멸 유발 펩타이드로 m2 유사 종앙관련 대식세포의 표적화 | |
WO2019103541A1 (ko) | 그래핀 나노구조체를 포함하는 항염증용 조성물 | |
WO2019083172A1 (ko) | 스트렙토니그린 및 라파마이신을 유효성분으로 포함하는, 암 예방 또는 치료용 약학적 조성물 | |
WO2021177518A1 (ko) | 혈중 콜레스테롤 저하용, 심혈관 대사질환의 예방 또는 치료용 및 항염용 약학적 조성물 | |
WO2020116810A1 (ko) | Fas 신호전달 억제용 펩티드를 포함하는 비만, 지방간 또는 지방간염의 예방 또는 치료용 약학적 조성물 | |
WO2014042392A1 (ko) | 메트포민을 이용한 루프스를 포함하는 면역질환의 예방 또는 치료용 조성물 | |
WO2016167605A2 (ko) | 고혈압 치료제를 이용한 흡연 및 비흡연자의 폐암 억제 방법 | |
WO2016027990A1 (ko) | Dusp5를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물 | |
WO2010021516A9 (ko) | 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도 | |
WO2021246755A1 (ko) | 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물 | |
Zhang et al. | Overexpression of apolipoprotein E4 increases kainic-acid-induced hippocampal neurodegeneration | |
WO2015182837A1 (ko) | 골수-유래 억제세포 저해용 조성물 | |
WO2018143615A1 (ko) | 페록시레독신 1 단백질의 활성 억제제를 유효성분으로 함유하는 골질환의 예방 또는 치료용 약학적 조성물 | |
WO2016021894A1 (ko) | Cd9 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물 | |
WO2023038479A1 (ko) | 생체분자의 안정적 발현 및 전달을 위한 플라스미드 플랫폼 | |
WO2023200069A1 (ko) | 에스트로겐과 항-pd-l1 항체를 포함하는 대장암 예방 또는 치료용 약학적 조성물 | |
WO2023195802A1 (ko) | 신규 펩타이드 기반 면역항암제 | |
WO2015026205A1 (ko) | 다우리놀 화합물을 유효성분으로 포함하는 면역질환의 예방 및 치료용 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18848080 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 3073257 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2018320102 Country of ref document: AU Date of ref document: 20180430 Kind code of ref document: A |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 18848080 Country of ref document: EP Kind code of ref document: A1 |