WO2023195802A1 - 신규 펩타이드 기반 면역항암제 - Google Patents

신규 펩타이드 기반 면역항암제 Download PDF

Info

Publication number
WO2023195802A1
WO2023195802A1 PCT/KR2023/004674 KR2023004674W WO2023195802A1 WO 2023195802 A1 WO2023195802 A1 WO 2023195802A1 KR 2023004674 W KR2023004674 W KR 2023004674W WO 2023195802 A1 WO2023195802 A1 WO 2023195802A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
macrophages
tumor
melittin
itgb2
Prior art date
Application number
PCT/KR2023/004674
Other languages
English (en)
French (fr)
Inventor
배현수
한익환
강문규
이희경
최정윤
최일섭
양주원
최홍서
신진선
Original Assignee
트윈피그바이오랩(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 트윈피그바이오랩(주) filed Critical 트윈피그바이오랩(주)
Publication of WO2023195802A1 publication Critical patent/WO2023195802A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2839—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
    • C07K16/2845—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily against integrin beta2-subunit-containing molecules, e.g. CD11, CD18
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70546—Integrin superfamily, e.g. VLAs, leuCAM, GPIIb/GPIIIa, LPAM
    • G01N2333/70553—Integrin beta2-subunit-containing molecules, e.g. CD11, CD18
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to a novel peptide-based immuno-anti-cancer agent, and to the use of melittin, its variants or analogues, or conjugates linked with these and drugs as an immuno-anti-cancer agent.
  • Anticancer immunotherapy which can minimize side effects compared to existing chemotherapy or radiation treatment methods, is a method of treating cancer using the body's immune system.
  • T cells which are therapeutic immune cells, are used to treat cancer. -T included), dendritic cells, natural killer cells, etc.
  • the activity of immune-activating substances and therapeutic immune cells is drastically reduced. Therefore, it is becoming important to develop treatments that have anti-cancer effects by controlling the microenvironment surrounding tumor cells without directly affecting tumor cells and immune cells, thereby blocking the supply of nutrients to tumor cells and angiogenesis around tumor cells.
  • the tumor microenvironment contributes to the proliferation and survival of malignant cells, angiogenesis, metastasis, abnormal adaptive immunity, and reduced response to hormonal and chemotherapy agents, and is therefore greatly considered as a therapeutic target.
  • tumor-associated macrophages play an important role in tumor growth.
  • Tumor-related macrophages play an important role in the overall tumor microenvironment, including cancer growth and metastasis, and are classified into two phenotypes: tumor suppressor M1 type macrophages or tumor supporting M2 type macrophages.
  • M1 type macrophages have a strong ability to present antigens, are generally activated by interferon- ⁇ , liposaccharide (LPS), and tumor necrosis factor (TNF)- ⁇ , and have pro-inflammatory and bactericidal effects.
  • LPS liposaccharide
  • TNF tumor necrosis factor
  • M2-type macrophages are known to promote immunosuppression, tumorigenesis, and angiogenesis by releasing various extracellular matrix components, angiogenic, and chemotactic factors. Generally, it is induced by IL-4 and IL-13 and expresses markers such as arginase-1, mannose (MMR, CD206), scavenger receptor (SR-A, CD204), CD163, and IL-10. This differentiates them from M1 type tumor-related macrophages. Tumor-related macrophages present around the tumor are closely related to the growth and metastasis of tumor cells. In cancer patients, if a large number of M2-type tumor-related macrophages are present around the tumor, the patient's prognosis and survival rate are poor.
  • M2-type macrophages produce cytokines such as IL-10, TGF ⁇ , and CCL18 that promote cancer growth, and receptors such as PDL1 and B7-1/2 present on the surface of M2-type tumor-related macrophages stimulate T cells. , it has been reported to inhibit the anti-tumor activity of NK cells. Since tumor growth, differentiation, and metastasis occur actively in a microenvironment where large amounts of M2-type tumor-related macrophages exist, the development of targeted therapeutic agents targeting M2-type tumor-related macrophages is necessary.
  • the purpose of the present invention is to provide a pharmaceutical composition for eliminating tumor-related macrophages in the microtumor environment.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer.
  • an object of the present invention is to provide a method for treating cancer.
  • the object of the present invention is to provide the conjugate of the present invention for use in the production of a pharmaceutical composition for the prevention and treatment of cancer.
  • the present invention is for removing tumor-related macrophages in the microtumor environment, comprising as an active ingredient a conjugate of melittin, its variants, or analogs thereof with a pro-apoptotic peptide or an anticancer agent.
  • Pharmaceutical compositions are provided.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of cancer, comprising as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer agent is bound to melittin, a variant thereof, or an analog thereof.
  • the present invention provides a method of treating cancer comprising the step of administering a conjugate of melittin, a variant thereof, or an analogue thereof with a pro-apoptotic peptide or an anticancer agent in a pharmaceutically effective amount to an individual suffering from cancer. do.
  • the present invention provides the use of a conjugate in which a pro-apoptotic peptide or an anticancer agent is bound to melittin, a variant thereof, or an analog thereof for use in the production of a pharmaceutical composition for the prevention and treatment of cancer.
  • Melittin, its variants, or their analogs of the present invention kills M2 tumor-related macrophages by specifically binding to ITGB2 expressed on the cell membrane of M2 tumor-related macrophages, and melittin, its variants, or their analogs are drug-treated.
  • a conjugate containing a pro-apoptotic peptide or an anticancer agent significantly increases the apoptotic effect of the M2 tumor-related macrophages, it can be used as an anticancer composition to inhibit tumor growth and metastasis.
  • Figure 1a is a diagram confirming the affinity of TAMpep for M2 macrophages by flow cytometry.
  • Figure 1b is a graph quantifying the affinity of TAMpep for M2 macrophages (* P ⁇ 0.05 versus the M0.).
  • Figure 2a is a Venn diagram of M2/M0 and M1/M0 ratio analysis identifying proteins that bind to TAMpep in M2 macrophages.
  • Figure 2b is a diagram showing the identification of proteins that bind to TAMpep in M2 macrophages through scatter plot analysis of the M2/M0 ratio.
  • Figure 2c is a diagram identifying proteins that bind to TAMpep in M2 macrophages through scatter plot analysis of the M1/M0 ratio.
  • Figure 2d is a diagram identifying proteins that bind to TAMpep in M2 macrophages through scatter plot analysis of the M2/M1 ratio.
  • Figure 3 is a diagram showing LC-MS chromatogram data obtained by reacting TAMpep826-biotin with cell membrane proteins extracted from M0, M1, and M2 macrophages, respectively.
  • Figure 4 is a diagram showing the identification of the target protein of TAMPep826 using LC-MS/MS proteomics.
  • Figure 5 is a diagram showing quantitative RT-PCR conditions.
  • Figure 6 is a diagram confirming ITGB2 mRNA expression in M2 macrophages.
  • Figure 7 is a diagram confirming ITGB2 protein expression in M2 macrophages.
  • Figure 8 is a diagram confirming the expression of ITGB2 protein in M2 macrophages by immunofluorescence analysis.
  • Figure 9 is a diagram confirming the expression of ITGB2 in the cell membrane of M2 macrophages.
  • Figure 10 is a diagram confirming the interaction of TAMpep826 and ITGB2 in M2 macrophages by pull-down assay.
  • Figure 11 is a diagram confirming the interaction between TAMpep826 and ITGB2 in M2 macrophages using immunofluorescence analysis.
  • Figures 12 and 13 show the binding sites of TB511 and ITGB2 confirmed through docking simulation.
  • Figure 14 is a schematic diagram showing that the anti-CD18 antibody used to produce the ITGB2 binding ADC of the present invention specifically binds to the extended-open form of the M2 TAM of CD18.
  • Figure 15 is a diagram showing the immobilization and confirmation of ITGB2 on the surface of the sensor chip.
  • Figure 16 is a diagram confirming the binding force between anti-ITGB2 antibody and ITGB2 protein by SPR.
  • Figure 17 is a diagram confirming the binding force between Melittin-dKLA and ITGB2 protein by SPR.
  • Figure 18 is a diagram confirming the mRNA expression of ITGB2 in a cell model that suppresses ITGB2 expression established through Crispr/cas9 in M2 macrophages.
  • Figure 19 is a diagram confirming the apoptosis reduction effect of Melittin-dKLA by suppressing ITGB2 expression in M2 macrophages.
  • Figure 20 is a diagram confirming the effect of reducing apoptosis induction of TB511 (TAMpep826-dKLA) by suppressing ITGB2 expression in M2 macrophages.
  • Figure 21 is a diagram confirming the effect of reducing apoptosis induction of TB511 by ITGB2 antibody in M2 macrophages.
  • Figures 22 and 23 are diagrams confirming the effect of TB511 on breast cancer 3D organoids.
  • Figures 24 and 25 are diagrams confirming the effect of TB511 in lung cancer 3D organoids.
  • Figure 26 is a diagram confirming the effect of M-DM1 in lung cancer 3D organoids.
  • Figures 27 and 28 are diagrams confirming the effect of TB511 on anticancer drug-resistant lung cancer 3D organoids.
  • Figures 29 and 30 are diagrams confirming the effect of TB511 on anticancer drug-resistant prostate cancer 3D organoids.
  • Figure 31 is a diagram confirming the effect of CD18-DM1 in breast cancer 3D organoids.
  • Figure 32 is a diagram confirming the effect of CD18-MMAE in breast cancer 3D organoids.
  • Figures 33 and 34 are diagrams confirming the effect of ADC (CD18-DM1 and CD18-MMAE) in lung cancer 3D organoids.
  • Figures 35 and 36 are diagrams confirming the effect of ADC (CD18-DM1 and CD18-MMAE) in anticancer drug-resistant lung cancer 3D organoids.
  • Figures 37 and 38 are diagrams confirming the effect of ADC (CD18-DM1 and CD18-MMAE) in anticancer drug-resistant prostate cancer 3D organoids.
  • amino acids referred to by abbreviations in the present invention are described according to the IUPAC-IUB nomenclature as follows:
  • the present invention relates to tumor associated macrophages (TAM) in a microtumor environment, comprising as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer agent is bound to melittin, a variant thereof, or an analog thereof. It relates to a pharmaceutical composition for removing.
  • TAM tumor associated macrophages
  • the tumor-related macrophages may be M2 tumor-related macrophages that express Integrin beta 2 (IGBT2).
  • IGBT2 Integrin beta 2
  • the composition is capable of removing only M2 macrophages without removing M1 macrophages.
  • melittin may include the amino acid sequence of SEQ ID NO: 1.
  • the variant of melittin may be a peptide in which the amino acids at positions 1 to 7 are deleted in the amino acid sequence of SEQ ID NO: 1, and may include the amino acid sequence of SEQ ID NO: 2.
  • ITGB2 may comprise the amino acid sequence of SEQ ID NO: 7 or 8.
  • the melittin, its variants, or their analogs may specifically bind to the extended active conformation of ITGB2 (CD18).
  • melittin, variants thereof, or analogs thereof may bind to amino acids 466 to 565 of ITGB2.
  • the composition may include a peptide containing the amino acid sequence of SEQ ID NO: 5 or 6.
  • the conjugate in which a pro-apoptotic peptide or an anticancer agent is bound to melittin, a variant thereof, or an analog thereof may be a peptide-drug conjugate (PDC), and the PDC may be an amino acid of SEQ ID NO: 5. It may be Melittin-dKLA containing the sequence, it may be TB511 containing the amino acid sequence of SEQ ID NO: 6, and it may be M-DM1 in which the drug DM1 is conjugated to maleimide-modified melittin.
  • PDC peptide-drug conjugate
  • LEU (6) of TB511 can bind to the LEU (528), THR (538), LEU (556), CYS (557), and PHE (558) regions of ITGB2, and TRP(12) can be combined with GLU(466), ILE(469), CYS(470), and ARG(471) of ITGB2.
  • melittin, variants thereof, or analogs thereof, and pro-apoptotic peptides or anticancer agents may be covalently bound via a linker or non-covalently bound without the intermediary of a linker.
  • the linker may include the amino acid sequence of SEQ ID NO: 3.
  • melittin, variants thereof, or analogs thereof may further include a targeting sequence, tag, labeled residue, or amino acid sequence designed for the specific purpose of increasing half-life or stability.
  • the pro-apoptotic peptide includes KLA, alpha-defensin-1, BMAP-28, Brevenin-2R, Buforin IIb, and cecropin A-MA.
  • Cecropin A-Magainin 2 CA-MA-2
  • Cecropin A Cecropin B
  • chrysophsin-1 D-K6L9
  • high Gomesin Lactoferricin B, LLL27, LTX-315
  • Magainin 2B Magainin II-bombesin conjugate
  • Pardaxin and combinations thereof more preferably the D-type isomer KLA, and may include the amino acid sequence of SEQ ID NO: 4.
  • the anticancer agent is SN-38 (7-Ethyl-10-hydroxy-camptothecin), daunorubicin, doxorubicin, epirubicin (epirubicin), idarubicin, pixantrone, sabarubicin, valrubicin, paclitaxel, docetaxel, mechloethamine, chlorambucil (chlorambucil), phenylalanine, mustard, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), streptozotocin (streptozotocin), busulfan, thiotepa, cisplatin, carboplatin, dactinomycin (actinomycin D), plicamycin, mitomycin C ( mitomycin C), vincristine, vinblastine, teniposide, topotecan, iridotecan, uramustine, melphal
  • the melittin, a variant thereof, or an analog thereof and a pre-apoptotic peptide or an anticancer agent may be linked by a chemical linker or direct bond, and the chemical linker is a melittin, a variant thereof, or an analog thereof and the whole cell. It can be linked through an amine group, carboxyl group, or sulfhydryl group on an apoptotic peptide or anticancer agent.
  • the chemical linker has a carbodiimide group (carbodiimide), N-hydroxysuccinimide ester (NHS ester), imidoester, and pentafluorophenyl ester ( pentafluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, vinylsulfone and combinations thereof.
  • carbodiimide carbodiimide
  • NHS ester N-hydroxysuccinimide ester
  • imidoester imidoester
  • pentafluorophenyl ester pentafluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, vinylsulfone and combinations thereof.
  • EDC Ethyl-3-(3-dimethylaminopropyl) carbodiimide
  • DCC N,N'-dicyclohexylcarbodiimide
  • SATA succinimidyl acetylthioacetate
  • sulfo-SMCC sulfosuccinimidyl-4-( NDmaleimidomethyl)cyclohexane-1-carboxylate
  • DMA (dimethyl adipimidate ⁇ 2HCl), DMP(dimethylpimelimidate ⁇ 2HCl), DMS(dimethyl Suberimidate ⁇ 2HCl), DTBP(dimethyl 3,3'-dithiobispropionimidate ⁇ 2HCl)
  • sulfo-SIAB sulfosuccinimidyl) (4-iodoacetyl)aminobenzoate
  • SIAB Succinimidyl (4-iodoacetyl
  • the peptide preferably has the above amino acid sequence, but is not limited thereto.
  • the peptide has an amino acid ratio of 50% or more, preferably 60% or more, more preferably 70% or more, more preferably 80% or more, and more preferably 90%. It is desirable to have it as high as above, most preferably 100%.
  • the peptide may also include a targeting sequence, a tag, a labeled residue, and an additional amino acid sequence designed for the specific purpose of increasing the half-life or stability of the peptide.
  • the peptide of the present invention can be linked to coupling partners such as effectors, drugs, prodrugs, toxins, peptides, and delivery molecules.
  • the peptide can be prepared in the form of a pharmaceutically acceptable salt.
  • salts can be formed by adding acids, such as inorganic acids (e.g. hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, etc.), organic carboxylic acids (e.g. acetic acid, trifluoroacetic acid, etc.) Acetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid), and acidic sugars (glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), acidic polysaccharides (e.g.
  • hyaluronic acid, chondroitin sulfate, Salts can be formed by adding organic sulfonic acids (e.g., methanesulfonic acid, p-toluene sulfonic acid), including sulfonic acid sugar esters such as arginic acid) and chondroitin sulfate.
  • organic sulfonic acids e.g., methanesulfonic acid, p-toluene sulfonic acid
  • sulfonic acid sugar esters such as arginic acid
  • conjugate refers to a conjugate in which melittin, its variants, or their analog peptides are combined with a pro-apoptotic peptide or an anticancer agent, and can target M2 type tumor-related macrophages.
  • the conjugate can suppress tumor growth and metastasis by binding to the targeting M2 macrophage and damaging the mitochondria of the macrophage, and can suppress cancer by selectively suppressing surrounding angiogenesis.
  • the conjugate of the present invention may have improved anticancer activity compared to anticancer drugs, but is not limited thereto.
  • the conjugate can connect melittin, its variants, or analogs thereof with a pro-apoptotic peptide through a GGGGS linker (SEQ ID NO: 3), or Doxorubicin, Methotrexate, Entinostat, Cladribine, It may be linked to anti-cancer drugs such as Pralatrexate and Lorlatinib.
  • anticancer drugs such as Pralatrexate and Lorlatinib.
  • Maytansine DM1, Maytansine DM3, and Maytansine DM4 may be combined by direct connection without a linker, but are not limited thereto.
  • the conjugate of the present invention may be in the form of melittin, a variant thereof, or an analog thereof connected to an anticancer agent through a chemical linker or directly, but is not limited thereto.
  • MEL phospholipase A2
  • bee venom is a mixture of acidic and basic secretions produced in the abdomen of honey bees (Apismellifera) and is in the form of a colorless, bitter liquid, the main ingredient of which is the peptide melittin. ), apamin, mast cell degranulating (MCD) peptide, and the enzyme phospholipase A2 (PLA2), and it also contains trace amounts of various other ingredients. Therefore, the melittin of the present invention may be isolated from the bee venom of honey bees (Apis mellifera), but is not limited thereto.
  • peptide used in the present invention refers to an amino acid polymer and may include not only natural amino acids but also non-proteinaceous amino acids as components.
  • variant refers to a corresponding amino acid sequence that contains at least one amino acid difference (substitution, insertion or deletion) when compared to a reference material.
  • a “variant” has high amino acid sequence homology and/or conservative amino acid substitutions, deletions and/or insertions when compared to a reference sequence.
  • peptide analog may include analogs substituted with one or more other functional groups for the side chain of an amino acid or the alpha-amino acid backbone.
  • side chain or backbone modified peptide analogs include, but are not limited to, hydroxyproline or N-methyl glycine “peptoids” in which the pyrrolidine ring is replaced with a hydroxy group.
  • Types of peptide analogs are known in the art.
  • Protein variants according to the present invention are interpreted to also include variants in which amino acid residues are conservatively substituted at specific amino acid residue positions.
  • “conservative substitution” refers to a modification of a variant comprising substituting one or more amino acids with an amino acid having similar biochemical properties that does not cause loss of biological or biochemical function of the melittin protein variant.
  • a “conservative amino acid substitution” is a substitution that replaces an amino acid residue with an amino acid residue having a similar side chain.
  • Classes of amino acid residues with similar side chains are defined and well known in the art. These classes include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), and amino acids with uncharged polar side chains (e.g., glycine).
  • amino acids with non-polar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta-branched side chains amino acids with aromatic side chains e.g., threonine, valine, isoleucine
  • amino acids with aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine.
  • Peptides according to the present invention can be prepared by standard synthetic methods, recombinant expression systems, or any other art method. Accordingly, peptides according to the invention can be synthesized by a number of methods, including, for example, methods including:
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of cancer, comprising as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer agent is bound to melittin, a variant thereof, or an analog thereof.
  • the cancer is brain tumor, melanoma, myeloma, non-small cell lung cancer, oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, triple negative breast cancer (TNBC), lung cancer, bone cancer, pancreatic cancer, skin cancer, Head or neck cancer, cervical cancer, ovarian cancer, colon cancer, small intestine cancer, rectal cancer, fallopian tube carcinoma, anal cancer, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymph node cancer, bladder cancer, Gallbladder cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, It may be any one or more selected from the group consisting of primary central nervous system lymphoma, spinal cord tumor, brains
  • the composition may be administered to a patient whose expression of ITGB2 is upregulated in M2 macrophages compared to M0 macrophages and M1 macrophages.
  • the composition may be a targeted anticancer agent.
  • the pharmaceutical composition of the present invention can be used as a stand-alone therapy, but can also be used in combination with other conventional biological therapies, chemotherapy, or radiotherapy. When such combination therapy is performed, cancer can be treated more effectively.
  • chemotherapy agents that can be used with the composition include cisplatin, carboplatin, procarbazine, mechlorethamine, Cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunoru daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transpla Includes transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate.
  • Radiation therapy that can be used with the composition of the present invention includes X-ray irradiation and ⁇ -ray ir
  • prevention refers to all actions that inhibit or delay the occurrence, spread, and recurrence of cancer by administering the composition according to the present invention.
  • the therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as administration method, target site, patient condition, etc. Therefore, when used in the human body, the dosage must be determined as appropriate by considering both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal testing. These considerations in determining an effective amount include, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount refers to an amount that is sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level is determined by the patient's Factors including health status, type and severity of disease, activity of drug, sensitivity to drug, method of administration, time of administration, route of administration and excretion rate, duration of treatment, drugs combined or used simultaneously, and other factors well known in the field of medicine. It can be decided depending on The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.
  • the pharmaceutical composition of the present invention may contain a carrier, diluent, excipient, or a combination of two or more commonly used in biological products.
  • a carrier diluent, excipient, or a combination of two or more commonly used in biological products.
  • pharmaceutically acceptable means that the composition exhibits non-toxic properties to normal cells or humans exposed to the composition.
  • the carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc.
  • saline solution sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these ingredients can be mixed and used, and if necessary, other ingredients such as antioxidants, buffers, and bacteriostatic agents. Normal additives can be added.
  • diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate dosage forms such as aqueous solutions, suspensions, emulsions, etc., into pills, capsules, granules, or tablets.
  • it can be preferably formulated according to each disease or ingredient using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
  • the pharmaceutical composition may be one or more formulations selected from the group including oral formulations, topical formulations, suppositories, sterile injectable solutions, and sprays.
  • composition of the present invention may also include carriers, diluents, excipients, or combinations of two or more commonly used in biological products.
  • Pharmaceutically acceptable carriers are not particularly limited as long as they are suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc.
  • the compounds described in, saline solution, sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these ingredients can be mixed and used, and if necessary, other ingredients such as antioxidants, buffers, and bacteriostatic agents. Normal additives can be added.
  • diluents can be additionally added to formulate dosage forms such as aqueous solutions, suspensions, emulsions, etc., into pills, capsules, granules, or tablets.
  • dosage forms such as aqueous solutions, suspensions, emulsions, etc., into pills, capsules, granules, or tablets.
  • it can be preferably formulated according to each disease or ingredient using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
  • composition of the present invention may additionally contain one or more active ingredients that exhibit the same or similar functions.
  • the composition of the present invention contains 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.
  • the pharmaceutical composition of the present invention may further include pharmaceutically acceptable additives, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, and calcium hydrogen phosphate. , lactose, mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, Calcium stearate, white sugar, dextrose, sorbitol, and talc may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
  • composition of the present invention can be administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) or orally depending on the desired method, and the dosage is determined by the patient's weight, age, gender, health condition, The range varies depending on diet, administration time, administration method, excretion rate, and severity of disease.
  • the daily dosage of the composition according to the present invention is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and it is more preferable to administer it once or several times a day.
  • Liquid preparations for oral administration of the composition of the present invention include suspensions, oral solutions, emulsions, syrups, etc., and in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives are used. etc. may be included together.
  • Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc.
  • the present invention relates to a method for eliminating M2 tumor-related macrophages, comprising treating the M2 tumor-related macrophages in a test tube with the composition of the present invention.
  • the present invention relates to a composition for diagnosing cancer comprising the composition of the present invention.
  • the present invention relates to a cancer diagnostic kit comprising the composition for cancer diagnosis of the present invention.
  • cancer diagnostic kit refers to a kit containing the cancer diagnostic composition of the present invention. Therefore, the above expression “cancer diagnostic kit” can be used interchangeably or interchangeably with “cancer diagnostic composition.”
  • diagnosis refers to determining the susceptibility of an object to a specific disease or disorder, determining whether an object currently has a specific disease or disorder, and determining whether an object currently has a specific disease or disorder.
  • Determining a subject's prognosis e.g., identifying a pre-metastatic or metastatic cancer state, determining the stage of the cancer, or determining the responsiveness of the cancer to treatment
  • therametrics e.g., determining the efficacy of a treatment
  • Melittin, its variants, or analogues of the present invention bind specifically to ITGB2 expressed on the cell membrane of M2 tumor-related macrophages, thereby preventing them or drugs linked to them (pro-apoptotic peptides or anticancer agents) from causing M2 tumor.
  • It is a theranostic agent that suppresses tumor growth and metastasis by killing related macrophages, has anticancer activity by selectively suppressing surrounding angiogenesis, and is also used in the diagnosis of cancer because it binds specifically to M2 tumor-related macrophages. It can be used as. In addition, it can also be used as an anticancer adjuvant administered simultaneously, separately, or sequentially along with an anticancer agent.
  • melittin, its variants, or their analogs specifically bind to M2 tumor-related macrophages, they can also be used as a drug delivery system targeting them.
  • the present invention provides a method comprising: contacting a biological sample isolated from a subject with a composition of the present invention; and a method of providing information for cancer diagnosis, including comparing the sample with a normal control sample.
  • a step of determining that the test subject may have cancer may be further included.
  • sample refers to a biological sample obtained from a subject or patient.
  • Sources of biological samples include solid tissue from fresh, frozen and/or preserved organ or tissue samples or biopsies or aspirates; Blood or any blood component; It may be a cell from any point in the subject's pregnancy or development.
  • the present invention relates to a cancer comprising the step of administering a conjugate of a pro-apoptotic peptide or an anticancer agent to melittin, a variant thereof, or an analog thereof of the present invention in a pharmaceutically effective amount to an individual suffering from cancer. It relates to treatment methods.
  • the subject may be a patient in whom expression of ITGB2 is upregulated in M2 macrophages compared to M0 macrophages and M1 macrophages.
  • the present invention relates to the use of a conjugate in which a pro-apoptotic peptide or an anticancer agent is bound to melittin, a variant thereof, or an analog thereof for the preparation of a pharmaceutical composition for the prevention and treatment of cancer.
  • M2 tumor-associated macrophages (M2 TAM) targeting peptide
  • Example 1 In order to confirm whether the melittin produced in Example 1 specifically binds to M2 tumor-related macrophages (M2 TAM), the human monocyte cell line THP-1 was differentiated into M0, M1 and M2 macrophages, and FITC conjugate The melittin was treated and confirmed by flow cytometry. Specifically, THP-1 cells were treated with 100 nM of PMA (phorbol 12-myristate 13-acetate) at 37°C for 24 hours (M0 macrophages), and differentiated M0 macrophages were treated with 100 nM of LPS and 20 ng/mL.
  • PMA phorbol 12-myristate 13-acetate
  • M1 macrophages M1 macrophages
  • M2 macrophages M2 macrophages
  • Differentiated cells were treated with 50 nM of FITC-conjugated melittin for 1 hour, and cells were detected with BD FACS CantoII instruments (BD biosciences, San Jose, CA, USA) and analyzed with FlowJo software (BD biosciences).
  • biotin-conjugated melittin (melittin-biotin) was synthesized. After differentiating THP-1 cells (5 ⁇ 10 6 cells) into M0, M1, and M2 macrophages, cells were collected using a scraper, washed by centrifugation (300 ⁇ g, 5 minutes), and cell membrane protein was extracted. Cell membrane proteins of macrophages were obtained using a membrane protein extraction kit (Thermo Fisher scientific).
  • melittin-biotin 200 ⁇ g
  • streptavidin resin streptavidin resin (Thermo Fisher scientific).
  • a protein bound to tin was obtained.
  • 100 ⁇ l each of 100% methanol, 0.1% formic acid, and 80% CAN were added to an 18 Micro Spin-Column to prepare the sample, and then the sample was loaded onto the prepared column and 50 ⁇ l of 0.1% formic acid was added to remove unnecessary salts. The material was removed. Afterwards, 100 ⁇ l of 80% CAN was added to elute the peptides.
  • Example 2-2 the target protein was confirmed through LC-MS/MS proteomics by reacting TAMpep826-biotin with cell membrane proteins extracted from M0, M1, and M2 macrophages, respectively.
  • ITGB2 was found to be expressed at a higher level in M2 macrophages compared to M0 and M1 macrophages ( Figure 4), and was selected as the M2 macrophage binding target protein of TAMpep826.
  • Western blot analysis was performed to evaluate the protein expression level of ITGB2 in M0, M1, M2 macrophages and TAMs. Specifically, proteins were extracted from each cell differentiated into M0, M1, and M2 macrophages using Proprep solution (iNtRON), and the proteins were transferred to the membrane by electrophoresis. The membrane was blocked by soaking it in 5% BSA, then treated with primary antibody (ITGB2) at 4°C for 24 hours and secondary antibody at room temperature for 1 hour, followed by D-Plus TM ECL Pico System (Dongin LS). was processed and protein band photos were taken with the Davinch-Chemi TM imaging system (Intoxia).
  • IGB2 primary antibody
  • D-Plus TM ECL Pico System Dongin LS
  • Immunofluorescence analysis was performed to evaluate the protein expression level of ITGB2 in M0, M1, M2 macrophages and TAMs. Specifically, each cell differentiated into M0, M1, and M2 macrophages was fixed with 4% formalin, washed with PBS, blocked in 5% BSA, and incubated with primary antibody (ITGB2) at 4°C for 24 hours. and staining was performed by treating with secondary antibody at room temperature for 2 hours. Stained cells were photographed using LSM800 (Zeiss) after DAPI mounting.
  • the protein of ITGB2 showed a higher expression level in M2 macrophages and TAMs compared to M0 and M1 ( Figure 8).
  • TAMpep826 interacts with ITGB2 in M2 macrophages
  • the expression of ITGB2 was assessed through competitive reaction of TAMpep826 and biotinylated TAMpep826. Specifically, cells differentiated into M2 macrophages were collected with a scraper, washed by centrifugation (300 ⁇ g, 5 minutes), and cell membrane proteins of macrophages were obtained using a cell membrane protein extraction kit (Thermo Fisher scientific).
  • TAMpep826 or scramble peptide After pre-treating TAMpep826 or scramble peptide at different concentrations (0.001, 0.01, 0.1, 1, and 10 ⁇ g) for 1 hour, react with TAMpep826 (200 ⁇ g), which has biotin bound to the protein, at room temperature (20-24°C) for 1 hour. After this, the protein bound to TAMpep826 was obtained using Dynabeads TM M-280 Streptavidin (Thermo Fisher scientific). The expression of ITGB2 was confirmed by Western blot analysis of the protein.
  • TAMpep826 and ITGB2 were found to be concentratedly distributed in the cell membrane of M2 macrophages (FIG. 11).
  • LEU(6) of TB511 was predicted to bind to the LEU(528), THR(538), LEU(556), CYS(557), and PHE(558) sites of CD18, and the TRP of TB511 (12) was predicted to bind to GLU (466), ILE (469), CYS (470), and ARG (471) of CD18.
  • LEU(6) and TRP(12) of TB511 were each replaced with alanine to simulate binding to CD18, it was found that both sites did not bind to any sequence of CD18. Therefore, LEU (6) and TRP (12) of TB511 are key parts in docking between TB511 and CD18, and TB511 can be predicted to bind to positions 466 to 565 of CD18 (FIG. 13).
  • maleimide-modified melittin (GenScript, Beijing, China) (100 ⁇ M, 1 mL) dissolved in 25 mM sodium borate buffer (25mM NaCl, 1mM EDTA, pH 8.0) , 0.1 mmoL), DM1 (Mertansine) (MedChem Express, Princeton) (1.1 equivalent, 10mM in DMF) and DMF (Dimethylformamide) were added and reacted at 37°C for 1 hour, and the product was added to Dulbecco's phosphate buffered saline (DPBS).
  • DPBS Dulbecco's phosphate buffered saline
  • M-DM1 PDC was produced by binding DM1 to the N-terminus of maleimide-modified melittin M by filtration three times by ultrafiltration at Welgene), and was named M-DM1.
  • the manufactured M-DM1 was subjected to reverse-phase high-performance liquid chromatography (HPLC) on a Poroshell 120 C18 column (2.7 ⁇ m, 3 ⁇ 50 mm, Agilent, Santa Clara, CA, USA) at a rate of 5 ⁇ L and 0.5 mL/min. Characteristics were analyzed.
  • FIG. 14 To produce an antibody (FIG. 14) that specifically binds to the active conformation of the M2 TAM of CD18, one of the macrophage-1 antigens (Mac-1), anti-
  • the culture fluid of hybridoma (MM18/2.a.8) cells secreting CD18 antibody was collected and centrifuged at 2,500 rpm for 10 minutes at 4°C to obtain the supernatant, which was then purified by protein G-Sepharose column chromatography. .
  • the antibody solution was slowly passed through a protein G-Sepharose column (Pharmacia, Sweden) previously equilibrated with PBS, and the column was connected to a peristatic pump and thoroughly washed with PBS.
  • the antibody was eluted with 0.2M glycin-HCl (pH 2.7). At this time, the eluate was buffered in a tube containing 1M Tris (pH 9.0) prepared in advance. This antibody was used after dialysis in PBS. The amount of purified antibody was measured using the BCA TM Protein Assay Kit (Pierce), and the binding ability of the antibody was confirmed through flow cytometry analysis.
  • the purified anti-CD18 antibody was buffered with PBS (pH 7.4), and anti-CD18 antibody (1 mg/ml, 6.67 ⁇ M) was mixed with SMCC-DM1 (mertansine, 120 ⁇ M) (MedChemExpress) dissolved in DMSO at a ratio of 1:18. Mixed in the ratio and reacted at room temperature for 4 to 20 hours.
  • SMCC-DM1 mertansine, 120 ⁇ M
  • CD18-DM1 was buffered with PBS (pH 7.4) using a 10 KDa cutoff centrifugal filter and filtered through a 0.2 ⁇ m syringe filter.
  • the ratio of DM1 to anti-CD18 antibody was calculated by measuring the amount of DM1 (252 nm) bound to anti-CD18 antibody (280 nm) using UV-Vis spectroscopy, and the DAR value was It was found to be 5.8.
  • the ADC combining anti-CD18 antibody and DM1 produced in this way was named CD18-DM1.
  • the anti-CD18 antibody purified in the above example was buffered with PBS (pH 7.4) and added to anti-CD18 antibody (1 mg/ml, 6.67 ⁇ M) to partially reduce the disulfide bond of the CD18 antibody.
  • 1mM DTT (66.7 ⁇ M) was mixed at a ratio of 1:10, reacted at 37°C for 1 to 2 hours, and the buffer was replaced with PBS (pH 7.4).
  • Partially reduced anti-CD18 antibody (1 mg/ml, 6.67 ⁇ M) was mixed with 10mM Suo-Val-Cit-PAB-MMAE (MedChemExpress) at a ratio of 1:20 to 1:40 and reacted at 4°C for 12 hours. and the buffer was replaced with PBS (pH 7.4).
  • CD18-MMAE The ADC combining anti-CD18 antibody and MMAE produced in this way was named CD18-MMAE.
  • ITGB2 protein was coated on a gold thin film sensor chip, then ITGB2 antibody and Melittin-dKLA were flowed as positive controls, respectively, and the reflected light was measured, and surface plasmon resonance (SPR) was used. Analysis was performed. Specifically, ITGB2 was immobilized on the surface of the sensor chip, and then immobilization was performed using amine coupling under the conditions shown in Table 5 below (FIG. 15).
  • a cell model in which the expression of ITGB2 was suppressed in M2 macrophages was created using Crispr/cas9. Specifically, cells differentiated into M2 macrophages were cultured in Opti-MEM medium. For Crispr/cas9, Cas9 protein V2 (Thermo Fisher scientific) and gRNA (Genscript; ITGB2; Table 7) from the CRISPRMAX TM Reagent kit (Thermo Fisher scientific) were mixed with Cas9 Plus TM Reagent (Thermo Fisher scientific), and CRISPRMAX TM Reagent was used.
  • Opti-MEM medium After diluting in Opti-MEM medium, everything was mixed and reacted for 5-10 minutes, then added to cells differentiated into M2 macrophages and cultured at 37°C for 2-3 days. Afterwards, the mRNA expression level of ITGB2 was confirmed.
  • Example 7-1 M2 macrophages in which ITGB2 expression was suppressed by Crispr/cas9 produced in Example 7-1. (1 ⁇ M) was treated for 24 hours, and cell viability was analyzed using the CCK-8 assay method. Specifically, ITGB2 knockdown macrophages prepared in Example 7-1 were reacted with Melittin-dKLA (1 ⁇ M) for 1 hour. After the reaction, the medium was replaced and cultured at 37°C for 24 hours. To check cell viability, CCK-8 reagent (Enzo Life Sciences) was added to 1/10 of the medium and reacted at 37°C for 3 hours. Absorbance was measured at 450 nm with a microplate leader (Molecular Devices).
  • TB511 TAMpep826-dKLA
  • TB511 TAMpep826-dKLA
  • the TB511 was reacted with M2 macrophages in which ITGB2 expression was suppressed by Crispr/cas9.
  • M2 macrophages showed a cell viability of about 50% due to TB511, but cells in which ITGB2 expression was suppressed showed a significant increase in cell viability (FIG. 20).
  • an anti-ITGB2 antibody Polyclonal Rabbit anti-Human ITGB2/CD18 antibody
  • LS-C312785; LS Bio (1 ⁇ g) was pretreated for 1 hour and then reacted with TB511 (1 ⁇ M) for 1 hour.
  • Cell viability was analyzed using CCK-8 analysis to determine whether apoptosis was induced.
  • caspase-3, caspase-8, and caspase-9 in M2 macrophages was significantly increased by TB511, whereas the expression of caspase-3, caspase-8, and caspase-9 by TB511 was significantly increased in M2 macrophages pretreated with ITGB2 antibody.
  • the expression of 9 was significantly decreased ( Figure 21).
  • caspase-3 expression was increased by TB511, whereas in M2 macrophages pretreated with ITGB2 antibody, caspase-3 expression was decreased by TB511 ( Figure 21).
  • co-localization of mitochondria and TB511 was reduced in M2 macrophages pretreated with ITGB2 antibody compared to cells without ITGB2 pretreatment (FIG. 21).
  • TEP tumor microenvironment
  • RPMI-1640 culture medium was mixed with 3% matrigel, and GFP was detected using MDA-MB-231 human breast cancer cells, CAF (Cancer-associated Fibroblast), and Incucyte®Nuclight Lentivirus Reagents (Sartorius).
  • THP-1 cells prepared to express were counted and distributed at a ratio of 5:1:1 to 200 ⁇ l in 96 u-bottom 3-D cultue plates (Sbio).
  • the cells were collected by centrifugation at 1200 rpm for 3 minutes, and then cultured in an incubator at 37°C for 48 hours to form spheroids.
  • TB511 was treated at concentrations of 1 ⁇ M, 2 ⁇ M, 4 ⁇ M, and 8 ⁇ M every three days, images were taken with a fluorescence microscope, and bright-field images were taken and the diameter of the ferret was measured. The spheroid area was measured.
  • the average tumor spheroid diameter was measured by measuring an average of 3 diameters per spheroid using an open source, and the size was analyzed using ImageJ (software version 1.47m).
  • the spheroid size was determined by taking a bright-field image (20X ), the average tumor spheroid diameter was measured at an average of 3 per spheroid and analyzed using ImageJ (software version 1.47m).
  • the spheroids were fixed and subjected to immunofluorescence staining by reacting with an antibody (abcam) against the tumor growth factor ki-67 (control stain: DAPI).
  • images of GFP fluorescence expressed within the cells were taken using a confocal microscope, and the number of cells expressing fluorescence was measured.
  • Lung cancer 3D spheroids were prepared by mixing A549 human lung cancer cells, CAF, and THP-1 cells using the method of Example 8-1, and then treated with TB511 at concentrations of 1 ⁇ M, 2 ⁇ M, and 4 ⁇ M, respectively, and the effect was evaluated. Analysis was performed as in Example 8-1 above. When producing spheroids, 3D spheroids were produced using cancer cells alone or a mixture of cancer cells + CAF cells only, and the sizes of the spheroids were compared.
  • the size of the spheroids was found to significantly increase when spheroids were formed with A549+CAF+THP-1 cells compared to when spheroids were formed with only A549 cells or A549+CAF cells.
  • the size of spheroids was found to be significantly reduced in a concentration-dependent manner of TB511 in the group treated with TB511 compared to the group not treated with TB511 ( *** p ⁇ 0.001) (FIG. 24).
  • the number of THP-1 cells was significantly reduced in a concentration-dependent manner compared to the group not treated with TB511, and the tumor growth factor ki-67 was also concentration-dependent. It was found to decrease dependently ( *** p ⁇ 0.001) (FIG. 25).
  • lung cancer 3D spheroids were prepared by mixing A549 human lung cancer cells, CAF, and THP-1 cells using the method of Example 8-1, M-DM1 was treated at concentrations of 1 ⁇ M, 2 ⁇ M, and 4 ⁇ M, respectively, and the effect was analyzed as in Example 8-1 above.
  • the size of the spheroids was found to decrease in a concentration-dependent manner in the group treated with M-DM1 compared to the group not treated with M-DM1 ( *** p ⁇ 0.001) (FIG. 26).
  • Example 8-1 To confirm the efficacy of TB511 against carboplatin-resistant lung cancer, carboplatin-resistant A549 cells, CAF, and THP-1 cells were mixed to form 3D-spheroids by the method of Example 8-1.
  • TB511 was treated at concentrations of 1 ⁇ M, 2 ⁇ M, and 4 ⁇ M, respectively, and the effect was analyzed as in Example 8-1.
  • the size of the spheroids was found to be significantly increased when spheroids were formed with A549+CAF+THP-1 cells compared to when spheroids were formed with only A549-resistant cells or A549+CAF cells, and TB511
  • the size of spheroids was found to be significantly reduced in a TB511 concentration-dependent manner in the TB511-treated group compared to the untreated group ( *** p ⁇ 0.001) (FIG. 27).
  • the number of THP-1 cells was significantly reduced in a concentration-dependent manner in the TB511-treated group compared to the TB511-untreated group, and tumor growth factors ki-67 was also found to significantly decrease from 2 ⁇ M ( *** p ⁇ 0.001) (FIG. 28).
  • Example 8-1 To confirm the efficacy of TB511 against docetaxel-resistant prostate cancer, docetaxel-resistant PC3 prostate cancer cells, CAF, and THP-1 cells were mixed to form 3D-spheroids using the method of Example 8-1, and TB511 was treated at a concentration of 1 ⁇ M, 2 ⁇ M, or 4 ⁇ M, respectively, and the effect was analyzed as in Example 8-1.
  • the size was significantly increased when spheroids were formed with PC3+CAF+THP-1 cells compared to when spheroids were formed with PC3-resistant cells alone or PC3+CAF cells alone, and the size was significantly increased in the group not treated with TB511.
  • the size of spheroids in the TB511-treated group was found to be significantly reduced in a TB511 concentration-dependent manner ( *** p ⁇ 0.001) (FIG. 29).
  • Example 8-1 To confirm the efficacy of ITGB2-binding ADC (Antibody-drug conjugate) against breast cancer, MDA-MB-231 human breast cancer cells, CAF, and THP-1 cells were mixed by the method of Example 8-1 to form 3D-spheroids. was formed and treated with CD18-DM1 or CD18-MMAE, the ADC of the present invention, at a concentration of 10 ⁇ g and 20 ⁇ g, respectively, and the effect was analyzed as in Example 8-1.
  • ITGB2-binding ADC Antibody-drug conjugate
  • 3D-spheroids were formed by mixing A549 human lung cancer cells, CAF, and THP-1 cells by the method of Example 8-1, and CD18-DM1, the ADC of the present invention, was mixed.
  • each was treated with CD18-MMAE at a concentration of 10 ⁇ g, and the effect was analyzed as in Example 8-1 above.
  • carboplatin-resistant A549 cells, CAF, and THP-1 cells were mixed to form 3D-spheroids using the method of Example 8-1 above, and CD18-DM1 Alternatively, CD18-MMAE was treated at a concentration of 10 ⁇ g each, and the effect was analyzed as in Example 8-1 above.
  • docetaxel-resistant PC3 prostate cancer cells, CAF, and THP-1 cells were mixed to form 3D-spheroids by the method of Example 8-1, and CD18-DM1 or After treating CD18-MMAE at a concentration of 10 ⁇ g each, the effect was analyzed as in Example 8-1 above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)

Abstract

본 발명은 신규 펩타이드 기반의 면역항암제에 관한 것으로, 멜리틴, 이의 변이체 또는 이들의 유사체, 또는 이들과 약물이 연결된 접합체의 면역항암제 용도에 관한 것으로, 본 발명의 멜리틴, 이의 변이체 또는 이들의 유사체는 M2 종양 관련 대식세포의 세포막에 발현되는 ITGB2에 특이적으로 결합하여 M2 종양 관련 대식세포를 사멸시키며, 멜리틴, 이의 변이체 또는 이들의 유사체에 약물로서 전세포사멸성 펩타이드 또는 항암제가 결합된 접합체가 상기의 M2 종양 관련 대식세포의 세포자멸사 효과를 현저히 증가시키므로, 이를 종양의 생장과 전이를 억제용 항암 조성물로 활용할 수 있다.

Description

신규 펩타이드 기반 면역항암제
본 발명은 신규 펩타이드 기반의 면역항암제에 관한 것으로, 멜리틴, 이의 변이체 또는 이들의 유사체, 또는 이들과 약물이 연결된 접합체의 면역항암제 용도에 관한 것이다.
기존의 항암치료는 암세포를 직접 공격하거나 암세포를 공격하는 체내 면역세포의 활성을 강화시키는 방향으로 연구되어 왔다. 그러나 이러한 항암제는 암세포 외의 다른 정상세포 또한 공격하여 탈모, 오심, 구토등의 많은 부작용을 가져왔고, 면역세포의 과도한 증가로 인한 부가적 반응을 초래한다. 기존의 화학적 요법이나 방사선 치료방법에 비하여 부작용을 최소화할 수 있는 항암면역치료방법은 체내의 면역시스템을 이용하여 암을 치료하는 방법이며, 이러한 항암면역치료기법 중에는 치료용 면역세포인 T 세포 (CAR-T 포함), 수지상세포(Dendritic Cells), 자연살해세포(Natural Killer Cells) 등을 체외에서 활성화 시킨 후에 체내에 직접 주입하는 세포치료제방법과 암 항원과 면역활성화 물질을 체내에 주입함으로써, 체내에 존재하는 면역세포를 직접적으로 활성화함으로써 항암효능을 높이는 항암백신에 대한 방법 등이 활발하게 진행되고 있다. 하지만, 이러한 세포치료제나 암백신은 주로 혈액암 관련 질병에 주로 사용되고 있고, 고형암에서는 대부분 그 치료효능이 매우 낮다는 단점을 갖고 있다. 이러한 이유 중의 하나는 고형암 주위에서 면역기능을 억제하는 미세환경 요인에 기인한다. 실제로, 종양미세환경에서 면역세포의 기능을 저하시키는 세포 (MDSC: myeoloid-derived stromal cells, Treg: regulatory T cell, TAM: tumor-assocaited macrophages)나 면역억제유발 사이토카인, 대사체 등이 활발하게 작용함으로써, 면역활성화 물질과 치료용 면역세포의 활성을 급격하게 저하시키는 것이다. 따라서 종양세포 및 면역세포에 직접적인 영향없이 종양세포의 주변 미세환경만을 조절하여 종양세포로의 영양분 공급, 종양세포 주변의 혈관신생등을 차단하여 항암효과를 갖는 치료제 개발이 중요해지고 있다. 종양 미세 환경은 악성 세포의 증식 및 생존, 혈관 신생, 전이, 비정상 적응 면역 및 호르몬 및 화학요법제에 대한 반응 감소에 기여하여 치료 목표로 크게 고려되고 있다.
종양 주변의 미세환경(microenvironment)은 내피세포, 염증성 세포 및 섬유아세포로 구성되어 있으며, 1970년대에 종양 관련 대식세포(tumor-associated macrophage, TAM)가 종양의 성장에 있어서 중요한 역할을 한다는 것이 밝혀졌다. 종양 관련 대식세포는 암의 성장, 전이 등 전반적인 종양 미세환경과 관련하여 중요한 역할을 담당하며, 종양억제 M1형 대식세포 또는 종양지지 M2형 대식세포의 두 가지 표현형으로 분류된다. M1형 대식세포는 항원을 제시하는 강력한 능력을 갖고, 일반적으로 인터페론-γ, 지방당류(LPS), 종양 괴사 인자(TNF)-α에 의하여 활성화 되며, 전염증 작용 및 살균 작용을 한다. M2형 대식세포는 다양한 세포 외 기질성분, 혈관 신생 및 주화성 인자를 방출함으로써 면역억제, 종양형성 및 혈관형성을 촉진하는 것으로 알려져 있다. 일반적으로, IL-4와 IL-13에 의해 유도되며, 아르기나제-1, mannose(MMR, CD206), 스캐빈저 수용체(SR-A, CD204), CD163, IL-10과 같은 마커를 발현함으로써 M1형 종양 관련 대식세포와 구별된다. 종양 주변에 존재하는 종양 관련 대식세포는 종양 세포의 성장, 전이와 밀접하게 관련이 되어 있으며, 암 환자에서 많은 숫자의 M2형 종양 관련 대식세포가 종양 주변에 존재하면 환자의 예후 및 생존률이 좋지 못한 것으로 보고되고 있다. M2형 대식세포는 암의 성장을 촉진하는 IL-10, TGFβ 및 CCL18과 같은 사이토카인을 생성하며, M2형 종양 관련 대식세포의 표면에 존재하는 PDL1 및 B7-1/2와 같은 수용체들은 T 세포, NK 세포의 항종양 활성을 억제하는 것으로 보고되고 있다. M2형 종양 관련 대식세포가 다량으로 존재하는 미세환경에서는 종양의 성장, 분화 및 전이가 활발하게 이루어지므로, M2형 종양 관련 대식세포를 표적으로 하는 표적 치료제의 개발이 필요하다.
본 발명의 목적은 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물을 제공하는 것이다.
또한, 본 발명의 목적은 암의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한, 본 발명의 목적은 암의 치료 방법을 제공하는 것이다.
아울러, 본 발명의 목적은 본 발명의 결합체의 암의 예방 및 치료용 약학적 조성물의 제조에 사용하기 위한 용도를 제공하는 것이다.
상기 목적의 달성을 위해, 본 발명은 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 유효성분으로 포함하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물을 제공한다.
또한, 본 발명은 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 약학적으로 유효한 양으로 암에 걸린 개체에 투여하는 단계를 포함하는 암의 치료 방법을 제공한다.
아울러, 본 발명은 암의 예방 및 치료용 약학적 조성물의 제조에 사용하기 위한, 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체의 용도를 제공한다.
본 발명의 멜리틴, 이의 변이체 또는 이들의 유사체는 M2 종양 관련 대식세포의 세포막에 발현되는 ITGB2에 특이적으로 결합하여 M2 종양 관련 대식세포를 사멸시키며, 멜리틴, 이의 변이체 또는 이들의 유사체에 약물로서 전세포사멸성 펩타이드 또는 항암제가 결합된 접합체가 상기의 M2 종양 관련 대식세포의 세포자멸사 효과를 현저히 증가시키므로, 이를 종양의 생장과 전이를 억제용 항암 조성물로 활용할 수 있다.
도 1a는 TAMpep의 M2 대식세포에 대한 친화도를 유세포 분석으로 확인한 도이다.
도 1b는 TAMpep의 M2 대식세포에 대한 친화도를 정량화한 그래프이다 (*P < 0.05 versus the M0.).
도 2a는 M2/M0 및 M1/M0 비율 분석 벤다이어그램으로 M2 대식세포에서 TAMpep과 결합하는 단백질을 식별한 도이다.
도 2b는 M2/M0 비율의 산점도 플롯(scatter plots) 분석으로 M2 대식세포에서 TAMpep과 결합하는 단백질을 식별한 도이다.
도 2c는 M1/M0 비율의 산점도 플롯 분석으로 M2 대식세포에서 TAMpep과 결합하는 단백질을 식별한 도이다.
도 2d는 M2/M1 비율의 산점도 플롯 분석으로 M2 대식세포에서 TAMpep과 결합하는 단백질을 식별한 도이다.
도 3은 M0, M1 및 M2 대식세포에서 각각 추출한 세포막 단백질과 TAMpep826-비오틴을 반응시켜 얻은 LC-MS 크로마토그램 데이터를 나타낸 도이다.
도 4는 LC-MS/MS 프로테오믹스를 이용하여 TAMpep826의 타겟 단백질을 동정한 도이다.
도 5는 Quantitative RT-PCR 조건을 나타낸 도이다.
도 6은 M2 대식세포에서 ITGB2 mRNA 발현을 확인한 도이다.
도 7은 M2 대식세포에서 ITGB2 단백질 발현을 확인한 도이다.
도 8은 면역형광분석으로 M2 대식세포에서 ITGB2 단백질의 발현을 확인한 도이다.
도 9는 M2 대식세포의 세포막에서 ITGB2의 발현을 확인한 도이다.
도 10은 M2 대식세포에서 TAMpep826 및 ITGB2의 상호작용을 풀-다운 분석(Pull-down assay)으로 확인한 도이다.
도 11은 면역형광분석으로 M2 대식세포에서 TAMpep826 및 ITGB2의 상호작용 확인한 도이다.
도 12 및 13은 TB511과 ITGB2의 결합 부위를 도킹 시뮬레이션으로 확인한 도이다.
도 14는 본 발명의 ITGB2 결합 ADC 제작에 사용된 항-CD18 항체가 CD18의 M2 TAM에서의 활성형 구조 (Extended-open form)에 특이적으로 결합하는 것을 나타낸 모식도이다.
도 15는 센서 칩 표면에 ITGB2을 고정화하고 확인한 도이다.
도 16은 항-ITGB2 항체와 ITGB2 단백질의 결합력을 SPR로 확인한 도이다.
도 17은 Melittin-dKLA와 ITGB2 단백질의 결합력을 SPR로 확인한 도이다.
도 18은 M2 대식세포에서 Crispr/cas9을 통해 확립한 ITGB2 발현 억제 세포 모델에서 ITGB2의 mRNA 발현을 확인한 도이다.
도 19는 M2 대식세포에서 ITGB2 발현 억제에 의한 Melittin-dKLA의 세포사멸 감소 효과를 확인한 도이다.
도 20은 M2 대식세포에서 ITGB2 발현 억제에 의한 TB511(TAMpep826-dKLA)의 세포사멸 유도 감소 효과를 확인한 도이다.
도 21은 M2 대식세포에서 ITGB2 항체에 의한 TB511의 세포사멸 유도 감소 효과를 확인한 도이다.
도 22 및 23은 유방암 3D 오가노이드에서 TB511의 효과를 확인한 도이다.
도 24 및 25는 폐암 3D 오가노이드에서 TB511의 효과를 확인한 도이다.
도 26은 폐암 3D 오가노이드에서 M-DM1의 효과를 확인한 도이다.
도 27 및 28는 항암제 내성 폐암 3D 오가노이드에서 TB511의 효과를 확인한 도이다.
도 29 및 30은 항암제 내성 전립선암 3D 오가노이드에서 TB511의 효과를 확인한 도이다.
도 31은 유방암 3D 오가노이드에서 CD18-DM1의 효과를 확인한 도이다.
도 32는 유방암 3D 오가노이드에서 CD18-MMAE의 효과를 확인한 도이다.
도 33 및 34는 폐암 3D 오가노이드에서 ADC (CD18-DM1 및 CD18-MMAE)의 효과를 확인한 도이다.
도 35 및 36은 항암제 내성 폐암 3D 오가노이드에서 ADC (CD18-DM1 및 CD18-MMAE)의 효과를 확인한 도이다.
도 37는 및 38은 항암제 내성 전립선암 3D 오가노이드에서 ADC (CD18-DM1 및 CD18-MMAE)의 효과를 확인한 도이다.
이하, 첨부된 도면을 참조하여 본 발명의 구현예로 본 발명을 상세히 설명하기로 한다. 다만, 하기 구현예는 본 발명에 대한 예시로 제시되는 것으로, 당업자에게 주지 저명한 기술 또는 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략할 수 있고, 이에 의해 본 발명이 제한되지는 않는다. 본 발명은 후술하는 특허청구범위의 기재 및 그로부터 해석되는 균등 범주 내에서 다양한 변형 및 응용이 가능하다.
또한, 본 명세서에서 사용되는 용어(terminology)들은 본 발명의 바람직한 실시예를 적절히 표현하기 위해 사용된 용어들로서, 이는 사용자, 운용자의 의도 또는 본 발명이 속하는 분야의 관례 등에 따라 달라질 수 있다. 따라서, 본 용어들에 대한 정의는 본 명세서 전반에 걸친 내용을 토대로 내려져야 할 것이다. 명세서 전체에서, 어떤 부분이 어떤 구성요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 본 발명에 통합된다.
본 명세서 전반을 통하여, 천연적으로 존재하는 아미노산에 대한 통상의 1문자 및 3문자 코드가 사용될 뿐만 아니라 Aib(α-아미노이소부티르산), Sar(N-methylglycine) 등과 같은 다른 아미노산에 대해 일반적으로 허용되는 3문자 코드가 사용된다. 또한 본 발명에서 약어로 언급된 아미노산은 하기와 같이 IUPAC-IUB 명명법에 따라 기재되었다:
알라닌: A, 아르기닌: R, 아스파라긴: N, 아스파르트산: D, 시스테인: C, 글루탐산: E, 글루타민: Q, 글리신: G, 히스티딘: H, 이소류신: I, 류신: L, 리신: K, 메티오닌: M, 페닐알라닌: F, 프롤린: P, 세린: S, 트레오닌: T, 트립토판: W, 티로신: Y 및 발린: V.
일 측면에서, 본 발명은 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 유효성분으로 포함하는, 미세종양환경에서 종양 관련 대식세포(tumor associated macrophages, TAM)를 제거하기 위한 약학적 조성물에 관한 것이다.
일 구현예에서, 상기 종양 관련 대식세포는 IGBT2(Integrin beta 2)를 발현하는 M2 종양 관련 대식세포일 수 있다.
일 구현예에서, 상기 조성물은 M1 대식세포는 제거하지 않으면서, M2 대식세포만을 제거할 수 있다.
일 구현예에서, 멜리틴은 서열번호 1의 아미노산 서열을 포함할 수 있다.
일 구현예에서, 멜리틴의 변이체는 서열번호 1의 아미노산 서열에서 위치 1 내지 7의 아미노산이 결실된 펩타이드일 수 있으며, 서열번호 2의 아미노산 서열을 포함할 수 있다.
일 구현예에서, ITGB2는 서열번호 7 또는 8의 아미노산 서열을 포함할 수 있다.
일 구현예에서, 상기 멜리틴, 이의 변이체 또는 이들의 유사체는 ITGB2(CD18)가 확장된(extended) 활성형 구조(Active conformation)에 특이적으로 결합할 수 있다.
일 구현예에서, 멜리틴, 이의 변이체 또는 이들의 유사체가 ITGB2의 466 내지 565의 아미노산과 결합할 수 있다.
일 구현예에서, 상기 조성물은 서열번호 5 또는 6의 아미노산 서열을 포함하는 펩타이드를 포함할 수 있다.
일 구현예에서, 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체는 펩타이드-약물 접합체(peptide-drug conjugate, PDC)일 수 있고, PDC는 서열번호 5의 아미노산 서열을 포함하는 Melittin-dKLA일 수 있으며, 서열번호 6의 아미노산 서열을 포함하는 TB511일 수 있고, 말레이미드-변형된 멜리틴에 약물 DM1이 컨쥬게이트된 M-DM1일 수 있다.
일 구현예에서, TB511의　LEU(6)은　ITGB2의　LEU(528), THR(538), LEU(556), CYS(557)　및　PHE(558)　부위와 결합(bindin)할 수 있고, TB511의　TRP(12)는　ITGB2의　GLU(466), ILE(469), CYS(470)　및　ARG(471)과 결합할 수 있다.
일 구현예에서, 멜리틴, 이의 변이체 또는 이들의 유사체와 전세포사멸성 펩타이드 또는 항암제는 링커를 매개로 공유적으로 결합하거나 링커의 매개없이 비공유적으로 결합할 수 있다.
일 구현예에서, 상기 링커는 서열번호 3의 아미노산 서열을 포함할 수 있다.
일 구현예에서, 멜리틴, 이의 변이체 또는 이들의 유사체에 반감기 또는 안정성을 증가시키기 위한 특정 목적을 위해 설계된 표적화 서열, 태그, 표지된 잔기 또는 아미노산 서열을 추가로 포함할 수 있다.
일 구현예에서, 상기 전세포사멸성 펩타이드는 KLA, 알파-디펜신-1(alpha-defensin-1), BMAP-28, Brevenin-2R, 부포린 IIb(Buforin IIb), 세크로핀 A-마가이닌 2(cecropin A-Magainin 2, CA-MA-2), 세크로핀 A(Cecropin A), 세크로핀 B(Cecropin B), 크리소피신-1(chrysophsin-1), D-K6L9, 고메신(Gomesin), 락토페리신 B(Lactoferricin B), LLL27, LTX-315, 마가이닌 2(Magainin 2), 마가이닌 II-봄패신 결합체(Magainin II-bombesin conjugate, MG2B), 파르닥신(Pardaxin) 및 이들의 조합으로 이루어진 군에서 선택될 수 있으며, D형 이성질체 KLA인 것이 더욱 바람직하고, 서열번호 4의 아미노산 서열을 포함할 수 있다.
일 구현예에서, 상기 항암제는 SN-38(7-에틸-10-히드록시-캠토테신, 7-Ethyl-10-hydroxy-camptothecin), 다우노루비신(daunorubicin), 독소루비신(doxorubicin), 에피루비신(epirubicin), 이다루비신(idarubicin), 픽산트론(pixantrone), 사바루비신(sabarubicin), 발루비신(valrubicin), 파클리탁셀(paclitaxel), 도세탁셀(docetaxel), 메클로에타민(mechloethamine), 클로람부실(chlorambucil), 페닐알라닌(phenylalanine), 무스타드(mustard), 사이클로포스파미드(cyclophosphamide), 이포스파미드(ifosfamide), 카르무스틴(carmustine: BCNU), 로무스틴(lomustine: CCNU), 스트렙토조토신(streptozotocin), 부설판(busulfan), 티오테파(thiotepa), 시스플라틴(cisplatin), 카보플라틴(carboplatin), 닥티노마이신(dactinomycin: actinomycin D), 플리카마이신(plicamycin), 마이토마이신 C(mitomycin C), 빈크리스틴(vincristine), 빈블라스틴(vinblastine), 테니포사이드(teniposide), 토포테칸(topotecan), 이리도테칸(iridotecan), 우라무스틴(uramustine), 멜파란(melphalan), 벤다무스틴(bendamustine), 다카바진(dacarbazine), 테모졸로마이드(temozolomide), 알트레타민(altretamine), 듀오카르마이신(duocarmycin), 네다플라틴(nedaplatin), 옥사리플라틴(oxaliplatin), 사트라플라틴(satraplatin), 트리플라틴 테트라나이트레이트(triplatin tetranitrate), 5-플루오로우라실(5-fluorouracil), 6-머캅토퓨린(6-mercaptopurine), 카페시타빈(capecitabine), 클라드리빈(cladribine), 클로파라빈(clofarabine), 시스타르빈(cystarbine), 플록스유리딘(floxuridine), 플루다라빈(fludarabine), 겜시타빈(gemcitabine), 하이드록시우레아(hydroxyurea), 메토트렉세이트(methotrexate), 페메트렉세드(pemetrexed), 펜토스타틴(pentostatin), 티오구아닌(thioguanine), 에토포사이드(etoposide), 미토산트론(mitoxantrone), 이자베필론(izabepilone), 빈데신(vindesine), 비노렐빈(vinorelbine), 에스트라머스틴(estramustine), 메이탄신(maytansine), DM1(mertansine, 메르탄신), DM4, 돌라스타틴(dolastatin), 아우리스타틴 E(auristatin E), 아우리스타틴 F(auristatin F), 모노메틸 아우리스타틴 E(monomethyl auristatin E, MMAE), 모노메틸 아우리스타틴 F(monomethyl auristatin F) 및 이들의 유도체로 이루어진 군에서 선택될 수 있으며, DM1 또는 MMAE일 수 있다.
일 구현예에서, 상기 멜리틴, 이의 변이체 또는 이들의 유사체와 전세포사멸성 펩타이드 또는 항암제는 화학적 링커 또는 직접 결합에 의해 연결될 수 있으며, 화학적 링커는 멜리틴, 이의 변이체 또는 이들의 유사체와 전세포사멸성 펩타이드 또는 항암제 상의 아민기(amine), 카르복시기(carboxyl) 또는 설프히드릴기(sulfhydryl)를 통해 연결될 수 있다.
일 구현예에서, 상기 화학적 링커는 양 말단에 카르보디이미드기(carbodiimide), N-히드록시숙신이미드 에스테르(N-hydroxysuccinimide ester; NHS ester), 이미도에스테르(imidoester), 펜타플루오로페닐에스테르(pentafluorophenyl ester), 히드록시메틸포스핀(hydroxymethyl phosphine), 말레이미드(maleimide), 할로아세틸(haloacetyl), 피리딜디설파이드(pyridyldisulfide), 티오술포네이트(thiosulfonate), 비닐술폰(vinylsulfone) 및 이들의 조합으로부터 선택되는 작용기를 포함할 수 있으며, EDC(1-ethyl-3-(3-dimethylaminopropyl) carbodiimide), DCC(N,N'-dicyclohexylcarbodiimide), SATA(succinimidyl acetylthioacetate), 술포-SMCC(sulfosuccinimidyl-4-(NDmaleimidomethyl)cyclohexane-1-carboxylate), DMA(dimethyl adipimidate·2HCl), DMP(dimethylpimelimidate·2HCl), DMS(dimethyl Suberimidate·2HCl), DTBP(dimethyl 3,3'-dithiobispropionimidate·2HCl), 술포-SIAB(sulfosuccinimidyl (4-iodoacetyl)aminobenzoate), SIAB(succinimidyl (4-iodoacetyl)aminobenzoate), SBAP(succinimidyl 3-(bromoacetamido)propionate), SIA(succinimidyl iodoacetate), SM(PEG)n(succinimidyl-([N-maleimidopropionamido]-#ethyleneglycol ester, n=2, 4, 6, 8, 12 또는 24), SMCC(succinimidyl-4-(N-Dmaleimidomethyl)cyclohexane-1-carboxylate), LCSMCC(succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), 술포-EMCS(N-εester), EMCS(N-ε술포-GMBS(N-γester), GMBS(N-γ ester), 술포-KMUS(N-κester), 술포-MBS(m-maleimidobenzoyl-Nhydroxysulfosuccinimide ester), MBS(m-maleimidobenzoyl-N-hydroxysuccinimide ester), 술포-SMPB(sulfosuccinimidyl 4-(p-maleimidophenyl)butyrate), SMPB(succinimidyl 4-(pmaleimidophenyl)butyrate), AMAS(N-α-maleimidoacet-oxysuccinimide ester), BMPS(N-β-maleimidopropyloxysuccinimide ester), SMPH(succinimidyl 6-[(β-maleimidopropionamido)hexanoate]), PEG12-SPDP(2-pyridyldithiol-tetraoxaoctatriacontane-N-hydroxysuccinimide), PEG4-SPDP, 술포-LCSPDP(sulfosuccinimidyl 6-[3'-(2-pyridyldithio)propionamido]hexanoate), SPDP(succinimidyl 3-(2-pyridyldithio)propionate), LC-SPDP(succinimidyl 6-[3'-(2-pyridyldithio)propionamido]hexanoate), SMPT(4-succinimidyloxycarbonyl-alpha-methyl-alpha(2-pyridyldithio)toluene), DSS(disuccinimidylsuberate), BS(PEG)5(bis(succinimidyl) penta(ethylene glycol)), BS(PEG)9(bis(succinimidyl)nona(ethylene glycol)), BS3(bis[sulfosuccinimidyl] suberate), BSOCOES(bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone), PDPH(3-(2-pyridyldithio)propionyl hydrazide), DSG(disuccinimidyl glutarate), DSP(dithiobis[succinimidyl propionate]), BM(PEG)n(1,8-bismaleimido-ethyleneglycol, n=2 또는 3), BMB(1,4-bismaleimidobutane), BMDB(1,4-bismaleimidyl-2,3-dihydroxybutane), BMH(bismaleimidohexane), BMOE(bismaleimidoethane), DTME(dithiobismaleimidoethane), TMEA(tris(2-maleimidoethyl)amine), DSS(disuccinimidyl suberate), DST(disuccinimidyl tartarate), DTSSP(3,3'-dithiobis[sulfosuccinimidylpropionate]), EGS(ethylene glycol bis[succinimidylsuccinate]), 술포-EGS(ethylene glycol bis[sulfosuccinimidylsuccinate]) 및 TSAT(tris-succinimidylaminotriacetate),DFDNB(1,5-difluoro-2,4-dinitrobenzene) 및 이들의 조합으로부터 선택될 수 있다.
본 발명에 있어서, 상기 펩타이드는 상기 아미노산 서열을 갖는 것이 바람직하지만 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현 예에 따르면, 상기 펩타이드는 상기 아미노산의 비율이 50% 이상, 바람직하게는 60% 이상, 보다 바람직하게는 70% 이상, 보다 바람직하게는 80% 이상, 보다 바람직하게는 90% 이상, 가장 바람직하게는 100%로 높은 것이 바람직하다.
본 발명에 있어서, 상기 펩타이드는 표적화 서열, 태그(tag), 표지된 잔기, 반감기 또는 펩타이드의 안정성을 증가시키기 위한 특정 목적으로 고안된 추가의 아미노산 서열도 포함할 수 있다. 또한, 본 발명의 펩타이드는 이펙터(effectors), 약물, 프로드럭, 독소, 펩타이드, 전달 분자 등의 커플링 파트너와 연결될 수 있다.
본 발명에 있어서, 상기 펩타이드는 약학적으로 허용 가능한 염의 형태로 제조될 수 있다. 구체적으로 산을 첨가함으로써 염을 형성할 수 있고, 예를 들어 무기산(예: 염산, 히드로브롬산, 인산, 질산, 황산 등), 유기 카르복실산(예: 아세트산, 트리플루오로아세트산과 같은 할로 아세트산, 프로피온산, 말레산, 숙신산, 말산, 시트르산, 타르타르산, 살리실산), 및 산성 당(글루쿠론산, 갈락투론산, 글루콘산, 아스코르브산), 산성 폴리사카리드 (예: 히알우론산, 콘드로이틴 술페이트, 아르기닌산), 콘드로이틴 술페이트와 같은 술폰산 당 에스테르를 포함하는 유기 술폰산(예: 메탄술폰산, p-톨루엔 술폰산) 등을 첨가하여 염을 형성할 수 있다.
본 발명의 용어, "결합체"는 멜리틴, 이의 변이체 또는 이들의 유사체 펩타이드와 전세포사멸성 펩타이드 또는 항암제가 결합된 접합체로써, M2형 종양관련 대식세포를 표적으로 할 수 있다. 상기 결합체는 타겟팅하는 M2형 대식세포에 결합하여 대식세포의 미토콘드리아를 손상시킴으로써 종양의 생장과 전이를 억제하고, 주변의 혈관신생을 선택적으로 억제함으로써 암을 억제할 수 있다.
즉, 본 발명의 접합체는 항암제에 비해 항암활성이 향상된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 결합체는 멜리틴, 이의 변이체 또는 이들의 유사체를 GGGGS 링커 (서열번호 3)를 통해 전세포사멸성 펩타이드와 연결할 수 있고, 또는 SPDP 링커를 통해 Doxorubicin, Methotrexate, Entinostat, Cladribine, Pralatrexate 및 Lorlatinib와 같은 항암제와 연결하는 것일 수 있다. 또한, 항암제 중 Maytansine DM1, Maytansine DM3 및 Maytansine DM4는 링커 없이 직접 연결하여 결합될 수 있으나, 이에 제한되는 것은 아니다.
즉, 본 발명의 결합체는 멜리틴, 이의 변이체 또는 이들의 유사체가 화학적 링커를 통하거나 직접 항암제와 연결된 형태일 수 있으나, 이에 제한되지 않는다.
본 발명의 용어, “멜리틴(Melittin; MEL)”은 봉독의 주요성분을 구성하는 펩타이드이다. 상기 본원에 사용되는 용어 “봉독(bee venom; BV)”은 꿀벌(Apismellifera)의 복부에서 생성되는 산성 및 염기성 분비물의 혼합물로서 무색의 쓴 액체형태를 띠며, 그 주된 성분은 펩타이드인 멜리틴(melittin), 아파민(apamin) 및 비만세포 탈과립화(mast cell degranulating; MCD) 펩타이드 및 효소인 포스포리파아제 A2(phospholipase A2; PLA2) 등이며, 이외 여러 가지 미량의 성분을 포함한다. 따라서 본발명의 멜리틴은 꿀벌(Apis mellifera)의 봉독에서 분리되는 것일 수 있으나 이에 제한되지 않는다.
본 발명에서 사용된 용어 "펩타이드"는 아미노산 중합체로서, 천연 아미노산 뿐 아니라, 비단백질성 아미노산도 구성요소로 포함할 수 있다.
본 발명에서 사용된, 용어 "변이체"는 기준 물질과 비교하였을 때 최소한 한개의 아미노산 차이(치환, 삽입 또는 결손)를 포함하는 대응하는 아미노산 서열을 말한다. 특정 구체예들에 있어서 "변이체"는 기준 서열과 비교하였을 때 높은 아미노산 서열 상동성(homology) 및/또는 보존적 아미노산 치환, 결손 및/또는 삽입을 가진다.
본 발명에서 사용된, 용어 "펩타이드 유사체"는 아미노산의 측쇄 또는 알파-아미노산 백본에 대하여 하나 이상의 다른 기능기로 치환된 유사체를 포함할 수 있다. 측쇄 또는 백본 개질화 펩타이드 유사체의 예로는 피롤리딘 고리가 하이드록시기로 치환된 하이드록시프롤린이나, N-메틸 글리신 "펩토이드"를 들 수 있으나, 이로 제한되지 않는다. 펩타이드 유사체의 종류에 대해서는 당업계에 공지되어 있다.
본 발명에 따른 단백질 변이체는 특정 아미노산 잔기 위치에서 아미노산 잔기가 보존적으로 치환된 변이체도 포함하는 의미로 해석된다.
본 발명에서 "보존적 치환"이란 1개 이상의 아미노산을 해당 멜리틴 단백질 변이체의 생물학적 또는 생화학적 기능의 손실을 야기하지 않는 유사한 생화학적 특성을 갖는 아미노산으로 치환하는 것을 포함하는 변이체의 변형을 의미한다. "보존적 아미노산 치환"은 아미노산 잔기를 유사한 측쇄를 갖는 아미노산 잔기로 대체시키는 치환이다. 유사한 측쇄를 갖는 아미노산 잔기 부류는 해당 기술분야에 규정되어 있으며, 잘 알려져 있다. 이들 부류는 염기성 측쇄를 갖는 아미노산 (예를 들어, 라이신, 아르기닌, 히스티딘), 산성 측쇄를 갖는 아미노산(예를 들어, 아스파르트산, 글루탐산), 대전되지 않은 극성 측쇄를 갖는 아미노산(예를 들어, 글리신, 아스파라진, 글루타민, 세린, 트레오닌, 티로신, 시스테인), 비-극성 측쇄를 갖는 아미노산(예를 들어, 알라닌, 발린, 류신, 이소류신, 프롤린, 페닐알라닌, 메티오닌, 트립토판), 베타-분지된 측쇄를 갖는 아미노산(예를 들어, 트레오닌, 발린, 이소류신) 및 방향족 측쇄를 갖는 아미노산 (예를 들어, 티로신, 페닐알라닌, 트립토판, 히스티딘)을 포함한다.
본 발명에 따른 펩타이드들은 표준 합성 방법, 재조합 발현 시스템, 또는 임의의 다른 당해 분야의 방법에 의해 제조될 수 있다. 따라서, 본 발명에 따른 펩타이드들은, 예를 들어 하기를 포함하는 방법을 포함하는 다수의 방법으로 합성될 수 있다:
(a) 펩타이드를 고체상 또는 액체상 방법의 수단으로 단계적으로 또는 단편 조립에 의해 합성하고, 최종 펩타이드 생성물을 분리 및 정제하는 방법; 또는
(b) 펩타이드를 인코딩하는 핵산 작제물을 숙주세포 내에서 발현시키고, 발현 생성물을 숙주 세포 배양물로부터 회수하는 방법; 또는
(c) 펩타이드를 인코딩하는 핵산 작제물의 무세포 시험관 내 발현을 수행하고, 발현 생성물을 회수하는 방법; 또는
(a), (b) 및 (c)의 임의의 조합으로 펩타이드의 단편을 수득하고, 이어서 단편을 연결시켜 펩타이드를 수득하고, 당해 펩타이드를 회수하는 방법.
일 측면에서, 본 발명은 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
일 구현예에서, 상기 암은 뇌종양, 흑색종, 골수종, 비소세포성폐암, 구강암, 간암, 위암, 결장암, 유방암, 삼중음성유방암(Triple Negative Breast Cancer, TNBC), 폐암, 골암, 췌장암, 피부암, 두부 또는 경부암, 자궁경부암, 난소암, 대장암, 소장암, 직장암, 나팔관암종, 항문부근암, 자궁내막암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 임파선암, 방광암, 담낭암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 신장 또는 수뇨관암, 신장세포 암종, 신장골반암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있으며, 항암제 내성 암일 수 있다.
일 구현예에서, 상기 조성물은 M0 대식세포 및 M1 대식세포에 비하여, M2 대식세포에서 ITGB2의 발현이 상향조절된 환자를 대상으로 투여될 수 있다.
일 구현예에서, 상기 조성물은 표적항암제일 수 있다.
본 발명의 약학적 조성물은 단독의 요법으로 이용될 수 있으나, 다른 통상적인 생물학적 요법, 화학 요법 또는 방사 요법과 함께 이용될 수도 있으며, 이러한 병행 요법을 실시하는 경우에는 보다 효과적으로 암을 치료할 수 있다. 본 발명을 암의 예방 및 치료에 이용하는 경우 상기 조성물과 함께 이용될 수 있는 화학 요법제는 시스플라틴(cisplatin), 카르보플라틴(carboplatin), 프로카르바진(procarbazine), 메클로레타민(mechlorethamine), 시클로포스파미드(cyclophosphamide), 이포스파미드(ifosfamide), 멜팔란(melphalan), 클로라부실(chlorambucil), 비술판(bisulfan), 니트로소우레아(nitrosourea), 디악티노마이신(dactinomycin), 다우노루비신(daunorubicin), 독소루비신(doxorubicin), 블레오마이신(bleomycin), 플리코마이신(plicomycin), 미토마이신(mitomycin), 에토포시드(etoposide), 탁목시펜(tamoxifen), 택솔(taxol), 트랜스플라티눔(transplatinum), 5-플루오로우라실(5-fluorouracil), 빈크리스틴(vincristin), 빈블라스틴(vinblastin) 및 메토트렉세이트(methotrexate) 등을 포함한다. 본 발명의 조성물과 함께 이용될 수 있는 방사 요법은 X-선 조사 및 γ-선 조사 등이다.
본 발명에서, 용어 "예방"이란 본 발명에 따른 조성물의 투여에 의해 암의 발생, 확산 및 재발을 억제 또는 지연시키는 모든 행위를 의미한다.
본 발명의 조성물의 치료적으로 유효한 양은 여러 요소, 예를 들면 투여방법, 목적부위, 환자의 상태 등에 따라 달라질 수 있다. 따라서, 인체에 사용 시 투여량은 안전성 및 효율성을 함께 고려하여 적정량으로 결정되어야 한다. 동물실험을 통해 결정한 유효량으로부터 인간에 사용되는 양을 추정하는 것도 가능하다. 유효한 양의 결정시 고려할 이러한 사항은, 예를 들면 Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed.(2001), Pergamon Press; 및 E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed.(1990), Mack Publishing Co.에 기술되어있다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에서 사용되는 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키지 않을 정도의 양을 의미하며, 유효용량 수준은 환자의 건강상태, 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와 순차적으로 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여, 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 둘 이상의 이들의 조합을 포함할 수 있다. 본 발명에서 사용되는 용어, "약학적으로 허용가능한"이란 상기 조성물에 노출되는 정상 세포나 인간에게 독성이 없는 특성을 나타내는 것을 의미한다. 상기 담체는 조성물을 생체 내 전달에 적합한 것이면 특별히 제한되지 않으며, 예를 들면, Merck Index, 13th ed., Merck & Co. Inc. 에 기재된 화합물, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 이용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주이용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 더 나아가 당 분야의 적정한 방법으로 또는 Remington's Pharmaceutical Science(Mack Publishing Company, Easton PA, 18th, 1990)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.
일 구현예에서, 상기 약학 조성물은 경구형 제형, 외용제, 좌제, 멸균 주사용액 및 분무제를 포함하는 군으로부터 선택되는 하나 이상의 제형일 수 있다.
본 발명의 조성물은 또한 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 둘 이상의 이들의 조합을 포함할 수 있다. 약학적으로 허용 가능한 담체는 조성물을 생체 내 전달에 적합한 것이면 특별히 제한되지 않으며, 예를 들면, Merck Index, 13th ed., Merck & Co. Inc. 에 기재된 화합물, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 이용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주이용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 더 나아가 당 분야의 적정한 방법으로 또는 Remington's Pharmaceutical Science(Mack Publishing Company, Easton PA, 18th, 1990)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.
본 발명의 조성물에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 본 발명의 조성물은, 조성물 총 중량에 대하여 상기 단백질을 0.0001 내지 10 중량 %로, 바람직하게는 0.001 내지 1 중량 %를 포함한다.
본 발명의 약학적 조성물은 약제학적으로 허용 가능한 첨가제를 더 포함할 수 있으며, 이때 약제학적으로 허용 가능한 첨가제로는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바 납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 백당, 덱스트로스, 소르비톨 및 탈크 등이 사용될 수 있다. 본 발명에 따른 약제학적으로 허용 가능한 첨가제는 상기 조성물에 대해 0.1 중량부 내지 90 중량부 포함되는 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명의 조성물은 목적하는 방법에 따라 비 경구 투여(예를 들어 정맥 내, 피하, 복강 내 또는 국소에 적용)하거나 경구 투여할 수 있으며, 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 다양하다. 본 발명에 따른 조성물의 일일 투여량은 0.0001 ~ 10 ㎎/㎖이며, 바람직하게는 0.0001 ~ 5 ㎎/㎖이며, 하루 일 회 내지 수회에 나누어 투여하는 것이 더욱 바람직하다.
본 발명의 조성물의 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 통상적으로 사용되는 단순 희석제인 물, 액체 파라핀 이외에 다양한 부형제, 예컨대 습윤제, 감미제, 방향제, 보존제 등이 함께 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제, 좌제 등이 포함된다.
일 측면에서, 본 발명은 본 발명의 조성물을 시험관의 M2 종양 관련 대식세포에 처리하는 단계를 포함하는, M2형 종양관련 대식세포 제거 방법에 관한 것이다.
일 측면에서, 본 발명은 본 발명의 조성물을 포함하는 암 진단용 조성물에 관한 것이다.
일 측면에서, 본 발명은 본 발명의 암 진단용 조성물을 포함하는, 암 진단 키트에 관한 것이다.
본 발명에서 용어 “암 진단 키트”는 본 발명의 암 진단용 조성물이 포함된 키트를 의미한다. 따라서, 상기 표현 “암 진단 키트”는 “암 진단용 조성물”과 서로 교차 또는 혼용하여 사용이 가능하다. 본 명세서에서 용어 “진단”은 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는 지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)(예컨대, 전-전이성 또는 전이성 암 상태의 동정, 암의 단계 결정 또는 치료에 대한 암의 반응성 결정)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다.
본 발명의 멜리틴, 이의 변이체 또는 이들의 유사체들은 M2 종양 관련 대식세포의 세포막에 발현되는 ITGB2에 특이적으로 결합함으로써, 이들 자체 또는 이들과 연결된 약물 (전세포사멸성 펩타이드 또는 항암제)이 M2 종양 관련 대식세포를 사멸시킴으로써 종양의 생장과 전이를 억제하고, 주변의 혈관신생을 선택적으로 억제함으로써 항암 활성을 가지며, M2 종양 관련 대식세포 특이적으로 결합하기 때문에 암의 진단에도 사용되는 테라노스틱 제제로서 사용될 수 있다. 또한, 항암제와 함께 동시에, 별도로 또는 순차적으로 투여되는 항암보조제로서도 사용될 수 있다. 아울러, 멜리틴, 이의 변이체 또는 이들의 유사체가 M2 종양 관련 대식세포와 특이적으로 결합하기 때문에, 이를 표적화하는 약물전달체로서도 이용될 수 있다.
일 측면에서, 본 발명은 대상으로부터 분리된 생물학적 시료와 본 발명의 조성물을 접촉시키는 단계; 및 정상 대조군 시료와 비교하는 단계를 포함하는, 암 진단을 위한 정보제공 방법에 관한 것이다.
일 구현예에서, 대상으로부터 분리된 생물학적 시료에서의 M2 종양 관련 대식세포 수준이 정상 대조군 시료에 비해 높은 경우, 상기 검사 대상이 암일 것으로 판단하는 단계를 추가로 포함할 수 있다.
본 발명에서 사용된 용어, "시료(샘플)"는 대상 또는 환자로부터 얻은 생물학적 시료를 의미한다. 생물학적 시료의 공급원은 신선한, 동결된 및/또는 보존된 장기 또는 조직 샘플 또는 생검 또는 흡인물로부터의 고형 조직; 혈액 또는 임의의 혈액 구성분; 대상의 임신 또는 발생의 임의의 시점의 세포일 수 있다.
일 측면에서, 본 발명은 본 발명의 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 약학적으로 유효한 양으로 암에 걸린 개체에 투여하는 단계를 포함하는 암의 치료 방법에 관한 것이다.
일 구현예에서, 상기 개체는 M0 대식세포 및 M1 대식세포에 비하여, M2 대식세포에서 ITGB2의 발현이 상향조절된 환자일 수 있다.
일 측면에서, 본 발명은 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체의 암의 예방 및 치료용 약학적 조성물의 제조에 사용하기 위한 용도에 관한 것이다.
하기의 실시예를 통하여 본 발명을 보다 상세하게 설명한다. 그러나 하기 실시예는 본 발명의 내용을 구체화하기 위한 것일 뿐 이에 의해 본 발명이 한정되는 것은 아니다.
실시예 1. M2 종양 관련 대식세포(M2 TAM) 표적화 펩타이드 합성
하기 표 1의 멜리틴(Melittin) 및 TAMpep826을 GenScript (Piscataway, NJ, USA)에 합성 의뢰하여 공급받았으며, 이후 실험에서 D-PBS에 5 mg/ml로 녹여 사용되었다.
명칭 서열 서열번호 설명
Melittin GIGAVLKVLTTGLPALISWIKRKRQQ 1 멜리틴 펩타이드
TAMpep826 VLTTGLPALISWIKRKRQQ 2 멜리틴의 첫 7개의 아미노산이 제거된 펩타이드
실시예 2. M2 TAM 표적화 분석
2-1. 멜리틴의 M2 TAM에 대한 친화도(Affinity) 확인
상기 실시예 1에서 제작한 멜리틴이 M2 종양 관련 대식세포(M2 TAM)에 특이적으로 결합하는지 확인하기 위해, 인간 단핵구 세포주 THP-1를 M0, M1 및 M2 대식세포로 분화시키고, FITC 컨쥬게이트된 멜리틴을 처리하여 유세포 분석으로 확인하였다. 구체적으로, THP-1 세포는 100 nM의 PMA(phorbol 12-myristate 13-acetate)를 37℃에서 24시간 동안 처리하였고 (M0 대식세포), 분화된 M0 대식세포를 100 nM의 LPS 및 20 ng/ml의 IFN-γ와 37℃에서 72시간 동안 배양하여 M1 대식세포 (M1)로 분화시켰으며, 20 ng/ml의 IL-4 및 IL-13와 37℃에서 72시간 동안 배양하여 M2 대식세포 (M2)로 분화시켰다. 분화된 세포에 FITC 컨쥬게이트된 멜리틴 50 nM을 1시간 동안 처리하고 BD FACS CantoII instruments (BD biosciences, San Jose, CA, USA)로 세포를 검출하여 FlowJo software (BD biosciences)로 분석하였다.
그 결과, FITC 양성 세포는 M0 및 M2 대식세포에 비해 M2 대식세포에서 현저히 증가하였다 (도 1a 및 b). 이를 통해, 멜리틴이 M2 대식세포에 우선적으로 결합하는 것을 확인하였다.
2-2. 멜리틴의 M2 TAM 결합 표적 단백질 식별
M2 대식세포의 어떤 단백질이 멜리틴과 M2 대식세포의 특이적 결합에 관련되었는지 확인하기 위해, 비오틴-컨쥬게이트된 멜리틴 (멜리틴-biotin)을 합성하였다. THP-1 세포 (5 Х 106 cells)를 M0, M1 및 M2 대식세포로 분화시킨 뒤, 스크래퍼를 이용하여 세포를 모아 원심분리 (300 Х g, 5분)를 통해 세포를 세척하고 세포막 단백질 추출 키트(membrane protein extraction kit) (Thermo Fisher scientific)을 사용하여 대식세포의 세포막 단백질을 얻었다. 멜리틴에 비오틴(biotin)이 결합된 멜리틴-비오틴 (200 μg)과 상온 (20~24℃)에서 1시간 동안 반응시킨 후 스트렙타비딘 레진(streptavidin resin) (Thermo Fisher scientific)을 이용하여 멜리틴과 결합한 단백질을 얻었다. 염을 제거하기 위해, 100% 메탄올, 0.1% 포름산 및 80% CAN을 각각 100㎕씩 18 Micro Spin-Column에 첨가하여 준비하고, 준비된 컬럼에 시료를 로딩하고 50 ㎕의 0.1% 포름산을 첨가하여 불필요한 물질을 제거하였다. 그 후, 80% CAN 100 ㎕를 첨가하여 펩타이드를 용리시켰다. 탈염이 끝나면 Speed-vac으로 건조시켜 용액을 모두 제거하고, 하기 표 2의 조건으로 UPLC-Exactive equipment (Thermo Fisher Scientific)를 이용하여 LC-MS/MS로 분석하였다. MaxQuant 및 MPP (Mass Profiler Professional)를 이용하여 M0 대식세포에 비해 M1 및 M2 대식세포에서 상향 조절된 단백질에 대해 데이터를 분석하였다. 데이터 분석을 위해 각 시표 별로 LC-MS/MS 데이터를 Proteome Discoverer를 이용하여 분석하였고, 데이터베이스는 Uniprot의 human database를 사용하여, LFQ(Label-Free Quantification)로 진행하였다. Modificaiton은 Oxidation(M), Carbamyl(N-term), Carbamidomethyl(C)를 추가하였고, Baseline option은 none으로 하였다.
Figure PCTKR2023004674-appb-img-000001
그 결과, M2/M0에서 53개의 단백질이, M1/M0에서 123개의 단백질이 상향조절되었다 (도 2a). M2 대식세포보다 더 많은 상향조절된 단백질들이 M1 대식세포와 상호작용하였으나, 세포막에 존재하는 단백질은 그렇지 않았다. 막 단백질들 중, ITGB2가 M2 대식세포에서 상향조절되는 것으로 나타났다 (도 2b). 또한, M1 대식세포의 마커로 알려진 IL-10 및 CXCL10와 같은 사이토카인들이 M1 대식세포에서 상향조절되었다 (도 2v). 또한, 단백질들이 M1에 비해 M2에서 상향조절된 단백질들이 확인되었으나, 막 단백질들 중 ITGB2만이 M2 대식세포에서 상향조절되는 것으로 확인되었다 (도 2d). 이를 통해, 멜리틴이 M2 대식세포의 막 단백질 ITGB2과 상호작용하고 결합하는 것을 확인하였다.
2-3. TAMpep826의 M2 TAM 결합 표적 단백질 식별
상기 실시예 2-2에서와 같이, M0, M1 및 M2 대식세포에서 각각 추출한 세포막 단백질과 TAMpep826-비오틴을 반응시켜 LC-MS/MS proteomics를 통해 타겟 단백질을 확인하였다.
그 결과, 세포막 단백질 중 ITGB2가 M0 및 M1 대식세포에 비해 M2 대식세포에서 더 높은 수준으로 발현되는 것으로 나타나 (도 4), TAMpep826의 M2 대식세포 결합 표적 단백질로서 선별되었다.
실시예 3. M2 대식세포의 ITGB2 발현 확인
3-1. ITGB2 mRNA 발현 확인
M0, M1, M2 대식세포 및 TAMs에서 ITGB2의 mRNA 발현 수준을 평가하기 위해 실시간 중합효소연쇄반응을 수행하였다. 구체적으로, M0, M1 또는 M2 대식세포로 분화된 세포에서 easy-BLUE total RNA Extraction Kit (iNtRON)를 이용하여 RNA를 추출하고, CycleScript-Reverse Transcriptase (Bioneer)를 이용하여 cDNA로 합성하였다. Actin 또는 ITGB2 유전자의 프라이머 (표 3)를 사용하고 도 5의 조건으로 real-time PCR (CFX96, Bio-rad)을 진행하여 Actin 대비 각 유전자의 발현량을 상대정량(Relative quantification)으로 비교 및 분석하였다.
Target cDNA Forward/Reverse Sequences (5' to 3')
β-Actin F GTGCTATGTTGCTCTAGACTTCG
R ATGCCACAGGATTCCATACC
ITGB2 F GAGGTCAGGAGGATTTGGGG
R TACAAGTGTTGGGGAGCCAG
그 결과, ITGB2의 mRNA 발현은 M0 및 M1에 비해 M2 대식세포 및 TAM에서 유의하게 증가한 것으로 나타났다 (도 6).
3-2. ITGB2 단백질 발현 확인
M0, M1, M2 대식세포 및 TAMs에서 ITGB2의 단백질 발현 수준을 평가하기 위해 웨스턴 블롯 분석을 수행하였다. 구체적으로, M0, M1 및 M2 대식세포로 분화된 각각의 세포에서 Proprep solution (iNtRON)를 이용하여 단백질을 추출하고, 전기영동법으로 멤브레인에 단백질을 트랜스퍼하였다. 멤브레인을 5% BSA에 담가 블로킹한 뒤, 1 차 항체 (ITGB2)를 24시간 동안 4℃에서 처리하고 2차 항체를 1시간 동안 상온에서 처리한 뒤, D-PlusTM ECL Pico System (동인LS)을 처리하고 Davinch-ChemiTM imaging system (Intoxia)으로 단백질 밴드 사진을 촬영하였다.
그 결과, ITGB2의 단백질 발현은 M0 및 M1에 비해 M2 대식세포 및 TAM에서 유의하게 증가한 것으로 나타났다 (도 7).
3-3. 면역형광법을 통한 ITGB2 단백질 발현 확인
M0, M1, M2 대식세포 및 TAMs에서 ITGB2의 단백질 발현 수준을 평가하기 위해 면역형광분석을 수행하였다. 구체적으로, M0, M1 및 M2 대식세포로 분화된 각각의 세포를 4% 포르말린으로 고정시킨 뒤, PBS로 세척하고 5% BSA에 담가 블로킹한 뒤, 1 차 항체(ITGB2)를 24시간 동안 4℃에서 처리하고 2차 항체를 2시간 동안 상온에서 처리하여 염색을 수행하였다. 염색된 세포는 DAPI mounting 후 LSM800 (Zeiss)으로 형광 사진을 촬영하였다.
그 결과, ITGB2의 단백질은 M0 및 M1에 비해 M2 대식세포 및 TAM에서 높은 발현 수준을 나타냈다 (도 8).
실시예 4. M2 TAM 표적화 펩타이드와 ITGB2의 상호작용 확인
4-1. M2 대식세포 세포막에서 ITGB2의 발현 확인
ITGB2이 M2 대식세포의 세포막에서 발현되는지 확인하기 위해, M2 대식세포에서 세포막 단백질 및 세포질(cytosol) 단백질을 각각 분리 추출하여 비오틴화된 TAMpep826과 반응시켜 ITGB2의 발현을 웨스턴 블롯 분석으로 평가하였다. 그 결과, ITGB2 단백질은 M2 대식세포의 세포막에서 발현되는 것으로 나타났다 (도 9).
4-2. TAMpep826 및 ITGB2의 상호작용 확인
M2 대식세포에서 TAMpep826이 ITGB2과 상호작용하는지 확인하기 위해, TAMpep826 및 비오틴화된 TAMpep826의 경쟁적인 반응을 통해 ITGB2의 발현을 평가하였다. 구체적으로, M2 대식세포로 분화된 세포를 스크래퍼로 모아 원심분리 (300 Х g, 5분)로 세포를 세척하고, 세포막 단백질 추출 키트 (Thermo Fisher scientific)를 사용하여 대식세포의 세포막 단백질을 얻었다. TAMpep826 또는 scramble 펩타이드를 농도별 (0.001, 0.01, 0.1, 1 및 10 μg)로 1시간 동안 전처리한 후 단백질에 비오틴이 결합된 TAMpep826 (200 μg)과 상온 (20~24℃)에서 1시간 동안 반응시킨 후 DynabeadsTM M-280 Streptavidin (Thermo Fisher scientific)을 이용하여 TAMpep826과 결합한 단백질을 얻었다. 단백질을 웨스턴 블롯 분석하여 ITGB2의 발현을 확인하였다.
그 결과, scrambled 펩타이드를 전처리하였을 때 비오틴화된 TAMpep826과 결합된 ITGB2의 발현은 영향이 없는 것으로 나타난 반면, TAMpep826으로 전처리하였을 때는 농도에 따라 ITGB2 발현이 억제되는 것으로 나타났다 (도 10). 이를 통해, TAMpep826이 M2 대식세포의 세포막에서 ITGB2과 상호작용하는 것을 확인할 수 있었다.
4-3. 면역형광법을 이용한 TAMpep826 및 ITGB2의 상호작용 확인
M2 대식세포의 세포막에서 ITGB2 및 TAMpep826이 co-localization하는지 확인하기 위해, FITC가 결합된 TAMpep826을 이용하여 면역형광분석을 수행하였다. 그 결과, TAMpep826과 ITGB2은 M2 대식세포의 세포막에 집중적으로 분포되어 있는 것으로 나타났다 (도 11).
4-4. TB511과 ITGB2의 결합 부위 확인
CD18(ITGB2)의 시스테인(cysteine) rich 부분의 서열을 바탕으로 (uniport_p05107, Cystein-rich tandem repeats region : 449-617), trRosetta 알고리즘(algorithm)을 이용하여 3차 구조(teritiary structure)를 구성하였다 (https://yanglab.nankai.edu.cn/trRosetta/). 그 후, TB511과 CD18의 도킹 시뮬레이션(Docking simulation)은 trRosetta로 만든 CD18 PDB 파일과 TB511의 아미노산 서열을 가지고, CABS-dock server를 통해 이루어졌다 (http://biocomp.chem.uw.edu.pl/CABSdock/). 도킹 시뮬레이션 결과 만들어진 10개의 모델 중, TB511 서열의 알라닌 치환 결과를 바탕으로 대표 모델을 선정하였다 (도 12).
그 결과, TB511의 LEU(6)은 CD18의 LEU(528), THR(538), LEU(556), CYS(557) 및 PHE(558) 부위와 결합(bindin)하는 것으로 예측되었으며, TB511의 TRP(12)는 CD18의 GLU(466), ILE(469), CYS(470) 및 ARG(471)과 결합하는 것으로 예측되었다. 또한, TB511의 LEU(6) 및 TRP(12)을 각각 알라닌으로 치환하여 CD18과의 결합을 시뮬레이션하면 두 부위 모두 CD18의 어느 서열과도 결합하지 않는 것으로 나타났다. 따라서 TB511의 LEU(6) 및 TRP(12)은 TB511과 CD18간의 도킹에서 핵심적인 부분이며, TB511은 CD18의 466 내지 565에 결합하는 것으로 예측할 수 있다 (도 13).
실시예 5. ITGB2 결합 모이어티 합성
5-1. ITGB2 결합 PDC(peptide-drug conjugate) 합성
하기 표 4의 Melittin-dKLA 및 TB511 펩타이드들을 GenScript (Piscataway, NJ, USA)에 합성 의뢰하여 공급받았으며, 이후 실험에서 D-PBS에 5 mg/ml로 녹여 사용되었다. dKLA는 펩타이드간 아미드 결합을 통해 연결하였으며, 멜리틴 또는 TAMpep826과 dKLA간의 상호작용 및 폴드를 최소화하기 위해 중간에 4개의 글리신 및 1개의 세린으로 구성된 링커를 배치하여 양단을 구분하였고, KLA는 체내 분해를 최소화 하기 위해 L형이 아닌 D형 이성질체를 사용하였다. 또한, M-DM1을 제작하기 위해, 25 mM 붕산나트륨 완충액 (25mM NaCl, 1mM EDTA, pH 8.0)에 녹인 말레이미드(Maleimide)-변형된 멜리틴 (GenScript, Beijing, China) (100 μM, 1 mL, 0.1 mmoL)에 DM1(Mertansine) (MedChem Express, Princeton) (1.1당량, DMF 중 10mM) 및 DMF(Dimethylformamide)를 첨가하여 37℃에서 1시간 동안 반응시킨 후, 생성물을 Dulbecco의 인산완충식염수 (DPBS; Welgene)에서 한외 여과로 3회 여과함으로써, 말레이미드(Maleimide)-변형된 멜리틴 M의 N-말단에 DM1을 결합시켜 PDC를 제작하였으며, M-DM1으로 명명하였다. 제작한 M-DM1은 Poroshell 120 C18 column (2.7 μm, 3 × 50 mm, Agilent, Santa Clara, CA, USA)에서 역상 고성능 액체 크로마토그래피 (HPLC)를 5 μL, 0.5 mL/min의 속도로 주입하여 특성을 분석하였다.
명칭 서열 서열번호 설명
Melittin GIGAVLKVLTTGLPALISWIKRKRQQ 1 멜리틴 펩타이드
TAMpep826 VLTTGLPALISWIKRKRQQ 2 멜리틴의 첫 7개의 아미노산이 제거된 펩타이드
링커 GGGGS 3
dKLA d[KLAKLAKKLAKLAK] 4 pro-apoptosis 펩타이드
Melittin-dKLA GIGAVLKVLTTGLPALISWIKRKRQQ-GGGGS-d[KLAKLAKKLAKLAK] 5 멜리틴에 링커 및 약물 dKLA가 부착된 펩타이드
TB511 VLTTGLPALISWIKRKRQQ-GGGGS-d[KLAKLAKKLAKLAK] 6 TAMpep826에 링커 및 약물 dKLA가 부착된 펩타이드
M-DM1 말레이미드-변형된 멜리틴에 약물 DM1이 컨쥬게이트된 PDC
5-2. ITGB2 결합 ADC(Antibody-drug conjugate) 합성
5-2-1. 항-CD18 항체 및 DM1의 ADC 제작
대식세포-1 항원(Macrophage-1 antigen, Mac-1) 중 하나인, CD18의 M2 TAM에서의 활성형 구조(Active conformation)에 특이적으로 결합하는 항체 (도 14)를 제작하기 위해, 항-CD18 항체를 분비하는 하이브리도마 (MM18/2.a.8) 세포의 배양액을 모아 2,500rpm, 4℃에서 10분간 원심분리하여 상층액을 얻은 후 단백질 G-세파로스 컬럼 크로마토그래피 방법으로 정제하였다. PBS로 미리 평형화시킨 단백질 G-세파로스 컬럼(Pharmacia, 스웨덴)에 항체 용액을 천천히 통과시키고 컬럼을 페리스타틱 펌프(peristatic pump)에 연결하여 PBS로 충분히 세척하였다. 세척 완료 후, 0.2M의 글리신(glycin)-HCl(pH 2.7)으로 항체를 용출하였다. 이때 미리 준비한 1M의 Tris(pH 9.0)를 포함한 튜브에 상기 용출액을 완충시켰다. 이 항체를 PBS에 투석 (dialysis) 한 후 사용하였다. BCA 단백질 분석 키트 (BCATM Protein Assay Kit, Pierce)를 이용하여 정제된 항체량을 측정하고, Flow cytometry 분석을 통해 항체의 결합능을 확인하였다. 정제한 항-CD18 항체를 PBS (pH 7.4)로 버퍼 교체하고, 항-CD18 항체 (1 mg/ml, 6.67 μM)에 DMSO에 녹인 SMCC-DM1 (mertansine, 120 μM) (MedChemExpress)을 1: 18의 비율로 섞어 상온에서 4~20 시간 동안 반응시켰다. 미반응한 DM1을 제거하기 위해 10 KDa cutoff centrifugal filter를 이용하여 CD18-DM1을 PBS (pH 7.4)로 버퍼 교체하고, 0.2 μm 시린지 필터로 여과하였다. UV-Vis spectroscopy를 이용하여 항-CD18 항체 (280 nm)에 결합된 DM1 (252 nm)의 양을 측정하여 DM1과 항-CD18 항체의 비율(drug antibody ratio, DAR)을 계산하였고, DAR 값은 5.8로 나타났다. 이렇게 제작된 항-CD18 항체와 DM1이 결합된 ADC를 CD18-DM1으로 명명하였다.
5-2-2. 항-CD18 항체 및 MMAE(Monomethyl auristatin E)의 ADC 제작
상기 실시예에서 정제한 항-CD18 항체를 PBS (pH 7.4)로 버퍼 교체하고, CD18 항체의 이황화 결합 (disulfide bond)을 부분적으로 환원하기 위해서 항-CD18 항체 (1 mg/ml, 6.67 μM)에 1mM DTT (66.7 μM)를 1: 10의 비율로 섞어 37 ℃에서 1~2 시간 동안 반응시키고 PBS (pH 7.4)로 버퍼 교체하였다. 부분적으로 환원된 항-CD18 항체 (1 mg/ml, 6.67 μM)에 10mM Suo-Val-Cit-PAB-MMAE (MedChemExpress)를 1:20 내지 1:40의 비율로 섞어 4 ℃에서 12 시간 동안 반응시키고 PBS (pH 7.4)로 버퍼 교체하였다. UV-Vis spectroscopy를 이용하여 항-CD18 항체 (280 nm)에 결합된 vc-MMAE (248 nm)의 양을 측정하여 vc-MMAE와 항-CD18 항체의 비율(drug antibody ratio, DAR) 을 계산하였고, DAR 값은 2.8 내지 5.4로 나타났다. 이렇게 제작된 항-CD18 항체와 MMAE가 결합된 ADC를 CD18-MMAE로 명명하였다.
실시예 6. ITGB2 결합 PDC의 M2 TAM 결합 확인
ITGB2 및 Melittin-dKLA의 결합력을 확인하기 위해, ITGB2 단백질을 골드 박막 센서칩 위에 코팅한 후 양성 대조군으로 ITGB2 항체 및 Melittin-dKLA를 각각 흘려 반사광을 측정하고, 표면 플라즈몬 공명 (Surface plasmon resonance, SPR) 분석을 수행하였다. 구체적으로, 센서 칩 표면에 ITGB2을 고정시킨 후 아민 커플링(amine coupling)을 이용하여 하기 표 5의 조건으로 고정화(immobilization)를 수행하였다 (도 15). 그 후, ITGB2이 코팅된 센서칩에 여러 농도의 ITGB2 항체 및 Melittin-dKLA을 흘려 결합(association) 및 해리(dissociation) 구간을 관찰하고 센서그램을 통해 하기 표 6의 분자간 결합 속도상수 분석(kinetic evoluation) 조건으로 분자간 결합 속도상수(kinetic prarmeter)를 계산하였다.
Figure PCTKR2023004674-appb-img-000002
Figure PCTKR2023004674-appb-img-000003
그 결과, 양성 대조군인 ITGB2 항체의 두 분자 사이의 결합력을 평가하는 해리속도상수 (kd; dissociation rate constant)를 결합속도상수 (ka; association rate constant)로 나누어 얻는 평형해리상수 (KD; equilibrium dissociation constant)가 1.14-8로 나타났고, Melittin-dKLA의 평형해리상수는 7.86-8로 나타났다 (도 16 및 17). 따라서, Melittin-dKLA이 ITGB2과 결합력을 가지고 있음을 확인하였다.
실시예 7. PDC의 ITGB2을 통한 M2 TAM 세포사멸 효과 확인
7-1. ITGB2의 발현 억제 세포 모델 제작
M2 대식세포에서 ITGB2을 통해 세포사멸을 유도하는지 확인하는데 사용하기 위한 세포 모델로서, Crispr/cas9를 이용하여 M2 대식세포에서 ITGB2의 발현이 억제된 세포 모델을 제작하였다. 구체적으로, M2 대식세포로 분화된 세포를 Opti-MEM 배지에서 배양하였다. Crispr/cas9은 CRISPRMAXTM Reagent kit (Thermo Fisher scientific)의 Cas9 protein V2 (Thermo Fisher scientific)와 gRNA (Genscript; ITGB2; 표 7)를 Cas9 PlusTM Reagent (Thermo Fisher scientific)와 함께 섞고, CRISPRMAXTM Reagent를 Opti-MEM 배지에 희석한 후 모두 섞어 5 - 10분 동안 반응시킨 뒤, M2 대식세포로 분화된 세포에 첨가하여 37℃에서 2-3일간 배양하였다. 그 후, ITGB2의 mRNA 발현 수준을 확인하였다.
sgRNA Sequences (5' to 3')
ITGB2 mG*mU*mU*rCrArArCrGrUrGrArCrCrUrUrCrCrGrGrCrGrUrUrUrUrArGrArGrCrUrA rGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrC rArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU* mU
그 결과, ITGB2 sgRNA를 주입한 M2 대식세포는 ITGB2의 발현이 대조군에 비해 유의하게 감소되는 것으로 나타났다 (도 18).
7-2. Melittin-dKLA의 ITGB2을 통한 M2 TAM 세포사멸 확인
Melittin-dKLA가 M2 대식세포에서 ITGB2에 결합하여 세포자멸사(apoptosis)를 유도하는지 확인하기 위해, 상기 실시예 7-1에서 제작한 Crispr/cas9에 의해 ITGB2 발현이 억제된 M2 대식세포에 Melittin-dKLA (1 μM)를 24시간 동안 처리하고, CCK-8 분석 방법을 이용하여 세포 생존율을 분석하였다. 구체적으로, 상기 실시예 7-1에서 제작한 ITGB2 낙다운 대식세포에 Melittin-dKLA (1 μM)을 1시간 동안 반응시켰다. 반응 후, 배지를 교체하고 37℃에서 24시간 동안 배양하였다. 세포 생존능을 확인하기 위해 CCK-8 reagent (Enzo Life Sciences)를 배지의 1/10으로 넣고 37℃에서 3시간 동안 반응시켰다. 흡광도는 microplate leader (Molecular Devices)로 450 nm에서 측정하였다.
그 결과, 대조군 M2 대식세포에서 Melittin-dKLA에 의해 세포 생존율이 현저히 감소하였으나, ITGB2가 낙다운된 M2 대식세포에서는 Melittin-dKLA에 의한 세포 생존율 감소가 억제되는 것으로 나타났다 (도 19). 따라서, 이를 통해, Melittin-dKLA가 M2 대식세포의 ITGB2와 특이적으로 결합함으로써 M2 대식세포의 세포자멸사를 유도하는 것을 확인할 수 있었다.
7-3. TB511의 ITGB2을 통한 M2 TAM 세포사멸 확인
TB511(TAMpep826-dKLA)이 M2 대식세포에서 ITGB2을 통해 세포사멸을 유도하는지 확인하기 위해, 상기 실시예 7-1에서 제작한 Crispr/cas9에 의해 ITGB2 발현이 억제된 M2 대식세포에 TB511을 반응시켰다. 그 결과, M2 대식세포는 TB511에 의해 50% 정도의 세포 생존능을 나타냈으나, ITGB2 발현이 억제된 세포에서는 세포 생존능이 유의하게 증가하는 것을 나타냈다 (도 20).
7-4. ITGB2 항체에 의한 TB511의 세포사멸 유도 감소 확인
TB511이 M2 대식세포에서 ITGB2을 통해 세포사멸을 유도하는지 확인하기 위해, 상기 실시예 7-1에서 제작한 ITGB2 발현이 억제된 M2 대식세포에 항-ITGB2 항체(Polyclonal Rabbit anti-Human ITGB2/CD18 항체) (LS-C312785; LS Bio) (1 μg)을 1시간 동안 전처리한 후 TB511 (1 μM)을 1시간 동안 반응시킨 뒤, 세포사멸 유발 여부를 CCK-8 분석을 이용한 세포생존능 분석으로, 세포사멸 마커인 caspase-3의 단백질 발현을 웨스턴 블롯 분석으로, caspase-3, caspase-8, caspase-9의 유전자 발현을 Real-time PCR로, 및 caspase-3의 단백질 발현 유도를 면역형광법을 통해 확인하였다.
그 결과, M2 대식세포는 ITGB2 항체에 의해서는 세포 생존능에는 영향이 없었으며, TB511에 의해서는 세포 생존능이 유의하게 감소하였다. 반면에 ITGB2 항체를 전처리한 M2 대식세포에서는 TB511에 의한 세포 생존능이 유의하게 증가한 것으로 나타났다 (도 21). 또한, M2 대식세포는 TB511에 의해 caspase-3 발현이 유의하게 증가한 반면, ITGB2 항체를 전처리한 M2 대식세포에서는 TB511에 의한 caspase-3 발현이 유의하게 감소하였다 (도 21). 또한, M2 대식세포는 TB511에 의해 caspase-3, caspase-8 및 caspase-9의 발현이 유의하게 증가한 반면, ITGB2 항체를 전처리한 M2 대식세포에서는 TB511에 의한 caspase-3, caspase-8 및 caspase-9의 발현이 유의하게 감소하였다 (도 21). M2 대식세포는 TB511에 의해 caspase-3 발현이 증가한 반면, ITGB2 항체를 전처리한 M2 대식세포에서는 TB511에 의한 caspase-3 발현이 감소하였다 (도 21). 추가적으로, TB511의 미토콘드리아 표적화를 확인한 결과, ITGB2 항체를 전처리한 M2 대식세포는 ITGB2 전처리하지 않은 세포와 비교해서 미토콘드리아와 TB511의 co-localization이 감소하였다 (도 21).
실시예 8. 3D 암 오가노이드에서 PDC의 효능 확인
8-1. 유방암 3D 오가노이드에서 TB511의 효과 확인
in vitro에서의 한계점을 보완하고 in vivo를 대체하고자 유방암의 암 미세환경(Tumor microenvironment; TME)을 모사한 3D 오가노이드를 제작하고, 이에 대한 TB511의 효과를 확인하였다. 구체적으로, RPMI-1640 배양액에 마트리젤(matrigel)이 3 %가 되도록 혼합하고 MDA-MB-231 인간 유방암 세포, CAF(Cancer-associated Fibroblast) 및 Incucyte®Nuclight Lentivirus Reagents (Sartorius)를 이용하여 GFP를 발현하도록 제작한 THP-1 세포를 계수하고 5:1:1의 비율로 200 μl가 되도록 96 u-bottom 3-D cultue plate (Sbio)에 분주하였다. 배양 후 1200 rpm에서 3분간 원심분리하여 세포를 모아준 뒤 37 ℃ 인큐베이터에서 48시간 배양하여 스페로이드(spheroid)를 형성하였다. 스페로이드 형성 2일차부터 TB511을 1 μM, 2 μM, 4 μM 및 8 μM 농도로 3일마다 각각 처리하고, 형광현미경으로 이미지를 촬영하였으며, Bright-field 이미지를 촬영한 뒤 페렛의 직경을 측정방법으로 스페로이드 영역(spheroid area)을 측정하였다. 또한, 평균 종양 회전 타원체 직경은 오픈 소스를 사용하여 스페로이드 당 평균 3개 직경을 측정하여 ImageJ (software version 1.47m)로 사이즈를 분석하였으며, 스페로이드 크기는 Bright-field 이미지를 촬영한 뒤 (20X), 평균 종양 회전 타원체 직경을 스페로이드 당 평균 3개씩 측정하여 ImageJ (software version 1.47m)로 분석하였다. 아울러, 약물처리 10일차에 스페로이드를 고정하여 종양 증식 인자인 ki-67에 대한 항체 (abcam)를 반응시켜 면역형광염색을 수행하였다 (대조 염색: DAPI). THP-1의 경우 별도의 염색을 진행하지 않고 세포내에 발현하는 GFP 형광을 공초점 현미경으로 이미지를 촬영하고 형광을 발현하는 세포의 수를 측정하였다.
그 결과, 약물을 처리하지 않은 군은 시간이 지날수록 스페로이드의 크기가 점점 커져, 단핵구(monocyte)인 THP-1 세포가 암세포 및 CAF와 공배양시 암세포 및 TME에 의해서 TAM로 분화되어 종양 성장을 촉진하는 것으로 나타났다. 반면, TB511을 처리한 군에서는 10일차에 1 μM 농도에서부터 농도 의존적으로 스페로이드의 크기가 감소하는 것을 확인하였으며 (도 22), GFP 형광을 발현하는 THP-1 세포의 수가 약물 무처리군에 비해 농도 의존적으로 현저히 감소하는 것으로 나타났다 (*** p < 0.001) (도 23). 따라서, ITGB2 결합 PDC인 TB511가 THP-1 세포에 선택적으로 결합하여 MDA-MB-231 인간 유방암의 세포사멸을 유도하는 것을 확인하였다.
8-2. 폐암 3D 오가노이드에서 TB511의 효과 확인
상기 실시예 8-1의 방법으로 A549 인간 폐암 세포, CAF 및 THP-1 세포를 혼합하여 폐암 3D 스페로이드를 제작한 뒤, TB511을 1 μM, 2 μM 및 4 μM 농도로 각각 처리하고 그 효과를 상기 실시예 8-1에서와 같이 분석하였다. 스페로이드 제작시, 암세포 단독 또는 암세포+CAF 세포만을 혼합하여 3D 스페로이드도 제작하여 스페로이드의 크기를 비교하였다.
그 결과, A549 세포 단독 또는 A549+CAF 세포만으로 스페로이드를 형성하였을 때보다 A549+CAF+THP-1 세포로 스페로이드를 형성하였을 때 스페로이드의 크기가 현저하게 증가하는 것으로 나타났다. 또한 TB511을 처리하지 않은 군에 비하여 TB511을 처리한 군에서 스페로이드의 크기가 TB511의 농도 의존적으로 현저하게 감소하는 것으로 나타났다 (*** p < 0.001) (도 24). 또한, 약물 처리 후 10일차에 스페로이드를 형광 염색하여 관련 마커를 확인한 결과, TB511을 처리하지 않은 군에 비하여 THP-1 세포의 수가 농도 의존적으로 현저하게 감소하였으며, 종양 증식 인자 ki-67도 농도의존적으로 감소하는 것으로 나타났다 (*** p < 0.001) (도 25).
8-3. 폐암 3D 오가노이드에서 M-DM1의 효과 확인
폐암에 대한 M-DM1(Mel-DM1)의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 A549 인간 폐암 세포, CAF 및 THP-1 세포를 혼합하여 폐암 3D 스페로이드를 제작한 뒤, M-DM1을 1 μM, 2 μM 및 4 μM 농도로 각각 처리하고 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, M-DM1을 처리하지 않은 군에 비하여 M-DM1을 처리한 군에서 농도 의존적으로 스페로이드의 크기가 감소하는 것으로 나타났다 (*** p < 0.001) (도 26).
실시예 9. 항암제 내성 3D 암 오가노이드에서 PDC의 효능 확인
9-1. 항암제 내성 폐암 3D 오가오이드에서 TB511의 효과 확인
카보플라틴(Carboplatin) 내성 폐암에 대한 TB511의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 카보플라틴 내성 A549 세포, CAF 및 THP-1 세포를 혼합하여 3D-스페로이드를 형성하고 TB511을 1 μM, 2 μM 및 4 μM 농도로 각각 처리한 뒤, 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, A549 내성 세포 단독 또는 A549+CAF 세포만으로 스페로이드를 형성하였을 때보다 A549+CAF+THP-1 세포로 스페로이드를 형성하였을 때 스페로이드의 크기가 현저히 증가하는 것으로 나타났으며, TB511을 처리하지 않은 군에 비하여 TB511을 처리한 군에서 스페로이드의 크기가 TB511 농도 의존적으로 현저하게 감소하는 것으로 나타났다 (*** p < 0.001) (도 27). 또한, 약물 처리 후 10일차에 스페로이드를 면역형광염색하여 관련 마커를 확인한 결과, TB511 무처리군에 비해 TB511을 처리한 군에서 THP-1 세포의 수가 농도 의존적으로 현저하게 감소하였고, 종양 증식 인자 ki-67도 2 μM에서부터 유의적으로 감소하는 것으로 나타났다 (*** p < 0.001) (도 28).
9-2. 항암제 내성 전립선암 3D 오가오이드에서 TB511의 효과 확인
도세탁셀(Docetaxel) 내성 전립선암에 대한 TB511의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 도세탁셀 내성 PC3 전립선암 세포, CAF 및 THP-1 세포를 혼합하여 3D-스페로이드를 형성하고 TB511을 1 μM, 2 μM 또는 4 μM 농도로 각각 처리한 뒤, 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, PC3 내성 세포 단독 또는 PC3+CAF 세포만으로 스페로이드를 형성하였을 때보다 PC3+CAF+THP-1 세포로 스페로이드를 형성하였을 때 그 크기가 현저하게 증가하였으며, TB511을 처리하지 않은 군에 비하여 TB511을 처리한 군에서 스페로이드의 크기가 TB511 농도 의존적으로 현저하게 감소하는 것으로 나타났다 (*** p < 0.001) (도 29). 또한, 약물 처리 후 10일차에 스페로이드를 면역형광염색하여 관련 마커를 확인한 결과, TB511 무처리군에 비해 TB511을 처리한 군에서 THP-1 세포의 수가 농도 의존적으로 현저히 감소하였고, 종양 증식 인자 ki-67도 감소하는 경향을 나타냈다 (** p < 0.01, *** p < 0.001) (도 30).
실시예 10. 3D 암 오가노이드에서 ADC의 효능 확인
10-1. 유방암 3D 오가노이드에서 ADC의 효과 확인
유방암에 대한 ITGB2 결합 ADC(Antibody-drug conjugate)의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 MDA-MB-231 인간 유방암 세포, CAF 및 THP-1 세포를 혼합하여 3D-스페로이드를 형성하고, 본 발명의 ADC인 CD18-DM1 또는 CD18-MMAE을 10 μg 및 20 μg의 농도로 각각 처리한 뒤, 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, ADC를 처리하지 않은 군은 시간이 지날수록 유방암 스페로이드의 크기가 점점 커졌으나 ADC를 처리한 군에서는 8일차에 스페로이드의 크기가 감소하는 것으로 나타났다 (도 31 및 32). 또한, ADC를 처리하지 않은 군에서 GFP 양성 THP-1 세포가 강하게 증가하였으나 CD18-DM1 또는 CD18-MMAE 처리군에서는 농도 의존적으로 감소하는 것으로 나타났다 (*** p < 0.001) (도 31 및 32).
10-2. 폐암 3D 오가노이드에서 ADC의 효과 확인
폐암에 대한 ADC의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 A549 인간 폐암 세포, CAF 및 THP-1 세포를 혼합하여 3D-스페로이드를 형성하고, 본 발명의 ADC인 CD18-DM1 또는 CD18-MMAE을 10 μg의 농도로 각각 처리한 뒤, 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, ADC를 처리하지 않은 군은 시간이 지날수록 스페로이드의 크기가 점점 커진 반면, CD18-DM1 또는 CD18-MMAE를 처리한 군에서는 8일차에 스페로이드의 크기가 감소하는 것으로 나타났다 (도 33). 또한, 약물 처리 후 8일차에 스페로이드를 면역형광염색하여 관련 마커를 확인한 결과, ADC를 처리하지 않은 군에서 THP-1 세포가 강하게 증가한 반면, ADC 처리군에서는 현저히 감소하는 것으로 나타났다 (*** p < 0.001) (도 34).
실시예 11. 항암제 내성 3D 암 오가노이드에서 ADC의 효능 확인
11-1. 항암제 내성 폐암 3D 오가오이드에서 ADC의 효과 확인
카보플라틴 내성 폐암에 대한 ADC의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 카보플라틴 내성 A549 세포, CAF 및 THP-1 세포를 혼합하여 3D-스페로이드를 형성하고 CD18-DM1 또는 CD18-MMAE를 각각 10μg 농도로 처리한 뒤, 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, ADC를 처리하지 않은 군은 시간이 지날수록 스페로이드의 크기가 점점 커진 반면, CD18-DM1 또는 CD18-MMAE를 처리한 군에서는 8일차에 스페로이드의 크기가 감소하는 것으로 나타났다 (도 35). 또한, 약물 처리 후 8일차에 스페로이드를 면역형광염색하여 관련 마커를 확인한 결과, ADC를 처리하지 않은 군에 비해, CD18-DM1 또는 CD18-MMAE를 처리한 군에서 THP-1 세포의 수가 유의성있게 감소하였고 종양 증식 인자 ki-67도 감소하는 것으로 나타났다 (*** p < 0.001) (도 36).
11-2. 항암제 내성 전립선암 3D 오가오이드에서 ADC의 효과 확인
도세탁셀 내성 전립선암에 대한 ADC의 효능을 확인하기 위해, 상기 실시예 8-1의 방법으로 도세탁셀 내성 PC3 전립선암 세포, CAF 및 THP-1 세포를 혼합하여 3D-스페로이드를 형성하고 CD18-DM1 또는 CD18-MMAE를 각각 10μg 농도로 처리한 뒤, 그 효과를 상기 실시예 8-1에서와 같이 분석하였다.
그 결과, ADC를 처리하지 않은 군은 시간이 지날수록 스페로이드의 크기가 점점 커진 반면, CD18-DM1 또는 CD18-MMAE를 처리한 군에서는 8일차에 스페로이드의 크기가 감소하는 것으로 나타났다 (도 37). 또한, 약물 처리 후 8일차에 스페로이드를 면역형광염색하여 관련 마커를 확인한 결과, ADC를 처리하지 않은 군에서는 형광이 강하게 증가한 반면, CD18-DM1 또는 CD18-MMAE를 처리한 군에서는 THP-1 세포의 수가 현저하게 감소하였고, 종양 증식 인자 ki-67도 감소하는 것으로 나타났다 (*** p < 0.001) (도 38).

Claims (17)

  1. 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 유효성분으로 포함하는, 미세종양환경에서 종양 관련 대식세포(tumor associated macrophages, TAM)를 제거하기 위한 약학적 조성물.
  2. 제 1항에 있어서, 종양 관련 대식세포는 IGBT2(Integrin beta 2)를 발현하는 M2 종양 관련 대식세포인, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  3. 제 1항에 있어서, 멜리틴, 이의 변이체 또는 이들의 유사체가 CD18가 확장된(extended) 활성형 구조(Active conformation)에 특이적으로 결합하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  4. 제 1항에 있어서, 멜리틴, 이의 변이체 또는 이들의 유사체가 ITGB2의 449 466 내지 565의 아미노산에 결합하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  5. 제 1항에 있어서, 멜리틴은 서열번호 1의 아미노산 서열을 포함하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  6. 제 1항에 있어서, 멜리틴의 변이체는 서열번호 2의 아미노산 서열을 포함하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  7. 제 1항에 있어서, 링커에 의해 결합된, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  8. 제 7항에 있어서, 링커는 서열번호 3의 아미노산 서열을 포함하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  9. 제 1항에 있어서, 서열번호 5 또는 6의 아미노산 서열을 포함하는 펩타이드를 포함하는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  10. 제 1항에 있어서, 전세포사멸성 펩타이드는 KLA, 알파-디펜신-1(alpha-defensin-1), BMAP-28, Brevenin-2R, 부포린 IIb(Buforin IIb), 세크로핀 A-마가이닌 2(cecropin A-Magainin 2, CA-MA-2), 세크로핀 A(Cecropin A), 세크로핀 B(Cecropin B), 크리소피신-1(chrysophsin-1), D-K6L9, 고메신(Gomesin), 락토페리신 B(Lactoferricin B), LLL27, LTX-315, 마가이닌 2(Magainin 2), 마가이닌 II-봄패신 결합체(Magainin II-bombesin conjugate, MG2B), 파르닥신(Pardaxin) 및 이들의 조합으로 이루어진 군에서 선택되는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  11. 제 1항에 있어서, 항암제는 SN-38(7-에틸-10-히드록시-캠토테신, 7-Ethyl-10-hydroxy-camptothecin), 다우노루비신(daunorubicin), 독소루비신(doxorubicin), 에피루비신(epirubicin), 이다루비신(idarubicin), 픽산트론(pixantrone), 사바루비신(sabarubicin), 발루비신(valrubicin), 파클리탁셀(paclitaxel), 도세탁셀(docetaxel), 메클로에타민(mechloethamine), 클로람부실(chlorambucil), 페닐알라닌(phenylalanine), 무스타드(mustard), 사이클로포스파미드(cyclophosphamide), 이포스파미드(ifosfamide), 카르무스틴(carmustine: BCNU), 로무스틴(lomustine: CCNU), 스트렙토조토신(streptozotocin), 부설판(busulfan), 티오테파(thiotepa), 시스플라틴(cisplatin), 카보플라틴(carboplatin), 닥티노마이신(dactinomycin: actinomycin D), 플리카마이신(plicamycin), 마이토마이신 C(mitomycin C), 빈크리스틴(vincristine), 빈블라스틴(vinblastine), 테니포사이드(teniposide), 토포테칸(topotecan), 이리도테칸(iridotecan), 우라무스틴(uramustine), 멜파란(melphalan), 벤다무스틴(bendamustine), 다카바진(dacarbazine), 테모졸로마이드(temozolomide), 알트레타민(altretamine), 듀오카르마이신(duocarmycin), 네다플라틴(nedaplatin), 옥사리플라틴(oxaliplatin), 사트라플라틴(satraplatin), 트리플라틴 테트라나이트레이트(triplatin tetranitrate), 5-플루오로우라실(5-fluorouracil), 6-머캅토퓨린(6-mercaptopurine), 카페시타빈(capecitabine), 클라드리빈(cladribine), 클로파라빈(clofarabine), 시스타르빈(cystarbine), 플록스유리딘(floxuridine), 플루다라빈(fludarabine), 겜시타빈(gemcitabine), 하이드록시우레아(hydroxyurea), 메토트렉세이트(methotrexate), 페메트렉세드(pemetrexed), 펜토스타틴(pentostatin), 티오구아닌(thioguanine), 에토포사이드(etoposide), 미토산트론(mitoxantrone), 이자베필론(izabepilone), 빈데신(vindesine), 비노렐빈(vinorelbine), 에스트라머스틴(estramustine), 메이탄신(maytansine), DM1(mertansine, 메르탄신), DM4, 돌라스타틴(dolastatin), 아우리스타틴 E(auristatin E), 아우리스타틴 F(auristatin F), 모노메틸 아우리스타틴 E(monomethyl auristatin E, MMAE), 모노메틸 아우리스타틴 F(monomethyl auristatin F) 및 이들의 유도체로 이루어진 군에서 선택되는, 미세종양환경에서 종양 관련 대식세포를 제거하기 위한 약학적 조성물.
  12. 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물.
  13. 제 12항에 있어서, 암은 뇌종양, 흑색종, 골수종, 비소세포성폐암, 구강암, 간암, 위암, 결장암, 유방암, 삼중음성유방암(Triple Negative Breast Cancer, TNBC), 폐암, 골암, 췌장암, 피부암, 두부 또는 경부암, 자궁경부암, 난소암, 대장암, 소장암, 직장암, 나팔관암종, 항문부근암, 자궁내막암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 임파선암, 방광암, 담낭암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 신장 또는 수뇨관암, 신장세포 암종, 신장골반암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군으로부터 선택되는 어느 하나 이상인, 암의 예방 또는 치료용 약학적 조성물.
  14. 제 12항에 있어서, 암은 항암제 내성 암인, 암의 예방 또는 치료용 약학적 조성물.
  15. 제 12항에 있어서, M0 대식세포 및 M1 대식세포에 비하여, M2 대식세포에서 ITGB2의 발현이 상향조절된 환자를 대상으로 투여하는 것인, 암의 예방 또는 치료용 약학적 조성물.
  16. 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체를 약학적으로 유효한 양으로 암에 걸린 개체에 투여하는 단계를 포함하는 암의 치료 방법.
  17. 암의 예방 및 치료용 약학적 조성물의 제조에 사용하기 위한, 멜리틴, 이의 변이체 또는 이들의 유사체에 전세포사멸성 펩타이드 또는 항암제가 결합된 결합체의 용도.
PCT/KR2023/004674 2022-04-07 2023-04-06 신규 펩타이드 기반 면역항암제 WO2023195802A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20220043200 2022-04-07
KR20220043573 2022-04-07
KR10-2022-0043200 2022-04-07
KR10-2022-0043573 2022-04-07

Publications (1)

Publication Number Publication Date
WO2023195802A1 true WO2023195802A1 (ko) 2023-10-12

Family

ID=88243260

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2023/004674 WO2023195802A1 (ko) 2022-04-07 2023-04-06 신규 펩타이드 기반 면역항암제
PCT/KR2023/004678 WO2023195805A2 (ko) 2022-04-07 2023-04-06 Itgb2 매개 약물전달체

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004678 WO2023195805A2 (ko) 2022-04-07 2023-04-06 Itgb2 매개 약물전달체

Country Status (2)

Country Link
KR (2) KR20230144960A (ko)
WO (2) WO2023195802A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019212324A1 (ko) * 2018-05-04 2019-11-07 경희대학교 산학협력단 멜리틴-기반 세포사멸 유발 펩타이드로 m2 유사 종앙관련 대식세포의 표적화

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200120743A (ko) * 2011-07-06 2020-10-21 젠맵 비. 브이 항체 변이체 및 그의 용도
KR102073273B1 (ko) * 2017-08-23 2020-03-02 (주) 레느스랩 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물
EA202192137A1 (ru) * 2019-01-31 2021-10-25 Ханчжоу Дэк Биотек Ко., Лтд Конъюгат аматоксинового аналога с разветвленными линкерами

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019212324A1 (ko) * 2018-05-04 2019-11-07 경희대학교 산학협력단 멜리틴-기반 세포사멸 유발 펩타이드로 m2 유사 종앙관련 대식세포의 표적화

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
HAN IK-HWAN, JEONG CHANMI, YANG JUWON, PARK SEUNG-HYEOK, HWANG DEOK-SANG, BAE HYUNSU: "Therapeutic Effect of Melittin–dKLA Targeting Tumor-Associated Macrophages in Melanoma", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 23, no. 3094, 13 March 2022 (2022-03-13), pages 1 - 16, XP093097978, DOI: 10.3390/ijms23063094 *
KIM SOYOUNG, CHOI ILSEOB, HAN IK-HWAN, BAE HYUNSU: "Enhanced Therapeutic Effect of Optimized Melittin-dKLA, a Peptide Agent Targeting M2-like Tumor-Associated Macrophages in Triple-Negative Breast Cancer", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 23, no. 15751, 12 December 2022 (2022-12-12), XP093097987, DOI: 10.3390/ijms232415751 *
LEE CHANJU, JEONG HYUNJU, BAE YOUNGHYEON, SHIN KYUNGMOON, KANG SINWOO, KIM HWIKYUNG, OH JAYOUNG, BAE HYUNSU: "Targeting of M2-like tumor-associated macrophages with a melittin-based pro-apoptotic peptide", JOURNAL FOR IMMUNOTHERAPY OF CANCER, vol. 7, no. 1, 1 December 2019 (2019-12-01), XP055907984, DOI: 10.1186/s40425-019-0610-4 *
LEE CHANJU, LEE HYUNJI, CHO HAYOON, KIM SOYOUNG, CHOI ILSEOB, HWANG YOUNG‐SIK, JEONG HYUNJU, JANG HOGI, PAK SEHYUN, HWANG DEOK‐SAN: "Combination of anti‐PD‐L1 antibody with peptide MEL‐dKLA targeting M2 tumor‐associated macrophages suppresses breast cancer metastasis", CANCER COMMUNICATIONS, vol. 42, no. 4, 1 April 2022 (2022-04-01), pages 345 - 349, XP093097982, ISSN: 2523-3548, DOI: 10.1002/cac2.12276 *
LEE ET AL.: "Development of melittin-based anti-cancer drug for targeting tumor-associated macrophages", THE JOURNAL OF IMMUNOLOGY, WILLIAMS & WILKINS CO., US, vol. 200, no. 1, supplement, 1 May 2018 (2018-05-01), US , pages 56.22, XP009524273, ISSN: 0022-1767, DOI: 10.4049/jimmunol.1701206 *
WU JINDAO, GAO WEN, TANG QIYUN, YU YUE, YOU WEI, WU ZHENGSHAN, FAN YE, ZHANG LONG, WU CHEN, HAN GUOYONG, ZUO XUELIANG, ZHANG YAO, : "M2 Macrophage-Derived Exosomes Facilitate HCC Metastasis by Transferring α M β 2 Integrin to Tumor Cells", HEPATOLOGY (BALTIMORE, MD.), UNITED STATES, 1 April 2021 (2021-04-01), United States, pages 1365 - 1380, XP093097975, [retrieved on 20231103] *

Also Published As

Publication number Publication date
KR20230144960A (ko) 2023-10-17
WO2023195805A2 (ko) 2023-10-12
KR20230144961A (ko) 2023-10-17
WO2023195805A3 (ko) 2024-05-30

Similar Documents

Publication Publication Date Title
KR101305533B1 (ko) Ｊｎｋ 신호 전달 경로의 세포 투과성 펩티드 억제제
KR102647074B1 (ko) 친수성 항체-약물 컨쥬게이트
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
EP1895005B1 (en) Cell-permeable peptide inhibitors of the JNK signal transduction pathway
WO2017078440A1 (ko) 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물
WO2015076621A1 (ko) 혈관 신생 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2013169077A1 (ko) 악액질 예방 또는 치료용 조성물
WO2016137162A1 (ko) 청력 손상 방어용 펩타이드 및 이를 포함하는 조성물
WO2014046478A1 (ko) 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
WO2019212324A1 (ko) 멜리틴-기반 세포사멸 유발 펩타이드로 m2 유사 종앙관련 대식세포의 표적화
WO2015093854A1 (ko) 전립선 암 치료용 조성물
WO2016105086A1 (ko) 안질환 치료 펩티드 및 이를 포함하는 안질환 치료용 조성물
CN113646008A (zh) pHLIP®肽介导的细胞表面的表位束缚
JP2023138866A (ja) Ｃｄ３８抗体薬物コンジュゲート
WO2015005723A1 (ko) 세포 투과성 펩티드 및 이를 포함하는 컨쥬게이트
JP2021510538A (ja) タンパク質性分子およびその使用
WO2018199593A1 (ko) Her3 및 cd3에 결합하는 이중특이적 항체
EP4110405A1 (fr) Conjugués anticorps-médicament anti-cd56 et leur utilisation en thérapie
WO2021177518A1 (ko) 혈중 콜레스테롤 저하용, 심혈관 대사질환의 예방 또는 치료용 및 항염용 약학적 조성물
WO2023195802A1 (ko) 신규 펩타이드 기반 면역항암제
WO2023204330A1 (ko) Itgb2 매개 약물 전달시스템
WO2023204329A1 (ko) 신규 펩타이드 기반 면역항암제
WO2015182837A1 (ko) 골수-유래 억제세포 저해용 조성물
WO2014010985A1 (ko) 세포내 단백질의 고효율 도입 및 유지용 펩타이드
WO2018124851A1 (ko) L1cam 단백질에 특이적으로 결합하는 항체; 및 피리미딘 유사체 및/또는 플라틴계 항암제를 포함하는 암의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23785026

Country of ref document: EP

Kind code of ref document: A1