WO2016021894A1 - Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물 - Google Patents

Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물 Download PDF

Info

Publication number
WO2016021894A1
WO2016021894A1 PCT/KR2015/008087 KR2015008087W WO2016021894A1 WO 2016021894 A1 WO2016021894 A1 WO 2016021894A1 KR 2015008087 W KR2015008087 W KR 2015008087W WO 2016021894 A1 WO2016021894 A1 WO 2016021894A1
Authority
WO
WIPO (PCT)
Prior art keywords
aging
cells
cell
antibody
senescence
Prior art date
Application number
PCT/KR2015/008087
Other languages
English (en)
French (fr)
Inventor
김재룡
조정희
박범찬
박재은
Original Assignee
영남대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150093429A external-priority patent/KR101834615B1/ko
Application filed by 영남대학교 산학협력단 filed Critical 영남대학교 산학협력단
Publication of WO2016021894A1 publication Critical patent/WO2016021894A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating cell aging or aging-related diseases containing a CD9 antibody as an active ingredient.
  • the present invention relates to a method for preventing or treating cell aging or aging-related diseases by using a CD9 specific antibody that inhibits cellular aging. I would like to.
  • Replication aging is known to occur as cells divide and shorten the telomeres, the terminal parts of chromosomes. Cell aging is also induced by oxidative stress, increased activity of cancer genes and cancer suppressor genes, and administration of cytotoxic substances such as anticancer agents. .
  • Aging cells are not only morphological features that grow and flatten in cells, but also increase the senescence-associated ⁇ -galactosidase (SA- ⁇ -gal) activity, as well as molecules such as p16, p53, and Rb, which are known as cancer suppressors. Accompanied by enemy features.
  • SA- ⁇ -gal senescence-associated ⁇ -galactosidase
  • p16, p53, and Rb which are known as cancer suppressors.
  • oncogenes such as Raf and Ras and cancer suppressor genes such as p53 and p16 are known.
  • interleukin-6, interleukin-1 ⁇ , interferon, inflammatory factors such as IGFBP5, aurora kinase B, and polo-like kinase 1 are known to be involved in cell cycle regulation genes.
  • Cell aging contributes to individual and tissue aging, inhibits or promotes cancer and contributes to tissue repair and the pathogenesis of aging-related diseases.
  • cell aging contributes to the pathogenesis of various aging-related diseases such as cancer, atherosclerosis, endometrial proliferation, hepatitis, diabetes, supplemental degeneration, skin aging, degenerative nephropathy, myopathy, osteoporosis and prostatic hyperplasia.
  • aging-related diseases such as cancer, atherosclerosis, endometrial proliferation, hepatitis, diabetes, supplemental degeneration, skin aging, degenerative nephropathy, myopathy, osteoporosis and prostatic hyperplasia.
  • Recent studies have shown that selective control of cell aging can regulate the aging of tissues, organs, longevity, and age-related diseases.
  • CD9 antigen is a tetraspanin cell membrane glycoprotein with a molecular weight of 24-27 kDa. Cell adhesion and migration, platelet activity and aggregation, fusion of eggs and sperm in mammalian fertilization, cancer development and metastasis, humoral immune response And antigens that play an important role in allergic reactions, HIV-1 and influenza virus replication, and the like.
  • studies on the regulation of cellular senescence of CD9 antigens and on the regulation of aging have only been reported to increase expression in aged human vascular endothelial cells, and report the role of CD9 in the regulation of cellular senescence and its role in atherosclerosis. It wasn't.
  • CD9 antibody was found to inhibit the action of CD9 through which the cell aging and atherosclerotic lesions were found to complete the present invention.
  • An object of the present invention is to use a composition containing an antibody that specifically binds to the CD9 protein with increased expression in aged cells as an active ingredient, biomarker composition that can inhibit cell aging and diagnose diseases associated with aging And to provide a pharmaceutical composition and health food composition that can prevent or treat cell aging or aging-related diseases.
  • the present invention provides a cell aging or aging-related disease biomarker composition containing CD9 as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating cell aging or aging-related diseases containing an antibody that specifically binds CD9 as an active ingredient.
  • the present invention provides a health food composition for preventing or ameliorating cell aging or aging-related diseases containing an antibody that specifically binds CD9 as an active ingredient.
  • the present invention provides a method for screening a therapeutic agent for aging-related diseases comprising the step of selecting a candidate drug that inhibits CD9 expression.
  • the CD9 specific antibody specifically binds to the extracellular domain of the CD9 antigen exposed to the cell surface and reduces the expression of CD9 in senescent cells, thereby inhibiting cellular aging and atherosclerosis associated with aging. It has been shown to reduce hardening lesions. Therefore, the CD9 of the present invention can be used as a biomarker composition for cell aging or aging-related diseases, and a pharmaceutical composition capable of inhibiting cell aging or preventing or treating aging-related diseases in a composition containing a CD9 specific antibody as an active ingredient. Or it can be usefully used as a health food composition.
  • FIG. 1E shows CD9 immunostaining in atherosclerotic lesions of LDLR-/-mice.
  • FIG. 1F shows CD9 in young and senescent cells. Western blotting confirms protein and mRNA levels And quantitative real-time PCR or RT-PCR results,
  • Figure 1G is a representative value showing the RT-PCR results confirming the level of CD9 mRNA in adriamycin treated cells.
  • L is the lumen of the artery
  • APs include atherosclerosis plaques
  • WT was C57BL / 6 mice
  • NC is experimental group without CD9 primary antibody
  • Y is a young cell
  • S is aged cell
  • Adr is adriamycin
  • HUVECs are human umbilical vein endothelial cells and HDFs represent human dermal fibroblasts.
  • Figure 2 shows the effect of restoring cell senescence through the inhibition of CD9 expression in senescent cells
  • Figure 2A is transfected CD9 or negative control siRNA in senescent cells (PD> 50) and incubated for 6 days at 37 °C and CD9, p53 And Western blotting results confirm the level of p21 protein
  • Figure 2B is a result showing the percentage of SA- ⁇ -gal staining and SA- ⁇ -gal positive cells
  • Figure 2C shows the cell proliferation under live-cell time-lapse microscope
  • 2D is a result of flow cytometry confirming BrdU uptake
  • Figure 2E is a result showing the percentage of Ki67 immunostaining and Ki67 positive cells
  • Figure 2F is a result of confirming the cell cycle by flow cytometry
  • Figure 2G is As a result of confirming the tube formation in HUVECs cells, the results are expressed as the mean ⁇ standard deviation of three repeated experiments
  • HUVECs are human umbilical vein endothelial cells
  • FIG. 3 and 4 confirm the acceleration of cellular senescence according to ectopic expression of CD9 in young cells
  • Figures 3A to 4F are transfected with recombinant human CD9 or negative control adenovirus in the young cells (PD ⁇ 28)
  • 3A shows the results of Western blotting confirming the levels of pATM, pRb, p53, phospho-p53 and p21 proteins, and RT-PCR confirming IL-6 and IL-1 ⁇ mRNA levels.
  • 3B is a result of confirming the percentage of SA- ⁇ -gal staining and SA- ⁇ -gal positive cells
  • FIG. 3C is a flow cytometry result confirming BrdU uptake
  • 3D is a percentage of Ki67 immunostaining and Ki67 positive cells.
  • 3E is a flow cytometry result of analyzing the cell cycle
  • FIG. 4F is a result of confirming endothelial cell tube formation
  • FIGS. 4G to 4H show that 5 MOI recombinant human CD9 or negative control adenovirus is transfected into young cells.
  • Introduction 4G shows the results of cell proliferation analysis by confirming the cell population doubling number (PDL), and FIG. 4H shows the levels of pATM, pRb, p53, phospho-p53 and p21 proteins.
  • FIG. 4I confirms the percentage of ⁇ H2AX positive cells in the nucleus of ⁇ H2AX population and CD9 adenovirus cells
  • Figure 3J shows the PARP-1 / 2 and caspase-3 of CD9 adenovirus cells
  • HUVECs were expressed in human umbilical vein endothelial cells
  • HDFs are human dermal fibroblasts
  • Y is a young cell
  • S is aged cell
  • Ad / Con negative control recombinant adenovirus
  • Ad / CD9 is recombinant human CD9 adenovirus
  • MOI is the multiplicity of infection
  • PDL is a population doubling level, * p ⁇ 0.05 and ** p ⁇ 0.01.
  • FIG. 5 shows that CD9 regulates cell senescence through PI3K-AKT-mTOR-p53 signaling.
  • young cells were transfected with p53, p16, ATM, PIK3CA, PIK3CB or control siRNA and cultured for 24 hours.
  • FIG. 5A shows that p53, p16 and control siRNA were transfected. Results of confirming p53, p21, and p16 protein and mRNA levels of infected cells, FIG.
  • FIG. 5B shows the percentage of SA- ⁇ -gal positive cells in cells transfected with p53, p16 and control siRNA
  • FIG. 5C shows ATM Or the results of confirming the levels of CD9 and ATM mRNA in the cells transfected with the control siRNA
  • Figure 5D is the result of confirming the percentage of SA- ⁇ -gal positive in the cells transfected with the ATM or control siRNA
  • Figure 5E is the result of confirming the level of pAKT, p53, phospho-p53, pS6K and p21 protein in cells treated with rapamycin or LY294002
  • Figure 5F is SA- ⁇ -gal positive cells in cells treated with rapamycin or LY294002
  • 5G is the result of checking the levels of pRb, PIK3CA, PIK3CB, pAKT, phospho-p53, p53, p21 and pS6K proteins in cells transfected with siPIK3CA, siPIK3CB or
  • siPIK3CA is siPIK3CA.
  • siPIK3CB or control siRNA is a result of confirming the percentage of SA- ⁇ -gal positive cells in cells transfected
  • Figure 5I is a diagram of the signal transduction process in cell senescence induced by CD9, the results are repeated three times Representative values of the results are shown, which are expressed as the mean ⁇ standard deviation of three repeated experiments
  • siCon is negative control siRNA
  • sip53 is p53 siRNA
  • sip16 is p16 siRNA
  • siATM is an ATM siRNA
  • LY is LY294002
  • Rap is rapamycin
  • siPIK3CA is a PIK3CA siRNA
  • siPIK3CB is a PIK3CB siRNA
  • Ad / Con is recombinant negative control adenovirus
  • Ad / CD9 is recombinant human CD9 adenovirus, with * p ⁇ 0.05 and ** p ⁇ 0.01.
  • Figure 6 shows the effect of the whole human monoclonal antibody against human CD9 (10E4) inhibits cellular aging by replication aging, 10 ⁇ g / ml of the whole human monoclonal antibody (10E4), human IgG against human CD9 (IgG) 10 ⁇ g / ml, 5 mM N-acetylcysteine (NAC) or 500 nM rapamycin (Rap) was treated by aging cells (PD> 50) for 4 days.
  • IgG human IgG against human CD9
  • NAC N-acetylcysteine
  • Rap 500 nM rapamycin
  • Figure 6B shows the result of immunofluorescence staining to confirm binding
  • Figure 6B is a flow cytometry result confirming that 10E4 binds to CD9 in HUVECs cells
  • Figure 6C is the percentage of SA- ⁇ -gal staining
  • Figure 6D is the p53 and p21 protein
  • Figure 6E is a cell count confirming the cell proliferation, the results are shown as a representative value, the value is expressed as mean ⁇ standard deviation
  • NAC is N-acetylcysteine
  • IgG is human IgG
  • FIGS. 7A to 7E show 10 ⁇ g / ml of 10E4 or IgG in young HUVECs cells or senescent HUVECs cells.
  • FIG. 7A shows the percentage of SA- ⁇ -gal staining in young cells treated with oxLDL and 10E4.
  • FIG. 7B is a result of confirming the percentage of SA- ⁇ -gal staining in oxLDL and 10E4 treated senescent cells
  • 7C is Oil-red O confirming lipid accumulation in young cells or senescent cells treated with oxLDL and 10E4.
  • 7D shows the results of cell proliferation in young cells treated with oxLDL and 10E4, and
  • FIG. 7E shows the level of p53 and p21 proteins in young cells treated with oxLDL and 10E4.
  • FIG. 8H represents mouse endothelial cells (MS- 1) and 10 ⁇ g / ml of rat monoclonal antibody or 10 ⁇ g / ml of rat IgG (rIgG) against mouse CD9 ( ⁇ rCD9) in mouse macrophages (RAW264.7), followed by 10 ⁇ g / ml
  • FIG. 8F is a result of SA- ⁇ -gal staining of MS-1 cells
  • FIG. 8G is SA- ⁇ of Raw264.7 cells.
  • Figure 8H is a result of oil-red O staining confirmed the lipid accumulation in young or senescent cells, the results are shown as representative data, the value is expressed as mean ⁇ standard deviation, NAC is N -acetylcysteine; IgG is human IgG; LDL is a low-density lipoprotein; oxLDL is an oxidized low-density lipoprotein with * p ⁇ 0.05 and ** p ⁇ 0.01.
  • Figure 9 confirms the inhibitory effect of the formation of atherosclerotic lesions of ApoE-/-mice on the rat monoclonal antibody against mouse CD9, 100 ⁇ g every 3.5 days in ApoE-/-mice fed a high fat diet for 15 weeks. After treatment with ⁇ rCD9 or rIgG, euthanasia was measured to measure total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol.
  • FIG. 9A shows the weight change of ApoE-/-mice treated with the CD9 antibody
  • Figure 9B shows the dietary intake of ApoE-/-mice
  • FIG. 9D shows intraarterial atherosclerosis.
  • FIG. 9E shows oil-red O staining and SA- ⁇ -gal staining for atherosclerotic atherosclerotic lesions in aortic densities of ApoE-/-mice.
  • ⁇ rCD9 is a rat monoclonal antibody against mouse CD9
  • rIgG is rat IgG
  • LDL is a low-density lipoprotein
  • oxLDL is an oxidized low-density lipoprotein
  • H / E is hematoxylin-eosin stain, with * p ⁇ 0.05 and ** p ⁇ 0.01.
  • the present invention provides a cell aging or aging-related disease biomarker composition containing CD9 as an active ingredient.
  • CD9 protein was increased in expression in aged cells than in young cells.
  • the expression of these CD9 proteins was reduced in aged cells, the growth of aged cells was improved, and the activity of SA- ⁇ -gal, which shows aging activity, was decreased.
  • the activity of SA- ⁇ -gal which shows aging activity
  • CD9 protein is an important biomarker composition capable of controlling and diagnosing cell aging.
  • the CD9 protein has a cell membrane region, a cytoplasmic region, and an extracellular region, and the extracellular region of CD9 is exposed to the cell surface.
  • the CD9 antibody of the present invention specifically binds to the extracellular region of CD9 to perform CD9 function. Inhibition resulted in cell growth and aging recovery effect of aged cells, and reduced atherosclerotic lesions, a vascular disease associated with cell aging.
  • the present invention provides a pharmaceutical composition for preventing or treating cell aging or aging-related diseases containing an antibody that specifically binds CD9 as an active ingredient.
  • CD9 antibody of the present invention may be one or more selected from amino acids represented by SEQ ID NO: 1 to amino acids represented by SEQ ID NO: 12, the group consisting of human (mouse), rat (rat) and goat (goat) Can be selected from. More specifically, it may be a CD9 human monoclonal antibody or a CD9 rat monoclonal antibody, and more preferably, it may be a CD9 human monoclonal antibody, but is not limited thereto.
  • antibody refers to a specific protein molecule directed to the antigenic site.
  • Antibodies of the invention can include both polyclonal antibodies, monoclonal antibodies, the preparation of the antibodies can be prepared using techniques well known in the art.
  • the antibody specifically binding to the CD9 of the present invention can effectively prevent or treat diseases associated with cell aging or aging.
  • cell aging may be aging or replication aging of vascular endothelial cells or fibroblasts, and aging of the vascular endothelial cells or fibroblasts may be induced by adriamycin, but is not limited thereto.
  • the aging-related disease may be selected from the group consisting of atherosclerosis, skin aging, osteoporosis, rheumatism and degenerative osteoarthritis, but is not limited thereto.
  • composition for preventing or treating cell aging or aging-related diseases of the present invention may further include a pharmaceutically acceptable excipient, carrier, diluent, and the like.
  • Carriers usable in the present invention include macromolecules that are slowly metabolized, such as proteins, polypeptides, liposomes, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers and inert viral particles.
  • Salts of inorganic acids such as, for example, hydrochloride, hydrobromide, phosphate and sulfate; Pharmaceutically acceptable salts such as salts of organic acids such as acetates, propionates, malonates and benzoates; Liquids such as water, saline, glycerol and ethanol; And auxiliary materials such as wetting agents, emulsifiers or pH buffering materials.
  • composition may be formulated in a unit dosage form suitable for intrabody administration of a patient, preferably in the form of preparations useful for the administration of protein medicines, according to conventional methods in the pharmaceutical art, for administration commonly used in the art.
  • Oral or intravenous, intramuscular, intraarterial, intramedullary, intramedullary, intraventricular, lung, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal tract, topical, sublingual, intravaginal or rectal Administration may be by parenteral administration routes including, but not limited to, routes.
  • Formulations suitable for this purpose include various oral preparations, such as tablets, pills, dragees, powders, capsules, syrups, solutions, gels, suspensions, emulsions, microemulsions, and injections such as injectable ampoules, Formulations for parenteral administration such as injectables and sprays such as hypospray are preferred.
  • preparations for injection or infusion they may take the form of suspensions, solutions or emulsions and may include formulations such as suspending agents, preservatives, stabilizers and / or dispersants.
  • the antibody molecule may also be formulated in a dried form that can be readjusted and used in an appropriate sterile liquid before use.
  • the antibody is divided into one or several times a 0.01 to 50 mg / kg body weight, preferably 0.1 to 20 mg / kg body weight per day for a mammal including a human. May be administered.
  • the actual dosage of the active ingredient is dependent on a number of related factors such as the disease to be prevented or treated, the severity of the disease, the route of administration, the patient's weight, age and sex, combination of the drug, the sensitivity of the reaction and the resistance / response to the treatment. It is to be understood that it is to be determined, and therefore, that dosage does not limit the scope of the invention in any aspect.
  • the present invention provides a health food composition for the prevention or improvement of cell aging or aging-related diseases containing an antibody that specifically binds to CD9.
  • CD9 antibody of the present invention may be one or more selected from amino acids represented by SEQ ID NO: 1 to amino acids represented by SEQ ID NO: 12, in the group consisting of human (mouse), rat (rat) and goat (goat) Can be selected. More specifically, it may be a CD9 human monoclonal antibody or a CD9 rat monoclonal antibody, and more preferably, it may be a CD9 human monoclonal antibody, but is not limited thereto.
  • cell aging may be aging or replication aging of vascular endothelial cells or fibroblasts, and aging of the vascular endothelial cells or fibroblasts may be induced by adriamycin, but is not limited thereto.
  • the aging-related disease may be selected from the group consisting of atherosclerosis, skin aging, osteoporosis, rheumatism and degenerative osteoarthritis, but is not limited thereto.
  • the health food may be provided in the form of a powder, granules, tablets, capsules, syrups or beverages, wherein the health food is combined with other foods or food additives in addition to the antibody specifically binding to CD9 according to the invention as an active ingredient. It can be used and can be suitably used according to a conventional method.
  • the mixed amount of the active ingredient can be suitably determined depending on the purpose of use thereof, for example, prophylactic, health or therapeutic treatment.
  • the effective dose of the antibody specifically binding to CD9 contained in the health food can be used in accordance with the effective dose of the pharmaceutical composition, but in the case of long-term intake for health and hygiene purposes or health control purposes It may be less than the above range, it is obvious that the active ingredient can be used in an amount above the above range because there is no problem in terms of safety.
  • the present invention provides a method for screening a therapeutic agent for aging-related diseases comprising the step of selecting a candidate drug that inhibits CD9 expression.
  • the screening method may be used as a method for screening a therapeutic agent for aging-related diseases consisting of atherosclerosis, skin aging, osteoporosis, rheumatoid arthritis and degenerative osteoarthritis.
  • HAVECs Human umbilical vein endothelial cells
  • HDFs human dermal fibroblasts
  • EBM-2 endothelial cell basal medium-2 containing growth factors
  • DMEM Distrachloroeagle medium
  • FBS fetal bovine serum
  • streptomycin 100 U / ml penicillin and 100 mg / ml streptomycin were purchased from Wel-Gene (Daegu, Republic of Korea).
  • Fluorescein conjugated anti-human IgG was tested by Vector Laboratories Inc. (Burlingame, CA, USA) and human IgG was obtained from Thermo Fisher Scientific Inc. (Waltham, MA, USA).
  • AD293 cells, pShuttle vectors, pAdEasy-1 vectors and pAdEasy titer kits are available from Stratagene Corp. (La Jolla, CA, USA).
  • Stealth TM siRNA and negative control siRNA of CD9, p53 and ATM were prepared using Invitrogen Life Technologies Inc.
  • P16 Silencer® select validated siRNA, PIK3CA Silencer® select validated siRNA and PIK3CB Silencer® select validated siRNA were purchased from Ambion (Carlsbad, CA, USA).
  • RNA isolation solutions were purchased from Bio Science Technology (Daegu, Republic of Korea).
  • Agarose gel extraction kit was purchased from SolGent (Daejeon, Republic of Korea), and Bromo-chloro-indolyl-galcto-pyranoside (BCIG; X-gal), N-acetylcysteine and rapamycin were Sigma- Aldrich Chemical Co. (St. Louis, MO, USA).
  • a bromodeoxyuridine (BrdU) flow kit was purchased from BD Bioscience (San Jose, CA, USA), and ⁇ H 2 AX (ser139) antibody conjugated with Alexa Fluor 488 was used for BioLegend (San Diego, CA, USA).
  • LDL Low-density lipoprotein
  • oxLDL oxidized low-density lipoprotein
  • Aortic vein tissue from 10, 20, 50 and 100 week - old ApoE -/- mice with dietary regulation was provided, and heart and arterial tissue from rats 5 and 26 months old was obtained from Aging Tissue Bank (Pusan, Republic of Korea).
  • Aortic denture tissue from LDLR -/- mice was provided by GT Oh (Ewha Women's University, Seoul, Republic of Korea).
  • 0.15% NaCl was perfused and arterial tissue and heart were removed.
  • the aorta was opened vertically and SA-b-gal activity and Oil-red O staining were performed.
  • serial sections were made every 20 mm from the beginning of the coronary artery to the end of the aortic plate.
  • HDFs Human umbilical vascular endothelial cells
  • HUVECs human dermal fibroblasts
  • EBM-2 medium containing growth factors.
  • HDFs cells were dispensed in 100 mm culture dish with 1 ⁇ 10 5 cells in Dulbecco's Modified Eagle Medium (DMEM) medium containing 10% fetal bovine serum (FBS), 100 U / ml penicillin and 100 mg / ml streptomycin, respectively. The cells were incubated at 37 ° C. in a 5% CO 2 incubator. When cells are present in about 80-90% of the culture dish, trypsin is treated to separate them from the culture dish, and cell growth was confirmed by population doubling (PDs) as shown in the following formula.
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • cells of PD ⁇ 28 were young cells, and cells of PD> 50 (passage 15) were used as senescent cells.
  • Human umbilical vascular endothelial cells (HUVECs) and human fibroblasts (HDFs) were each dispensed 1 ⁇ 10 5 cells in a 60 mm culture dish and incubated for 24 hours in a 37 ° C., 5% CO 2 incubator. After washing three times using Dulbecco's Modified Eagle Medium (DMEM), cells were treated with 500 nM of adriamycin for 4 hours. After removal of the adriamycin, three washes with DMEM were performed.
  • Human umbilical vein endothelial cells contained 10% fetal bovine serum, 100 U / ml penicillin, and 100 ⁇ g / ml streptomycin. Cultured EGM-2 medium, human fibroblasts were incubated for 4 days in DMEM medium containing 10% fetal bovine serum, 100 U / ml penicillin, 100 ⁇ g / ml streptomycin It was.
  • RT reaction was performed using a reaction solution (final reaction volume 20 ⁇ l) containing 1 ⁇ g of isolated RNA and MMLV reverse transcriptase (Promega Corp., Madison, WI, USA), 2.5 ⁇ M oligo-dT primer and 1 mM dNTP. CDNA was synthesized.
  • the cDNA was PCR amplified using Super-Therm DNA polymerase (SR Product, Kent, UK), and the RNA amount of each sample was normalized with GAPDH primers. PCR products were separated on 2% agarose gels and visualized using Synergy Brands (SYBR) green stain (Applied Biosystems, Carlsbad, Calif., USA) and LAS-3000 imaging system (Fujifilm Corp., Stamford, CT, USA). .
  • SYBR Synergy Brands
  • Cells are washed with cold PBS (phosphate-buffered saline; Invitrogen Inc., Grand Island, NY, USA) and frozen in cold 100 ⁇ l RIPA buffer [25 mM Tris-HCl, pH 7.4, 150 mM KCl, 5 mM EDTA, 1 % NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM Na 3 VO 4 , 5 mM NaF, 1 mM phenylmethyl sulfonylfluoride] Cells were collected, vortexed for 30 seconds, incubated in ice, and ruptured by repeating twice at 30 minute intervals.
  • PBS phosphate-buffered saline
  • RIPA buffer 25 mM Tris-HCl, pH 7.4, 150 mM KCl, 5 mM EDTA, 1 % NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM Na 3 VO 4 , 5 mM NaF
  • the supernatant was separated by centrifugation at 13,000 rpm for 15 minutes at 4 ° C., and the protein concentration in the supernatant was quantified by bicinchoninic acid (BCA) method (Pierce Biotechnology Inc., Rockford, IL, USA) using bovine serum albumin. It was.
  • BCA bicinchoninic acid
  • Proteins were separated on 8, 10 or 12% sodium dodecyl sulfate polyacrylamide gels and transferred to nitrocellulose membranes.
  • Membranes were treated with 1 ⁇ TTBS (10 mM Tris-HCl pH 7.5, 150 mM NaCl, and 0.05% Tween-20) for 5 minutes at room temperature, followed by pAKT, pS6, PIK3CA, Secondary reaction with PIK3CB, pATM, pRb, CD9, p53, phospho-p53, PARP 1/2, caspase-3 or p21 overnight at 4 ° C and with horseradish peroxidase The antibody was allowed to react at room temperature for 90 minutes, and then washed three times with 1 ⁇ TTBS.
  • 1 TTBS 10 mM Tris-HCl pH 7.5, 150 mM NaCl, and 0.05% Tween-20
  • Antigen-antibody complexes were detected with Western blotting Luminol reagent (Santa Cruz Biotech Inc., Santa Cruz, Calif., USA), and the proteins were visualized with Fujifilm LAS-3000 image system. GAPDH antibody was used as a control for protein loading, and the relative intensity of each protein band was confirmed using Multi Gauge software, version 3.0 (Fujifilm Corp., Stamford, CT, USA).
  • PCR amplification using Takara HS DNA polymerase (Shiga, Japan) and primers (CCCCACTAGTCATGCCGGTCAAAGGAGGCA and CCCCCTCGAGCTAGACCATCTCGCGGTTCCTGC) was performed to amplify the full-length human CD9 cDNA and gel extraction kit (SolGent). Corp., Daejeon, Republic of Korea) was used to purify the PCR product.
  • the full-length CD9 cDNA sequence was digested with XhoI and SpeI and then linked to the same restriction enzyme site of the pShuttle-IRES-hrGFP-2 vector to construct the pShuttle / CD9 vector.
  • the nucleotide sequence of the full-length CD9 cDNA was confirmed by DNA sequencing (SolGent Corp., Daejeon, Republic of Korea).
  • CD9 aneovirus vectors were prepared in E. coli BJ5183 double-recombined with pAdEasy-1 vector and pShuttle / CD9 vector.
  • BJ5183 cells were transformed by electroporation with the pAdEasy-1 vector to transform the pAd / CD9 vector.
  • BJ5183 colonies containing pAd / CD9 vectors were selected and confirmed for the presence of pAd / CD9 vectors by treatment with PacI (New England Biolabs Inc., Ipswich, Mass., USA).
  • Recombinant pAd / CD9 vectors linearized by PacI cleavage were transfected into AD293 cells using Fugene HD transfection reagent (Roche Diagnostic Corp., Indianapolis, IN, USA) according to the manufacturer's instructions.
  • Recombinant adenovirus was amplified in AD293 cells and purified using an adenovirus purification kit (Cell Biolabs Inc., San Diego, Calif., USA), and virus titers were confirmed in AD293 cells using Virus titers.
  • Young cells (PD ⁇ 28, 1 ⁇ 10 5 cells) were seeded in 60 mm culture dishes and incubated overnight. Cells were then treated with 5, 10 and 15 MOI of recombinant CD9 adenovirus or negative control adenovirus for 24 hours, then discarded medium and further cultured by time zone.
  • CD9 or negative control siRNA was transfected into senescent cells (PD> 50, 1 ⁇ 10 5 cells) using Lipofectamine 2000 transfection reagent (Life Technologies Inc., Gaithersburg, MD, USA) according to the manufacturer's instructions to inhibit CD9 expression. It was confirmed.
  • Young cells (1 ⁇ 10 5 cells) were aliquoted into 60 nm culture dishes and incubated overnight, and siRNAs described in Table 2 were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen Life Technologies). After 24 hours of incubation, 15 MOI of recombinant CD9 adenovirus or negative control adenoviruses were treated with the cells for 24 hours, then the medium was discarded and replaced with growth medium for further incubation at each time period.
  • Trypsinized cells were resuspended in 70% ethanol and incubated at ⁇ 20 ° C. for a minimum of 1 hour. Thereafter, PBS containing 2% fetal bovine serum (FBS), 0.01% CaCl 2 , and RNase (1% w / v) was added and incubated at 37 ° C. for 30 minutes.
  • FBS fetal bovine serum
  • CaCl 2 0.01% CaCl 2
  • RNase 1% w / v
  • the cells were centrifuged and resuspended in PBS with 50 ⁇ g / ml propidium iodide and incubated for 20 minutes.
  • Cell cycle distribution was analyzed by measuring the intracellular propidium iodide intensity of 10,000 cells using a Becton-Dickinson FACS Canto II flow cytometer (Becton-Dickinson, San Jose, Calif., USA).
  • 96-well plates were coated with 65 ⁇ l Matrigel (Becton Dickinson, Bedford, Mass.). Young HUVECs (2.5 ⁇ 10 4 cells / well) transduced with recombinant CD9 adenovirus or negative control adenovirus were plated repeatedly and incubated at 37 ° C. for 4 hours. Aged HUVECs (2.5 ⁇ 10 4 cells / well) transduced with CD9 or negative control siRNA were repeatedly dispensed onto plates, incubated at 37 ° C. for 4 hours and tube formation confirmed by light microscopy.
  • the cells were washed three times with PBS, blocked with 3% goat serum (Invitrogen Corp) for 45 minutes, and then CD9 antibody (SC-9148; dilution 1: 100) or Ki67 antibody (Abcam, Cambridge, MA). , USA, Cat No. ab16667; dilution 1: 150) at 37 ° C. overnight. Then incubate with Alexa Fluor 546-conjugated goat anti-rabbit IgG (dilution 1: 10,000; Molecular Probes, Eugene, OR, USA) for 2 hours and stain with 4 ', 6-diamidino-2-phenylindole (DAPI). Performed and confirmed by confocal microscopy.
  • CD9 antibody SC-9148; dilution 1: 100
  • Ki67 antibody Abcam, Cambridge, MA
  • DAPI 6-diamidino-2-phenylindole
  • Paraffin embedded tissue blocks were cut to 5 ⁇ m and attached to silane coated slides.
  • Young cells were transfected with recombinant CD9 adenovirus, senescent cells were transfected with CD9 siRNA, cultured for 5 days, and treated with BrdU for one day.
  • the number of BrdU-positive cells in 10,000 cells was determined using a Becton-Dickinson FACS Canto II flow cytometer (BD Bioscience).
  • the molecular cloning method using PCR fused the recombinant of human CD9 large extracellular domain (hCD9-ECL2; amino acids 112-195 of human CD9) with the Fc portion of human IgG C-terminus.
  • the hCD9-ECL2-Fc fusion protein prepared by the above method was expressed in HEK293E cells and purified using a protein A-Sepharose column (GE healthcare) according to the manufacturer's instructions.
  • Human IgG1 Fc (only Fc) without CD9 protein was also expressed and purified in the same manner as the above method and used as a negative control.
  • the purified recombinant proteins were dialyzed with PBS and analyzed by SDS-PAGE.
  • M13 phage labeled human naive scFv library with a diversity of 2 ⁇ 10 11 was obtained from E. coli XL-1 blue strain (Stratagene).
  • the antibody library was subjected to four rounds of regularly panned hCD9-ECL2-Fc, after which the Fc bound phage was subtracted in one round where only Fc was panned.
  • the input and output titers of each panning round (Titer) were confirmed as shown in Table 3.
  • Monoclonal phage particles were randomly selected and grown in the third and fourth panning and measured at 37 ° C. for 1 hour at 1 ⁇ g / ml concentration in PBS using hCD9-ECL2-Fc coated ELISA.
  • Fc and anti-Myc monoclonal antibodies (clone 9E10, GE healthcare) were also coated and confirmed that scFv binds to Fc and phage particles.
  • the detection was visualized using O-phenylenediamine.
  • reaction was visualized using O-phenylenediamine as substrate and the peroxidase reaction was stopped with 2.5 NH 2 SO 4 and measured at A450 using a microtiter plate reader. Positive clones were selected and sequenced.
  • a 10E4 clone showing high VH homology with human antibody germ line was selected as a representative hCD9 specific whole human monoclonal antibody. Phagemids of 10E4 clones were cleaved with SfiI and BstXI to form VH and VL.
  • VH and VL gene fragments were inserted into the pNATAB-H hidden fixed site of the heavy chain (CH1-CH2-CH3) and the pNATAB-L hidden fixed site of the light chain, respectively, to generate whole IgG antibody genes.
  • the two resulting plasmids were transfected together into 293E cells and the growth medium was harvested and purified for 4 hours every other day.
  • Target antigen Panning Input phage number Binding phage number CD9-ECL2-Fc 1 st 3.2 ⁇ 10 13 2.4 ⁇ 10 7 2 st 1.1 ⁇ 10 13 1 ⁇ 10 6 3 st 2.3 ⁇ 10 13 1.2 ⁇ 10 7 4 st 1.3 ⁇ 10 13 3 ⁇ 10 9
  • 10 ⁇ g / ml LDL or oxLDL and 10 ⁇ g / ml total human monoantibody or human IgG against human CD9 (10E4) were treated with HUVECs for 4 or 6 days.
  • Mouse endothelial cell line MS-1 and mouse macrophage line Raw264.7 were treated with 50 ⁇ g / ml of LDL or oxLDL and rat IgG (rIgG) or CD9 antibody ( ⁇ rCD9) for 3 days. Lipid accumulation was confirmed by oil-red O staining and SA- ⁇ -gal active staining was performed to confirm cell aging.
  • CD9 expression levels are increased in aged endothelial cells, we have identified the extent of CD9 expression in aged vascular tissues and atherosclerotic lesions in humans or rats. .
  • CD9-positive immunostaining in human arteries increases as shown in FIG. 1A, with 51-60 and 61-70 years showing the highest peaks, and slightly decreased in 71-80 and 81-90 years.
  • CD9 levels were also increased in the arteries and the heart of aged rats compared with young rats 5 months old.
  • the CD9 immune response was also observed in atherosclerotic lesions of the human carotid arteries as shown in FIG. 1C. It was confirmed that the increase.
  • the CD9 immune response and SA- ⁇ -gal staining are increased in the atherosclerotic lesions of the aortic veins of aged ApoE-/-mice and LDLR-/-mice. It could be confirmed.
  • CD9 is associated with cellular aging, vascular tissue aging and vascular disease associated with aging.
  • BrdU incorporation increased with CD9 expression inhibition
  • Ki67 also known as a cell proliferation marker
  • inhibition of CD9 expression reduced G0 / G1 phase cell numbers and increased S and G2 / M cell numbers, which may be suggested to release G1 arrest, a typical phenotype of cell aging.
  • HUVECs form tubular structures, and in older cells, HUVECs reduce tubular formation.
  • FIG. 2G inhibition of CD9 expression restored tubular formation in aged cells.
  • Recombinant human CD9 adenovirus was used to overexpress CD9 in young cells and to determine if cell senescence is induced in CD9 overexpressed young cells.
  • CD9 overexpression decreased the level of phosphorylated Rb (phospho-Rb) and increased levels of p53, phospho-p53, p21, IL-6 and IL-1 ⁇ as shown in FIG. 3A.
  • ⁇ -gal staining was increased and the ratio of BrdU incorporation (FIG. 3C), Ki67 immunoactivity (FIG. 3D) and S phase cell number (FIG. 3E) was reduced.
  • the cell size was large and flat as shown in FIG. 3B, and endothelial tube formation was inhibited as in FIG. 4F in HUVECs cells transduced with CD9 adenovirus.
  • the present inventors have introduced CD9 adenovirus and overexpressed CD9 for 36 days and confirmed the effect on cell proliferation.
  • the cell number proliferation level gradually decreased due to CD9 overexpression, and a significant difference appeared after 24 days.
  • p53 / p21 and Rb / p16 are known to regulate cell senescence
  • p53 or p16 siRNA were transfected into cells transduced with CD9 adenovirus as shown in FIG. 5A.
  • p53 signaling is a signaling process that regulates cellular senescence induced by CD9.
  • DDR DNA damage response
  • PI3K / AKT signaling plays an important role in p53-induced aging, and CD9 is known to modulate PI3K / AKT signaling in vascular smooth muscle cells.
  • mTOR Mammalian target of rapamycin
  • mTOR is a subsequent molecule in PI3K / AKT signaling, involved in translation and cell proliferation.
  • PIK3CA affects CD9-induced aging.
  • PI3K-AKT-mTOR-p53 signaling process as shown in FIG. 5I was confirmed to be a signaling process that regulates CD9-induced cell senescence. .
  • CD9 inhibition with CD9 neutralizing antibodies could overcome cellular aging and vascular diseases associated with aging.
  • Example 14 a whole human monoclonal antibody against human CD9 was prepared using phage display technology, and clone 10E4 bound to KEVFDN, an epitope in the extracellular domain of human CD9. It was confirmed.
  • FIGS. 6A and 6B 10E4 was confirmed to bind to aged intracellular CD9.
  • FIGS. 6C and 6D senescent cells treated with 10E4 SA- ⁇ -gal activity and it was confirmed that the level of p53 and p21 is reduced, as a result it can be seen that the increased cell proliferation as shown in Figure 6E there was.
  • oxLDL is a potential inflammatory molecule that penetrates endothelial cells and macrophages to promote foam cell formation in atherosclerotic lesions and leads to premature aging of endothelial cells.
  • CD9 increases oxLDL uptake induced by CD36 in macrophages. .
  • 10E4 was treated to oxLDL treated young HUVECs cells and senescent HUVECs cells.
  • mouse CD9 ( ⁇ rCD9) is involved in cell aging and formation of atherosclerotic lesions using the mouse endothelial cell line (MS-1) and macrophage cell line (Raw264.7). The effect of rat monoclonal antibody was confirmed against.
  • ⁇ rCD9 inhibited SA- ⁇ -gal activity and lipid uptake induced by oxLDL in MS-1 and Raw264.7 cells as shown in Figs. 8F to 8H.
  • 100 ⁇ g of ⁇ rCD9 or rIgG was injected daily in ApoE ⁇ / ⁇ mice intraperitoneally for 3.5 days and a high fat diet was taken for 15 weeks.
  • ⁇ rCD9 not only reduced the SA- ⁇ -gal activity and atherosclerotic plaque portion of the facial aorta, but also the amount of SA- ⁇ -gal activity and atherosclerosis lesions in the aorta. It showed an effect of reducing.
  • the CD9 antibody can be effectively used to inhibit and treat atherosclerotic lesions.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물에 관한 것으로, 보다 상세하게는 CD9 특이적 항체는 세포 표면에 노출되어 있는 CD9 항원의 세포외 영역과 특이적으로 결합함으로써, 노화된 세포에서 CD9의 발현을 감소시켜 세포 노화를 억제하고, 노화와 관련된 혈관질환인 죽상경화 병변을 감소시키는 효과를 나타내었다. 따라서, 본 발명의 CD9은 세포 노화 또는 노화 관련 질환의 바이오마커 조성물로 사용될 수 있으며, CD9 특이적 항체를 유효성분으로 함유하는 조성물을 세포 노화를 억제 또는 노화 관련 질환을 예방하거나 치료할 수 있는 약학조성물 또는 건강식품조성물로 유용하게 사용할 수 있다.

Description

ＣＤ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물
본 발명은 CD9 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물에 관한 것으로, 세포 노화를 억제하는 CD9 특이적 항체를 이용함으로써, 세포 노화 또는 노화 관련 질환을 예방 또는 치료하고자 한다.
포유류의 정상 체세포를 분리하여 시험관에서 배양하면, 일정한 횟수 분열 후, 더 이상 분열하지 않고 성장이 멈추는데 이를 복제노화라고 한다. 복제노화는 세포가 분열하면서 염색체의 말단 부분인 텔로미어가 짧아지면서 생기는 것으로 알려져 있으며, 그 외 산화스트레스, 암 유전자 및 암 억제 유전자의 활성 증가, 항암제와 같은 세포 독성 물질 투여에 의해서도 세포노화가 유도된다.
노화세포는 세포의 크기가 커지고 평평해지는 형태적 특징뿐만 아니라, senescence-associated β-galactosidase (SA-β-gal) 활성의 증가, 암 억제인자로 알려진 p16, p53, 그리고 Rb의 발현 증가와 같은 분자적 특징을 동반한다. 또한 노화세포에서는 염증 반응, DNA 손상, 세포 성장 및 주기 조절과 관련된 다양한 유전자들의 발현이 변하는 것으로 알려져 있는데, 이와 관련된 유전자로는 Raf, Ras와 같은 암유전자 및 p53, p16과 같은 암억제 유전자들이 알려져 있으며, 인터루킨-6, 인터루킨-1β, 인터페론, IGFBP5와 같은 염증인자, aurora kinase B, polo-like kinase 1과 같은 세포주기 조절 유전자들도 관여하는 것으로 알려져 있다.
세포노화 현상은 개체 및 조직 노화에 기여하며, 암을 억제하거나 촉진하기도 하고 조직복구 및 노화관련 질환의 병인에 기여한다. 특히, 세포노화는 암, 죽상경화, 혈관내막증식, 간염, 당뇨병, 추가판 퇴행증, 피부노화, 퇴행성 신결질환, 근감소증, 골다공증 및 전립선 비대증과 같은 다양한 노화관련 질환의 병인에 기여한다. 최근 연구결과에 따르면, 세포노화를 선택적으로 조절하면 조직, 장기의 노화, 건강 수명, 노화관련 질환의 발생을 조절할 수 있다고 보고되었다.
CD9 항원은 분자량 24-27kDa의 테트라스파닌(tetraspanin) 세포막 당단백질로 세포 부착 및 이동, 혈소판활성 및 응집, 포유동물의 수정과정에서 난자와 정자의 융합, 암의 발생 및 전이, 체액성 면역 반응 및 알러지 반응, HIV-1과 인플루엔자 바이러스 복제 등에 중요한 역할을 하는 항원으로 알려져 있다. 그러나, CD9 항원의 세포노화 조절이나, 노화조절 연구는 단순히 노화된 사람 혈관내피 세포에서 발현이 증가되는 것이 보고되었을 뿐, CD9의 세포노화 조절기전 및 혈관노화 관련질환인 죽상경화증에서의 역할을 보고되지 않았다.
따라서, 본 발명은 CD9이 세포노화 조절에 어떠한 영향을 미치는지를 연구하던 중, CD9 항체에 의해 CD9의 작용이 억제되고 이를 통하여 세포노화 및 죽상경화 병변이 저해되는 효과를 발견하여 본 발명을 완성하였다.
본 발명의 목적은 노화된 세포에서 발현이 증가하는 CD9 단백질에 특이적으로 결합하는 항체를 유효성분으로 함유하는 조성물을 이용함으로써, 세포노화를 억제하고 노화와 관련된 질환을 진단할 수 있는 바이오마커 조성물 및 세포노화 또는 노화 관련 질환 예방 또는 치료할 수 있는 약학조성물 및 건강식품조성물을 제공하고자 한다.
상기 목적을 달성하기 위해, 본 발명은 CD9을 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 바이오마커 조성물을 제공한다.
본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물을 제공한다.
본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물을 제공한다.
또한 본 발명은 CD9 발현을 억제하는 후보약물을 선별하는 단계를 포함하는 것을 특징으로 하는 노화 관련 질환 치료제 스크리닝 방법을 제공한다.
본 발명에 따르면, CD9 특이적 항체는 세포 표면에 노출되어 있는 CD9 항원의 세포외 영역과 특이적으로 결합하여 노화 세포에서 CD9의 발현을 감소시킴으로써, 세포 노화를 억제하고 노화와 관련된 혈관질환인 죽상경화 병변을 감소시키는 효과를 나타내었다. 따라서, 본 발명의 CD9은 세포 노화 또는 노화 관련 질환의 바이오마커 조성물로 사용될 수 있으며, CD9 특이적 항체를 유효성분으로 함유하는 조성물을 세포 노화를 억제 또는 노화 관련 질환을 예방하거나 치료할 수 있는 약학조성물 또는 건강식품조성물로 유용하게 사용할 수 있다.
도 1은 나이별 사람 및 랫 동맥경화 조직과 사람 경동맥 및 ApoE-/- 또는 LDLR-/- 생쥐의 대동맥굴내 아테크롬 동맥경화성 병변에서 CD9 과발현을 확인한 것으로, 도 1A는 나이별 사람 동맥 조직의 CD9 면역활성을 확인한 결과와 각 그룹의 사람 동맥의 CD9 양성 면역염색 백분율을 나타낸 결과이며, 도 1B는 5 내지 26 개월된 랫의 동맥 및 심장에서 CD9 단백질의 수준을 확인한 웨스턴 블롯팅 결과이며, 도 1C는 사람 경동맥(n=6)내 아테크롬 동맥경화 병변에서 CD9 면역염색을 수행한 결과이며, 도 1D는 나이별 ApoE-/- 생쥐(각, n=5)의 대동맥굴에서 CD9 면역활성, SA-β-gal 및 Oil-red O 염색을 수행한 결과이며, 도 1E는 LDLR-/- 생쥐의 아테크롬 동맥경화 병변에서 CD9 면역염색을 수행한 결과이며, 도 1F는 젊은 세포 및 노화 세포에서 CD9 단백질 및 mRNA 수준을 확인한 웨스턴 블로팅 및 정량적 실시간 PCR 또는 RT-PCR 결과이며, 도 1G는 아드리아마이신 처리된 세포에서 CD9 mRNA의 수준을 확인한 RT-PCR 결과를 대표 값으로 나타낸 결과이다. 상기 값들은 세 번 반복된 실험의 평균 ± 표준편차로 나타내었으며, 상기 도면에서 L은 동맥의 내강; AP는 아테크롬 동맥경화성 플라크; ApoE-/-는 아포리포단백질 E 결핍 생쥐; WT는 C57BL/6 생쥐; NC는 CD9 1차 항체가 없는 실험군; LDLR-/-은 저밀도 리포단백질 수용체 결핍 생쥐; Y는 젊은 세포; S는 노화된 세포; Adr은 아드리아마이신(adriamycin); HUVECs은 사람 제대혈 내피 세포(human umbilical vein endothelial cells)이며, HDFs는 사람 피부 섬유아세포(human dermal fibroblasts)를 나타낸다.
도 2는 노화세포에서 CD9 발현 억제를 통한 세포 노화 회복 효과를 확인한 결과로, 도 2A는 노화 세포(PD>50)에 CD9 또는 음성 대조군 siRNA을 형질감염시키고 37℃에서 6일간 배양하고 CD9, p53 및 p21 단백질의 수준을 확인한 웨스턴 블롯팅 결과이며, 도 2B는 SA-β-gal 염색 및 SA-β-gal 양성 세포의 백분율을 나타낸 결과이며, 도 2C는 live-cell time-lapse 현미경으로 세포 증식을 확인한 결과이며, 도 2D는 BrdU 흡수를 확인한 유세포 분석결과이며, 도 2E는 Ki67 면역염색 및 Ki67 양성 세포의 백분율을 나타낸 결과이며, 도 2F는 유세포 분석으로 세포 주기를 확인한 결과이며, 도 2G는 HUVECs 세포에서 관형성을 확인한 결과로, 상기 결과들은 세 번 반복된 실험의 평균 ± 표준편차로 나타내었으며, HUVECs은 사람 제대혈 내피 세포(human umbilical vein endothelial cells); HDFs는 사람 피부 섬유아세포(human dermal fibroblasts); Y는 젊은 세포; S는 노화된 세포; siCon은 음성 대조군 siRNA; siCD9은 CD9 siRNA이며, *p < 0.05 및 **p < 0.01 이다.
도 3 및 도 4는 젊은 세포에서 CD9의 이소성 발현에 따른 세포 노화 가속화를 확인한 결과로, 도 3A 내지 도 4F는 젊은 세포(PD<28)에 재조합 사람 CD9 또는 음성 대조군 아데노바이러스가 형질도입시키고 37℃에서 6일간 배양하여 확인한 결과들로 도 3A는 pATM, pRb, p53, phospho-p53 및 p21 단백질의 수준을 확인한 웨스턴 블롯팅 결과와 IL-6 및 IL-1β mRNA 수준을 확인한 RT-PCR 결과이며, 도 3B는 SA-β-gal 염색 및 SA-β-gal 양성 세포의 백분율을 확인한 결과이며, 도 3C는 BrdU 흡수를 확인한 유세포 분석 결과이며, 도 3D는 Ki67 면역염색 및 Ki67 양성 세포의 백분율을 나타낸 결과이며, 도 3E는 세포 주기를 분석한 유세포 분석 결과이며, 도 4F는 내피 세포 관 형성을 확인한 결과이며, 도 4G 내지 도 4H는 젊은 세포에 5 MOI 재조합 사람 CD9 또는 음성 대조군 아데노바이러스가 형질도입시키고 각 시간대별로 배양하여 확인한 결과들로, 도 4G는 세포집단배가수(PDL)을 확인하여 세포 증식을 분석한 결과이며, 도 4H는 pATM, pRb, p53, phospho-p53 및 p21 단백질의 수준을 확인한 웨스턴 블롯팅 분석 결과이며, 도 4I는 γH2AX 군집 및 CD9 아데노바이러스 세포의 핵 내 γH2AX 양성 세포의 백분율을 확인한 결과이며, 도 3J는 CD9 아데노바이러스 세포에서 PARP-1/2 및 카스파제-3의 웨스턴 블롯팅 결과로, 상기 결과들은 세 번 반복된 실험 결과의 평균 ± 표준편차로 나타내었으며, HUVECs은 사람 제대혈 내피 세포(human umbilical vein endothelial cells); HDFs는 사람 피부 섬유아세포(human dermal fibroblasts); Y는 젊은 세포; S는 노화된 세포; Ad/Con은 음성 대조군 재조합 아데노바이러스; Ad/CD9은 재조합 사람 CD9 아데노바이러스; MOI은 감염의 다중도; PDL은 세포집단배가수(population doubling level) 이며, *p < 0.05 및 **p < 0.01 이다.
도 5는 PI3K-AKT-mTOR-p53 신호과정을 통하여 CD9이 세포노화를 조절하는 것을 확인한 결과로, 젊은 세포에 p53, p16, ATM, PIK3CA, PIK3CB 또는 대조군 siRNA를 형질감염시켜 24시간 동안 배양하였으며, 젊은 세포에 4시간 동안 LY294002 또는 라파마이신(rapamycin)을 처리하고 재조합 사람 CD9 또는 음성 대조군 아데노바이러스를 형질도입시키고 6일 후 노화 표현형을 확인한 결과로, 도 5A는 p53, p16 및 대조군 siRNA가 형질감염된 세포의 p53, p21, 및 p16 단백질 및 mRNA 수준을 확인한 결과이며, 도 5B는 p53, p16 및 대조군 siRNA가 형질감염된 세포에서 SA-β-gal 양성 세포의 백분율을 확인한 결과이며,도 5C는 ATM 또는 대조군 siRNA가 형질감염된 세포에서 CD9 및 ATM mRNA의 수준을 확인한 결과이며, 도 5D는 ATM 또는 대조군 siRNA가 형질감염된 세포에서 SA-β-gal 양성의 백분율을 확인한 결과이며, 도 5E는 라파마이신 또는 LY294002가 처리된 세포에서 pAKT, p53, phospho-p53, pS6K 및 p21 단백질의 수준을 확인한 결과이며, 도 5F는 라파마이신 또는 LY294002가 처리된 세포에서 SA-β-gal 양성 세포의 백분율을 확인한 결과이며, 도 5G는 siPIK3CA, siPIK3CB 또는 대조군 siRNA가 형질감염된 세포에서 pRb, PIK3CA, PIK3CB, pAKT, phospho-p53, p53, p21 및 pS6K 단백질의 수준을 확인한 결과이며, 도 5H는 siPIK3CA, siPIK3CB 또는 대조군 siRNA가 형질감염된 세포에서 SA-β-gal 양성 세포의 백분율을 확인한 결과이며, 도 5I는 CD9에 의해 유도되는 세포 노화에서 신호 절달 과정을 도식화 것으로, 상기 결과들은 세 번 반복된 실험 결과의 대표 값을 나타내었으며, 상기 값은 세번 반복된 실험의 평균 ± 표준편차로 나타내었으며, siCon은 음성 대조군 siRNA; sip53은 p53 siRNA; sip16은 p16 siRNA; siATM은 ATM siRNA; LY은 LY294002; Rap은 rapamycin; siPIK3CA은 PIK3CA siRNA; siPIK3CB은 PIK3CB siRNA; Ad/Con은 재조합 음성 대조군 아데노바이러스; Ad/CD9은 재조합 사람 CD9 아데노바이러스이며, *p < 0.05 및 **p < 0.01이다.
도 6은 사람 CD9(10E4)에 대한 전체 사람 단일클론 항체가 복제 노화에 의한 세포 노화를 억제하는 효과를 확인한 결과로, 사람 CD9에 대한 전체 사람 단일클론 항체(10E4) 10 μg/ml, 사람 IgG (IgG) 10 μg/ml, 5 mM N-acetylcysteine (NAC) 또는 500 nM 라파마이신(Rap)을 노화 세포(PD>50)에 4일간 처리하여 확인한 것으로, 도 6A는 노화세포에서 10E4가 CD9에 결합하는 것을 확인한 면역형광 염색 결과이며, 도 6B는 HUVECs 세포에서 10E4가 CD9에 결합하는 것을 확인한 유세포 분석 결과이며, 도 6C는 SA-β-gal 염색의 백분율이며, 도 6D는 p53 및 p21 단백질의 수준을 나타낸 결과이며, 도 6E는 세포 증식을 확인한 세포 계수 결과로, 상기 결과들은 대표값으로 나타내었으며, 값은 평균 ± 표준편차로 나타내었으며, NAC은 N-acetylcysteine; IgG은 사람 IgG이며, *p < 0.05 및 ** p < 0.01 이다.
도 7 및 도 8은 CD9 항체가 oxLDL가 처리된 HUVECs 세포의 세포 노화를 억제하는 효과를 확인한 것으로, 도 7A 내지 도 7E는 젊은 HUVECs 세포 또는 노화 HUVECs 세포에 10 μg/ml의 10E4 또는 IgG를 2시간 동안 사전 처리하고 10 μg/ml의 LDL 또는 oxLDL를 4일 동안 처리하고 세포 노화를 분석한 결과로, 도 7A는 oxLDL 및 10E4가 처리된 젊은 세포에서 SA-β-gal 염색의 백분율을 확인한 결과이며, 도 7B는 oxLDL 및 10E4가 처리된 노화 세포에서 SA-β-gal 염색의 백분율을 확인한 결과이며, 도 7C는 oxLDL 및 10E4가 처리된 젊은 세포 또는 노화 세포에서 지질 축적을 확인한 Oil-red O 염색 결과이며, 도 7D는 oxLDL 및 10E4가 처리된 젊은 세포에서 세포 증식을 확인한 결과이며, 도 7E는 oxLDL 및 10E4가 처리된 젊은 세포에서 p53 및 p21 단백질의 수준을 확인한 결과이며, 도 8F 내지 도 8H는 생쥐 내피 세포(MS-1) 및 생쥐 대식세포(RAW264.7)에 생쥐 CD9(αrCD9)에 대한 랫 단일클론 항체 10 μg/ml 또는 랫 IgG(rIgG) 10 μg/ml을 2시간 동안 처리한 후, 10 μg/ml의 LDL 또는 oxLDL을 4일 동안 처리하고 oxLDL에 의해 유도되는 세포 노화를 확인한 결과로, 도 8F는 MS-1 세포의 SA-β-gal 염색 백분율 결과이며, 도 8G는 Raw264.7 세포의 SA-β-gal 염색 백분율 결과이며, 도 8H는 젊은 세포 또는 노화 세포에서 지질 축적을 확인한 Oil-red O 염색 결과이로, 상기 결과들은 대표 데이터으로 나타내었으며, 값은 평균 ± 표준편차로 나타내었으며, NAC은 N-acetylcysteine; IgG은 human IgG; LDL은 저밀도 리포단백질(low-density lipoprotein); oxLDL은 oxidized low-density lipoprotein이며, *p < 0.05 및 ** p < 0.01 이다.
도 9는 생쥐 CD9에 대한 랫 단일클론 항체의 ApoE-/- 생쥐의 아테크롬 동맥경화성 병변의 형성 억제효과를 확인한 것으로, 15주 동안 고지방 식이를 섭취시킨 ApoE-/- 생쥐에 3.5일 마다 100 μg의 αrCD9 또는 rIgG를 처리한 후 안락사시켜 전체 콜레스테롤, 트리글리세라이드, HDL-콜레스테롤 및 LDL-콜레스테롤을 측정하였으며, 얼굴 동맥 및 대동맥굴 내 아테크롬 동맥경화성 병변의 형성을 SA-β-gal 염색 및 Oil-red O 염색을 수행하여 확인한 결과로, 도 9A는 CD9 항체를 처리한 ApoE-/- 생쥐의 몸무게 변화를 나타낸 것이며, 도 9B는 ApoE-/- 생쥐의 식이 섭취량을 나타낸 것이며, 도 9C는 αrCD9 또는 rIgG (각, n=5)가 처리된 ApoE-/- 생쥐의 혈청에서 전체 콜레스테롤, 트리글리세라이드, HDL-콜레스테롤 및 LDL-콜레스테롤 수준을 확인한 결과이며, 도 9D는 얼굴 동맥내 아테크롬 동맥경화성 플라크 부분을 Oil-red O 염색 및 SA-β-gal 염색한 결과이며, 도 9E는 Oil-red O 염색 및 SA-β-gal 염색하여 ApoE-/- 생쥐의 대동맥굴내 아테크롬 동맥경화성 병변의 부피를 확인한 결과로, 상기 결과들은 대표 데이터으로 나타내었으며, 값은 평균 ± 표준편차로 나타내었으며, αrCD9은 생쥐 CD9에 대한 랫 단일클론 항체; rIgG은 랫 IgG; LDL은 저밀도 리포단백질(low-density lipoprotein); oxLDL은 산화된 저밀도 리포단백질(oxidized low-density lipoprotein); H/E는 헤마톡실린-에오신(hematoxylin-eosin) 염색아며, *p < 0.05 및 ** p < 0.01 이다.
본 발명은 CD9을 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 바이오마커 조성물을 제공한다.
본 발명의 일실시예에 따르면, CD9 단백질은 젊은 세포에서보다 노화된 세포에서 발현이 증가되어 있었다. 이러한 CD9 단백질을 노화된 세포에서 발현 감소시켰을 때 노화된 세포의 성장이 향상되었으며, 노화 활성을 나타내는 SA-β-gal의 활성이 감소하였다. 반면, 젊은 세포에서 CD9의 과발현시켰을 때, 세포 성장이 감소하고 노화가 촉진되는 것을 확인할 수 있었다. 상기 결과로부터 CD9 단백질이 세포노화를 조절하고 진단할 수 있는 중요한 바이오마커 조성물인 것이 확인되었다.
이러한 CD9 단백질은 세포막 영역, 세포질 영역, 세포외 영역을 가지고 있으며, CD9의 세포외 영역은 세포 표면에 노출되어 있는데, 본 발명의 CD9 항체는 CD9의 세포외 영역과 특이적으로 결합하여 CD9 작용을 억제함으로써, 노화된 세포의 세포 성장 및 노화 회복 효과를 나타내었으며, 세포노화와 관련된 혈관 질환인 죽상경화 병변을 감소시켰다.
따라서, 본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물을 제공한다.
본 발명의 CD9 항체는 서열번호 1로 표시된 아미노산 내지 서열번호 12로 표시된 아미노산에서 선택된 하나 이상인 것일 수 있으며, 인간(human), 마우스(mouse), 랫트(rat) 및 고우트(goat)로 이루어진 군에서 선택될 수 있다. 보다 상세하게는 CD9 인간 단클론 항체 또는 CD9 흰쥐 단클론 항체일 수 있으며, 보다 바람직하게는 CD9 인간 단클론 항체일 수 있으나, 이에 한정되지는 않는다.
본 발명에서‘항체’란 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 항체는 다클론 항체, 단클론 항체를 모두 포함할 수 있으며, 항체의 제조는 당업계에 널리 공지된 기술을 이용하여 제조할 수 있다.
상기 전술한 바와 같이, 본 발명의 CD9에 특이적으로 결합하는 항체는 세포노화 또는 노화와 관련된 질환을 효과적으로 예방 또는 치료할 수 있다.
본 발명에서 세포노화는 혈관내피세포 또는 섬유아세포의 노화 또는 복제 노화일 수 있으며, 상기 혈관내피세포 또는 섬유아세포의 노화는 아드리아마이신에 의해 유도될 수 있으나, 이에 한정되지는 않는다.
또한 본 발명에서 노화 관련 질환은 죽상경화, 피부노화, 골다공증, 류마티스 및 퇴행성 골관절염으로 이루어진 군에서 선택될 수 있으며, 이에 한정되지는 않는다.
본 발명의 세포노화 또는 노화 관련 질환 예방 또는 치료용 조성물은 약학적으로 허용되는 부형제, 담체, 희석제 등을 추가로 포함할 수 있다. 본 발명에서 사용가능한 담체로는 단백질, 폴리펩타이드, 리포좀, 다당, 폴리락트산, 폴리글리콜산, 중합체성 아미노산, 아미노산 공중합체 및 불활성 바이러스 입자와 같이 천천히 대사되는 거대분자를 들 수 있다. 예를 들면, 하이드로클로라이드, 하이드로브로마이드, 포스페이트 및 설페이트와 같은 무기산의 염; 아세테이트, 프로피오네이트, 말로네이트 및 벤조에이트와 같은 유기산의 염과 같은 약제학적으로 허용 가능한 염; 물, 염수, 글리세롤 및 에탄올과 같은 액체; 및 수화제, 유화제 또는 pH 완충 물질과 같은 보조적 물질을 사용할 수 있다.
또한, 상기 조성물은 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위투여형의 제제, 바람직하게는 단백질 의약품의 투여에 유용한 제제 형태로 제형화시켜 당 업계에서 통상적으로 사용하는 투여방법을 이용하여 경구, 또는 정맥 내, 근육 내, 동맥 내, 골수 내, 수막강 내, 심실 내, 폐, 경피, 피하, 복강 내, 비강 내, 소화관 내, 국소, 설 하, 질 내 또는 직장 경로를 포함하는 비경구투여 경로에 의하여 투여될 수 있으나, 이들에 한정되는 것은 아니다.
이러한 목적에 적합한 제형으로는 정제, 환제, 당제 (dragee), 산제, 캡슐제, 시럽제, 용액제, 겔제, 현탁제, 에멀젼, 마이크로에멀젼 등의 다양한 경구투여용 제제 및 주사용 앰플과 같은 주사제, 주입제, 및 하이포스프레이 (hypospray)와 같은 분무제 등과 같은 비경구투여용 제제가 바람직하다. 주사 또는 주입용 제제의 경우에는, 현탁액, 용액 또는 에멀션 등의 형태를 취할 수 있고, 현탁화제, 보존제, 안정화제 및/또는 분산제와 같은 제제화제를 포함할 수 있다. 또한, 상기 항체 분자는 사용 전에 적절한 무균 액체로 재조정하여 사용할 수 있는 건조된 형태로 제제화될 수도 있다.
본 발명의 조성물 또는 약학적 제제의 유효성분으로서 상기 항체는 사람을 포함하는 포유동물에 대해 하루에 0.01 내지 50 ㎎/kg 체중, 바람직하게는 0.1 내지 20 ㎎/kg 체중을 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 유효성분의 실제 투여량은 예방 또는 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별, 약제 조합, 반응 민감성 및 치료에 대한 내성/반응 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
또한 본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물을 제공한다.
본 발명의 CD9 항체는 서열번호 1로 표시된 아미노산 내지 서열번호 12로 표시된 아미노산에서 선택된 하나 이상일 수 있으며, 인간(human), 마우스(mouse), 랫트(rat) 및 고우트(goat)로 이루어진 군에서 선택될 수 있다. 보다 상세하게는 CD9 인간 단클론 항체 또는 CD9 흰쥐 단클론 항체일 수 있으며, 보다 바람직하게는 CD9 인간 단클론 항체일 수 있으나, 이에 한정되지는 않는다.
본 발명에서 세포노화는 혈관내피세포 또는 섬유아세포의 노화 또는 복제 노화일 수 있으며, 상기 혈관내피세포 또는 섬유아세포의 노화는 아드리아마이신에 의해 유도될 수 있으나, 이에 한정되지는 않는다.
또한 본 발명에서 노화 관련 질환은 죽상경화, 피부노화, 골다공증, 류마티스 및 퇴행성 골관절염으로 이루어진 군에서 선택될 수 있으며, 이에 한정되지는 않는다.
상기 건강식품은 분말, 과립, 정제, 캡슐, 시럽 또는 음료의 형태로 제공될 수 있으며, 상기 건강식품은 유효성분인 본 발명에 따른 CD9에 특이적으로 결합하는 항체 이외에 다른 식품 또는 식품 첨가물과 함께 사용되고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 그의 사용 목적 예를 들어 예방, 건강 또는 치료적 처치에 따라 적합하게 결정될 수 있다.
상기 건강식품에 함유된 CD9에 특이적으로 결합하는 항체의 유효용량은 상기 약학조성물의 유효용량에 준해서 사용할 수 있으나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 범위 이하일 수 있으며, 유효성분은 안전성 면에서 아무런 문제가 없기 때문에 상기 범위 이상의 양으로도 사용될 수 있음은 확실하다.
상기 건강식품의 종류에는 특별한 제한이 없고, 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등을 들 수 있다.
또한 본 발명은 CD9 발현을 억제하는 후보약물을 선별하는 단계를 포함하는 것을 특징으로 하는 노화 관련 질환 치료제 스크리닝 방법을 제공한다.
상기 스크리닝 방법은 죽상경화, 피부노화, 골다공증, 류마티스 및 퇴행성 골관절염으로 이루어진 노화 관련 질환의 치료제 스크리닝 방법으로 이용될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
<참고예 1> 물질
사람 제대혈 내피세포(Human umbilical vein endothelial cells; HUVECs), 사람 피부 섬유아세포(human dermal fibroblasts; HDFs) 및 성장인자가 포함된 내피세포 성장배지(endothelial cell basal medium-2; EBM-2)를 Lonza Inc. (Walkersville, MD, USA)에서 구입하였다. DMEM(Dulbecco’s modified eagle medium), 태아소혈청(fetal bovine serum; FBS), 100 U/ml 페니실린 및 100 mg/ml 스트렙토마이신은 Wel-Gene(Daegu, Republic of Korea)에서 구입하였다.
본 발명에 사용된 프라이머는 Bioneer Inc.(Daejeon, Republic of Korea)에서 합성하였으며(표 1), 웨스턴 블롯 분석용 항체는 표 2에 기재하였다.
플루오레세인이 결합된 항-사람 IgG는 Vector Laboratories Inc. (Burlingame, CA, USA)에서 얻었으며, 사람 IgG는 Thermo Fisher Scientific Inc. (Waltham, MA, USA)에서 구입하였다. AD293 세포, pShuttle 벡터, pAdEasy-1 벡터 및 pAdEasy titer kit는 Stratagene Corp. (La Jolla, CA, USA)에서 구입하였다.
CD9, p53 및 ATM의 Stealth™ siRNA와 음성 대조군 siRNA를 Invitrogen Life Technologies Inc. (Carlsbad, CA, USA)에서 구입하였으며, p16 Silencer® select validated siRNA, PIK3CA Silencer® select validated siRNA 및 PIK3CB Silencer® select validated siRNA는 Ambion(Carlsbad, CA, USA)에서 구입하였다.
전체 RNA 분리(TRI) 용액을 Bio Science Technology (Daegu, Republic of Korea)에서 구입하였다.
agarose gel extraction kit를 SolGent (Daejeon, Republic of Korea)에서 구입하였으며, Bromo-chloro-indolyl-galcto-pyranoside(BCIG; X-gal), N-아세틸시스테인(acetylcysteine) 및 라파마이신(rapamycin)은 Sigma-Aldrich Chemical Co. (St. Louis, MO, USA)에서 구입하였다. 브로모디옥시우리딘(bromodeoxyuridine; BrdU) flow kit를 BD Bioscience(San Jose, CA, USA)에서 구입하였으며, Alexa Fluor 488이 결합된 γH2AX(ser139) 항체를 BioLegend (San Diego, CA, USA)에서 구입하였다. 저밀도 리포단백질(Low-density lipoprotein; LDL) 및 산화된 저밀도 리포단백질(oxidized low-density lipoprotein; oxLDL)은 K. H. Cho (Yeungnam University, Gyeongsan, Republic of Korea)에게 제공받았다.
Name Sequence DNA size ( bp )
CD9 CATGATGCTGGTGGGCTTCC 260
CCAAACCACAGCAGTTCAAC
p53 GCCTGAGGTTGGCTCTGA 226
GTGGTGAGGCTCCCCTTT
IL-6 TGAGGAGACTTGCCTGGTG 388
TGCCCAGTGGACAGGTTT
IL-1b TCTCCACCTCCAGGGACA 438
CTGCCAGCCCTAGGGATT
p16 CTTCCTGGACACGCTGGT 183
ACCTTCCGCGGCATCTAT
GAPDH CGACCACTTTGTCAAGCTCA 227
AGGGGTCTACATGGCAACTG
ATM GCAAACGAACCTGGAGAGAG 226
GGTGGAGGGATTTGGTAGGT
Name company catalog number
CD9 Santa Cruz Biotechnology SC-9148
p53 SC-126
PARP-1/2 SC-7150
caspase-3 SC-7148
PIK3CA p110α SC-7174
PIK3CB p110β SC-7174
p21 Cell Signaling #2947S
phospho-p53 (p-p53) #9286S
phospho-AKT (pAKT) #4058S
phospho-S6 (pS6K) #5364S
phospho-ATM (pATM) #4526S
phospho-Rb (pRb) #9308S
<참고예 2> 사람 동맥 조직 및 경동맥으로부터 아테크롬 동맥경화성 플라크 수집
사람 혈관 조직을 1세에서 90세의 비장 및 고환에서 얻었으며 10세 간격으로 그룹을 구분하였다(각, n=20) 또한, 사람 경동맥 조직는 영남대학교병원(Daegu, Republic of Korea)에서 1995년부터 2012년까지 아테크롬 동맥경화 환자로부터 외과적으로 절제된 6 시료를 이용하였다.
<참고예 3> 동물 조직 및 동물 실험
모든 동물실험은 영남대학교 의학대학의 기관의 동물 관리 및 사용 위원회로부터 승인을 받고 수행되었다(YUMC-AEC2013-008 및 YUMC-EDU2014-014).
식이 조절된 10, 20, 50 및 100 주령 ApoE-/- 생쥐의 대동맥굴 조직을 제공받았으며, 5 및 26 개월된 랫의 심장 및 동맥 조직을 Aging Tissue Bank (Pusan, Republic of Korea)로 부터 얻었으며, LDLR-/- 생쥐의 대동맥굴 조직은 G. T. Oh (Ewha Women’s University, Seoul, Republic of Korea)로부터 제공받았다.
ApoE-/-생쥐내 아테크롬 동맥경화성 병변 형성에 생쥐 CD9에 대한 중화된 항체의 효과를 확인하기 위해 생쥐를 두 그룹(각, n=5)으로 나누었으며, 45% Kcal 지방이 포함된 설치류 먹이(Research Diets Inc., New Brunswick, NJ, USA)를 생쥐에게 섭취시켰다.
100 μg의 항-마우스 CD9 단일클론 항체(KMC8, BD Pharmingen, Cat. No. 553758) 및 랫 IgG를 3.5일 마다 15주간 복강내에 주사하였다. 주사 기간동안 3.5일 마다 음식 섭취와 몸무게를 확인하였으며, 15주 후 생쥐를 안락사시켰다.
0.15% NaCl을 관류시키고 동맥 조직 및 심장을 적출하였다. 얼굴 염색을 위해, 대동맥을 세로로 열고 SA-b-gal 활성 및 Oil-red O 염색을 수행하였다.
대동맥굴 조직을 OCT 화합물로 포매한 후 관상동맥 처음에서부터 대동맥 판의 끝까지 20 mm 부분마다 연속적인 절편을 제작하였다.
상기 조직 절편에 SA-b-gal 활성 염색, CD9 면역조직화학 염색 및 Oil-red O 염색을 수행하고 Image J program을 이용하여 대동맥 및 경동맥내 아테크롬 동맥경화성 병변의 정도를 확인하였다.
<실험예 1> 세포 배양
사람 제대혈관내피세포 (human umbilical vascular endothelial cells, HUVECs) 및 사람 섬유아세포 (human dermal fibroblasts, HDFs)를 LONZA Inc.(Walkersville, MD)에서 구매하여 HUVECs세포는 성장인자가 포함된 EBM-2 배지에, HDFs세포는 10% 태아소혈청(FBS), 100 U/ml 페니실린 및 100 mg/ml 스트렙토마이신이 포함된 Dulbecco’s Modified Eagle Medium (DMEM) 배지에 각각 1×105 세포로 100mm 배양 접시에 분주하여 37℃, 5% CO2 배양기에서 배양하였다. 배양 접시의 80~90% 정도로 세포가 존재하게 되면 트립신(trypsin)을 처리하여 배양 접시로부터 분리하고 세포 성장을 하기식과 같이 세포집단배가수(population doubling; PDs)로 확인하였다.
PD=log2F/log2I (F=마지막으로 모인 세포의 수, I = 처음 분주한 세포의 수)
확인 후, PD<28(passage 7)의 세포를 젊은 세포, PD>50(passage 15)인 세포를 노화 세포로 사용하였다.
<실험예 2> 아드리아마이신 처리
사람 제대혈관내피세포(HUVECs) 및 사람 섬유아세포(HDFs)를 60 mm 배양 접시에 각각 1×105 세포를 분주하고 37℃, 5% CO2 배양기에서 24시간 배양하였다. 그 후, Dulbecco’s Modified Eagle Medium (DMEM)을 사용하여 3번 세척한 후 아드리아마이신(adriamycin) 500 nM을 4시간 동안 세포에 처리하였다. 아드리아마이신을 제거한 후에 DMEM으로 3번 세척을 하고 사람 제대정맥혈관내피세포는 10% 태아소혈청(fetal bovine serum), 100 U/ml 페니실린(penicillin), 100 μg/ml 스트렙토마이신(streptomycin)이 포함된 EGM-2 배지로, 사람 섬유아세포는 10% 태아소혈청(fetal bovine serum), 100 U/ml 페니실린(penicillin), 100 μg/ml 스트렙토마이신(streptomycin)이 포함된 DMEM 배지로 4일 동안 배양하였다.
<실험예 3> 전체 RNA 추출 및 중합효소연쇄반응(PCR)
1. 전체 RNA 추출
트라이졸(Trizol) 시약을 사용하여 제조사의 설명서대로 수행하여 전체 RNA를 추출하였다. RNA 농도는 UV 분광광도계를 이용하여 260 nm 흡광도에서 측정한 후, 추출된 RNA를 사용전까지 -70 ℃에서 보관하였다.
2. 역전사 중합효소연쇄반응(RT-PCR)
분리된 전체 RNA 1㎍와 MMLV 역전사 중합효소(Promega Corp., Madison, WI, USA), 2.5 μM oligo-dT 프라이머 및 1 mM dNTP를 포함한 반응용액(최종 반응 용량 20 μl)을 이용하여 RT 반응을 수행하여 cDNA를 합성하였다.
상기 cDNA에 Super-Therm DNA 중합효소(SR Product, Kent, UK)를 이용하여 PCR 증폭하고, 각 시료의 RNA 양은 GAPDH 프라이머로 표준화하였다. PCR 산물을 2% 아가로스 겔에 분리시키고 Synergy Brands(SYBR) green stain(Applied Biosystems, Carlsbad, CA, USA) 및 LAS-3000 imaging system(Fujifilm Corp., Stamford, CT, USA)를 이용하여 시각화하였다.
3. 실시간 정량적 PCR 분석
SYBR Green PCR master mix (Applied Biosystems, Carlsbad, CA, USA)와 LightCycler 2.0 Real-Time PCR system (Roche Diagnostic Corp., Indianapolis, IN, USA)를 이용하여 실시간 정량적 PCR 분석을 수행하였다.
<실험예 4> 단백질 추출 및 웨스턴 블롯팅
1. 단백질 추출
세포를 차가운 PBS(phosphate-buffered saline; Invitrogen Inc., Grand Island, NY, USA)으로 세척하고 어름같이 차가운 100 μl RIPA 버퍼 [25 mM Tris-HCl, pH 7.4, 150 mM KCl, 5 mM EDTA, 1% NP-40, 0.5% 소듐 디옥시콜레이트(sodium deoxycholate), 0.1% SDS, 1 mM Na3VO4, 5 mM NaF, 1 mM 페닐메틸 설포닐프롤라이드(phenylmethyl sulfonylfluoride)]로 재부유시켜 긁게로 세포를 수집하고 30 초동안 와류(vortexing)시킨 후 어름에서 인큐베이트시키고 30분 간격으로 2번 반복하여 세포를 파열시켰다.
그 후 4℃, 13,000 rpm에서 15분간 원심분리시켜 상등액을 분리하고 소혈청알부민을 기준으로 이용하여 bicinchoninic acid(BCA) 방법(Pierce Biotechnology Inc., Rockford, IL, USA)으로 상등액 내 단백질 농도를 정량하였다.
2. 웨스턴 블롯 분석
단백질을 8, 10 또는 12 % 소디움 도데실 설페이트폴리아크릴아마이드 겔에 분리시기키고 니트로셀룰로스 막에 옮겼다. 막을 5% 탈지유(skim milk)가 포함된 1×TTBS (10 mM Tris-HCl pH 7.5, 150 mM NaCl, and 0.05% Tween-20)로 실온에서 30분 동안 처리한 후, pAKT, pS6, PIK3CA, PIK3CB, pATM, pRb, CD9, p53, phospho-p53, PARP 1/2, caspase-3 또는 p21에 대한 항체를 4℃에서 하룻밤동안 반응시키고 호어스래디시 페록시다아제(horseradish peroxidase)가 부착된 이차 항체를 실온에서 90분 동안 반응시킨 후, 1×TTBS로 30분씩 3번 세척하였다.
항원-항체 복합체를 Western blotting Luminol reagent(Santa Cruz Biotech Inc., Santa Cruz, CA, USA)로 검출하였으며, Fujifilm LAS-3000 image system으로 단백질을 시각화하였다. 단백질 로딩에 대한 대조군으로 GAPDH 항체를 이용하였으며, Multi Gauge software, version 3.0 (Fujifilm Corp., Stamford, CT, USA)을 이용하여 각 단백질 밴드의 상대적 강도를 확인하였다.
<실험예 5> 사람 재조합 CD9 아데노바이러스 제작
사람 재조합 CD9 아데노바이러스 벡터를 제조하기 위해, Takara HS DNA 중합효소(Shiga, Japan)와 프라이머(CCCCACTAGTCATGCCGGTCAAAGGAGGCA 및 CCCCCTCGAGCTAGACCATCTCGCGGTTCCTGC)를 이용한 PCR 증폭을 수행하여 전체 길이의 사람 CD9 cDNA를 증폭하고, gel extraction kit(SolGent Corp., Daejeon, Republic of Korea)을 사용하여 PCR 산물을 정제하였다.
전체 길이 CD9 cDNA 서열을 XhoI 및 SpeI으로 절단한 후 pShuttle-IRES-hrGFP-2 벡터의 동일한 제한 효소 부위에 연결하여 pShuttle/CD9 벡터를 제작하였다.
전체 길이 CD9 cDNA의 뉴클레오티드 서열을 DNA 염기서열결정(SolGent Corp., Daejeon, Republic of Korea)으로 확인하였다.
pAdEasy-1 벡터와 pShuttle/CD9 벡터로 이중-재조합된 E. coli BJ5183에서 CD9 아네노바이러스 벡터를 제조하였다.
pShuttle/CD9 벡터에 PmeI 및 alkaline phosphatase(New England Biolabs Inc., Ipswich, MA, USA)를 처리한 후, pAdEasy-1 벡터와 함께 전기천공법(electroporation)으로 BJ5183 세포를 형질전환시켜 pAd/CD9 벡터를 얻었다.
pAd/CD9 벡터를 포함하고 있는 BJ5183 콜로니들은 선택하고 pAd/CD9 벡터의존재여부를 PacI(New England Biolabs Inc., Ipswich, MA, USA)를 처리하여 확인하였다.
PacI 절단으로 선형화된 재조합 pAd/CD9 벡터를 Fugene HD transfection reagent (Roche Diagnostic Corp., Indianapolis, IN, USA)를 이용하여 제조사의 설명서에 따라 AD293 세포에 형질주입하였다.
AD293 세포에서 재조합 아데노바이러스를 증폭시키고 adenovirus purification kit (Cell Biolabs Inc., San Diego, CA, USA)를 이용하여 정제하였으며, Virus titers를 이용하여 AD293 세포 내 바이러스 역가를 확인하였다.
<실험예 6> 재조합 CD9 아데노바이러스 형질도입
젊은 세포(PD<28, 1×105 세포)을 60 mm 배양 접시에 접종하고 하룻밤 동안 배양하였다. 그 후 세포에 5, 10 및 15 MOI의 재조합 CD9 아데노바이러스 또는 음성 대조군 아데노바이러스를 24시간 동안 처리한 후 배지를 버리고 시간대별로 추가 배양하였다.
<실험예 7> siRNA 형질주입
노화세포(PD>50, 1×105 세포)에 CD9 또는 음성 대조군 siRNA을 Lipofectamine 2000 transfection reagent (Life Technologies Inc., Gaithersburg, MD, USA)을 이용하여 제조사의 설명서에 따라 형질주입하고 CD9 발현 억제를 확인하였다.
젊은세포(1×105 세포)를 60 nm 배양접시에 분주하고 하룻밤동안 배양하고 표 2에 기재된 siRNA을 Lipofectamine 2000 transfection reagent (Invitrogen Life Technologies)를 이용하여 세포에 형질주입하였다. 24시간 배양 후, 15 MOI의 재조합 CD9 아데노바이러스 또는 음성 대조군 아데노바이러스를 24시간 동안 세포에 처리한 후 배지를 버리고 성장 배지로 교체하여 각 시간대별고 추가 배양하였다.
그 후, RT-PCR 또는 웨스턴 블롯으로 발현 정도를 확인하였으며, 형질주입 4일 후 SA-β-gal 활성을 확인하였다.
<실험예 8> 실시간 세포 성장 확인
노화세포(1×105 세포)에 CD9 siRNA 또는 음성 대조군 siRNA을 24시간 동안 형질주입하고 세포를 떼어내어 96-well 플레이트에 분주하고 하룻밤동안 배양하였다. 재조합 CD9 아데노바이러스 또는 음성 대조군 아데노바이러스를 젊은세포(1×105 세포)에 24시간 동안 형질도입하고 96-well 플레이트에 분주하고 하룻밤동안 배양한 후 배지를 버리고 성장배지로 교체하여 4일동안 추가 배양하였다.
배양 후 Leica ASMDW 공초점 현미경(Leica Microsystems GmbH, Wetzlar, Germany)을 이용하여 세포를 관찰하고 각 시간대별로 세포 수를 측정하였다.
<실험예 9> 노화 관련된 β-갈락토시다아제(SA-β-gal) 염색
이전에 보고된 방법(Itahana K, Campisi J, Dimri GP. Methods to detect biomarkers of cellular senescence: The senescence-associated beta-galactosidase assay. Methods Mol Biol. 2007;371:21-31)에 따라, 세포 및 냉각된 조직 절편에서 SA-β-gal 활성을 확인하였다.
2×104 세포를 35 mm 배양 접시에 분주하고 1일 동안 배양한 후, PBS로 세포를 2번 세척하고 실온에서 3.7% (v/v) 포름알데하이드가 포함된 PBS로 3분 동안 고정시켰다. 그 후, 1 mg/ml 5-브로모-4-클로로-3-인돌일-β-D-갈락토시드, 40 mM 시트릭 산-소디움 포스페이트(pH 5.85), 5 mM 페리시안화칼륨(potassium ferricyanide), 150 mM NaCl 및 2 mM MgCl2로 구성된 염색 용액으로 37℃에서 17.5 시간 동안 세포를 염색하였다. 염색 후 PBS로 두 번 세척하고 0.5% 에오신 용액으로 3분 동안 염색하여 푸른색 세포의 백분율을 광학현미경하에서 계산하였다.
<실험예 10> 유세포 분석(Flow cytometry)
트립신 처리된 세포를 70% 에탄올에 재부유시키고 -20 ℃에서 최소 1시간 동안 인큐베이트하였다. 그 후 세포에 2% 태아소혈청(FBS)와 0.01% CaCl2, RNase (1% w/v)가 포함된 PBS를 첨가하고 37℃에서 30분 동안 인큐베이트하였다.
상기 세포를 원심분리하고 50μg/ml 프로피디움 요오드화물(propidium iodide)이 포함된 PBS에 재부유시키고 20분 동아 인큐베이트하였다.
Becton-Dickinson FACS Canto II flow cytometer (Becton-Dickinson, San Jose, CA, USA)를 이용하여 10,000 세포의 각 세포내 프로피디움 요오드화물 강도를 측정하여 세포 주기 분포를 분석하였다.
<실험예 11> 내피세포 관 형성 확인
65 μl 마트리겔(Becton Dickinson, Bedford, MA)로 96-well 플레이트를 코팅하였다. 재조합 CD9 아데노바이러스 또는 음성 대조군 아데노바이러스로 형질도입된 젊은 HUVECs(2.5×104 cells/well)를 플레이트에 반복하여 분주하고 37℃에서 4시간 동안 인큐베이트하였다. CD9 또는 음성 대조군 siRNA로 형질도입된 노화된 HUVECs(2.5×104 cells/well)를 플레이트에 반복하여 분주하고 37℃에서 4시간 동안 인큐베이트하고 광학현미경으로 관 형성을 확인하였다.
<실험예 12> 세포 및 조직 면역조직화학(immunohistochemical) 염색
유리 커버슬립에 세포를 분주하고 24시간 동안 배양하고, 세포를 PBS로 세번 세정한 후, 3.7 %(v/v) 파라포름알데하이드가 포함된 PBS로 10분간 고정시켰다.
다음으로 세포를 PBS로 세번 세정한 후, 3% 고트 혈청(goat serum; Invitrogen Corp)으로 45분간 차단시킨 후, CD9 항체(SC-9148; dilution 1:100) 또는 Ki67 항체(Abcam, Cambridge, MA, USA, Cat No. ab16667; dilution 1:150)로 37℃에서 하룻밤 동안 염색하였다. 그 후 Alexa Fluor 546-conjugated goat anti-rabbit IgG (dilution 1:10,000; Molecular Probes, Eugene, OR, USA)로 2시간 동안 인큐베이트하고 4',6-diamidino-2-phenylindole (DAPI)로 염색을 수행하고 공초점 현미경으로 확인하였다.
파라핀 포매된 조직 블록을 5 μm로 절단하고 실란(silane)이 코팅된 슬라이드에 부착시켰다. 사람에서 절제된 비장 및 고환의 혈관조직과 ApoE-/- 생쥐의 대동맥굴 조직에 CD9 항체(Abcam, Cambridge, MA, USA, Cat No. ab92726)를 1:50으로 Dako Envision Kit (ChemMate™, DAKO EnVision™, Denmark)를 이용하여 제조사의 설명서대로 면역조직화학적 염색을 수행하였다. 대비염색으로 Mayer’s 헤마톡실린을 이용하였다.
<실험예 13> BrdU 함입 확인
BrdU flow kit를 이용하여 세포내 BrdU 함입 정도를 확인하였다.
젊은세포에 재조합 CD9 아데노바이러스가 형질도입시키고, 노화세포에 CD9 siRNA를 형질감염시켜 5일간 배양하고 BrdU를 하룻동안 처리하였다. Becton-Dickinson FACS Canto II flow cytometer (BD Bioscience)를 이용하여 10,000세포 중 BrdU-양성 세포의 수를 확인하였다.
<실험예 14> 사람 CD9에 대한 전체 사람 단일클론 항체 제조 및 스크리닝
PCR을 이용한 분자 클로닝 방법으로 사람 CD9 거대 세포외 영역(hCD9-ECL2; amino acids 112-195 of human CD9)의 재조합 형과 사람 IgG C-말단의 Fc 부분을 융합시켰다.
상기 방법으로 제작된 hCD9-ECL2-Fc 융합 단백질을 HEK293E 세포에 발현시키고 protein A-Sepharose column (GE healthcare)을 이용하여 제조사의 설명서에 따라 정제하였다.
CD9 단백질이 없는 사람 IgG1 Fc(오직 Fc)역시 상기 방법과 동일한 과정으로 발현시키고 정제하여 음성 대조군으로 사용하였다.
상기 정제된 재조합 단백질들을 PBS로 투석하고 SDS-PAGE로 분석하였다.
2×1011 의 다양성을 갖는 사람 나이브(naive) scFv 라이브러리(library)가 표시된 M13 파아지(phage)를 E. coli XL-1 파란색 균주(Stratagene)에서 얻었다.
항체 라이브러리는 hCD9-ECL2-Fc가 규칙적으로 패닝된 네 개의 라운드를 대상으로 하였으며, 그 후 Fc만 패닝된 한 개의 라운드에서 Fc가 결합된 파아지를 제하였다. 각 패닝 라운드의 입력 및 출력 역가(Titer)를 표 3과 같이 확인하였다.
각 패닝 라운드에서 용출된 폴리파아지가 hCD9-ECL2-Fc와 결합 특이성을 갖는지를 enzyme-linked immunosorbent assay (ELISA)를 수행하여 확인하였다.
3 번째 및 4 번째 패닝에서 단일클론 파아지 입자를 무작위로 선택하여 성장시키고 hCD9-ECL2-Fc가 코팅된 ELISA를 이용하여 PBS내 1 μg/ml 농도로 37℃에서 1 시간 동안 측정하였다.
Fc 및 항-Myc 단일클론 항체(clone 9E10, GE healthcare)또한 코팅시키고 scFv가 Fc 및 파아지 입자에 결합하는지 확인하였다.
0.1% Tween 20가 포함된 PBS(PBST)로 세번 반복 세척 후, 4% 탈지유를 각 웰에 첨가하여 1시간 동안 실온에서 인큐베이트하였다. 인큐베이트 후 PBST로 세번 세척하고 용출된 파아지를 각 웰에 첨가하고 37℃에서 1 시간 동안 추가 배양하였다. 그 후 PBST로 세척하고 래빗 항-M13 항체(1 μg/ml, GE healthcare)와 반응시킨 후 HRP가 결합된 고트 (Fab’)2 항 래빗 IgG(1:5000)를 사용하여 검출하였다.
상기 검출은 O-페닐렌디아민(O-phenylenediamine)을 사용하여 시각화하였다.
O-페닐렌디아민을 기질로 사용하여 상기 반응을 시각화하였으며, 2.5 N H2SO4로 페록시다아제 반응을 중단시키고 microtiter plate reader를 사용하여 A450에서 측정하였다. 양성 클론을 선택하고 염기서열을 확인하였다.
그 결과, 표 4와 같은 5개의 hCD9-EC2 특이적 파아지 항체를 얻었다.
사람 항체 생식세포 계열과 높은 VH 상동성을 보인 10E4 클론을 대표적인 hCD9 특이적 전체 사람 단일클론 항체로 선택하였다. SfiI 및 BstXI로 10E4 클론의 파지미드(Phagemid)를 절단하여 VH 및 VL 형로 만들었다.
전체 IgG 항체 유전자를 발생시키기 위해 상기 VH 및 VL 유전자 조각을 각각 중쇄(CH1-CH2- CH3)의 pNATAB-H 숨겨진 고정부위 및 경쇄의 pNATAB-L 숨겨진 고정부위에 삽입하였다.
상기 결과로 얻어진 두 플라스미드를 함께 293E 세포에 형질주입하고 성장 배지를 하루 걸러 4 시간 동안 수거하고 정제하였다.
Target antigen Panning Input phage number Binding phage number
CD9-ECL2-Fc 1st 3.2×1013 2.4×107
2st 1.1×1013 1×106
3st 2.3×1013 1.2×107
4st 1.3×1013 3×109
Clone name VH Identities VL Identities VH ( CDR3 - a.a seq ) Vk ( CDR3 - a.a seq ) Group Ratio
11G3 L12a 269/283(95.1%) DNSPPRI(서열번호 1) QQYSDYWT(서열번호 2) 1 1.232
12F3 VH1-46 243/296(83.4%) L8 271/279(95.1%) EDDIEDAFDF(서열번호 3) QQYDSVPLT(서열번호 4) 2 0.669
3F3 VH1-46 243/296(83.4%) V1-4 283/297(95.3%) DNSPPRI(서열번호 5) GSYTSSSTFEV(서열번호 6) 3 0.918
8A3 VH1-46 243/296(83.4%) L8 274/286(95.8%) EGVSAAGGLDH(서열번호 7) QQLNSYPLT(서열번호 8) 4 0.730
5G4 VH1-46 243/296(83.4%) L8 273/284(96.1%) EDDIEDAFDF(서열번호 9) HKTDSFPLT(서열번호 10) 5 1.043
10E4 VH3-9 271/287(94.4%) L8 276/286(96.5%) SPVGTTYFDY(서열번호 11) QQLNIFPLT(서열번호 12) 6 1.441
<실험예 15> oxLDL 및 CD9 항체 투여
LDL 또는 oxLDL 10 μg/ml 및 인간 CD9(10E4)에 대한 전체 사람 단일항체 또는 인간 IgG 10 μg/ml을 4 또는 6일간 HUVECs에 처리하였다. 마우스 내피 세포주인 MS-1 및 마우스 대식세포주인 Raw264.7에 LDL 또는 oxLDL 50 μg/ml 및 랫 IgG (rIgG) 또는 CD9 항체(αrCD9)를 3일 동안 처리하였다. 오일-레드 O 염색으로 지질 축적을 확인하고 SA-β-gal 활성 염색을 수행하여 세포 노화를 확인하였다.
< 실시예 1> 노화된 혈관 조직 및 아테크롬성 동맥 경화 병변에서 CD9 발현 증가 확인
세포 노화는 노화 관련 질환과 연관있으며, 노화된 내피세포에서는 CD9 발현 수준이 증가되어 있다고 보고되어짐에 따라, 본 발명자들은 사람 또는 랫의 노화된 혈관 조직과 아테롬성 동맥 경화 병변에서 CD9 발현 정도를 확인하였다.
그 결과, 도 1A와 같이 나이가 증가할수록 사람 동맥에서 CD9 양성 면역염색 백분율이 증가하여 51-60 및 61-70세가 가장 높은 피크를 나타내었으며, 71-80 및 81-90세에서는 약간 감소하였다. 또한 도 1B를 참고하면 노화된 랫의 동맥 및 심장에서도 CD9 수준이 태어난지 5 달된 젊은 랫과 비교하여 증가된 것을 확인할 수 있었으며, 도 1C와 같이 사람 경동맥의 아테크롬성 동맥경화 병변에서도 CD9 면역반응이 증가된 것을 확인할 수 있었다.
도 1D 및 도 1E를 참고하면, 상기 결과와 같이 노화된 ApoE-/- 생쥐 및 LDLR-/-생쥐의 대동맥굴 부분의 아테크롬성 동맥경화 변변에서 CD9 면역반응 및 SA-β-gal 염색이 증가된 것을 확인할 수 있었다.
또한, 도 1F 및 도 1G와 같이 복제 노화 및 아드리아마이신에 의해 세포 노화가 유도된 인간 초대(primary) HUVECs 및 HDFs 세포에서도 CD9 발현 증가가 확인되었다.
상기 결과로부터 CD9은 세포 노화, 혈관 조직 노화 및 노화와 관련된 혈관 질환과 연관되어 있다고 제안될 수 있다.
<실시예 2> CD9 발현 억제에 따른 세포노화 회복 효과 확인
세포 노화에 있어서 CD9의 역할을 확인하기 위해, 노화된 HUVECs 및 HDFs (PD >50)세포에서 CD9 발현 억제(Knockdown)에 따른 영향을 확인하였다.
그 결과, 도 2A와 같이 노화된 세포에서 발현이 증가되며, 세포 노화를 조절하는 p53 및 p21 수준이 siRNA을 이용하여 CD9 발현이 억제된 노화세포에서 감소되었으며, 도 2B와 같이 CD9 발현 억제에 따라 SA-β-gal 염색이 감소되었다. 또한, 도 2C와 같이 세포 증식이 증가되었으며, 젊은 세포와 유사한 형태적 변화가 확인되었다(도 2B).
또한, 도 2D 및 도 2E를 참고하면 CD9 발현 억제에 따라 BrdU 함입이 증가하였으며, 세포 증식 마커로 알려진 Ki67의 면역활성도 증가되었다.
도 2F를 참고하면 CD9 발현 억제는 G0/G1기 세포 수를 감소시키고 S 및 G2/M 세포 수를 증가시켰으며, 이는 세포 노화의 전형적인 표현형인 G1기 정지가 해제된 것으로 제안될 수 있다.
in vitro에서 혈관 생성 인자의 노출에 따라 HUVECs는 관 구조를 형성하며, 노화된 세포에서는 HUVECs의 관 형성이 감소되는데 도 2G를 참고하면, CD9 발현 억제는 노화된 세포에서 관 형성을 회복시켰다.
상기 결과로부터 노화된 세포에서 CD9 발현 억제는 세포 노화를 유의하게 회복시키는 것을 확인할 수 있었다.
<실시예 3> CD9의 이소성 발현에 의한 세포노화 촉진 확인
재조합 인간 CD9 아데노바이러스를 이용하여 젊은 세포에 CD9을 과발현시키고 CD9 과발현된 젊은 세포에서 세포 노화가 유도되는지를 확인하였다.
그 결과 CD9 과발현은 도 3A와 같이 인산화된 Rb(phospho-Rb)의 수준을 감소시키고 p53, phospho-p53, p21, IL-6 및 IL-1β의 수준을 증가시켰으며, 도 3B와 같이 SA-β-gal 염색을 증가시켰으며, BrdU 함입(도 3C), Ki67 면역활성(도 3D) 및 S 단계 세포 수의 비율(도 3E)을 감소시켰다. 또한, CD9 아데노바이러스가 형질도입된 젊은세포의 경우 도 3B와 같이 세포 크기가 크고 납작한 형태를 나타내었으며, CD9 아데노바이러스가 형질도입된 HUVECs 세포에서는 도 4F와 같이 내피 관 형성이 억제되었다.
또한, 본 발명자들은 CD9 아데노바이러스를 도입하여 36일간 CD9 과발현시키고 세포 증식에 어떠한 효과를 나타내는지 확인하였다.
그 결과, 도 4G와 같이 CD9 과발현에 의해 세포수 증식수준이 점차 감소하여 24일 후에는 유의한 차이가 나타났다.
또한, 도 4H와 같이 p53, phospho-p53 및 p21 단백질 수준의 증가가 확인된 반면, CD9 과발현에도 phospho-ATM (pATM)의 수준은 변화가 나타나지 않았다.
상기 결과는 세포 노화기 동안 DNA 손상반응(DNA damage response; DDR) 증가에 따른 것으로 제안되며, 이를 확인하기 위해 CD9에 의해 유도된 세포 노화기 동안 DNA 손상 반응(DDR)이 발생하는지를 확인하였다.
먼저, DDR은 핵내 γH2AX가 양성 반응을 나타내는 군집의 발현과 관련있기 때문에 H2AX 히스톤 변형체의 인산화형인 γH2AX 수준을 확인하였다.
그 결과, 도 4I와 같이 CD9 아데노바이러스 세포에서는 γH2AX 군집의 증가가 나타나지 않았으며, 이는 아팝토시스가 CD9 아데노바이러스 세포의 세포 증식을 감소시키기 때문일 것으로 예상되었다. 이를 확인한 결과, 도 4J와 같이 아팝토시스 유도인자로 알려진 PARP 1/2 및 카스파제 3(caspase 3)의 절단이 확인되었다.
상기 결과로부터 CD9의 이소성(ectopic) 발현에 의해 젊은 세포에서 세포 노화가 촉진될 수 있음이 확인되었다.
<실시예 4> CD9이 유도하는 세포 노화에 작용하는 신호과정 확인
CD9이 유도하는 세포노화에 어떤 신호 과정이 영향을 미치는 지 확인하였다.
두 개의 종양 억제 신호과정인 p53/p21 및 Rb/p16은 세포 노화를 조절하는 것으로 알려짐에 따라, 도 5A와 같이 CD9 아데노바이러스로 형질도입된 세포에 p53 또는 p16 siRNA를 형질감염시켰다.
그 후 SA-β-gal 활성을 확인한 결과, 도 5B와 같이 CD9 과발현에 의해 증가되었던 SA-β-gal 활성이 p53 발현 억제된 세포에서는 감소하였으나, p16 발현 억제된 세포에서는 SA-β-gal 활성 감소가 나타나지 않았다.
상기 결과로부터 p53 신호과정이 CD9에 의해 유도되는 세포 노화를 조절하는 신호 과정일 것으로 제안될 수 있다.
또한, 활성화된 ATM 신호가 CD9에 의해 유도되는 세포 노화의 원인이 되는지 확인하기 위해, CD9 아데노바이러스로 형질도입된 세포에 ATM siRNA를 형질감염시키고 CD9에 의해 유도되는 세포노화를 확인하였다.
그 결과, 도 5C 및 도 5D와 같이 ATM 발현이 억제된 세포에서 SA-β-gal 활성 감소가 나타나지 않았다.
상기 결과로부터 DNA 손상 반응(DDR)은 CD9에 의해 유도되는 노화와 관계가 없음이 확인되었다.
p53에 의해 유도되는 노화에 있어서 PI3K/AKT 신호과정의 활성화는 중요한 역할을 하며, CD9은 혈관 평활근 세포의 PI3K/AKT 신호과정을 조절하는 것으로 알려져있다. 또한, mTOR(Mammalian target of rapamycin)은 PI3K/AKT 신호과정의 후속 분자로 번역(translation) 및 세포 증식과 관련있다.
따라서, CD9에 의해 유도되는 노화에 있어서, PI3K/AKT-mTOR 신호과정의 영향을 확인하였다.
그 결과, 도 5E 및 도 5F와 같이 PI3K 특이적 억제제 LY294002 또는 mTOR 억제제 라파마이신이 사전에 처리된 세포에서 p53과 p21의 수준 및 SA-β-gal 활성의 감소가 확인되었다.
또한, 발현 억제 실험을 통하여 CD9에 의해 유도되는 노화에 있어서, PIK3CA 110α, PIK3CB 110β 및 두 개의 PI3K 촉매소단위가 어떤 역할을 하는 지 확인하였다.
PIK3CA 및 PIK3CB의 발현 억제를 수행한 결과, 도 5G 및 도 5H와 같이 PIK3CA 발현 억제와 다르게 PIK3CB가 발현 억제된 세포에서는 SA-β-gal 활성 및 phospho-AKT (pAKT), p53, phospho-p53, phospho-S6K (pS6K) 및 p21 단백질의 수준이 감소하였다.
상기 결과로부터 PIK3CA가 CD9에 의해 유도되는 노화에 영향을 주는 것이 확인되었으며, 이를 통하여 도 5I와 같은 PI3K-AKT-mTOR-p53 신호과정이 CD9이 유도하는 세포 노화를 조절하는 신호과정임을 확인할 수 있었다.
<실시예 5> CD9에 의해 유도되는 세포 노화에 대한 사람 단일클론 항체 효과확인
CD9이 발현 억제된 노화 세포에서 세포 노화가 유의하게 회복되는 것을 확인함에 따라, CD9 중화 항체를 이용한 CD9 억제가 세포 노화 및 노화와 관련된 혈관 질환을 극복할 수 있는지 확인하였다.
실험예 14와 같이 파지 발현기술(phage display technology)을 이용하여 사람 CD9에 대한 전체 사람 단일클론 항체를 제작하고, 클론 10E4이 사람 CD9의 거대 세포외 영역 내 항원결정부위(epitope)인 KEVFDN와 결합하는지를 확인하였다.
면역 형광 염색 및 유세포 분석을 수행한 결과, 도 6A 및 도 6B와 같이 10E4은 노화된 세포내 CD9과 결합하는 것을 확인할 수 있었다. 또한, 도 6C 및 도 6D와 같이 10E4가 처리된 노화세포에서는 SA-β-gal 활성 및 p53와 p21의 수준이 감소되는 것을 확인할 수 있었으며, 그 결과 도 6E와 같이 세포 증식이 증가된 것을 확인할 수 있었다.
상기 결과로부터 10E4의 세포노화 억제 효과는 세포노화 억제제로 알려진 N-아세틸시스테인(N-acetylcysteine) 및 라파마이신과 유사한 것을 확인할 수 있었다.
oxLDL은 내피 세포 및 대식세포에 침투하여 아테크롬 동맥경화 병변내 거품 세포 형성을 촉진시키고 내피 세포의 조기 노화를 유도하는 잠재적인 염증 분자로 CD9은 대식세포내 CD36에 의해 유도되는 oxLDL 흡수를 증가시킨다.
따라서, oxLDL에 의해 유도되는 세포 노화에 대한 10E4의 효과를 확인하기 위해, oxLDL이 처리된 젊은 HUVECs 세포 및 노화 HUVECs 세포에 10E4를 처리하였다.
그 결과, 10E4은 도 7A 및 도 7B와 같이 젊은 HUVECs 세포 및 노화 HUVECs 세포의 SA-β-gal 활성을 억제시켰으며, 도 7C와 같이 상기 두 세포에서 oxLDL의 지질 흡수가 억제되었으며, 도 7D와 같이 oxLDL에 의한 세포 증식 감소가 유의하게 회복되었다. 또한, 도 7E를 참고하면 젊은 세포에서 p53 및 p21의 수준이 감소된 것을 확인할 수 있었다.
상기 결과로부터 10E4의 항-노화 효과를 확인할 수 있었으며, 10E4은 효과적인 세포 노화 치료제로 사용될 수 있음이 확인되었다.
<실시예 6> 생쥐 CD9에 대한 랫 단일클론 항체의 아테크롬 동맥 경화성 플라크 형성 억제 효과 확인
생쥐 CD9에 대한 중화 항체가 혈장 리포단백질의 손상된 제거능에 의해 형성되는 ApoE-/- 생쥐의 아테크롬 동맥 경화 병변을 억제할 수 있는지 확인하였다.
10E4는 생쥐 CD9과 교차반응하지 않기 때문에 생쥐 내피 세포주(MS-1) 및 대식세포 세포 주(Raw264.7)를 이용하여 세포 노화 및 아테크롬성 동맥 경화 병변의 형성에 관여하는 생쥐 CD9(αrCD9)에 대하여 랫 단일클론 항체의 효과를 확인하였다.
그 결과, 도 8F 내지 도 8H와 같이 αrCD9는 MS-1 및 Raw264.7 세포에서 SA-β-gal 활성과 oxLDL에 의해 유도되는 지질 흡수을 억제하였다. 또한, 아테크롬성 동맥 경화 병변에 미치는 αrCD9의 영향을 확인하기 위해, ApoE-/- 생쥐 복강내에 αrCD9 또는 rIgG를 100 μg씩 3.5일간 매일 주사하고 15 주동안 고지방 식이를 섭취시켰다.
그 결과, 도 9B와 같이 rIgG 그룹과 αrCD9 그룹이 섭취한 식이량의 유의한 차이는 없었으나, 도 9A와 같이 rIgG 그룹보다 αrCD9 그룹의 몸무게가 더 적게 나타났으며, 도 9C와 같이 총 콜레스테롤 및 LDL 콜레스테롤의 수준 역시 rIgG 그룹보다 αrCD9 그룹이 낮게 나타났다.
또한, 도 9D 및 도 9E를 참고하면 αrCD9은 얼굴 대동맥의 SA-β-gal 활성 및 아테크롬 동맥 경화성 플라크 부분을 감소시켰을 뿐만 아니라 대동맥굴에서 SA-β-gal 활성 및 아테크롬 동맥 경화 병변의 양을 감소시키는 효과를 나타내었다.
상기 결과로부터 CD9 항체는 아테크롬 동맥 경화성 병변을 억제하고 치료하는데 효과적으로 사용될 수 있음이 확인되었다.

Claims (13)

  1. CD9을 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 바이오마커 조성물.
  2. CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물.
  3. 청구항 2에 있어서, 상기 항체는 서열번호 1로 표시된 아미노산 내지 서열번호 12로 표시된 아미노산에서 선택된 하나 이상인 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물.
  4. 청구항 2에 있어서, 상기 세포노화는 혈관내피세포 또는 섬유아세포의 노화 또는 복제 노화인 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물.
  5. 청구항 4에 있어서, 상기 혈관내피세포 또는 섬유아세포의 노화는 아드리아마이신에 의해 유도되는 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물.
  6. 청구항 2에 있어서, 상기 노화 관련 질환은 죽상경화, 피부노화, 골다공증, 류마티스 및 퇴생성 골관절염으로 이루어진 군에서 선택될 수 있는 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물.
  7. CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물.
  8. 청구항 7에 있어서, 상기 항체는 서열번호 1로 표시된 아미노산 내지 서열번호 12로 표시된 아미노산에서 선택된 하나 이상인 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물.
  9. 청구항 7에 있어서, 상기 세포노화는 혈관내피세포 또는 섬유아세포의 노화 또는 복제 노화인 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물.
  10. 청구항 9에 있어서, 상기 혈관내피세포 또는 섬유아세포의 노화는 아드리아마이신에 의해 유도되는 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물.
  11. 청구항 7에 있어서, 상기 노화 관련 질환은 죽상경화, 피부노화, 골다공증, 류마티스 및 퇴행성 골관절염으로 이루어진 군에서 선택될 수 있는 것을 특징으로 하는 세포노화 또는 노화 관련 질환 예방 또는 개선용 건강식품조성물.
  12. CD9 발현을 억제하는 후보약물을 선별하는 단계를 포함하는 것을 특징으로 하는 노화 관련 질환 치료제 스크리닝 방법.
  13. 청구항 12항에 있어서, 상기 노화 관련 질환은 죽상경화, 피부노화, 골다공증, 류마티스 및 퇴행성 골관절염으로 이루어진 군에서 선택될 수 있는 것을 특징으로 하는 노화 관련 질환 치료제 스크리닝 방법.
PCT/KR2015/008087 2014-08-04 2015-08-03 Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물 WO2016021894A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20140099872 2014-08-04
KR10-2014-0099872 2014-08-04
KR1020150093429A KR101834615B1 (ko) 2014-08-04 2015-06-30 Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물
KR10-2015-0093429 2015-06-30

Publications (1)

Publication Number Publication Date
WO2016021894A1 true WO2016021894A1 (ko) 2016-02-11

Family

ID=55264103

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/008087 WO2016021894A1 (ko) 2014-08-04 2015-08-03 Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물

Country Status (1)

Country Link
WO (1) WO2016021894A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020213982A1 (ko) * 2019-04-18 2020-10-22 황정후 Cd9을 이용한 퇴행성 신경질환의 예방 또는 치료용 조성물과 퇴행성 신경질환 치료제 스크리닝 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140073526A1 (en) * 2012-09-10 2014-03-13 Nestec Sa Immune function biomarkers
KR20140033431A (ko) * 2011-05-18 2014-03-18 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 망막 질환을 치료하기 위한 조성물 및 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140033431A (ko) * 2011-05-18 2014-03-18 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 망막 질환을 치료하기 위한 조성물 및 방법
US20140073526A1 (en) * 2012-09-10 2014-03-13 Nestec Sa Immune function biomarkers

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KIM ET AL.: "Identification of replicative senescence-associated genes in human umbilical vein endothelial cells by an annealing control primer system", EXPERIMENTAL GERONTOLOGY, vol. 43, no. 4, 2008, pages 286 - 295, XP022523981, DOI: doi:10.1016/j.exger.2007.12.010 *
KWON ET AL.: "Expression of CD 9 and CD 82 in clear cell renal cell carcinoma and its clinical significance", PATHOLOGY-RESEARCH AND PRACTICE, vol. 210, no. 5, May 2014 (2014-05-01), pages 285 - 290, XP028842141, DOI: doi:10.1016/j.prp.2014.01.004 *
NISHIDA ET AL.: "Localization of CD 9, an enhancer protein for proheparin-binding epidermal growth factor-like growth factor, in human atherosclerotic plaques possible involvement of juxtacrine growth mechanism on smooth muscle cell proliferation", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY, vol. 20, no. 5, 2000, pages 1236 - 1243 *
PAUL ET AL.: "Aging results in molecular changes in an enriched population of undifferentiated rat spermatogonia", BIOLOGY OF REPRODUCTION, 2013, pages 1 - 14 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020213982A1 (ko) * 2019-04-18 2020-10-22 황정후 Cd9을 이용한 퇴행성 신경질환의 예방 또는 치료용 조성물과 퇴행성 신경질환 치료제 스크리닝 방법

Similar Documents

Publication Publication Date Title
JP6251234B2 (ja) Ｇｉ症候群及び移植片対宿主病を治療及び予防する方法
JP2019104754A (ja) アネキシン−１（リポコルチン１）をモジュレートすることによる自己免疫疾患の処置方法
US20120128697A1 (en) NOTCH Inhibition in the Treatment or Prevention of Atherosclerosis
WO2010087594A9 (ko) 시디９３ 또는 이의 가용성 단편의 용도
CN114133450B (zh) 抗-Rho GTPase的构象单域抗体及其用途
US20160347844A1 (en) AGENTS THAT MODULATE RGMb-NEOGENIN-BMP SIGNALING AND METHODS OF USE THEREOF
US10894082B2 (en) Anti-S100A8 for treating leukemia
WO2009059425A1 (en) Stat3 inhibitors for the treatment of fibrosis
CA2347734A1 (en) Methods and products for regulating lectin complement pathway associated complement activation
WO2019039700A1 (ko) 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물
WO2017146538A1 (ko) 조절 t 세포 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
WO2021158091A2 (ko) 케모카인 억제제, 콜로니 자극 인자 억제제 및 면역항암제를 포함하는 암의 예방 또는 치료용 조성물 및 병용 요법
WO2021177518A1 (ko) 혈중 콜레스테롤 저하용, 심혈관 대사질환의 예방 또는 치료용 및 항염용 약학적 조성물
WO2016021894A1 (ko) Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물
US20240158861A1 (en) Methods and compositions for treating cell senescence accumulation related disease
WO2022137964A1 (ja) 軟骨・骨・関節疾患の予防または治療用医薬組成物および軟骨・骨・関節疾患の予防または治療用薬剤のスクリーニング方法
WO2010021516A9 (ko) 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도
WO2023022271A1 (ko) 항-igsf1 항체 및 이의 용도
WO2021187911A1 (ko) 제대혈 혈장 유래의 엑소좀 또는 이의 모방체 및 이의 약학적 용도
KR101834615B1 (ko) Ｃｄ９ 항체를 유효성분으로 함유하는 세포노화 또는 노화 관련 질환 예방 또는 치료용 약학조성물
WO2019245269A1 (ko) Flt3 억제제를 유효성분으로 포함하는 만성 골수성 백혈병 약물 내성 억제용 조성물
KR101803224B1 (ko) 매트릭스 gla 단백질을 유효성분으로 함유하는 미오스타틴 활성 저해용 조성물
WO2024025264A1 (en) Method for treating cancer and inflammatory diseases using stem cell- derived extracellular vesicles comprising sirp
JPWO2010018764A1 (ja) 血管新生制御剤，及びそのスクリーニング方法，並びにスクリーニング用キット

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15830307

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15830307

Country of ref document: EP

Kind code of ref document: A1