WO2021246755A1 - 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물 - Google Patents

포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물 Download PDF

Info

Publication number
WO2021246755A1
WO2021246755A1 PCT/KR2021/006807 KR2021006807W WO2021246755A1 WO 2021246755 A1 WO2021246755 A1 WO 2021246755A1 KR 2021006807 W KR2021006807 W KR 2021006807W WO 2021246755 A1 WO2021246755 A1 WO 2021246755A1
Authority
WO
WIPO (PCT)
Prior art keywords
phospholipase
pld2
diabetes
mice
group
Prior art date
Application number
PCT/KR2021/006807
Other languages
English (en)
French (fr)
Inventor
배외식
김형식
박민영
Original Assignee
성균관대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 성균관대학교산학협력단 filed Critical 성균관대학교산학협력단
Publication of WO2021246755A1 publication Critical patent/WO2021246755A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/438—The ring being spiro-condensed with carbocyclic or heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to a technology for developing a composition for preventing, improving or treating a metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance, which targets phospholipase D2 (Phospholipase D2, PLD2).
  • a metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance, which targets phospholipase D2 (Phospholipase D2, PLD2).
  • Non-Patent Document 1 brown adipose tissue (BAT) is activated by adrenergic stimulation (Non-Patent Document 4), and decomposes lipids to generate heat to protect against hypothermia (Non-Patent Documents 5 and 6) .
  • Non-Patent Document 7 a mitochondrial protein that separates electron transport from ATP production.
  • Cell types known as “beige” or “brite” adipocytes can be recruited to be thermogenically activated through a process called “browning” (Non-Patent Document 8).
  • mice In mice, these cells are mainly located in subcutaneous white adipose tissue (scWAT) (Non-Patent Document 9), and UCP1-dependent (Non-Patent Document 10) or -Independent means (Non-Patent Document 11) through fever possess the ability
  • scWAT subcutaneous white adipose tissue
  • Non-Patent Document 10 UCP1-dependent (Non-Patent Document 10) or -Independent means
  • adrenergic activation-induced brown and beige adipocytes also referred to as thermogenic adipocytes
  • exhibit a protective effect against metabolic diseases Non-Patent Document 12).
  • Non-Patent Document 13 pharmacological targets of adrenergic receptors have shown limited clinical efficacy due to excessive thermogenesis (Non-Patent Document 13) and microvascular disease (Non-Patent Document 14) after chronic administration of the drug (Non-Patent Document 15). Therefore, there is a need for a new treatment strategy that activates brown and beige adipocytes that can overcome the limitations of existing drugs for managing obesity.
  • BAT thermogenesis is mainly controlled by the sympathetic nervous system (SNS) (Non-Patent Document 16), and can be stimulated by low temperature exposure (Non-Patent Document 17) or pharmacological administration of adrenergic receptor agonists (Non-Patent Document).
  • SNS sympathetic nervous system
  • Non-Patent Document 17 pharmacological administration of adrenergic receptor agonists
  • literature 18 Low temperature or adrenergic activation improves energy consumption by inducing activation of AMPK (AMP-activated protein kinase), a cellular sensor of energy homeostasis (Non-Patent Document 19).
  • AMPK AMP-activated protein kinase
  • Non-Patent Document 20 Since obesity and insulin resistance are related to decreased AMPK activity in adipose tissue (Non-Patent Document 20), AMPK activation by low temperature or ⁇ -adrenergic receptor ( ⁇ -AR) stimulation is implicated in UCP1 upregulation. It causes an increase in insulin sensitivity mediated by and a beneficial effect on obesity (Non-Patent Document 21). Various stimuli that enhance brown adipogenesis are also mediated by activation of AMPK (Non-Patent Document 22).
  • Ppargc1a encoding PGC1- ⁇ , acetyl-CoA carboxylase ( ACC) is regulated by the regulation of several target genes, including Acaca and Acacb (Non-Patent Document 24) encoding (Non-Patent Document 25).
  • AMPK mediates important events in response to cold or ⁇ -AR signals to regulate thermogenesis in adipose tissue, the events upstream of AMPK activation that detect cold or ⁇ -AR signals have yet to be elucidated. It has been an important issue to detect cold or ⁇ -AR signaling stress and to identify molecules that mediate exothermic programming in adipose tissue.
  • the present inventors confirmed that it is possible to prevent and treat metabolic diseases such as obesity, diabetes and insulin resistance through inhibition of phospholipase D2, thereby completing the present invention.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating a metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance.
  • Another object of the present invention is to provide a health functional food composition for preventing or improving the metabolic disease.
  • Another object of the present invention is to provide a screening method for a substance for the prevention or treatment of the metabolic disease.
  • the present invention comprises an agent that inhibits phospholipase D2 gene expression or protein activity as an active ingredient, preventing or preventing metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance
  • an agent that inhibits phospholipase D2 gene expression or protein activity as an active ingredient, preventing or preventing metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance
  • a therapeutic pharmaceutical composition is provided.
  • the present invention provides a method for preventing or treating the metabolic disease comprising administering the composition to an individual in need thereof.
  • the present invention provides a health functional food composition for preventing or improving the metabolic disease comprising an agent that inhibits phospholipase D2 gene expression or protein activity as an active ingredient.
  • the present invention provides a preventive, ameliorating or therapeutic use of the composition for the above metabolic disease.
  • the present invention provides the use of the composition for the preparation of a preparation for the prevention or treatment of the metabolic disease.
  • the agent for inhibiting the expression of the phospholipase D2 gene is miRNA, siRNA, shRNA, ribozyme, DNAzyme, PNA (peptide nucleic acid) complementary to the mRNA of the gene acid) and antisense oligonucleotides, but is not limited thereto.
  • the agent for inhibiting the activity of the phospholipase D2 protein may be selected from the group consisting of antibodies, aptamers, peptides and compounds that bind to phospholipase D2 protein, but is limited thereto it is not
  • the compound is CAY10594(N-[2-(4-oxo-1-phenyl-1,3,8-triazaspiro[4,5]dec-8-yl)ethyl]- 2-naphthalene carboxamide) or a pharmaceutically acceptable salt thereof, but is not limited thereto.
  • the diabetes may be type 2 diabetes, but is not limited thereto.
  • the diabetes may be obese diabetes, but is not limited thereto.
  • the agent for inhibiting the expression or protein activity of the phospholipase D2 gene may improve the adipose tissue thermogenic program, but is not limited thereto.
  • the present invention provides the steps of (a) contacting a candidate material to an isolated cell or tissue, and (b) measuring the level of phospholipase D2 protein or mRNA level of a gene encoding the protein in the cell or tissue. It provides a screening method for a substance for preventing or treating a metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance, including.
  • the isolated cells or tissues may be adipose cells or adipose tissue, but is not limited thereto.
  • the The candidate substance when the level of the phospholipase D2 protein or the mRNA level of the gene encoding the protein in the cell or tissue contacted with the candidate substance is reduced compared to the level before contact with the candidate substance, the The candidate substance may be determined as a substance for preventing or treating the metabolic disease, but is not limited thereto.
  • the phospholipase D2 inhibitor can significantly reduce fat accumulation in adipocytes constituting adipose tissue by activating the adipose tissue thermogenesis program, and can qualitatively and quantitatively improve the mitochondria of adipocytes.
  • the phospholipase D2 inhibitor can effectively alleviate fatty liver and type 2 diabetes induced by a high-fat diet. Accordingly, the present invention is expected to be usefully used as a therapeutic agent for metabolic diseases such as obesity, diabetes, and insulin resistance.
  • FIG. 1A to 1E are diagrams showing that PLD2 is specifically induced in ingWAT and BAT during obesity.
  • NCD normal chow diet
  • HFD high fat diet
  • FIGS. 2A to 2f are diagrams showing that the degradation of PLD2 in ingWAT and BAT is induced by ⁇ -AR activation.
  • FIG. 2A Schematic of an experiment to test the effect of sympathetic nervous system stimulation on PLD2 levels. C57BL/6 mice were treated at 4°C for 1 week, or 1 mg/kg of CL, a ⁇ 3-AR agonist, was injected for 7 consecutive days.
  • FIG. 2D Representative Western blot images of PLD2 and ⁇ -actin in primary brown adipocytes treated with ⁇ -AR agonists (isoprenaline 1 ⁇ M or CL 10 ⁇ M) at the indicated times.
  • FIG. 2E Representative Western blot images of PLD2 and ⁇ -actin in primary brown adipocytes treated with isoprenaline (1 ⁇ M) or SR59230A (1 ⁇ M).
  • FIG. 2F Representative Western blot images of PLD2 and ⁇ -actin in primary brown adipocytes treated with isoprenaline (1 ⁇ M), bortezomib (20 nM) or chloroquine (10 ⁇ M). Data are presented as mean ⁇ SEM. By two-tailed Student's t test, *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 (Fig. 2b right and 2c).
  • FIG. 3A to 3G are diagrams showing that adipocyte-specific PLD2 deletion activates a fever program in pyrogenic adipose tissue.
  • FIG. 3A Generation of Pld2 Ad-KO mice.
  • FIG. 3B Representative Western blot images of PLD2 and ⁇ -actin in liver and various adipose tissue depots into control and Pld2 Ad-KO mice.
  • FIGS. 4A to 4M are diagrams showing resistance of Pld2 Ad-KO mice to HFD-induced obesity and type 2 diabetes.
  • FIGS. 4F and 4G Representative Western blot images of pAKT(S473), AKT, pGsk3 ⁇ and Gsk3 ⁇ in liver samples from epiWAT.
  • FIG. 4L Representative Western blot images of pAKT(S473), AKT, pGsk3 ⁇ and Gsk3 ⁇ in liver samples from epiWAT.
  • FIG. 5a to 5i are diagrams showing that inhibition of PLD2 in HFD-induced obese mice improves obesity and type 2 diabetes.
  • FIG. 5a Schematic diagram of an experiment to investigate the therapeutic effect of CAY10594 in obese mice.
  • FIG. 5f Representative images of H&E staining of various adipose tissues. Scale bar, 25 ⁇ m.
  • FIG. 6A to 6K are diagrams showing that inhibition of PLD2 regulates mitochondrial quality through AMPK and p62 in cultured brown adipocytes.
  • FIG. 6B Representative Western blot images of pAMPK (T172), AMPK ⁇ , pACC (S79), ACC, UCP1 and ⁇ -actin in vehicle or CAY10594 (10 ⁇ M) treated primary brown adipocytes.
  • FIG. 6B Representative Western blot images of pAMPK (T172), AMPK ⁇ , pACC (S79), ACC, UCP1 and ⁇ -actin in vehicle or CAY10594 (10 ⁇ M) treated primary brown adipocytes.
  • FIG. 6C Representative Western blot images of pLKB1 (S428), LKB1, pAMPK (T172), AMPK ⁇ and ⁇ -actin in CAY10594 (10 ⁇ M)-treated primary brown adipocytes at the indicated time points.
  • FIG. 6D Representative Western blot images of pAMPK(T172), AMPK ⁇ , LKB1 and ⁇ -actin in primary brown adipocytes transfected with control siRNA or siLKB1.
  • FIG. 6E Representative Western blot images of pLKB1 (S428), LKB1, pAMPK (T172), AMPK ⁇ , p62, UCP1 and ⁇ -actin in vehicle or CAY10594 (10 ⁇ M) treated human primary white adipocytes.
  • FIG. 6f p62 and ⁇ -actin (top) and p62 mRNA expression (bottom) in primary brown adipocytes treated with isoprenaline (1 ⁇ M), CL (10 ⁇ M) or CAY10594 (10 ⁇ M) at the indicated time points
  • FIG. 6f Representative western blot images of (Fig.
  • FIG. 6g Differentiated primary brown adipocytes were treated with CAY10594 (10 ⁇ M) at the indicated times, anti-p62 (red), anti-Tom20 (green) and DAPI (4',6-diamidino-2-phenylindole) ) (blue). Scale bar, 10 ⁇ m.
  • FIG. 6i Representative Western blot images of p62, LC3 and ⁇ -actin in CAY10594 (10 ⁇ M)-treated primary brown adipocytes at the indicated time points.
  • FIG. 6J Representative Western blot images of pDRP1 (S616, S637), DRP1, FIS1 and ⁇ -actin in CAY10594 (10 ⁇ M) or CCCP (20 ⁇ M)-treated primary brown adipocytes at the indicated time points.
  • FIG. 6K Representative Western blot images of mitochondrial complex components in primary brown adipocytes treated with CAY10594 (10 ⁇ M) at the indicated time points. Data are presented as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 by two-way ANOVA (Fig. 6a left) or two-tailed Student's t test (Fig. 6a right, 6e bottom and 6h right).
  • FIG. 7A to 7D are diagrams showing that PLD2 inhibition regulates mitochondrial quality through AMPK and p62 in cultured brown adipocytes.
  • FIG. 7A Representative Western blot images of pLKB1 (S428), LKB1, pAMPK (T172), AMPK ⁇ , p62, UCP1 and ⁇ -actin in ingWAT and BAT of HFD- induced control and Pld2 Ad-KO mice.
  • FIG. 7A Representative Western blot images of pLKB1 (S428), LKB1, pAMPK (T172), AMPK ⁇ , p62, UCP1 and ⁇ -actin in ingWAT and BAT of HFD- induced control and Pld2 Ad-KO mice.
  • FIG. 7C Representative Western blot images of pLKB1 (S428), LKB1, pAMPK (T172), AMPK ⁇ , p62, UCP1 and ⁇ -actin in ingWAT and BAT of obese WT mice injected with vehicle or CAY10594.
  • FIG. 8A and 8B are diagrams showing that PLD2 regulates mitochondrial quality through AMPK and p62 in cultured brown adipocytes.
  • FIG. 8B Representative Western blot images of pLKB1 (S428), LKB1, pAMPK (T172), AMPK ⁇ , p62, UCP1 and ⁇ -actin in primary brown adipocytes of control and Pld2 Ad-KO mice. Data are presented as mean ⁇ SEM. By two-tailed Student's t test, *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 (Fig. 8a right).
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases selected from the group consisting of obesity, diabetes and insulin resistance, comprising as an active ingredient an agent that inhibits phospholipase D2 gene expression or protein activity provides
  • the present invention provides a method for preventing or treating a metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance, comprising administering the composition to an individual in need thereof.
  • PLD2 phospholipase D2
  • PA phosphatidic acid
  • choline choline
  • the agent for inhibiting the expression of the phospholipase D2 gene is miRNA, siRNA, shRNA, ribozyme, DNAzyme, PNA (peptide nucleic acid) and antisense complementary to the mRNA of the gene It may be selected from the group consisting of oligonucleotides.
  • miRNA, siRNA, and shRNA refer to nucleic acid molecules that bind to mRNA transcribed from a target gene mainly to mediate RNA interference or gene silencing, thereby inhibiting the translation of the mRNA. do. Since the miRNA, siRNA and shRNA can inhibit the expression of a target gene at a translational level, they can be used in an efficient gene knockdown method or gene therapy method.
  • ribozyme is a catalytic RNA molecule capable of degrading a nucleic acid molecule having a sequence that is completely or partially homologous to the sequence of a ribozyme.
  • a ribozyme transgene encoding an RNA ribozyme that specifically pairs with a target RNA and functionally inactivates the target RNA by degrading the phosphodiester backbone at a specific position can be designed. In carrying out this degradation, the ribozyme itself does not change and thus can be recycled to degrade other molecules.
  • the ribozyme may be directly targeted to a cell in the form of an RNA oligonucleotide incorporating a ribozyme sequence, or may be introduced into a cell as an expression vector encoding a desired ribozyme RNA. Ribozymes can be used and applied in substantially the same manner as described for antisense oligonucleotides.
  • DNAzyme is a catalytic DNA molecule that cleaves single-stranded RNA, is highly selective for a target RNA sequence, and thus can be used to down-regulate a specific gene by targeting messenger RNA.
  • PNA Peptide Nucleic Acid
  • DNA has a phosphate-ribose sugar backbone
  • PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases binding strength and stability to DNA or RNA, resulting in molecular biology , diagnostic assays and antisense therapy.
  • PNA is described in Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thyminesubstituted polyamide". Science 254 (5037): 1497-1500.
  • antisense oligonucleotide refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a specific mRNA sequence, which binds to a complementary sequence in the mRNA to convert the mRNA into a protein. It may exhibit the effect of inhibiting translation.
  • the agent for inhibiting the activity of the phospholipase D2 protein may be selected from the group consisting of antibodies, aptamers, peptides and compounds that bind to phospholipase D2 protein.
  • the term "antibody” refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule.
  • the form of the antibody is not particularly limited, and a part thereof is included in the antibody of the present invention as long as it has polyclonal antibody, monoclonal antibody or antigen-binding property, and all immunoglobulin antibodies may be included as well as humanized antibody It may contain special antibodies, such as
  • the antibody includes functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains.
  • a functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab') 2 and Fv.
  • aptamer refers to a single-stranded oligonucleotide having a size of about 20 to 60 nucleotides, and has a stable tertiary structure by itself and can bind to a target molecule with high affinity and specificity. It refers to a type of polynucleotide composed of single-stranded nucleic acids (DNA, RNA, or modified nucleic acids) with the characteristic characteristic.
  • the aptamer can use various substances such as polynucleotides, polypeptides, compounds, and polymers as target molecules, has superior stability than proteins, has a simple structure and is composed of nucleic acids and is easy to synthesize, so it detects various target molecules is used in how to do it.
  • the aptamer may inhibit the activity of a predetermined target molecule by binding to the predetermined target molecule.
  • the aptamer may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may also be in a linear or cyclic form.
  • the compound is CAY10594 (N-[2-(4-oxo-1-phenyl-1,3,8-triazaspiro[4,5]dec-8-yl)ethyl]-2 of the formula 1 -naphthalene carboxamide) or a pharmaceutically acceptable salt thereof.
  • the term "pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like.
  • Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an aqueous solution of an excess of acid, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating an equimolar amount of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or by suction filtration of the precipitated salt.
  • a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium.
  • the alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate.
  • the metal salt it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).
  • the diabetes may be type 2 diabetes or obese diabetes.
  • the agent for inhibiting the expression or protein activity of the phospholipase D2 gene can improve the adipose tissue thermogenic program (Thermogenic program).
  • the agent inhibiting the expression or protein activity of the phospholipase D2 gene can qualitatively or quantitatively improve the mitochondria of adipocytes.
  • the expression of PLD2 was remarkably increased in the adipose tissue (subcutaneous fat and brown fat) involved in thermogenesis in normal and obese mice fed the low-calorie diet and the high-calorie diet, respectively ( 1), in order to create an environment opposite to obesity, when the group in which mice were placed in a cold place and the group injected with a substance that activates beta-adrenergic receptors were compared with the control group, PLD2 protein was found in subcutaneous fat and brown fat. It was confirmed that it was significantly reduced (see FIG. 2). These results suggest that beta-adrenergic receptor activation induces the disappearance of PLD2, thereby triggering the thermogenesis program.
  • mice from which PLD2 was removed had a higher thermogenesis ability than the control mice, and that the white adipose tissue accumulating fat was converted into brown adipose tissue capable of generating thermogenesis. (See Fig. 3).
  • AMPK which is an important molecule for regulating bioenergy metabolism
  • LKB1 which is important for activating AMPK
  • LKB1 which is important for thermogenesis
  • the content of the active ingredient in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50, based on the total weight of the composition It may be a weight %, but is not limited thereto.
  • the content ratio is a value based on the dry amount from which the solvent is removed.
  • the pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions.
  • the excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.
  • the pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade.
  • tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • formulation it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • water diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc.
  • water diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone,
  • sucrose solution other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.
  • Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.
  • the suspending agent according to the present invention includes a suspending agent such as acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC) 1828, HPMC 2906, HPMC 2910, etc. may be used, and if necessary, surfactants, preservatives, stabilizers, colorants, and fragrances may be used.
  • a suspending agent such as acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC) 1828, HPMC 2906, HPMC 2910, etc.
  • HPMC hydroxypropylmethylcellulose
  • surfactants preservatives, stabilizers, colorants, and fragrances may be used.
  • the injection according to the present invention includes distilled water for injection, 0.9% sodium chloride injection, Ringel injection, dextrose injection, dextrose + sodium chloride injection, PEG (PEG), lactated Ringel injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such as albumin, peptone and
  • the suppository according to the present invention includes cacao fat, lanolin, witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neos
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ( It is prepared by mixing sucrose), lactose, or gelatin.
  • excipients for example, starch, calcium carbonate, sucrose ( It is prepared by mixing sucrose), lactose, or gelatin.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.
  • the pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.
  • “individual” means a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cattle, etc. means the mammals of
  • administration means providing a given composition of the present invention to a subject by any suitable method.
  • prevention means any action that inhibits or delays the onset of a desired disease
  • treatment means that the desired disease and metabolic abnormalities are improved or It means all actions that are advantageously changed
  • improvement means all actions that reduce the parameters related to the desired disease, for example, the degree of symptoms by administration of the composition according to the present invention.
  • the present invention comprises an agent (phospholipase D2 inhibitor) that inhibits the expression or protein activity of a phospholipase D2 gene as an active ingredient, from the group consisting of obesity, diabetes and insulin resistance. It provides a health functional food composition for preventing or improving selected metabolic diseases.
  • an agent phospholipase D2 inhibitor
  • the inhibitor When the phospholipase D2 inhibitor of the present invention is used as a food additive, the inhibitor may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the inhibitor may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material. However, in the case of long-term intake for health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.
  • Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in the ordinary sense.
  • the health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage.
  • the above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.
  • natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.
  • the proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.
  • the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, Carbonating agents used in carbonated beverages, etc. may be contained.
  • the composition of the present invention may contain the pulp for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.
  • the present invention provides the steps of (a) contacting an isolated cell or tissue with a candidate substance, and (b) the level of phospholipase D2 protein or a gene encoding the protein in the cell or tissue. It provides a screening method for a substance for preventing or treating a metabolic disease selected from the group consisting of obesity, diabetes and insulin resistance, comprising the step of measuring the mRNA level.
  • the isolated cells or tissues may be adipose cells or adipose tissue.
  • the candidate substance when the level of the phospholipase D2 protein or the mRNA level of the gene encoding the protein in the cell or tissue contacted with the candidate substance is reduced compared to the level before contact with the candidate substance, the candidate substance is said It can be determined as a substance for the prevention or treatment of metabolic diseases.
  • RT-PCR reverse transcription polymerase reaction
  • Competitive RT-PCR competitive reverse transcription polymerase reaction
  • Realtime RT-PCR realtime reverse transcription polymerase reaction
  • RNase protection assay RNase protection assay
  • Northern blotting and DNA chips.
  • Methods for measuring the level of the protein include Western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion method, rocket ) immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (FACS), and protein chip, but are not limited thereto.
  • mice All experiments involving mice were performed with the approval of the institutional review committee on animal care and use of Sungkyunkwan University. All experiments used male C57BL/6 mice. C57BL/6 mice were purchased from DBL, and adiponectin-Cre mice (AdipoQ-cre) were provided from HI Kim (KAIST, Daejeon, Korea). Pld2 flox/flox mice were generated as previously reported (Ghim J., et al, 2014, Arterioscler Thromb Vasc Biol). Pld2 flox/flox mice were crossed with AdipoQ-cre knock-in mice to generate Pld2 flox/flox AdipoQ-cre mice. For the obese mouse model, 8-week-old mice were fed NCD (10% fat as kcal, Research Diets) or HFD (60% fat as kcal, Research Diets) for 10 or 12 weeks.
  • NCD % fat as kcal, Research Diets
  • HFD 50% fat as kcal, Research Diets
  • PCR reactions were performed twice for each sample and analyzed using a Rotor-Gene SYBR Green PCR kit (Qiagen) and a Rotor-Gene Q (2plex on PC) real-time PCR instrument (Qiagen).
  • the mRNA expression level was calculated by the ⁇ CT method and normalized to the housekeeping gene GAPDH.
  • the primer sequences are shown in Table 1.
  • membranes were washed with 1x TBST, incubated with anti-rabbit IgG horseradish peroxidase (HRP)-conjugated antibody or anti-mouse IgG antibody, and antigen-antibody complexes were treated with enhanced chemiluminescence or Supersignal West Pico Chemiluminescent Substrate (Thermofisher Scientific ) was visualized.
  • HRP horseradish peroxidase
  • antigen-antibody complexes were treated with enhanced chemiluminescence or Supersignal West Pico Chemiluminescent Substrate (Thermofisher Scientific ) was visualized.
  • PLD activity in adipose tissue was measured using Amplex Red Phospholipase D Assay kit (Invitrogen).
  • PLD cleaves phosphatidylcholine to produce choline and PA. Choline is then oxidized to betaine and H 2 O 2 by choline oxidase. Finally, in the presence of HRP, H 2 O 2 reacts with Amplex Red reagent to generate resorufin, a fluorescence product measured at 571 and 585 nm.
  • Tissues were fixed in 4% paraformaldehyde (Sigma) at 4° C. for 60 to 72 hours, and cut after paraffin embedding. Multiple sections were deparaffinized and rehydrated and used for hematoxylin and eosin (H&E) staining and immunohistochemistry.
  • H&E hematoxylin and eosin
  • slides were immersed in 10 mM sodium citrate (pH 6.0) and heated to 70° C. for 30 min. Visualization of UCP1 was performed using the VECTASTAIN ABC kit (PK-6101, Vector Laboratories) according to the manufacturer's instructions. Briefly, slides were incubated with 5% normal goat serum for 30 min at room temperature to block non-specific binding.
  • Sections were incubated with a primary antibody against UCP1 (ab10983, Abcam) at room temperature for 1 hour and then incubated with a species-specific biotinylated secondary antibody for 30 minutes.
  • a primary antibody against UCP1 (ab10983, Abcam)
  • a species-specific biotinylated secondary antibody for 30 minutes.
  • slides were incubated with alkaline phosphatase substrate (DAB, SK-4100, Vector Laboratories).
  • mice Cold tolerance experiments were performed with mice aged 8-9 weeks. Animals were placed in a cold room (4-8° C.) without access to food or water. Rectal temperature was measured at indicated times after exposure to cold using a Testo 925 electronic rectal thermometer (Testo).
  • O-GTT 2 g of glucose per kg body weight was orally administered to mice that had been fasted overnight for 10 hours. After administration, blood was collected by puncturing the tail vein, and glucose levels were measured using a glucose meter (Accu-Chek Acive, Roche) at the indicated period.
  • glucose meter Acu-Chek Acive, Roche
  • human insulin Santa Cruz Biotechnology (0.75 U/kg body weight) was administered i.p. Injections were made, and tail blood glucose concentrations were monitored at the indicated periods.
  • ELISA kit ALPCO
  • plasma insulin concentrations were measured in mice that had been fasted for 10 hours overnight.
  • CAY10594 (Cayman Chemical) was dissolved in DMSO/Tween-80/Distilled Water (D.W.) (1:1:8). This working solution was mixed by vortexing, and CAY10594 (10 mg/kg) was added i.p. injected. In the control group, DMSO of the same volume diluted in D.W. and Tween-80 solution was injected, and body weight was measured weekly. Ten weeks after injection, O-GTT, IP-ITT and metabolic rate were measured as described above.
  • Inguinal white adipose tissue ingWAT or brown adipose tissue (BAT) was isolated from 6-week-old C57BL/6 mice. Briefly, WAT was minced with 1.5 mg/ml collagenase in DMEM containing 10% fetal bovine serum (FBS) and then digested, and BAT was digested at 37° C. at 1.5 mg/ml in PBS containing 10 mM CaCl 2 for 30 min. ml Collagenase was reacted with continuous shaking. Mature adipocytes and connective tissue were separated from the cell pellet by centrifugation at 200 g for 5 min.
  • FBS fetal bovine serum
  • the cell pellet was suspended in ACK lysis buffer (Invitrogen) and filtered through a 100- ⁇ m cell strainer (BD Bioscience). After washing with PBS, pelleted stromal vascular cells derived from ingWAT were resuspended in DMEM/F12 containing 10% FBS and 1% penicillin/streptomycin (P/S), followed by adipogenic differentiation ( For adipogenic differentiation), it was dispensed in a 6-well plate.
  • ACK lysis buffer Invitrogen
  • BD Bioscience 100- ⁇ m cell strainer
  • P/S penicillin/streptomycin
  • brown adipocytes To prepare brown adipocytes, washed stromal vascular cells isolated from BAT were resuspended in DMEM containing 20% FBS and 1% P/S, and aliquoted in 6-well plates. 90-95% confluent cells were differentiated with DMEM medium containing 10% FBS, 125 ⁇ M indomethacin, 2 ⁇ g/ml dexamethasone, 0.5 mM IBMX, 0.5 ⁇ M rosiglitazone and 1% P/S. After 3 days, the medium was replaced with maintenance medium containing 15% FBS, 10 ⁇ g/ml insulin, 1 nM T3 and 1% P/S. After 2 days, these cells were maintained in DMEM with 20% FBS and 1% P/S. The medium was replaced with fresh medium every 2 days until the cells were fully differentiated on the 7th day. From induction to maintenance, adipocytes were treated with DMSO or 10 ⁇ M CAY10594 (Cayman Chemical).
  • Human subcutaneous adipocytes purchased from Zenbio (SP-F-2) were isolated from human subcutaneous adipose tissue with a BMI of 25.0-29.99.
  • the cryopreserved cells were cultured in adipocyte progenitor medium (Zenbio, PM-1) and differentiated to 100% confluency in adipocyte differentiation medium (Zenbio, DM-2).
  • Zenbio, PM-1 adipocyte progenitor medium
  • Zenbio, DM-2 differentiated to 100% confluency in adipocyte differentiation medium
  • differentiated adipocytes were cultured in adipocyte maintenance medium (Zenbio, AM-1). From induction to maintenance, adipocytes were treated with DMSO or 10 ⁇ M CAY10594 (Cayman Chemical).
  • the stromal vascular fraction (SVF) was isolated from ingWAT and measured using a Seahorse XF24 Extracellular Flux analyzer. Cells were seeded in XF 24-well cell culture microplates (Agilent) at 1.0 X 10 5 cells per well, and differentiated in 200 ⁇ l of growth medium. Respiration in the basal state was assessed. Under CAY10594 treatment (10 ⁇ M), 2 ⁇ M oligomycin, 1 ⁇ M carbonyl cyanide-4-phenylhydrazone (FCCP) and 0.5 ⁇ M rotenone/antimycin A were added at 22 minute intervals. Consumption was normalized to the protein extracted from the final mixture. Oxygen consumption was repeated twice in each experiment.
  • Adipocytes differentiated at 80% confluency were transfected with target siRNA or control scrambled siRNA (20 nM) using Lipofectamine RNAiMAX (Invitrogen) for 48 hours according to the manufacturer's instructions.
  • adipocytes were seeded on a 6-well plate cover slip.
  • Cells were fixed in 3% paraformaldehyde for 15 minutes and permeabilized in 0.1% Triton X-100 dissolved in PBS for 5 minutes at room temperature. After incubation for 20 min with PBS containing 2% bovine serum albumin, samples were transferred to a mouse monoclonal antibody against Tom20 (1:200; FL-10, sc-17764, Santa Cruz Biotechnology) and rabbit against p62. Incubated with the clonal antibody (1:500, ab91526) at room temperature for 3 hours.
  • the tissue was fixed with 2.5% glutaraldehyde dissolved in 0.1 M phosphate (pH 7.3) at room temperature for 2 hours. After fixation, the tissue was treated with 1% OsO 4 and 1.5% potassium ferrocyanide dissolved in 0.1% phosphate buffer (pH 7.3) for 1 hour at a temperature of 4 ° C in dark conditions, and ethanol and propylene oxide series ( After dehydration in propylene oxide series), it was embedded in Epon 812. Polymerization was performed using pure resin at 70° C. for 2 days. Ultrathin sections (70 nm) were obtained with an ultramicrotome (EM UC7, Leica, Austria) and then collected on a 100 mesh copper grating. After staining with 2% uranyl acetate (15 min) and lead citrate (5 min), the sections were analyzed at 120 kV (JEM-1400Plus) with a transmission electron microscope at the Korea Basic Science Institute (KBSI).
  • JEM-1400Plus a transmission electron microscope at the Korea Basic Science Institute
  • adipocytes and SVF cells were incubated with an Fc block for 15 minutes. After blocking, the cells were resuspended in FACS buffer and stained with CD45 (30-F11; ThermoFisher; 11-0451-82) for 30 minutes at 4°C in dark conditions.
  • CD45 + cells were obtained using FACSCanto II (BD biosciences) and analyzed with FACS Diva (BD biosciences) and FlowJo (TreeStar) software programs.
  • Mature brown adipocytes derived from brown adipose tissue from WT mice were stimulated with DMSO, 10 ⁇ M CAY10594 or 20 ⁇ M CCCP in a 37° C. incubator for 3 or 24 hours. Stimulated cells were stained with 100 nM of TMRM (ThermoFisher, 134361) at 37°C for 30 min. Cells were then washed with PBS and analyzed using FACSCanto II (BD biosciences) and FlowJo (TreeStar) software programs.
  • TMRM ThermoFisher, 134361
  • Example 1 HFD up-regulates PLD2 in adipose tissue.
  • the present inventors investigated the expression of Pld1 and Pld2 in various adipose tissues using qPCR. High expression of Pld1 and Pld2 mRNA was observed in subcutaneous inguinal white adipose tissue (ingWAT) and BAT than in epididymal white adipose tissue (epiWAT) (Fig. 1a). These results indicate that the mRNA expression of PLD isoforms is different in each adipose tissue.
  • ingWAT subcutaneous inguinal white adipose tissue
  • epiWAT epididymal white adipose tissue
  • ⁇ -adrenergic receptor ( ⁇ -AR) activation promotes PLD2 downregulation in thermogenic adipose tissue.
  • PLD2 protein level was significantly reduced by SNS activation in ingWAT and BAT (Fig. 2b).
  • PLD activity was also significantly reduced by SNS activation in ingWAT and BAT (Fig. 2c). ).
  • proteasome proteasomal activity induced by ⁇ -AR activation could affect PLD2 levels in adipocytes.
  • the isoprenaline-induced decrease in PLD2 was not inhibited by the lysosomal inhibitor (chloroquine), but was inhibited by the proteasome inhibitor (bortezomib) ( FIG. 2f ).
  • chloroquine lysosomal inhibitor
  • botezomib the proteasome inhibitor
  • Example 3 Adipocyte-specific Pld2 Deficiency activates a pyrogenic program in pyrogenic adipose tissue.
  • Pld2 Ad-KO mice adipocyte-specific Pld2 conditional knockout mice and control mice to reduce the level of PLD2 in adipose tissue.
  • the (patho)physiological and functional roles were evaluated ( FIG. 3A ).
  • 8-week -old Pld2 Ad-KO mice showed almost complete knockdown of Pld2 in several adipose tissues (epiWAT, ingWAT and BAT), but not in the liver (Fig. 3b).
  • Pld2 Ad-KO mice showed significantly smaller size and weight of adipose tissue such as epiWAT and ingWAT compared to control mice ( FIGS. 3c and 3d ).
  • thermogenesis-related genes of ingWAT and BAT isolated from control and Pld2 Ad-KO mice were compared.
  • Ucp1 mRNA levels were increased in ingWAT of Pld2 Ad-KO mice than in control mice.
  • Other thermogenesis-related genes were also higher in ingWAT of Pld2 Ad-KO than in control mice: these genes were mitochondrial genes such as cytochrome c oxidase subunit 7A ( Cox7a ), cytochrome c oxidase subunit 8b ( Cox8b ) and cytochrome complex ( Cycs ).
  • Pld2 Ad-KO mice also showed a smaller size and browning effect of some adipose tissue (epiWAT, ingWAT, BAT), and a reduced weight of these adipose tissue compared to control mice (Figs. 4d and 4e). Histologically, Pld2 Ad-KO mice exhibited smaller adipocyte sizes and smaller fat droplets in epiWAT, ingWAT and BAT compared to control mice (Fig. 4f). Fatty liver and adipocyte hypertrophy are well-known phenotypes of HFD-induced obesity (Sarwar et al., Diabetes Metab. Syndr. Obes. 11, 533-542, 2018).
  • the present inventors also observed that HFD induced fatty liver and adipocyte hypertrophy in control mice.
  • fatty liver and adipocyte hypertrophy were not clearly observed in the livers of HFD-fed Pld2 Ad-KO mice (Fig. 4g).
  • HFD-induced obesity is accompanied by insulin resistance mediating the pathological progression of type 2 diabetes (Taylor, Diabetes. 61, 778-779, 2012).
  • Pld2 Ad-KO mice We investigated the effect of adipocyte-specific Pld2 deletion on glucose metabolism in HFD fed mice. Consistent with less fat accumulation, the intake or fasting glucose levels of Pld2 Ad-KO mice were significantly lower than those of control mice (Fig. 4h).
  • Example 5 Pharmacological inhibition of PLD2 improves HFD-induced obesity and glucose metabolism by enhancing the fever program.
  • CAY10594 injected mice displayed a smaller abdominal fat size, less fat mass and less weight of various fat depots compared to vehicle injected mice ( FIGS. 5d-5e ) histologically. , CAY10594 injected mice showed smaller fat droplet sizes in epiWAT, ingWAT and BAT (Fig. 5f).
  • CAY10594-administered mice showed significantly lower blood glucose levels compared to vehicle-administered mice (Fig. 5g).
  • ITT analysis also showed that mice administered CAY10594 showed significantly lower blood glucose levels in response to intraperitoneal (ip) injection of insulin compared to mice administered vehicle ( FIG. 5H ).
  • CAY10594 also improved the degree of inflammation through the regulation of inflammation-related gene expression in epiWAT (Fig. 5i). Taken together, these results show that the PLD2 inhibitor CAY10594 exerts a therapeutic effect on HFD-induced obesity by enhancing glucose metabolism.
  • Example 6 CAY10594 improves mitochondrial quality through activation of AMPK and upregulation of p62.
  • CAY10594 treatment upregulated UCP1 expression in adipocytes (Fig. 6b). These results suggest that CAY10594 induces AMPK activation and UCP1 expression in adipocytes.
  • Adipocyte stimulation by CAY10594 also increased phosphorylation of LKB1, a key kinase for activation of AMPK ( FIG. 6c ) (Shackelford and Shaw, Nat. Rev. Cancer. 9, 563-575, 2009).
  • Knockdown of Lkb1 using siRNA against Lkb1 blocked CAY10594-induced AMPK phosphorylation (FIG. 6d), indicating that CAY10594 induces AMPK phosphorylation through LKB1.
  • CAY10594 In order to investigate whether the beneficial effect of CAY10594 on the activation of exothermic programming in adipocytes is also applicable to humans, the effect of CAY10594 on the thermogenic activity-related factors was investigated. Stimulation of human primary adipocytes by CAY10594 significantly increased the levels of LKB1 phosphorylation, AMPK phosphorylation, p62 and UCP1 (Fig. 6e).
  • p62 is important in regulating mitochondrial quality by regulating mitophagy (Liu et al., J. Bioenerg. Biomembr. 49, 413-422, 2017).
  • Stimulation of adipocytes by ⁇ -AR3 agonists such as isoprenaline and CL upregulated the expression level of p62 ( FIG. 6f ).
  • ⁇ -AR3 agonists such as isoprenaline and CL upregulated the expression level of p62
  • stimulation of adipocytes with CAY10594 increased the expression level of p62 at 3 or 24 h after stimulation (Fig. 6f).
  • stimulation of adipocytes by CAY10594 enhanced the localization of p62 in mitochondria (stained by Tom20 antibody), especially after 3 h of CAY10594 treatment (Fig. 6g).
  • TMRM Tetramethylrhodamine, methyl ester
  • CAY10594 affects the phosphorylation status of DRP1, a mitochondrial fission-related protein, thereby increasing DRP1 (Phospho-Ser616) levels but decreasing DRP1 (Phospho-Ser637) levels in adipocytes.
  • Mitochondrial quality is related to the expression level of reactive oxygen species and OXPHOS components that play an essential role in ATP generation (Held and Houtkooper, Bioessays. 37, 867-876, 2015).
  • Stimulation of adipocytes with CAY10594 slightly increased the expression levels of OXPHOS components such as complex V, IV, III, II and I after 24 hours in response to CAY10594 stimulation ( FIG. 6k ).
  • palmitate induces loss of mitochondrial membrane potential in cultured cells (Hammerschmidt et al., Cell. 177, 1536-1552, 2019).
  • the present inventors confirmed the level of mitochondrial membrane potential by CAY10594 in the presence of palmitate. Palmitate increased the TMRM low group, but decreased the TMRM high group. The addition of CAY10594 increased the TMRM high group, but increased the TMRM low group after 24 hours (FIG. 8a). This result is consistent with the above experimental result that CAY10594 improves mitochondrial quality.
  • PLD2 inhibition promotes AMPK activation-induced mitochondrial biogenesis and mitochondrial quality control via p62-induced mitophagy.
  • BAT SVF cells derived from Pld2 Ad-KO mice also showed significantly increased levels of p62 and UCP1 as well as LKB1 phosphorylation and AMPK phosphorylation compared to control mice ( FIG. 8b ). These results support that PLD2 negatively regulates the activity of LKB1 and AMPK and the subsequent expression of p62 and UCP1.
  • Pld2 Ad-KO mice showed slightly increased phosphorylation of LKB1 and significantly increased phosphorylation of AMPK in ingWAT and BAT compared to control mice (Fig. 7a).
  • p62 and UCP1 levels are in the model compared to the HFD control mice was significantly increased in Pld2 ingWAT and BAT of Ad-KO mice (Fig. 7a).
  • TEM analysis showed that the BAT of Pld2 Ad-KO in the HFD model had a significantly increased number of mitochondria compared to control mice (Fig. 7b).
  • the phospholipase D2 inhibitor can significantly reduce fat accumulation in adipocytes constituting adipose tissue by activating the adipose tissue thermogenesis program, and can qualitatively and quantitatively improve the mitochondria of adipocytes.
  • the phospholipase D2 inhibitor can effectively alleviate fatty liver and type 2 diabetes induced by a high-fat diet. Accordingly, the present invention is expected to be usefully used as a therapeutic agent for metabolic diseases such as obesity, diabetes, and insulin resistance.

Abstract

본 발명은 포스포리파아제 D2 억제제를 유효성분으로 포함하는 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다. 본 발명에 따르면, 포스포리파아제 D2 억제제는 지방 조직의 열 발생 프로그램을 활성화시켜 지방 조직을 이루는 지방 세포의 지방 축적을 현저히 감소시킬 수 있으며, 지방 세포의 미토콘드리아를 질적, 양적으로 개선시킬 수 있다. 또한, 포스포리파아제 D2 억제제는 고지방식에 의해 유도된 지방간과 제2형 당뇨를 효과적으로 완화시킬 수 있다. 따라서, 본 발명은 비만, 당뇨병 및 인슐린저항성과 같은 대사성 질환의 치료제로서 유용하게 사용될 수 있을 것으로 기대된다.

Description

포스포리파아제 D2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물
본 발명은 포스포리파아제 D2(Phospholipase D2, PLD2)를 표적으로 하는, 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방, 개선 또는 치료용 조성물 개발 기술에 관한 것이다.
본 발명은 2020년 6월 3일에 출원된 한국특허출원 제10-2020-0067339호에 기초한 우선권을 주장하며, 상기 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
전세계적인 비만의 대유행은 제2형 당뇨병, 인슐린 저항성, 심장병, 뇌졸중 및 고혈압을 포함하는 대사 질환의 높은 위험과 관련된다. 에너지 섭취가 지속적으로 총 에너지 소비를 초과하면, 과도한 에너지는 백색 지방 세포에 저장되며(비특허문헌 1), 백색 지방 세포의 증대로 인하여 비만이 초래된다(비특허문헌 2). 지방 조직도 에너지 소비에 중요한 역할을 한다(비특허문헌 3). 추운 환경에서 갈색 지방 조직(brown adipose tissue, BAT)은 아드레날린성 자극에 의해 활성화되며(비특허문헌 4), 저체온증을 방어하기 위한 열을 생성하기 위하여 지질을 분해시킨다(비특허문헌 5, 6). BAT의 이러한 발열 특성은 ATP 생산으로부터 전자 수송을 분리시키는 미토콘드리아 단백질인 UCP1에 의해 매개된다(비특허문헌 7). "베이지(beige)" 또는 "브라이트(brite)" 지방 세포로 알려진 세포 유형은 "브라우닝(browning)"이라 불리는 과정을 통해 열 발생적으로 활성화되도록 모집될 수 있다(비특허문헌 8). 마우스에서, 이들 세포는 주로 피하 백색 지방 조직(subcutaneous white adipose tissue, scWAT)에 위치하고(비특허문헌 9), UCP1-의존적(비특허문헌 10) 또는 -독립적 수단(비특허문헌 11)을 통하여 발열 능력을 보유한다. 설치류에서, 아드레날린성 활성화-유도된 갈색 및 베이지색 지방 세포[발열성 지방 세포(thermogenic adipocyte)라고도 함]는 대사 질환에 대해 보호 효과를 나타낸다(비특허문헌 12). 그러나, 아드레날린 수용체의 약리학적 표적은 약물의 만성 투여 후 과도한 열 생성(비특허문헌 13) 및 미세 혈관 질환(비특허문헌 14)으로 인해 제한된 임상 효능이 나타났다(비특허문헌 15). 따라서, 비만을 관리하기 위한 기존 약물이 가진 한계점을 극복할 수 있는, 갈색 및 베이지색 지방 세포를 활성화시키는 새로운 치료 전략이 필요하다.
BAT 열 발생은 주로 교감 신경계(sympathetic nervous system, SNS)에 의해 제어되며(비특허문헌 16), 저온 노출(비특허문헌 17) 또는 아드레날린 수용체 작용제의 약리학적 투여에 의해 자극될 수 있다(비특허문헌 18). 저온이나 아드레날린성 활성화는 에너지 항상성의 세포 센서인 AMPK(AMP-activated protein kinase)의 활성화를 유도함으로써 에너지 소비를 향상시킨다(비특허문헌 19). 비만과 인슐린 저항성은 지방 조직에서 감소된 AMPK 활성과 관련이 있기 때문에(비특허문헌 20), 저온 또는 β-아드레날린 수용체(β-adrenergic receptor, β-AR) 자극에 의한 AMPK 활성화는 UCP1 상향 조절에 의해 매개되는 인슐린 민감성의 증가 및 비만에 대한 유익한 효과를 발생시킨다(비특허문헌 21). 갈색 지방 생성을 향상시키는 다양한 자극은 또한 AMPK의 활성화에 의해 매개된다(비특허문헌 22). AMPK에 의한 에너지 소비의 증대는 세포 에너지 대사를 조절하여 열 발생(thermogenesis)에 적응하도록 하는데 중요한 역할을 하는, PGC1-α를 코딩하는 Ppargc1a(비특허문헌 23), 아세틸-CoA 카르복실라아제(ACC)를 코딩하는 Acaca 및 Acacb(비특허문헌 24)를 포함한 여러 표적 유전자의 조절에 의해 조정된다(비특허문헌 25). AMPK가 지방 조직에서 열 발생을 조절하기 위해 저온 또는 β-AR 신호에 반응하는 중요한 사건을 매개하지만, 저온 또는 β-AR 신호를 감지하는 AMPK 활성화의 업스트림 사건은 아직 밝혀지지 않았다. 저온 또는 β-AR 신호전달 스트레스를 감지하고, 지방 조직의 발열 프로그래밍을 매개하는 분자를 동정하는 것은 중요한 문제였다.
이에 본 발명자들은 포스포리파아제 D2 억제를 통하여 비만, 당뇨병 및 인슐린저항성과 같은 대사성 질환을 예방 및 치료할 수 있음을 확인하여, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 대사성 질환의 예방 또는 개선용 건강기능식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 대사성 질환의 예방 또는 치료용 물질의 스크리닝 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제를 유효성분으로 포함하는, 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 상기 대사성 질환의 예방 또는 치료방법을 제공한다.
나아가, 본 발명은 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제를 유효성분으로 포함하는 상기 대사성 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
뿐만 아니라, 본 발명은 상기 조성물의 상기 대사성 질환에 대한 예방, 개선 또는 치료 용도를 제공한다.
또한, 본 발명은 상기 대사성 질환의 예방 또는 치료용 제제의 제조를 위한 상기 조성물의 용도를 제공한다.
본 발명의 일 구현예에 있어서, 상기 포스포리파아제 D2 유전자의 발현을 억제하는 제제는 상기 유전자의 mRNA에 상보적으로 결합하는 miRNA, siRNA, shRNA, 리보자임(ribozyme), DNAzyme, PNA(peptide nucleic acid) 및 안티센스 올리고뉴클레오티드로 구성된 군으로부터 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현예에 있어서, 상기 포스포리파아제 D2 단백질의 활성을 억제하는 제제는 포스포리파아제 D2 단백질에 결합하는 항체, 앱타머, 펩타이드 및 화합물로 구성된 군으로부터 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에 있어서, 상기 화합물은 CAY10594(N-[2-(4-oxo-1-phenyl-1,3,8-triazaspiro[4,5]dec-8-yl)ethyl]-2-naphthalene carboxamide) 또는 이의 약학적으로 허용 가능한 염일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에 있어서, 상기 당뇨병은 제2형 당뇨병일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에 있어서, 상기 당뇨병은 비만성 당뇨병일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에 있어서, 상기 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제는 지방 조직의 열 발생 프로그램(Thermogenic program)을 향상시킬 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 (a) 분리된 세포 또는 조직에 후보물질을 접촉시키는 단계 및 (b) 상기 세포 또는 조직에서 포스포리파아제 D2 단백질의 수준 또는 상기 단백질을 코딩하는 유전자의 mRNA 수준을 측정하는 단계를 포함하는 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 물질의 스크리닝 방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 분리된 세포 또는 조직은 지방 세포 또는 지방 조직일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현예에 있어서, 상기 후보물질과 접촉된 세포 또는 조직에서 포스포리파아제 D2 단백질의 수준 또는 상기 단백질을 코딩하는 유전자의 mRNA 수준이 후보물질과 접촉 전의 수준과 비교하여 감소한 경우, 상기 후보물질을 상기 대사성 질환의 예방 또는 치료용 물질로 판정할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 따르면, 포스포리파아제 D2 억제제는 지방 조직의 열 발생 프로그램을 활성화시켜 지방 조직을 이루는 지방 세포의 지방 축적을 현저히 감소시킬 수 있으며, 지방 세포의 미토콘드리아를 질적, 양적으로 개선시킬 수 있다. 또한, 포스포리파아제 D2 억제제는 고지방식에 의해 유도된 지방간과 제2형 당뇨를 효과적으로 완화시킬 수 있다. 따라서, 본 발명은 비만, 당뇨병 및 인슐린저항성과 같은 대사성 질환의 치료제로서 유용하게 사용될 수 있을 것으로 기대된다.
도 1a 내지 1e는 PLD2가 비만 동안 ingWAT 및 BAT에서 특이적으로 유도됨을 보여주는 도이다. (도 1a) 8주령 C57BL/6 마우스의 다양한 지방 조직에서 Pld1 및 Pld2 mRNA 발현의 정량적 RT-PCR(n=5/그룹). (도 1b) 정상 식이(normal chow diet, NCD) 또는 고지방 식이(high fat diet, HFD) 섭취한 WT 마우스의 epiWAT, ingWAT 및 BAT에서의 Pld1 및 Pld2 mRNA 발현의 정량적 RT-PCR(n=5/그룹). (도 1c) NCD 또는 HFD-유도된 WT 마우스의 ingWAT 및 BAT에서의 PLD1, PLD2, β-액틴 및 GAPDH의 대표적인 웨스턴 블롯 이미지(n=5/그룹). (도 1d) NCD 또는 HFD 섭취한 WT 마우스의 각 지방 조직의 용해물에서의 PLD 활성 수준(n=8/그룹). (도 1e) 지방 세포(Adipo), 백혈구(면역선택된 CD45+ 세포)로 구성된 SVF 및 ingWAT 분획물에서의 Pld2 mRNA 발현의 정량적 RT-PCR(n=5/그룹). 데이터는 평균±SEM으로 나타내었다. two-tailed Student's t test에 의하여, *p<0.05, **p<0.01 및 ***p <0.001(도 1a, 1b, 1d 및 1e).
도 2a 내지 2f는 ingWAT 및 BAT에서 PLD2의 분해는 β-AR 활성화에 의해 유도됨을 보여주는 도이다. (도 2a) 교감 신경계 자극이 PLD2 수준에 미치는 영향을 시험하기 위한 실험의 개략도. C57BL/6 마우스를 4℃에서 1주 동안 처리하거나, β3-AR 작용제인 CL 1 mg/kg을 7일 연속으로 주사하였다. (도 2b 및 2c) 지시된 시점에서 분자 분석을 위해 ingWAT 및 BAT 저장소를 수거하였다. ingWAT 및 BAT에서의 PLD2, UCP1, β-액틴 및 GAPDH의 대표적인 웨스턴 블롯 이미지(도 2b) 및 PLD 활성 수준(도 2c)(n=5/그룹). (도 2d) 표시된 시간에 β-AR 작용제(이소프레날린 1 μM 또는 CL 10 μM) 처리된 일차 갈색 지방 세포에서의 PLD2 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 2e) 이소프레날린(1 μM) 또는 SR59230A(1 μM) 처리된 일차 갈색 지방 세포에서의 PLD2 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 2f) 이소프레날린(1 μM), 보르테조밉(20 nM) 또는 클로로퀸(10 μM) 처리된 일차 갈색 지방 세포에서의 PLD2 및 β-액틴의 대표적인 웨스턴 블롯 이미지. 데이터는 평균±SEM으로 나타내었다. two-tailed Student's t test에 의하여, *p<0.05, **p<0.01, ***p<0.001 (도 2b 우측 및 2c).
도 3a 내지 3g는 지방 세포 특이적 PLD2 결실은 발열성 지방 조직에서 발열 프로그램을 활성화시킴을 보여주는 도이다. (도 3a) Pld2 Ad-KO 마우스의 생성. (도 3b) 대조군 및 Pld2 Ad-KO 마우스로의 다양한 지방 조직 데포(depot) 및 간에서의 PLD2 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 3c) 대조군 및 Pld2 Ad-KO 마우스의 지방 조직 및 간의 대표 이미지(n=10/그룹). 스케일 바, 1 cm. (도 3d) 대조군 및 Pld2 Ad-KO 마우스의 epiWAT, ingWAT, BAT 및 간의 조직 중량(n=5/그룹). (도 3e) 대조군 및 Pld2 Ad-KO 마우스의 epiWAT, ingWAT 및 BAT 조직의 H&E 및 UCP1 염색의 대표적인 이미지(n=5/그룹). 스케일 바, 25 μm. (도 3f) 대조군 및 Pld2 Ad-KO 마우스의 ingWAT 및 BAT에서의 발열성 mRNA의 발현(n=5/그룹). (도 3g) 매시간마다 NCD-유도된 대조군 및 Pld2 Ad-KO 마우스의 직장 온도 측정(n=7/그룹). 데이터는 평균±SEM으로 나타내었다. Student's t test(도 3d, 3f) 또는 two-way ANOVA(도 3g)에 의하여, *p<0.05, ***p<0.001.
도 4a 내지 4m은 HFD-유도된 비만 및 제2형 당뇨병에 대한 Pld2 Ad-KO 마우스의 저항성을 보여주는 도이다. (도 4a 및 4b) HFD-유도된 대조군 및 Pld2 Ad-KO 마우스의 체중 곡선(도 4a) 및 대표 이미지(도 4b)(n=10/그룹). (도 4c 및 4d) 매일 음식 섭취량(도 4c) 및 지방 데포의 대표 이미지(도 4d)(n=10/그룹). 스케일 바, 1 cm. (도 4e) 지방 데포 및 간의 중량(n=6/그룹). (도 4f 및 4g) HFD-유도된 대조군 및 Pld2 Ad-KO 마우스의 지방 조직(도 4f) 및 간(도 4g)의 H&E 염색의 대표적인 이미지(n=6/그룹). 스케일 바, 25 μm. (도 4h 및 4i) 포도당(도 4h) 및 인슐린(도 4i)의 섭취 및 공복 혈중 농도(n=6/그룹). (도 4j 및 4k) 공복 마우스에서 O-GTT(도 4j) 또는 IP-ITT(도 4k) 동안 혈당 농도(n=6/그룹). (도 4l) epiWAT에서 간 샘플에서의 pAKT(S473), AKT, pGsk3β 및 Gsk3β의 대표적인 웨스턴 블롯 이미지. (도 4m) HFD-유도된 대조군 및 Pld2 Ad-KO 마우스의 epiWAT 및 ingWAT에서의 염증 관련 유전자의 발현(n=5/그룹). 데이터는 평균±SEM으로 나타내었다. two-way ANOVA(도 4j 및 4k) 또는 two-tailed Student's t test(도 4c, 4e, 4h, 4i 및 4m)에 의해, *p<0.05, **p<0.01, ***p<0.001.
도 5a 내지 5i는 HFD-유도된 비만 마우스에서 PLD2의 억제는 비만 및 제2형 당뇨병을 개선시킴을 보여주는 도이다. (도 5a) 비만 마우스에서 CAY10594의 치료 효과를 조사하기 위한 실험의 개략도. (도 5b 및 5c) 체중 곡선(도 5b) 및 일일 음식 섭취 수준(도 5c)(n=5/그룹). (도 5d) 마우스 및 지방 조직의 대표 이미지(n=5/그룹). 스케일 바, 1 cm. (도 5e) 지방 조직 및 간의 중량(n=5/그룹). (도 5f) 다양한 지방 조직의 H&E 염색의 대표 이미지. 스케일 바, 25 μm. (도 5g 및 5h) 공복 마우스에서 O-GTT(도 5g) 또는 IP-ITT(도 5h) 동안 혈당 농도(n=6/그룹). (도 5i) 비히클 또는 CAY10594 주사된 비만 마우스(n=6/그룹)의 epiWAT 및 ingWAT에서의 염증 관련 유전자의 발현. 데이터는 평균±SEM으로 나타내었다. two-way ANOVA(도 5b, 5g 및 5h) 또는 two-tailed Student's t test(도 5c, 5e, 5i)에 의하여, *p<0.05, **p<0.01, ***p<0.001.
도 6a 내지 6k는 PLD2의 억제가 배양된 갈색 지방 세포에서 AMPK 및 p62를 통해 미토콘드리아 질을 조절함을 보여주는 도이다. (도 6a) 산소 소비율(OCR)을 측정하는 대표적인 seahorse extracellular flux 분석(n=3/그룹). (도 6b) 비히클 또는 CAY10594(10 μM) 처리된 일차 갈색 지방 세포에서 pAMPK(T172), AMPKα, pACC(S79), ACC, UCP1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 6c) 지시된 시점에서 CAY10594(10 μM) 처리된 일차 갈색 지방 세포에서 pLKB1(S428), LKB1, pAMPK(T172), AMPKα 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 6d) 대조군 siRNA 또는 siLKB1으로 트랜스펙션된 일차 갈색 지방 세포에서의 pAMPK(T172), AMPKα, LKB1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 6e) 비히클 또는 CAY10594(10 μM) 처리된 인간 일차 백색 지방 세포에서의 pLKB1(S428), LKB1, pAMPK(T172), AMPKα, p62, UCP1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 6f) 지시된 시점에 이소프레날린(1 μM), CL(10 μM) 또는 CAY10594(10 μM) 처리된 일차 갈색 지방 세포에서의 p62 및 β-액틴(위) 및 p62 mRNA 발현(아래)의 대표적인 웨스턴 블롯 이미지. (도 6g) 분화된 일차 갈색 지방 세포를 지시된 시간에 CAY10594(10 μM)로 처리하고, anti-p62(적색), anti-Tom20(녹색) 및 DAPI(4',6-diamidino-2-phenylindole)(청색)로 면역 염색하였다. 스케일 바, 10 μm. (도 6h) 지시된 시간에 비히클, CAY10594(10 μM) 또는 CCCP(20 μM)로 자극된 일차 갈색 지방 세포의 TMRM 분석(n=3/그룹). (도 6i) 지시된 시점에서 CAY10594(10 μM) 처리된 일차 갈색 지방 세포에서의 p62, LC3 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 6j) 지시된 시점에서 CAY10594(10 μM) 또는 CCCP(20 μM) 처리된 일차 갈색 지방 세포에서의 pDRP1(S616, S637), DRP1, FIS1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 6k) 지시된 시점에서 CAY10594(10 μM) 처리된 일차 갈색 지방 세포에서의 미토콘드리아 복합체 성분의 대표적인 웨스턴 블롯 이미지. 데이터는 평균±SEM으로 나타내었다. two-way ANOVA(도 6a 좌측) 또는 two-tailed Student's t test(도 6a 우측, 6e 하단 및 6h 우측)에 의하여, *p<0.05, **p<0.01, ***p<0.001.
도 7a 내지 7d는 PLD2 억제가 배양된 갈색 지방 세포에서 AMPK 및 p62를 통해 미토콘드리아 질을 조절함을 보여주는 도이다. (도 7a) HFD-유도된 대조군 및 Pld2 Ad-KO 마우스의 ingWAT 및 BAT에서의 pLKB1(S428), LKB1, pAMPK(T172), AMPKα, p62, UCP1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 7b) HFD-유도된 대조군 및 Pld2 Ad-KO 마우스의 BAT에서의 투과 전자 현미경(TEM)의 대표 이미지(좌측) 및 Mtco1/Ndufv1 비(우측)(n=6/그룹). (도 7c) 비히클 또는 CAY10594 주사된 비만 WT 마우스의 ingWAT 및 BAT에서의 pLKB1(S428), LKB1, pAMPK(T172), AMPKα, p62, UCP1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. (도 7d) 비히클 또는 CAY10594 주사된 비만 WT 마우스(n=6/그룹)의 BAT에서의 투과 전자 현미경(TEM)의 대표 이미지(좌측) 및 Mtco1/Ndufv1 비(우측). 데이터는 평균±SEM으로 나타내었다. two-tailed Student's t test에 의하여, *p<0.05, **p<0.01(도 7b 우측 및 7d 우측).
도 8a 및 8b는 PLD2가 배양된 갈색 지방 세포에서 AMPK 및 p62를 통해 미토콘드리아 질을 조절함을 보여주는 도이다. (도 8a) 지시된 시간에 팔미테이트(500 μM) 자극과 함께 CAY10594(10 μM)로 자극된 일차 갈색 지방 세포의 TMRM 분석(n=3/그룹). (도 8b) 대조군 및 Pld2 Ad-KO 마우스의 일차 갈색 지방 세포에서 pLKB1(S428), LKB1, pAMPK(T172), AMPKα, p62, UCP1 및 β-액틴의 대표적인 웨스턴 블롯 이미지. 데이터는 평균±SEM으로 나타내었다. two-tailed Student's t test에 의하여, *p<0.05, **p<0.01, ***p<0.001 (도 8a 우측).
본 발명은 포스포리파아제 D2(Phospholipase D2) 유전자의 발현 또는 단백질의 활성을 억제하는 제제를 유효성분으로 포함하는, 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 다른 양태로서, 본 발명은 상기 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료방법을 제공한다.
본 명세서에서 사용된 용어, 포스포리파아제 D2(PLD2)는 포스파티딜콜린(phosphatidylcholine)을 포스파티드산(phosphatidic acid, PA)과 콜린(choline)으로 가수분해하는 효소이다. 현재 PLD2가 소포 수송(vesicle transport), 세포 골격 조직을 통한 세포 이동, 세포 증식/세포사멸 및 세포 분화 등과 같은 다양한 생물학적 과정에 관련이 있음이 보고되었지만(Jang, J.H., C.S. Lee, D. Hwang, and S.H. Ryu. 2012. Progress in Lipid Research. 51:71-81), PLD2에 의한 비만 병리 조절 효과에 대해서는 밝혀진 바가 없다.
본 발명에 있어서, 상기 포스포리파아제 D2 유전자의 발현을 억제하는 제제는 상기 유전자의 mRNA에 상보적으로 결합하는 miRNA, siRNA, shRNA, 리보자임(ribozyme), DNAzyme, PNA(peptide nucleic acid) 및 안티센스 올리고뉴클레오티드로 구성된 군으로부터 선택될 수 있다.
본 명세서에서 사용된 용어, "miRNA, siRNA 및 shRNA"는 RNA 방해 또는 유전자 사일런싱(silencing)을 매개하기 위하여 주로 목적 유전자로부터 전사된 mRNA에 결합하여, 상기 mRNA의 해독을 저해하는 핵산 분자를 의미한다. 상기 miRNA, siRNA 및 shRNA는 표적 유전자의 발현을 해독수준에서 억제할 수 있기 때문에, 효율적인 유전자 녹다운(knockdown) 방법 또는 유전자치료 방법에 사용될 수 있다.
본 명세서에서 사용된 용어, "리보자임(ribozyme)"은 리보자임의 서열에 대해서 완전히 또는 부분적으로 상동성인 서열을 갖는 핵산 분자를 분해할 수 있는 촉매적 RNA 분자이다. 표적 RNA와 특이적으로 짝을 이루고, 특정의 위치에서 포스포디에스테르 골격을 분해시킴으로써 표적 RNA를 기능적으로 불활성화시키는 RNA 리보자임을 코드화한 리보자임 이식유전자를 디자인할 수 있다. 이러한 분해를 수행함에 있어서, 리보자임은 그 자체가 변화되지 않으며, 따라서 재순환하여 다른 분자를 분해시킬 수 있다. 상기 리보자임은 리보자임 서열을 통합시킨 RNA 올리고뉴클레오티드의 형태로 세포에 대해 직접 표적화될 수 있거나, 원하는 리보자임 RNA를 코드화한 발현 벡터로서 세포 내에 도입될 수 있다. 리보자임은 안티센스 올리고뉴클레오티드에 대해서 기술된 것과 대체로 동일한 방식으로 사용 및 적용될 수 있다.
본 명세서에서 사용된 용어, "DNAzyme"은 단일 가닥 RNA를 절단하는 촉매 DNA 분자로, 표적 RNA 서열에 대하여 매우 선택적이고 이로써 전령 RNA를 표적으로 하여 특정 유전자를 하향 조절하는데 사용될 수 있다.
본 명세서에서 사용된 용어, "PNA(Peptide Nucleic Acid)"는 인공적으로 합성된, DNA 또는 RNA와 비슷한 중합체를 가리키며, 1991년 덴마크 코펜하겐 대학교의 Nielsen, Egholm, Berg와 Buchardt 교수에 의해 처음으로 소개되었다. DNA는 인산-리보스당 골격을 갖는데 반해, PNA는 펩타이드 결합에 의해 연결된 반복된 N-(2-아미노에틸)-글리신 골격을 가지며, 이로 인해 DNA 또는 RNA에 대한 결합력과 안정성이 크게 증가되어 분자 생물학, 진단 분석 및 안티센스 치료법에 사용되고 있다. PNA는 문헌[Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thyminesubstituted polyamide". Science 254 (5037): 1497-1500]에 상세하게 개시되어 있다.
본 명세서에서 사용된 용어, "안티센스 올리고뉴클레오티드"는 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하는데, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 효과를 나타낼 수 있다.
본 발명에 있어서, 상기 포스포리파아제 D2 단백질의 활성을 억제하는 제제는 포스포리파아제 D2 단백질에 결합하는 항체, 앱타머, 펩타이드 및 화합물로 구성된 군으로부터 선택될 수 있다.
본 명세서에서 사용된 용어, "항체"란 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질성 분자를 의미한다. 상기 항체의 형태는 특별히 제한되지 않으며, 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고 모든 면역 글로불린 항체가 포함될 수 있을 뿐만 아니라, 인간화 항체 등의 특수 항체를 포함할 수도 있다. 아울러, 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며, Fab, F(ab'), F(ab') 2 및 Fv 등이 될 수 있다.
본 명세서에서 사용된 용어, "앱타머(aptamer)"란 20 내지 60 뉴클레오티드 정도의 크기를 갖는 단일가닥 올리고 뉴클레오티드로서, 그 자체로 안정된 삼차 구조를 가지면서 표적 분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 단일가닥 핵산(DNA, RNA 또는 변형핵산)으로 구성된 폴리뉴클레오티드의 일종을 의미한다. 상기 앱타머는 폴리뉴클레오티드, 폴리펩타이드, 화합물, 중합체 등의 다양한 물질을 표적분자로서 사용할 수 있고, 단백질보다 안정성이 우수하며, 구조가 간단하면서도 핵산으로 구성되어 합성이 용이하기 때문에, 다양한 표적분자를 검출하는 방법에 이용되고 있다. 상기 앱타머는 소정의 표적 분자에 대하여 결합함으로써, 소정의 표적 분자의 활성을 저해할 수 있다. 상기 앱타머는 RNA, DNA, 변형된(modified) 핵산 또는 이들의 혼합물일 수 있으며, 또한 직쇄상 또는 환상의 형태일 수 있다.
본 발명에 있어서, 상기 화합물은 하기 화학식 1의 CAY10594(N-[2-(4-oxo-1-phenyl-1,3,8-triazaspiro[4,5]dec-8-yl)ethyl]-2-naphthalene carboxamide) 또는 이의 약학적으로 허용 가능한 염일 수 있다.
화학식 1
Figure PCTKR2021006807-appb-img-000001
본 명세서에서 사용된 용어, "약학적으로 허용 가능한 염"이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. 적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 글루콘산, 나프탈렌-2-설폰산, 벤젠설폰산 등을 들 수 있다. 산부가염은 통상의 방법, 예를 들면 화합물을 과량의 산 수용액에 용해시키고, 이 염을 메탄올, 에탄올, 아세톤 또는 아세토니트릴과 같은 수혼화성 유기 용매를 사용하여 침전시켜서 제조할 수 있다. 또한, 동몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고 이어서 상기 혼합물을 증발시켜서 건조시키거나, 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.
적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리토 금속 수산화물 용액 중에 용해하고, 비용해 화합물염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 이 때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하며, 또한 이에 대응하는 은염은 알칼리 금속 또는 알칼리토 금속염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.
본 발명에 있어서, 상기 당뇨병은 제2형 당뇨병 또는 비만성 당뇨병일 수 있다.
본 발명에 있어서, 상기 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제는 지방 조직의 열 발생 프로그램(Thermogenic program)을 향상시킬 수 있다.
또한, 상기 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제는 지방 세포의 미토콘드리아를 질적 또는 양적으로 개선시킬 수 있다
본 발명의 일 실시예에서는 저열량 사료와 고열량 사료를 먹인 각각의 정상 쥐와 비만 쥐에서 열 발생에 관여하고 있는 지방 조직(피하지방과 갈색지방)에서 PLD2의 발현이 두드러지게 증가함을 확인하였으며(도 1 참조), 비만과 반대의 환경을 조성하기 위해, 쥐들을 추운 장소에 놓은 그룹과 베타 아드레날린 수용체를 활성화시키는 물질을 주사한 그룹을 대조군과 비교하였을 때, PLD2 단백질이 피하지방과 갈색지방에서 현저히 감소하였음을 확인하였다(도 2 참조). 이러한 결과는 베타 아드레날린 수용체 활성화가 PLD2의 소멸을 유도하고, 그럼으로써 열 발생 프로그램이 발동한다는 것을 시사한다.
또한, 본 발명의 일 실시예에서는 PLD2가 제거된 쥐가 대조군 쥐에 비해 보다 높은 열 발생 능력을 갖고 있으며, 지방을 축적하는 백색 지방 조직이 열 발생을 할 수 있는 갈색 지방 조직화되어 있음을 확인하였다(도 3 참조).
또한, 본 발명의 일 실시예에서는 지방 조직 특이적 PLD2 제거 쥐에 고열량 사료를 주어 비만을 유도하였을 때, 대조군에 비해 현저히 체중이 적게 증가하였으며, 이는 지방 조직의 열 발생으로 인한 대사 활성의 증가 때문이며, 비만에 의한 당뇨 현상도 두드러지게 완화되는 것을 확인하였다(도 4 참조).
또한, 본 발명의 일 실시예에서는 분자적 제거가 아닌 PLD2의 활성을 억제시킬 수 있는 물질(CAY10594)을 쥐에 주사하였을 때, 지방 조직의 열 발생 능력이 현저하게 활성화되었으며(도 5 참조), 미토콘드리아 수와 질을 조절할 수 있는 미토콘드리아 자가소화 작용이 CAY10594를 3시간 처리한 지방 세포에서 관찰되었고, 자가소화 작용을 조절하는 분자인 p62와 LC3 발현양이 CAY10594에 의해 증가됨과 미토콘드리아와 결합하는 것을 확인하였다(도 6 참조).
또한, 본 발명의 일 실시예에서는 지방 조직 특이적 PLD2 제거 쥐와 대조군 쥐 각각의 피하지방과 갈색지방을 얻은 후 생체 에너지 대사 조절에 중요한 분자인 AMPK, AMPK를 활성화시키는데 중요한 LKB1, 열 발생에 중요한 역할을 하는 미토콘드리아 단백질인 UCP1, 그리고 미토콘드리아의 자가소화 조절을 통해 개체 내 미토콘드리아의 질을 관리하는 p62의 단백질 양을 확인한 결과, 미토콘드리아 및 생체 에너지 대사와 관련된 단백질들은 대조군에 비해 지방 조직 특이적 PLD2 제거 쥐의 지방 조직에서 더 높게 발현되는 것을 확인하였다(도 7 참조).
한편, 본 발명의 조성물 내의 상기 유효성분의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC) HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜(PEG) 4000,PEG 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스(HPMC) 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9% 염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3) 이산화탄소가스, 메타중아황산나트륨(Na2S2O3), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16(Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈(Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다.
본 발명에서 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에서 "투여"란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 "예방"이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, "치료"란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, "개선"이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
본 발명의 또 다른 양태로서, 본 발명은 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제(포스포리파아제 D2 억제제)를 유효성분으로 포함하는, 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명의 포스포리파아제 D2 억제제를 식품 첨가물로 사용할 경우, 상기 억제제를 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시 상기 억제제는 원료에 대하여 15 중량% 이하, 또는 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-0.20g, 또는 약 0.04-0.10g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명의 또 다른 양태로서, 본 발명은 (a) 분리된 세포 또는 조직에 후보물질을 접촉시키는 단계 및 (b) 상기 세포 또는 조직에서 포스포리파아제 D2 단백질의 수준 또는 상기 단백질을 코딩하는 유전자의 mRNA 수준을 측정하는 단계를 포함하는 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 물질의 스크리닝 방법을 제공한다.
본 발명에 있어서, 상기 분리된 세포 또는 조직은 지방 세포 또는 지방 조직일 수 있다.
본 발명에 있어서, 상기 후보물질과 접촉된 세포 또는 조직에서 포스포리파아제 D2 단백질의 수준 또는 상기 단백질을 코딩하는 유전자의 mRNA 수준이 후보물질과 접촉 전의 수준과 비교하여 감소한 경우, 상기 후보물질을 상기 대사성 질환의 예방 또는 치료용 물질로 판정할 수 있다.
상기 mRNA 수준을 측정하는 방법은 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 칩을 포함하나, 이에 한정되지 않는다.
상기 단백질의 수준을 측정하는 방법은 웨스턴 블롯팅, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: Radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역확산법, 로케트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), 유세포분석(FACS) 및 단백질 칩(protein chip)을 포함하나, 이에 한정되지 않는다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실험재료 및 실험방법
실험동물
마우스와 관련된 모든 실험은 성균관대학교의 동물 관리 및 이용에 관한 기관 검토위원회의 승인을 받아 수행하였다. 모든 실험은 수컷 C57BL/6 마우스를 사용하였다. C57BL/6 마우스는 DBL로부터 구입하였고, adiponectin-Cre 마우스(AdipoQ-cre)는 H.I. Kim(KAIST, Daejeon, Korea)으로부터 제공받았다. Pld2flox/flox 마우스는 이전의 보고된 바와 같이 생성하였다(Ghim J., et al, 2014, Arterioscler Thromb Vasc Biol). Pld2flox/flox 마우스를 AdipoQ-cre knock-in 마우스와 교배하여 Pld2flox/flox AdipoQ-cre 마우스를 생성하였다. 비만 마우스 모델의 경우, 8주령의 마우스에 10주 또는 12주 동안 NCD(10% fat as kcal, Research Diets) 또는 HFD(60% fat as kcal, Research Diets)를 섭취시켰다.
RNA 분리 및 정량적 RT-PCR
제조사의 지시에 따라 Trizol 방법(Invitrogen)을 사용하여 지방 조직 및 일차 지방 세포로부터 총 RNA를 추출하였다. 역전사 키트(iNtRON)를 사용하여 1 μg의 RNA로부터 상보적 DNA를 제조하였다. PCR 반응을 각각의 샘플에 대해 두 번씩 수행하고, Rotor-Gene SYBR Green PCR 키트(Qiagen) 및 Rotor-Gene Q(2plex on PC) 실시간 PCR 기기(Qiagen)를 사용하여 분석하였다. mRNA 발현 수준을 △△CT법으로 계산하고, 하우스키핑 유전자 GAPDH로 정규화 하였다. 프라이머 서열을 표 1에 나타내었다.
Gene Symbol Forward Reverse
Pld1 TGCATCCTCAAACGGAAAGC (서열번호 1) AGGTACACGCTGGACCACAC (서열번호 2)
Pld2 CGAGACCCTGTCTGTGATGA (서열번호 3) GTAGCCAAGGACTCCACAGC (서열번호 4)
Ucp1 ACTGCCACACCTCCAGTCATT (서열번호 5) CTTTGCCTCACTCAGGATTGG (서열번호 6)
Cox7a CAGCGTCATGGTCAGTCTGT (서열번호 7) AGAAAACCGTGTGGCAGAGA (서열번호 8)
Cox8b GAACCATGAAGCCAACGACT (서열번호 9) GCGAAGTTCACAGTGGTTCC (서열번호 10)
Cycs CAGGCTGCTGGATTCTCTTAC (서열번호 11) TCCCCAGGTGATACCTTTGT (서열번호 12)
Elovl3 GATGGTTCTGGGCACCATCTT (서열번호 13) CGTTGTTGTGTGGCATCCTT (서열번호 14)
Pgc1a AGCACACGTTTATTCACGGGT (서열번호 15) GCCCCCAAGTCCTCACATG (서열번호 16)
Cidea ATCACAACTGGCCTGGTTACG (서열번호 17) TACTACCCGGTGTCCATTTCT (서열번호 18)
Dio2 CAGTGTGGTGCACGTCTCCAATC (서열번호 19) TGAACCAAAGTTGACCACCAG (서열번호 20)
Tnfa GACGTGGAACTGGCAGAAGAG (서열번호 21) ACCGCCTGGAGTTCTGGAA (서열번호 22)
Il6 TAGTCCTTCCTACCCCAATTTCC (서열번호 23) TTGGTCCTTAGCCACTCCTTC (서열번호 24)
Il1b GCAACTGTTCCTGAACTCAACT (서열번호 25) ATCTTTTGGGGTCCGTCAACT (서열번호 26)
Il10 GCTATGCTGCCTGCTCTTACT (서열번호 27) CCTGCTGATCCTCATGCCA (서열번호 28)
Mtco1 TGCTAGCCGCAGGCATTAC (서열번호 29) GGGTGCCCAAAGAATCAGAAC (서열번호 30)
Ndufv1 GCGGGTATCTGTGCGTTTCA (서열번호 31) GAACCTTTCAGCCTCCAGTCA (서열번호 32)
Gapdh CCACCACCCTGTTGCTGTA (서열번호 33) AATGTGTCCGTCGTGGATCT (서열번호 34)
웨스턴 블롯
균질화된 조직 및 세포를 단백질 분해효소 및 포스파타제 억제제를 함유하는 RIPA 완충액(iNtRON)에서 용해시켰다. 원심 분리 후 상청액을 수득하고, 상청액 내 단백질 농도를 BCA 단백질 분석 키트(Thermofisher Scientific)를 사용하여 측정하였다. 이어서 세포 용해물을 동일 부피의 2x SDS 샘플 버퍼와 혼합하고, 95℃에서 5분 동안 끓여주었다. 이어서, 단백질 샘플을 SDS-PAGE로 분리하고, 폴리비닐리덴 디플루오라이드 막(Millipore)으로 옮겼다. 5% 탈지유 용액 또는 4% 소 혈청 알부민(Sigma)에서 차단(blocking)한 후, 막을 특정 1차 항체와 함께 배양하였다. 인큐베이션 후, 막을 1x TBST로 세척하고, anti-rabbit IgG horseradish peroxidase(HRP)-결합된 항체 또는 anti-mouse IgG 항체와 함께 인큐베이션하고, 항원-항체 복합체를 enhanced chemiluminescence 또는 Supersignal West Pico Chemiluminescent Substrate(Thermofisher Scientific)로 시각화하였다.
PLD 활성 측정
지방 조직에서의 PLD 활성을 Amplex Red Phospholipase D Assay 키트(Invitrogen)를 사용하여 측정하였다. 이 분석에서, PLD는 포스파티딜콜린을 절단하여 콜린 및 PA를 생성한다. 이어서 콜린은 콜린 산화효소에 의해 베타인 및 H2O2로 산화된다. 마지막으로, HRP의 존재 하에서 H2O2는 Amplex Red 시약과 반응하여 571 및 585 nm에서 측정되는 형광 생성물질인 레조루핀(resorufin)을 생성한다.
조직학적 분석 및 면역조직화학 분석
조직을 4℃에서 60 내지 72시간 동안 4% 파라포름알데하이드(Sigma)에 고정시키고, 파라핀 포매 후 절단하였다. 다수의 절편을 탈파라핀화 및 재수화시키고, 헤마톡실린 및 에오신(H&E) 염색 및 면역조직화학에 사용하였다. 항원 복구(antigen retrieval)를 위하여, 슬라이드를 10 mM 시트르산 나트륨(pH 6.0)에 침지시키고, 30분 동안 70℃로 가열하였다. UCP1의 시각화는 제조사의 지시에 따라 VECTASTAIN ABC 키트(PK-6101, Vector Laboratories)를 사용하여 수행하였다. 간략히 설명하면, 슬라이드를 5% 정상 염소 혈청과 함께 30분 동안 실온에서 인큐베이션하여 비특이적 결합을 차단하였다. 절편을 UCP1(ab10983, Abcam)에 대한 1차 항체와 함께 실온에서 1시간 동안 인큐베이션 한 후 종-특이적 비오틴화 2차 항체와 함께 30분간 인큐베이션 하였다. 시각화를 위하여 슬라이드를 알칼리 포스파타아제 기질(DAB, SK-4100, Vector Laboratories)과 함께 인큐베이션 하였다.
내한성(Cold tolerance) 실험
8-9주령 마우스로 내한성 실험을 수행하였다. 동물을 음식이나 물에 접근 없이 차가운 방(4-8℃)에 위치시켰다. 직장 온도를 Testo 925 전자 직장 온도계(Testo)를 사용하여 추위에 노출 후 지시된 시간에 측정하였다.
혈당 및 혈장 인슐린 수준 측정
O-GTT의 경우, 10시간 밤새 금식한 마우스에 체중 kg 당 2g의 포도당을 경구 투여하였다. 투여 후 꼬리 정맥을 천공하여 혈액을 채취하고, 지시된 기간에 포도당 측정기(Accu-Chek Acive, Roche)를 사용하여 포도당 수준을 측정하였다. IP-ITT의 경우, 10시간 밤새 금식한 마우스에 인간 인슐린(Santa Cruz Biotechnology)(0.75 U/kg 체중)을 i.p. 주사하고, 꼬리 혈당 농도를 지시된 기간에 모니터링 하였다. ELISA 키트(ALPCO)를 사용하여 10시간 밤새 금식한 마우스의 혈장 인슐린 농도를 측정하였다.
마우스에 CAY10594 주사
CAY10594(Cayman Chemical)를 DMSO/트윈-80/증류수(D.W.)(1:1:8)에 용해시켰다. 이 작업 용액(working solution)을 볼텍싱하여 혼합하고, CAY10594(10 mg/kg)을 i.p. 주사하였다. 대조군에는 D.W.와 트윈-80 용액에 희석된 동일 부피의 DMSO를 주사하고, 주간(weekly) 체중을 측정하였다. 주사 10주 후, O-GTT, IP-ITT 및 대사율을 상기한 바와 같이 측정하였다.
세포 배양
6주령의 C57BL/6 마우스로부터 ingWAT(inguinal white adipose tissue) 또는 BAT(brown adipose tissue)를 분리하였다. 간략히 설명하면, WAT를 10% 소 태아 혈청(FBS)을 함유한 DMEM에서 1.5 mg/ml 콜라겐 분해효소로 다진 후 분해시키고, BAT를 37℃에서 30분 동안 10 mM CaCl2 함유 PBS에서 1.5 mg/ml 콜라겐 분해효소와 계속하여 흔들어주면서 반응시켰다. 성숙한 지방 세포 및 결합 조직을 200g에서 5분 동안 원심분리하여 세포 펠릿으로부터 분리하였다. 이어서 세포 펠릿을 ACK 용해용 버퍼(Invitrogen)에 현탁시키고, 100-μm 세포 여과기(BD Bioscience)를 통해 여과하였다. PBS로 세척 후, ingWAT 유래의 펠릿화된 기질 혈관 세포(stromal vascular cells)를 10% FBS, 1% 페니실린/스트렙토마이신(P/S)을 함유하는 DMEM/F12에 재현탁시키고, 지방 생성 분화(adipogenic differentiation)를 위하여 6웰 플레이트에 분주하였다. 90~95% 컨플루언트 세포(confluent cell)를 5% FBS, 10 μg/ml 인슐린, 120 μM 인도메타신, 0.2 μM 덱사메타손, 0.5 mM 3-이소부틸-1-메틸크산틴(IBMX), 1 nM 3,3',5-트리요오드-1-티로닌(T3) 및 1% P/S를 포함하는 배지로 분화시켰다. 3일 후, 배지를 10% FBS, 10 μg/ml 인슐린 및 1% P/S를 함유하는 유지 배지(maintenance medium)로 교체하였다. 2일 후, 이들 세포를 10% FBS 및 1% P/S가 포함된 DMEM/F12에서 유지시켰다.
갈색 지방 세포를 제조하기 위하여, BAT로부터 분리된 세척된 기질 혈관 세포를 20% FBS, 1% P/S를 함유하는 DMEM에 재현탁시키고, 6웰 플레이트에 분주하였다. 90~95% 컨플루언트 세포를 10% FBS, 125 μM 인도메타신, 2 μg/ml 덱사메타손, 0.5 mM IBMX, 0.5 μM 로시글리타존(rosiglitazone) 및 1 % P/S를 함유하는 DMEM 배지로 분화시켰다. 3일 후, 배지를 15% FBS, 10 μg/ml 인슐린, 1 nM T3 및 1% P/S를 함유하는 유지 배지로 교체하였다. 2일 후, 이들 세포를 20% FBS 및 1% P/S가 함유된 DMEM에서 유지시켰다. 세포가 7일째에 완전히 분화될 때까지 배지를 2일마다 새로운 배지로 교체해 주었다. 상기 유도(induction)에서부터 유지(maintenance)까지, 지방 세포에 DMSO 또는 10 μM CAY10594(Cayman Chemical)를 처리하였다.
인간 일차 백색 지방 세포의 분화
Zenbio(SP-F-2)로부터 구매한 인간 피하 지방 전구세포(preadipocyte)는 BMI가 25.0-29.99인 인간의 피하 지방 조직으로부터 분리되었다. 동결 보존된 세포를 지방 전구세포 배지(Zenbio, PM-1)에서 배양하고, 지방 세포 분화 배지(Zenbio, DM-2)에서 100% 컨플루언시로 분화시켰다. 성숙을 위하여, 분화된 지방 세포를 지방 세포 유지 배지(Zenbio, AM-1)에서 배양하였다. 상기 유도(induction)에서부터 유지(maintenance)까지, 지방 세포에 DMSO 또는 10 μM CAY10594(Cayman Chemical)를 처리하였다.
미토콘드리아 호흡 분석
SVF(stromal vascular fraction)를 ingWAT로부터 분리하고, Seahorse XF24 Extracellular Flux 분석기를 사용하여 측정하였다. 세포를 웰 당 1.0 X 105 세포로 XF 24웰 세포 배양 마이크로 플레이트(Agilent)에 분주하고, 200 μl의 성장 배지에서 분화시켰다. 기저 상태(basal state)에서의 호흡을 평가하였다. CAY10594 처리(10 μM) 하에서, 2 μM 올리고마이신, 1 μM 카보닐 시아나이드-4-페닐하이드라존(FCCP) 및 0.5 μM 로테논/안티마이신 A를 22분 간격으로 첨가하였다. 소모량을 최종 혼합물로부터 추출된 단백질로 정규화 하였다. 각 실험에서 산소 소모를 2회 반복하였다.
트랜스펙션
80% 컨플루언시에서 분화된 지방 세포를 표적 siRNA 또는 대조군 scrambled siRNA(20 nM)로 리포펙타민 RNAiMAX(Invitrogen)를 사용하여 제조사의 지시에 따라 48시간 동안 트랜스펙션 시켰다.
공초점 현미경
p62와 미토콘드리아의 PLD2 억제제에 의해 유도된 공동 국재화(co-localization)를 시각화하기 위하여, 일차 지방 세포를 6웰 플레이트의 커버 슬립에 분주하였다. 세포를 15분 동안 3% 파라포름알데하이드에서 고정시키고, 실온에서 5분 동안 PBS에 용해된 0.1% 트리톤 X-100에서 투과화(permeabilized) 하였다. 2% 소 혈청 알부민을 함유하는 PBS와 함께 20분 동안 인큐베이션 한 후, 샘플을 Tom20(1:200; FL-10, sc-17764, Santa Cruz Biotechnology)에 대한 마우스 단일클론항체 및 p62에 대한 토끼 다클론항체(1:500, ab91526)와 함께 실온에서 3시간 동안 인큐베이션 하였다. 샘플을 PBS로 3회 세척하고, 2차 항체와 함께 2시간 동안 인큐베이션하고, 15분 동안 DAPI로 대조 염색하였다. 커버 슬립을 유리 슬라이드에 장착하고, Zeiss LSM700 현미경으로 시각화하였다. 획득한 이미지를 Adobe Photoshop으로 처리하였다.
투과전자현미경(Transmission electron microscopy)
먼저 조직을 실온에서 0.1M 포스페이트(pH 7.3)에 용해된 2.5% 글루타알데하이드로 2시간 동안 고정시켰다. 고정 후 조직에 0.1% 포스페이트 버퍼(pH 7.3)에 용해된 1% OsO4 및 1.5% 페로시안화 칼륨(potassium ferrocyanide)을 암 조건에서 4℃의 온도에서 1시간 동안 처리하고, 에탄올 및 프로필렌 옥사이드 시리즈(propylene oxide series)에서 탈수 후 Epon 812에 포매하였다. 70℃에서 2일 동안 순수한 레진을 사용하여 중합을 수행하였다. 초마이크로톰(EM UC7, Leica, Austria)으로 초박형 절편(70 nm)을 얻은 다음 100 메쉬 구리 격자판에서 수거하였다. 2% 우라닐 아세테이트(15 분) 및 납 시트레이트(5 분)로 염색 한 후, 절편을 한국기초과학연구소(KBSI)에서 투과전자현미경으로 120 kV(JEM-1400Plus)에서 분석하였다.
유세포 분석
수득된 지방 세포 및 SVF의 세포를 15분 동안 Fc 블록(Fc block)과 함께 배양하였다. 블로킹 후, 세포를 FACS 버퍼에 재현탁 시키고, 암 조건에서 4℃에서 30분 동안 CD45(30-F11; ThermoFisher; 11-0451-82)로 염색하였다. CD45+ 세포를 FACSCanto II(BD biosciences)를 사용하여 획득하고, FACS Diva(BD biosciences) 및 FlowJo(TreeStar) 소프트웨어 프로그램으로 분석하였다.
미토콘드리아에 대한 유세포 분석
WT 마우스의 갈색 지방 조직 유래의 성숙된 갈색 지방 세포를 37℃ 인큐베이터에서 3시간 또는 24시간 동안 DMSO, 10 μM CAY10594 또는 20 μM CCCP로 자극하였다. 자극된 세포를 37℃에서 30분 동안 100 nM의 TMRM(ThermoFisher, I34361)으로 염색하였다. 이후 세포를 PBS로 세척하고, FACSCanto II(BD biosciences) 및 FlowJo(TreeStar) 소프트웨어 프로그램을 사용하여 분석하였다.
통계 분석
모든 결과를 GraphPad prism 소프트웨어를 사용하여 평가하였다. 일원 분산분석(ANOVA) 후 Student 's t-test를 사용하여 통계 분석을 수행하였다. 모든 결과를 평균±SEM으로 표시하였다. P값 <0.05를 통계적으로 유의한 것으로 간주하였다.
실시예 1. HFD는 지방 조직에서 PLD2를 상향 조절한다.
PLD 이소형(isoform)은 다양한 조직에서 흔히 발현되는 것으로 여겨지지만(Trujillo Viera et al., PLoS One. 11, e0157607, 2016), 지방 조직이 PLD 이소형을 발현하는지는 확실하지 않다. 본 발명자들은 qPCR을 이용하여 여러 지방 조직에서의 Pld1 및 Pld2의 발현을 조사하였다. Pld1 및 Pld2 mRNA의 고발현은 내장 부고환 백색 지방 조직(epididymal white adipose tissue, epiWAT)에서 보다 피하 서혜부 백색 지방 조직(inguinal white adipose tissue, ingWAT) 및 BAT에서 관찰되었다(도 1a). 이러한 결과는 PLD 이소형의 mRNA 발현이 각 지방 조직에서 상이하다는 것을 나타낸다. 다음으로 본 발명자들은 다른 지방 조직에서 PLD 이소형의 발현에 대한 HFD의 영향을 조사하였다. 12주간 HFD를 섭취한 마우스는 ingWAT 및 BAT에서 증가된 Pld2 mRNA 수준을 보였으나, epiWAT 및 다른 기관에서는 그렇지 않았다(도 1b 우측). 그러나, Pld1 mRNA의 발현 수준은 ingWAT 및 BAT에서 HFD에 의해 영향 받지 않았다(도 1b 좌측). ingWAT 및 BAT에서 PLD2의 선택적인 상향 조절은 웨스턴 블롯 분석에 의해서도 확인되었다. PLD1이 아닌 PLD2의 수준은 정상 식이(normal chow diet, NCD)와 비교하여 HFD에 의해 ingWAT 및 BAT에서 유의하게 증가되었다(도 1c). PLD 활성의 측정 역시 NCD 섭취 마우스와 비교하여 HFD 섭취 마우스로부터 분리된 ingWAT 및 BAT에서 증가된 PLD 활성을 보여주었다(도 1d). HFD 섭취 마우스가 ingWAT에서 증가된 PLD2를 나타냄을 확인함에 따라, 본 발명자들은 HFD에 의해 상향 조절된 PLD2의 세포 요인(cellular identity)을 조사하였다. 본 발명자들은 HFD 섭취 마우스의 ingWAT로부터 기질 혈관 분획(stromal vascular fraction, SVF)의 지방 세포 및 CD45+(백혈구 공통 항원) 세포를 분리하였다. Pld2 mRNA 수준은 지방 세포에서 HFD에 의해 현저히 증가하였으나, HFD 섭취 마우스의 ingWAT로부터 분리된 CD45+ 세포에서는 그렇지 않았다(도 1e). 이러한 결과는 HFD에 의해 ingWAT 및 BAT에서 선택적으로 증가된 PLD2가 지방 조직의 지방 축적(adiposity)과 직접적으로 관련될 수 있음을 시사한다.
실시예 2. β-AR(β-adrenergic receptor) 활성화는 발열성(thermogenic) 지방 조직에서 PLD2 하향 조절을 촉진한다.
PLD2가 HFD에 의해 ingWAT 및 BAT에서 상향 조절됨을 확인함에 따라, 본 발명자들은 발열성 지방 조직(ingWAT 및 BAT)에서 교감 신경계(sympathetic nervous system, SNS) 활성화가 PLD 수준에 미치는 효과를 조사하였다. SNS 활성화를 위하여, C57BL/6 마우스를 추운 환경(4~6℃에서 7일 동안 두거나, 또는 β3-AR 작용제인 CL316,243(CL)로 7일 동안 매일 주사하였다(도 2a). 이전에 보고된 바와 같이(Cypess et al., Cell Metab. 21, 33-38, 2015), 저온 또는 β3-AR 작용제 처리에 의한 SNS의 활성화는 ingWAT 및 BAT에서 잘 알려진 발열 단백질인 UCP1의 상향 조절을 유도하였다(도 2b). 그러나, mRNA 수준과는 달리, PLD2 단백질 수준은 ingWAT 및 BAT에서 SNS 활성화에 의해 현저하게 감소되었다(도 2b). PLD 활성도 ingWAT 및 BAT에서 SNS 활성화에 의해 상당히 감소되었다(도 2c).
다음으로, 본 발명자들은 β3-AR 작용제가 일차 갈색 지방 세포에서 PLD2의 분해를 직접 유발하는지 조사하였다. 이소프레날린 또는 CL을 이용하여 BAT로부터 분리된 일차 지방 세포를 자극한 경우 자극 후 3-24시간에 PLD2 감소를 유도하였다(도 2d). 이소프레날린에 의해 유도된 PLD2의 감소는 β3-AR 길항제(SR59230A)에 의해 억제되었고(도 2e), 이는 상기 과정에서 β3-AR의 결정적인 역할을 보여준다. 이전 보고는 프로테아좀 활성이 갈색 지방의 열 발생 능력에 중요하다는 것을 보여주었다(Bartelt et al., Nat. Med. 24, 292-303, 2018). 이에, 본 발명자들은 β-AR 활성화에 의하여 유도된 프로테아좀(proteasomal) 활성이 지방 세포에서 PLD2 수준에 영향을 미칠 수 있는지 조사하였다. 이소프레날린에 의하여 유도된 PLD2의 감소는 리소좀 억제제(클로로퀸)에 의해서는 억제되지 않았으나, 프로테아좀 억제제(보르테조밉)에 의해서는 억제되었다(도 2f). 이러한 결과는 갈색 지방 세포에서 PLD2가 프로테아좀 활성화를 통하여 β-AR 활성화에 의해 감소됨을 보여준다.
실시예 3. 지방 세포-특이적 Pld2 결핍은 발열성 지방 조직에서 발열 프로그램을 활성화시킨다.
PLD2가 HFD에 의해 상향 조절되고 β3-AR 활성화에 의해 하향 조절되었음을 확인함에 따라, 본 발명자들은 지방 세포-특이적 Pld2 조건부 녹아웃(Pld2 Ad-KO) 마우스 및 대조군 마우스를 생성하여 지방 조직에서 PLD2의 (병리)생리학적 기능적 역할을 평가하였다(도 3a). 8주령의 Pld2 Ad-KO 마우스는 몇몇 지방 조직(epiWAT, ingWAT 및 BAT)에서 Pld2의 거의 완전한 녹다운을 나타내었지만, 간에서는 그렇지 않았다(도 3b). Pld2 Ad-KO 마우스는 대조군 마우스와 비교하여 epiWAT 및 ingWAT와 같은 지방 조직의 크기와 중량이 상당히 작은 것으로 나타났다(도 3c 및 3d). BAT의 크기와 중량은 간과는 크게 다르지 않았지만, BAT는 대조군 마우스와 비교하여 Pld2 Ad-KO 마우스에서 보다 더 갈색이었다(도 3c 및 3d). 조직학적 분석은 Pld2 Ad-KO 마우스가 대조군 마우스와 비교하여 ingWAT 및 BAT에서 더 작은 지방 방울(lipid droplet)을 나타냄을 보여주었다(도 3e). 면역조직화학적 분석은 Pld2 Ad-KO 마우스에서 분리된 발열성 지방 조직에서 UCP1 발현 수준이 현저하게 증가되었음을 보여주었다(도 3e). 그러나, 대조군과 Pld2 Ad-KO 마우스의 epiWAT에서는 지방 방울 및 UCP1 발현에 있어 발견 가능한 차이가 관찰되지 않았다(도 3e). 또한, 대조군 및 Pld2 Ad-KO 마우스에서 분리된 ingWAT 및 BAT의 여러 열 발생 관련 유전자의 발현 수준을 비교하였다. 먼저, Ucp1 mRNA 수준은 대조군 마우스에서보다 Pld2 Ad-KO 마우스의 ingWAT에서 증가하였다. 다른 열 발생 관련 유전자 역시 대조군 마우스에서보다 Pld2 Ad-KO의 ingWAT에서 더 높았다: 이들 유전자는 cytochrome c oxidase subunit 7A (Cox7a), cytochrome c oxidase subunit 8b (Cox8b), cytochrome complex (Cycs)와 같은 미토콘드리아 유전자, 및 elongation of very long chain fatty acid protein 3 (Elovl3), peroxisome proliferator-activated receptor gamma coactivator 1-alpha (Pgc1a) 및 cell death-inducing DNA fragmentation factor alpha-like effector A (Cidea)와 같은 다른 유형의 발열성 유전자를 포함한다(도 3f, 좌측). 또한, Pld2 Ad-KO 마우스의 BAT는 대조군 마우스에서보다 몇몇 발열성 유전자(Ucp1, Cycs, Pgc1a 및 iodothyronine deiodinase 2 (Dio2))의 현저한 증가를 보였다(도 3f, 우측).
체온 변화를 4℃ 챔버에서 모니터링 하였다. 비록 대조군 마우스는 4시간 내에 체온이 약 32℃로 급격히 감소한 것으로 나타났지만, Pld2 Ad-KO 마우스는 동일한 조건에서 34℃를 초과하여 상당히 높은 체온을 나타내었다(도 3g). 이러한 결과는 Pld2의 지방 세포-특이적 결실이 저온으로부터 보호하기 위한 증가된 열 발생 효과에 기여하는 에너지 소비를 향상시킨다는 것을 보여준다.
실시예 4. Pld2 Ad-KO 마우스는 HFD-유도된 비만에 내성이 있으며, HFD- 유도된 인슐린 저항성으로부터 보호 효과를 나타낸다.
증가된 UCP1 발현 및 에너지 소비는 HFD-유도된 비만 및 당뇨병으로부터 마우스를 보호한다(Brondani et al., Arq. Bras. Endocrinol. Metabol, 2012). Pld2 Ad-KO 마우스가 발열성 지방 조직에서 UCP1의 증가된 발현과 증가된 에너지 소비를 나타냄을 발견함에 따라(도 3), 본 발명자들은 HFD 후 체중 증가에 대한 Pld2의 지방 세포-특이적 결실의 효과를 조사하였다. Pld2 Ad-KO 마우스는 HFD에 대하여 대조군 마우스와 비교하여 체중이 상당히 감소된 것으로 나타났다(도 4a 및 4b). 그러나, 음식 섭취량은 대조군 및 Pld2 Ad-KO 마우스에서 다르지 않았다(도 4c). Pld2 Ad-KO 마우스는 또한 대조군 마우스와 비교하여 몇몇 지방 조직(epiWAT, ingWAT, BAT)의 더 작은 크기와 갈변 효과, 및 이러한 지방 조직의 감소된 무게를 보였다(도 4d 및 4e). 조직학적으로, Pld2 Ad-KO 마우스는 대조군 마우스와 비교하여 epiWAT, ingWAT 및 BAT에서 더 작은 지방 세포 크기 및 더 작은 지방 방울을 나타냈다(도 4f). 지방간 및 지방 세포 비대는 HFD-유도된 비만의 잘 알려진 표현형이다(Sarwar et al., Diabetes Metab. Syndr. Obes. 11, 533-542, 2018). 본 발명자들 역시 HFD가 대조군 마우스에서 지방간 및 지방 세포 비대를 유도하였음을 관찰하였다. 그러나, 지방간 및 지방 세포 비대는 HFD 섭취한 Pld2 Ad-KO 마우스의 간에서 분명하게 관찰되지 않았다(도 4g). HFD-유도된 비만은 제2형 당뇨병의 병리학적 진행을 매개하는 인슐린 저항성을 동반한다(Taylor, Diabetes. 61, 778-779, 2012). 본 발명자들은 HFD 섭취한 마우스에서 포도당 대사에 대한 지방 세포-특이적 Pld2 결실의 효과를 조사하였다. 더 적은 지방 축적과 일치하게, Pld2 Ad-KO 마우스의 섭취 또는 공복 포도당 수치는 대조군 마우스의 수치보다 현저히 낮았다(도 4h). Pld2 Ad-KO 마우스의 혈액 인슐린 수준은 섭취 또는 공복 조건 하에서 대조군 마우스의 것보다 현저히 낮았다(도 4i). 경구 포도당 내성 시험(O-GTT)은 Pld2 Ad-KO 마우스가 대조군 마우스와 비교하여 개선된 포도당 내성을 가짐을 보여 주었다(도 4j). 독립적 인슐린 내성 시험(ITT)은 Pld2 Ad-KO 마우스가 대조군 마우스와 비교하여 인슐린에 반응하여 더 낮은 수준의 혈당을 보여주었다(도 4k). HFD-유도된 비만 및 혈당 수준은 인슐린 다운스트림의 세포 신호전달의 감소를 나타내는 인슐린 저항성과 관련이 있기 때문에(Wilcox, Clin. Biochem. Rev. 26, 19-39, 2005), 본 발명자들은 인슐린 투여에 대한 epiWAT 및 간에서의 Akt 및 GSK3β와 같은 일부 신호전달 분자의 활성을 HFD 섭취 대조군 및 Pld2 Ad-KO 마우스에서 비교하였다. 인슐린 투여에 따른 pAkt 및 pGSK3β의 수준은 대조군 마우스와 비교하여 Pld2 Ad-KO 마우스의 epiWAT 및 간에서 현저하게 증가하였다(도 4l). NCD 섭취한 Pld2 Ad-KO 마우스 역시 대조군 마우스와 비교하여 인슐린 투여에 반응하여 증가된 인슐린 민감성 및 pAkt, pGSK3β의 수준을 보여주었다. 내장 WAT의 염증은 전형적으로 제2형 당뇨병의 발병과 관련되어 있다(Schuster, Diabetes Metab. Syndr. Obes. 3, 53-262, 2010). 염증 유발 관련 유전자인 종양 괴사 인자-알파(Tnfα), 인터루킨-6(Il6) 및 인터루킨-1β(Il1b)의 수준은 대조군 마우스와 비교하여 HFD-유도된 Pld2 Ad-KO 마우스의 epiWAT에서 감소하였으나, 항염증 유전자인 인터루킨-10(Il10)은 대조군 마우스와 Pld2 Ad-KO 마우스에서 다르지 않았다(도 4m). 이러한 결과는 Pld2 Ad-KO 마우스가 대조군 마우스와 비교하여 HFD-유도된 비만 및 제2형 당뇨병에 대해 보호 효과를 나타내는 더 높은 에너지 소비를 나타냄을 보여준다.
실시예 5. PLD2의 약리학적 억제는 발열 프로그램을 향상시킴으로써 HFD- 유도된 비만 및 포도당 대사를 개선시킨다.
지방 세포-특이적 Pld2 결실이 증가된 발열성 에너지 소비를 통해 HFD-유도된 비만 및 인슐린 저항성을 개선시켰음을 확인함에 따라, 본 발명자들은 발열 효과에 대한 PLD2 특이적 억제제(CAY10594)의 효과를 조사하였다. 유사한 체중의 WT 마우스에 7일 연속으로 CAY10594 또는 비히클 대조군을 주사하였다. 비히클 또는 CAY10594 주사된 마우스의 체질량은 다르지 않았지만, 비히클과 비교하여 ingWAT 및 BAT의 중량이 CAY10594에 의해 감소되었다. 조직학적으로, CAY10594 주사된 마우스의 ingWAT 및 BAT는 비히클 주사된 마우스보다 작은 지방 세포 크기 및 많은 UCP1 양성 염색 세포를 가졌다. 분자 수준에서, CAY10594 처리는 비히클 처리와 비교하여 ingWAT 및 BAT에서 발열 관련 유전자의 더 높은 발현을 초래하였다. 이러한 결과는 PLD2 억제가 발열 관련 인자의 상향 조절을 유도한다는 것을 보여준다. 이후, PLD2 억제가 CAY10594와 함께 HFD 공급 하에서 비만을 개선시키는지 여부를 조사하였다(도 5a). 가벼운 비만(mildly obese, 4주 HFD 섭취) 마우스에 2일마다 10주 동안 비히클 또는 CAY10594를 주사하였다(도 5a 및 5b). 놀랍게도, CAY10594 주사는 음식 섭취에 영향을 미치지 않으면서 HFD 섭취에 반응하여 체중 증가를 상당히 감소시켰다(도 5b 및 5c). 체중 감소와 일관되게, CAY10594 주사된 마우스는 비히클 주사된 마우스와 비교하여 더 작은 복부 지방 크기, 적은 지방량 및 다양한 지방 조직(fat depot)의 더 적은 중량을 나타내었다(도 5d-5e) 조직학적으로, CAY10594 주사된 마우스는 epiWAT, ingWAT 및 BAT에서 더 작은 지방 방울의 크기를 나타냈다(도 5f). 또한, O-GTT 분석에 따르면 CAY10594 투여된 마우스는 비히클 투여된 마우스에 비해 현저히 낮은 혈당 수준을 나타냈다(도 5g). ITT 분석 역시 CAY10594 투여된 마우스가 비히클 투여된 마우스에 비해 인슐린의 복강 내(i.p.) 주사에 반응하여 현저히 낮은 혈당 수준을 나타냈다(도 5h). CAY10594는 또한 epiWAT에서 염증 관련 유전자 발현의 조절을 통해 염증 정도를 개선시켰다(도 5i). 종합적으로, 이러한 결과는 PLD2 억제제 CAY10594가 포도당 대사를 향상시킴으로써 HFD-유도된 비만에 대한 치료 효과를 나타낸다는 것을 보여준다.
실시예 6. CAY10594는 AMPK의 활성화와 p62의 상향 조절을 통하여 미토콘드리아 질을 향상시킨다.
다음으로 본 발명자들은 PLD2-조절된 지방 과다와 관련된 분자 메커니즘을 조사하였다. 이전 보고는 미토콘드리아의 질 관리와 미토파지(mitophagy) 조절이 지방 과다와 관련이 있음을 보여주었다(Bournat and Brown, Curr. Opin. Endocrinol. Diabetes Obes. 17, 446-452, 2010). 이에, 본 발명자들은 PLD2 억제제를 사용하여 미토콘드리아 기능에 대한 PLD2의 역할을 조사하였다. 미토콘드리아 산소 소비율(OCR) 측정 결과, CAY10594에 의한 일차 갈색 지방 세포의 자극은 특히 양성자 누출 및 최대 OCR 등 현저히 증가된 OCR을 보여주었다(도 6a). 이러한 결과는 CAY10594가 미토콘드리아 질을 조절할 수 있음을 보여준다.
이전의 보고는 저온 스트레스 및 β-AR 자극에 반응한 열 생성을 위해 지방 세포 AMPK가 필요하다는 것을 입증했다(Mulligan et al., J. Physiol. 580, 677-684, 2007). 본 연구에서, CAY10594에 의한 지방 세포 자극이 AMPK 인산화(Thr 172 잔기)를 유도하였음을 발견했다(도 6b). CAY10594는 또한 아세틸-CoA 카르복실라제(AMPK의 기질)의 인산화(Ser79 잔기)를 유도하였는데, 이는 증가된 β-산화(β-oxidation) 및 아세틸-CoA의 미토콘드리아로의 후속 수송에 필요하다(Shi and Tu, Curr. Opin. Cell Biol. 33, 125-131, 2015). 인 비보 데이터와 일치하게, CAY10594 처리는 지방 세포에서 UCP1 발현을 상향 조절하였다(도 6b). 이러한 결과는 CAY10594가 지방 세포에서 AMPK 활성화 및 UCP1 발현을 유도함을 시사한다. CAY10594에 의한 지방 세포 자극은 또한 AMPK의 활성화를 위한 주요 키나아제인 LKB1의 인산화를 증가시켰다(도 6c)(Shackelford and Shaw, Nat. Rev. Cancer. 9, 563-575, 2009). Lkb1에 대한 siRNA를 사용한 Lkb1의 녹다운은 CAY10594-유도된 AMPK 인산화를 차단하였고(도 6d), 이는 CAY10594가 LKB1을 통하여 AMPK 인산화를 유도함을 보여준다. 지방 세포에서 발열 프로그래밍의 활성화에 대한 CAY10594의 유익한 효과가 인간에게도 적용 가능한지 알아보기 위하여, 발열 활성 관련 인자에 대한 CAY10594의 효과를 조사하였다. CAY10594에 의한 인간 일차 지방 세포의 자극은 LKB1 인산화, AMPK 인산화, p62 및 UCP1의 수준을 현저하게 증가시켰다(도 6e).
이전의 보고는 p62가 미토파지(mitophagy)를 조절함으로써 미토콘드리아 질을 조절하는데 중요하다는 것을 보여주었다(Liu et al., J. Bioenerg. Biomembr. 49, 413-422, 2017). 이소프레날린 및 CL과 같은 β-AR3 작용제에 의한 지방 세포의 자극은 p62의 발현 수준을 상향 조절하였다(도 6f). β-AR3 작용제와 마찬가지로, CAY10594를 사용한 지방 세포의 자극은 자극 후 3시간 또는 24시간에 p62의 발현 수준을 증가시켰다(도 6f). 또한, CAY10594에 의한 지방 세포의 자극은 특히 CAY10594 처리 3시간 후에 미토콘드리아에서 p62의 국소화(localization)를 향상시켰다(Tom20 항체에 의해 염색)(도 6g). 미토파지는 미토콘드리아 막 전위의 탈분극을 필요로 하기 때문에(Twig and Shirihai, Antioxid. Redox. Signal. 14, 1939-1951, 2011), 본 발명자들은 TMRM(Tetramethylrhodamine, methyl ester)을 사용하여 미토콘드리아 막 전위의 변화에 대한 CAY10594의 효과를 조사하였다. CAY10594는 자극 후 3시간째에 TMRMlow 집단을 유의하게 증가시켰지만, 자극 후 24시간째에 TMRMhigh 집단을 유의하게 증가시켰는데(도 6h), 이러한 결과는 CAY10594는 3시간째에 미토콘드리아 활성을 감소시켰으나 24시간째에는 증가시켰음을 보여준다. CAY10594는 자가포식 단백질 LC3B 축적을 촉진한다(도 6i). 본 발명자들은 또한 CAY10594가 미토콘드리아 분열(mitochondrial fission) 관련 단백질인 DRP1의 인산화 상태에 영향을 미쳐, 지방 세포에서 DRP1(Phospho-Ser616) 수준은 증가하지만 DRP1(Phospho-Ser637) 수준은 감소한다는 것을 관찰하였다(도 6j). 미토콘드리아의 질은 활성산소종과 ATP 생성에 필수적인 역할을 하는 OXPHOS 성분의 발현 수준과 관련이 있다(Held and Houtkooper, Bioessays. 37, 867-876, 2015). CAY10594를 이용한 지방 세포의 자극은 CAY10594 자극에 반응하여 24시간 후 complex V, IV, III, II 및 I와 같은 OXPHOS 성분의 발현 수준을 약간 증가시켰다(도 6k). 이전 보고에 따르면, 팔미테이트는 배양 세포에서 미토콘드리아 막 전위의 소실을 유도한다(Hammerschmidt et al., Cell. 177, 1536-1552, 2019).
이에, 본 발명자들은 팔미테이트의 존재 하에서 CAY10594에 의한 미토콘드리아 막 전위 수준을 확인하였다. 팔미테이트는 TMRMlow 집단을 증가시켰지만, TMRMhigh 집단은 감소시켰다. CAY10594의 추가는 TMRMhigh 집단은 증가시켰지만, 24시간 후 TMRMlow 집단을 증가시켰다(도 8a). 이 결과는 CAY10594가 미토콘드리아의 질을 향상시킨다는 상기 실험결과와 일치한다. 따라서, PLD2 억제는 AMPK 활성화-유도된 미토콘드리아 신생(mitochondrial biogenesis) 및 p62-유도된 미토파지를 통해 미토콘드리아 질 조절(quality control)을 촉진한다. Pld2 Ad-KO 마우스로부터 유래된 BAT SVF 세포 역시 대조군 마우스와 비교하여 LKB1 인산화와 AMPK 인산화뿐만 아니라, p62 및 UCP1의 수준을 현저하게 증가되었음을 보여주었다(도 8b). 이러한 결과는 PLD2가 LKB1 및 AMPK의 활성 및 p62 및 UCP1의 후속적인 발현을 음성적으로 조절한다는 것을 뒷받침한다.
실시예 7. Pld2 Ad-KO 마우스 및 CAY10594-주사된 마우스는 HFD 모델의 지방 조직에서 개선된 미토콘드리아 질을 나타낸다.
다음으로, 본 발명자들은 HFD 마우스의 ingWAT 및 BAT에서의 p62 발현, AMPK 인산화 및 UCP1 발현에 대한 지방 조직-특이적 Pld2 결실의 효과를 조사하였다. Pld2 Ad-KO 마우스는 대조군 마우스와 비교하여 ingWAT 및 BAT에서 약간 증가한 LKB1의 인산화 및 현저히 증가한 AMPK의 인산화를 보였다(도 7a). 더욱이, p62 및 UCP1의 수준은 HFD 모델에서 대조군 마우스와 비교하여 Pld2 Ad-KO 마우스의 ingWAT 및 BAT에서 뚜렷하게 증가하였다(도 7a). TEM 분석은 HFD 모델에서 Pld2 Ad-KO의 BAT가 대조군 마우스와 비교하여 현저하게 증가된 수의 미토콘드리아를 가지고 있음을 보여주었다(도 7b). 이러한 결과는 Pld2의 지방 세포 특이적 결실이 미토콘드리아 수 및 질, p62 상향 조절 및 AMPK 활성화를 개선시킨다는 것을 보여준다. PLD2 선택적 억제제인 CAY10594 또한 HFD 모델에서 ingWAT 및 BAT에서 LKB1 및 AMPK의 인산화뿐만 아니라, p62의 발현을 현저하게 증가시켰다(도 7c). 미토콘드리아 수 또한 비히클 주사된 마우스와 비교하여 HFD 섭취한 마우스의 BAT에서 CAY10594에 의해 현저하게 증가하였다(도 7d). 종합적으로, Pld2의 지방 세포-특이적 결실 또는 CAY10594를 사용한 PLD2의 약리학적 억제는 미토콘드리아 수뿐만 아니라, 개선된 미토콘드리아 질을 유도한다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따르면, 포스포리파아제 D2 억제제는 지방 조직의 열 발생 프로그램을 활성화시켜 지방 조직을 이루는 지방 세포의 지방 축적을 현저히 감소시킬 수 있으며, 지방 세포의 미토콘드리아를 질적, 양적으로 개선시킬 수 있다. 또한, 포스포리파아제 D2 억제제는 고지방식에 의해 유도된 지방간과 제2형 당뇨를 효과적으로 완화시킬 수 있다. 따라서, 본 발명은 비만, 당뇨병 및 인슐린저항성과 같은 대사성 질환의 치료제로서 유용하게 사용될 수 있을 것으로 기대된다.

Claims (13)

  1. 포스포리파아제 D2(Phospholipase D2) 유전자의 발현 또는 단백질의 활성을 억제하는 제제를 유효성분으로 포함하는, 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 포스포리파아제 D2 유전자의 발현을 억제하는 제제는 상기 유전자의 mRNA에 상보적으로 결합하는 miRNA, siRNA, shRNA, 리보자임(ribozyme), DNAzyme, PNA(peptide nucleic acid) 및 안티센스 올리고뉴클레오티드로 구성된 군으로부터 선택되는 것을 특징으로 하는, 약학적 조성물.
  3. 제1항에 있어서,
    상기 포스포리파아제 D2 단백질의 활성을 억제하는 제제는 포스포리파아제 D2 단백질에 결합하는 항체, 앱타머, 펩타이드 및 화합물로 구성된 군으로부터 선택되는 것을 특징으로 하는, 약학적 조성물.
  4. 제3항에 있어서,
    상기 화합물은 CAY10594(N-[2-(4-oxo-1-phenyl-1,3,8-triazaspiro[4,5]dec-8-yl)ethyl]-2-naphthalene carboxamide) 또는 이의 약학적으로 허용 가능한 염인 것을 특징으로 하는, 약학적 조성물.
  5. 제1항에 있어서,
    상기 당뇨병은 제2형 당뇨병인 것을 특징으로 하는, 약학적 조성물.
  6. 제1항에 있어서,
    상기 당뇨병은 비만성 당뇨병인 것을 특징으로 하는, 약학적 조성물.
  7. 제1항에 있어서,
    상기 포스포리파아제 D2 유전자의 발현 또는 단백질의 활성을 억제하는 제제는 지방 조직의 열 발생 프로그램(Thermogenic program)을 향상시키는 것을 특징으로 하는, 약학적 조성물.
  8. 포스포리파아제 D2(Phospholipase D2) 유전자의 발현 또는 단백질의 활성을 억제하는 제제를 유효성분으로 포함하는, 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 개선용 건강기능식품 조성물.
  9. 다음의 단계를 포함하는 비만, 당뇨병 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 물질의 스크리닝 방법:
    (a) 분리된 세포 또는 조직에 후보물질을 접촉시키는 단계; 및
    (b) 상기 세포 또는 조직에서 포스포리파아제 D2 단백질의 수준 또는 상기 단백질을 코딩하는 유전자의 mRNA 수준을 측정하는 단계.
  10. 제9항에 있어서,
    상기 분리된 세포 또는 조직은 지방 세포 또는 지방 조직인 것을 특징으로 하는, 스크리닝 방법.
  11. 제1항에 따른 약학적 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 비만, 당뇨병, 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료방법.
  12. 포스포리파아제 D2(Phospholipase D2) 유전자의 발현 또는 단백질의 활성을 억제하는 제제의 비만, 당뇨병, 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방, 개선 또는 치료 용도.
  13. 비만, 당뇨병, 및 인슐린저항성으로 구성된 군으로부터 선택된 대사성 질환의 예방 또는 치료용 제제의 제조를 위한, 포스포리파아제 D2(Phospholipase D2) 유전자의 발현 또는 단백질의 활성을 억제하는 제제의 용도.
PCT/KR2021/006807 2020-06-03 2021-06-01 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물 WO2021246755A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0067339 2020-06-03
KR1020200067339A KR102324725B1 (ko) 2020-06-03 2020-06-03 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2021246755A1 true WO2021246755A1 (ko) 2021-12-09

Family

ID=78516282

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006807 WO2021246755A1 (ko) 2020-06-03 2021-06-01 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR102324725B1 (ko)
WO (1) WO2021246755A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115227706A (zh) * 2022-06-08 2022-10-25 珍奥集团股份有限公司 5’-单磷酸核苷酸组合物在制备消脂减肥功能食品和药物中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010138869A1 (en) * 2009-05-29 2010-12-02 The Trustees Of Columbia University In The City Of New York Modulation of phospholipase d for the treatment of neurodegenerative disorders
US20110212889A1 (en) * 2008-06-05 2011-09-01 University Of Michigan Use of leptin for the treatment of fatty liver diseases and conditions
KR101647918B1 (ko) * 2015-03-09 2016-08-11 성균관대학교산학협력단 포스포리파제 d2 억제제를 유효성분으로 포함하는 박테리아 감염 질환 예방 또는 치료용 조성물
KR20170110381A (ko) * 2016-03-23 2017-10-11 포항공과대학교 산학협력단 포스포리파아제 d의 발현 또는 활성 억제제를 유효성분으로 포함하는 염증성 장 질환의 예방 또는 치료용 약학적 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110212889A1 (en) * 2008-06-05 2011-09-01 University Of Michigan Use of leptin for the treatment of fatty liver diseases and conditions
WO2010138869A1 (en) * 2009-05-29 2010-12-02 The Trustees Of Columbia University In The City Of New York Modulation of phospholipase d for the treatment of neurodegenerative disorders
KR101647918B1 (ko) * 2015-03-09 2016-08-11 성균관대학교산학협력단 포스포리파제 d2 억제제를 유효성분으로 포함하는 박테리아 감염 질환 예방 또는 치료용 조성물
KR20170110381A (ko) * 2016-03-23 2017-10-11 포항공과대학교 산학협력단 포스포리파아제 d의 발현 또는 활성 억제제를 유효성분으로 포함하는 염증성 장 질환의 예방 또는 치료용 약학적 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NELSON ROCHELLE K., YA-PING JIANG, GADBERY JOHN, ABEDEEN DANYA, SAMPSON NICOLE, LIN RICHARD Z., FROHMAN MICHAEL A.: "Phospholipase D2 loss results in increased blood pressure via inhibition of the endothelial nitric oxide synthase pathway", SCIENTIFIC REPORTS, vol. 7, no. 9112, 1 December 2017 (2017-12-01), pages 1 - 13, XP055876772, DOI: 10.1038/s41598-017-09852-4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115227706A (zh) * 2022-06-08 2022-10-25 珍奥集团股份有限公司 5’-单磷酸核苷酸组合物在制备消脂减肥功能食品和药物中的应用
CN115227706B (zh) * 2022-06-08 2023-12-29 陈玉松 5’-单磷酸核苷酸组合物在制备消脂减肥功能食品和药物中的应用

Also Published As

Publication number Publication date
KR102324725B1 (ko) 2021-11-11

Similar Documents

Publication Publication Date Title
Huang et al. The FGF21-CCL11 axis mediates beiging of white adipose tissues by coupling sympathetic nervous system to type 2 immunity
Linnemann et al. Interleukin 6 protects pancreatic β cells from apoptosis by stimulation of autophagy
Meng et al. Autophagy attenuates angiotensin II-induced pulmonary fibrosis by inhibiting redox imbalance-mediated NOD-like receptor family pyrin domain containing 3 inflammasome activation
Sun et al. Nuclear factor (NF)-κB p65 regulates differentiation of human and mouse lung fibroblasts mediated by TGF-β
WO2014182051A1 (ko) Ａｓｍ 억제제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
US20130053312A1 (en) Compositions comprising pedf and uses of same in the treatment and prevention of ovary-related syndromes
WO2021246755A1 (ko) 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물
WO2018056706A1 (ko) 티오레독신 결합단백질 유래 펩타이드 또는 이를 암호화 하는 폴리뉴클레오타이드를 유효성분으로 함유하는 노화 줄기세포의 역노화용 조성물 및 이의 용도
Wang et al. Kynurenic acid ameliorates lipopolysaccharide-induced endometritis by regulating the GRP35/NF-κB signaling pathway
Lee et al. Licoricidin abrogates T-cell activation by modulating PTPN1 activity and attenuates atopic dermatitis in vivo
JP6918839B2 (ja) 概日時計の乱れに関連するマイクロバイオームの調節異常を処置するための方法及び医薬組成物
WO2024039164A1 (ko) 스테포게닌을 유효성분으로 포함하는 암 예방, 개선, 또는 치료용 조성물
WO2018074862A2 (ko) Tha를 유효성분으로 포함하는 유방암 치료용 약학적 조성물
WO2019039700A1 (ko) 멜리틴을 포함하는 m2형 종양관련 대식세포 제거용 조성물
WO2014042392A1 (ko) 메트포민을 이용한 루프스를 포함하는 면역질환의 예방 또는 치료용 조성물
WO2020116810A1 (ko) Ｆａｓ 신호전달 억제용 펩티드를 포함하는 비만, 지방간 또는 지방간염의 예방 또는 치료용 약학적 조성물
WO2010021516A9 (ko) 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도
WO2018212503A1 (ko) 조혈모세포의 항상성 유지에 관여하는 cotl1 단백질 및 이의 용도
US20100233199A1 (en) Modulators of hypersensitivity reactions
EP2647386B1 (en) Lissencephaly therapeutic agent
EP3250218B1 (en) Naktide peptide for treating obesity
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
US20230136792A1 (en) Compositions and methods for treating age-related diseases and premature aging disorders
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2022220403A1 (ko) 뇌전증에 의해 유발된 뇌손상 진단용 마커로서의 네오제닌의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21817603

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21817603

Country of ref document: EP

Kind code of ref document: A1