WO2018070819A1 - 시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물 - Google Patents

시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물 Download PDF

Info

Publication number
WO2018070819A1
WO2018070819A1 PCT/KR2017/011284 KR2017011284W WO2018070819A1 WO 2018070819 A1 WO2018070819 A1 WO 2018070819A1 KR 2017011284 W KR2017011284 W KR 2017011284W WO 2018070819 A1 WO2018070819 A1 WO 2018070819A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
ciclesonide
cells
composition
growth
Prior art date
Application number
PCT/KR2017/011284
Other languages
English (en)
French (fr)
Inventor
이동선
최학선
Original Assignee
제주대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 제주대학교 산학협력단 filed Critical 제주대학교 산학협력단
Priority to CN201780077650.8A priority Critical patent/CN110072529B/zh
Priority to US16/341,132 priority patent/US11191746B2/en
Publication of WO2018070819A1 publication Critical patent/WO2018070819A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308—Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention

Definitions

  • the present invention comprises a ciclesonide or a pharmaceutically acceptable salt thereof as an active ingredient, a composition for inhibiting cancer stem cell growth, inhibiting metastasis of cancer comprising the composition, or a pharmaceutical composition for treating or preventing cancer, It relates to a food composition and the like.
  • Cancer stem cells were first identified in myeloid leukemia and then in various solid cancers, including breast, brain, colon, ovary, pancreatic, and prostate cancers.
  • the cancer stem cells are also called tumor-initiating cells and cancer stem-like cells. It has also been shown that various cancer types, including breast cancer, originate from cancer stem cells (CSCs), a subpopulation of tumors. Such populations are known to cause changes in tumor volume through self-renewal and differentiation. Wnt (wingless), Shh (Sonic hedgehog), Stat3, NF- ⁇ B, Wnt / ⁇ -catenin, TGF- ⁇ and Notch signaling pathways are known to be critical for self-renewal of CSCs.
  • CSCs cancer stem cells
  • Wnt wingless
  • Shh Sonic hedgehog
  • Stat3 NF- ⁇ B
  • Wnt / ⁇ -catenin Wnt / ⁇ -catenin
  • TGF- ⁇ and Notch signaling pathways are known to be critical for self-renewal of CSCs.
  • Cancer stem cells exhibit drug resistance and radiation resistance to chemotherapy and radiation therapy and cause cancer to recur and metastasize.
  • targeted therapies for cancer stem cells are essential for the treatment of cancer.
  • Cancer stem cells are known to express certain proteins, including Oct4, C-myc, Nanog, and Aldehyde dehydrogenase-1 (ALDH).
  • the ALDH is an enzyme that oxidizes toxic aldehydes, and its enzymatic activity is widely used as a CSC (cancer stem cells) marker of leukemia, head and neck, bladder, bone, colon, liver, lung, pancreas, prostate, thyroid and cervical cancer. have.
  • ALDH is known as a therapeutic target for cancer stem cells.
  • Stat3 (Signal transducers and activators of transcription 3) is mainly activated in CSCs, and mammosphere formation is associated with the JAK1-STAT3 pathway.
  • Secreted IL-6 activates the JAK1-STAT3 pathway and increases expression of the Oct4 gene.
  • the IL-6 / JAK1 / STAT3 signaling pathway is known to be important for the conversion of NSCCs (Non-CSCs) to CSCs. Blocking the STAT3 signaling pathway is known to inhibit the growth of breast cancer cell-derived CD44 + / CD24- stem cell-like cells.
  • Nuclear factor- ⁇ B (NF- ⁇ B) transcription factor is structurally (constantly) activated in tumor cells, including colon, breast and liver cancer, and regulated by the I ⁇ B kinase (IKK) complex.
  • IKK I ⁇ B kinase
  • Pyrrolidinedithiocarbamate (PDTC) an inhibitor of NF- ⁇ B, is known to inhibit breast cancer stem-like cells.
  • the breast cancer stem cells are known to be identified by the expression of biomarkers such as CD44 high / CD24 low , ESA + (epithelial specific antigen) and ALDH. Chemotherapy is known to increase the proportion of cancer cells expressing CD44 + / CD24 and mammoth formation. CSCs overexpress specific ABC transporters to protect CSCs from toxins. ABC pumps are used to separate side populations (SP) and can be classified by ABCG2 transporter-specific Hoechst 33342 dyes. Because breast CSCs produce low levels of reactive oxygen species (ROS) compared to tumor cells, breast cancer stem-likes cells are radiation resistant.
  • ROS reactive oxygen species
  • CSCs are known to have less DNA damage than non-stem cancer cells (Diehn M, Cho RW, Lobo NA, Kalisky T). , Dorie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, Joshua B, Kaplan MJ, Wapnir I, Dirbas FM, Somlo G, Garberoglio C, et al.Association of reactive oxygen species levels and radioresistance in cancer stem cells.Nature. 2009; 458 (7239): 780-783).
  • the breast cancer cell line MCF-7 is known to have a subset of cells with similar capacity to stem cells that can grow in oval form without apoptosis without attachment in vitro. Artificially creating a non-basement condition by floating culture, the cells with stem cell properties are attached to each other to form a spherical cell mass, which is called a neurosphere. Applying this concept to human breast stem cells is the "mammosphere". Mammoth Fair contains eight times more progenitor cells than normal human breast cells, and can be passaged continuously. After several passages, 100% of the cells grow into bi-potent precursors.
  • Mammoth is capable of differentiating into mammary gland epitherlial cells, ductal epithelial cells, and alveolar epitherlial cells, which are adult breast cells. It is observed to form a complex functional breast structure while forming a three-dimensional structure. Mammoth fair is one of the most characteristic characteristics of stem cells is capable of self-proliferation, so that a large number of mammo pairs or breast stem cells can be obtained from a single mammo pair. In addition, compared with hematopoietic stem cells, neural stem cells, embryonic stem cells, etc., many expression genes were confirmed to overlap, and mammospheres were reported to be actual breast stem cells. The standard method for analyzing the self-renewal ability of cancer stem cells is to analyze the implantation in vivo and the mammosphere formation in vitro.
  • cells having stem cell properties may be attached to each other to form spherical cell masses in various cancer cell lines including breast cancer cells as well as lung cancer, which is called a tumorsphere.
  • the two pairs refers to tumor cells developed by the proliferation of one cancer stem cell or cancer progenitor cell.
  • Lung cancer is the leading cause of cancer-related deaths worldwide, and is classified into two major subtypes: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC).
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • NSCLC non-small cell lung cancer
  • the non-small cell lung cancer (NSCLC) is divided into three subtypes, adenocarcinoma, squamous cell carcinoma and large cell carcinoma.
  • Smoking is a major risk factor for lung cancer.
  • Lung cancer can be treated with chemotherapy and radiation but becomes resistant.
  • the 5-year survival rate of lung cancer is low, and the 1-year survival rate of small cell lung cancer is 40%, and the 5-year survival rate is 5% or less.
  • cancer stem cells have chemical resistance and radiation resistance to chemotherapy and radiotherapy to eradicate bulk tumors, resulting in cancer recurrence and metastasis.
  • treatment targeting CSC is essential for the treatment of lung cancer.
  • cancer stem cells To date, studies on cancer stem cells have many limitations, and the role of cancer stem cells in the formation and maintenance of tumors is not clear. In order to efficiently perform treatments targeting cancer stem cells without damaging normal stem cells, knowledge and understanding of molecular biological characteristics and its regulatory pathways that are important for the maintenance and regulation of cancer stem cells are required.
  • An object of the present invention is to provide a composition for inhibiting cancer stem cell growth, comprising a ciclesonide represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for treating or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • Another object of the present invention to provide a pharmaceutical composition for inhibiting cancer metastasis, comprising the composition for inhibiting cancer stem cell growth.
  • Another object of the present invention is to provide a food composition for improving or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • Another object of the present invention is to provide a food composition for improving or preventing cancer metastasis, comprising the composition for inhibiting cancer stem cell growth.
  • Another object of the present invention is to provide a method for inhibiting the growth of cancer stem cells, comprising administering to a subject a ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a method for inhibiting cancer metastasis, comprising administering to a subject a ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a method for preventing or treating cancer, comprising administering to a subject a ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a use for the manufacture of a medicament for inhibiting the growth of cancer stem cells using the ciclesonide represented by the formula (1) or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a use for the manufacture of a medicament for inhibiting cancer metastasis of the ciclesonide represented by the formula (1) or a pharmaceutically acceptable salt thereof.
  • Still another object of the present invention is to provide a use for the manufacture of a medicament for the prevention or treatment of cancer using the ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the ciclesonide of the present invention inhibits the growth of breast cancer and lung cancer cells, and inhibited the formation of breast cancer and lung cancer stem cells. In addition, it inhibited the expression of self-renewing genes such as Nanog, C-myc, Oct4, Sox2, Snail and CD44, which are known to be characteristically expressed in breast and lung cancer stem cells. Inhibition of the production of IL-6 and IL-8, which are known to be involved in the formation of tumor pairs, was confirmed to inhibit the STAT3 signaling pathway. Accordingly, the compound inhibits the growth of cancer stem cells, such as breast cancer and lung cancer, and the growth of these cancers, and can be used for the treatment of cancers such as breast cancer and lung cancer.
  • FIG. 1 shows that ciclesonide inhibits various cancer features in breast cancer cell lines. Specifically, (A and B) the chemical structure of ciclesonide and the survival rate of ciclesonide for MCF-7 and MDA-MB-231 cells. MCF-7 and MDA-MB-231 cells were treated with increasing concentrations of ciclesonide for 48 hours. The anti-proliferative effect of ciclesonide was measured by MTS analysis.
  • MDA-MB-231 cells were treated with ciclesonide for 24 hours and killed cells were analyzed by FACS using the Annexin V-PI staining kit.
  • Caspase3 / 7 activity in MDA-MB-231 cells was analyzed by Caspase-Gloss 3/7 kit.
  • Apoptotic cells were analyzed by fluorescence staining. Nuclei were stained with Hoechst 33258 (enlarged, x100) in breast cancer.
  • (F) shows the effect of ciclesonide on the migration potential of human breast cancer cells. Wound healing of MDA-MB-231 cells was taken at 0 and 18 hours, depending on whether ciclesonide was treated.
  • FIG. 1 shows the effect of ciclesonide on colony formation in human breast cancer cells.
  • the dissociated 1000 MDA-MB-231 cells were seeded in 6-well plates and treated for 7 days at the indicated concentrations of ciclesonide and DMSO. Representative images of colonies were recorded. Data shown represent mean ⁇ SD of three independent experiments. * p ⁇ 0.05 vs. DMSO-treated control.
  • (B) shows the effect of ciclesonide on the weight of the tumor. Tumor weights were measured after treatment.
  • MCF-7 and MDA-MB-231 cells were incubated under mammoth pairing conditions for 7 days.
  • (A) Shows the effect of ciclesonide on mammoth pair formation derived from MCF-7 cells. Primary mammospheres were incubated with ciclesonide (5 and 10 ⁇ M) or DMSO.
  • FIG. B shows the effect of ciclesonide on mammoth pair formation derived from MDA-MB-231 cells.
  • the mammo pair was incubated with ciclesonide (10 ⁇ M) or DMSO.
  • FIG. B shows the effect of ciclesonide on ALDH positive cell population.
  • MDA-MB-231 cells were treated with ciclesonide (10 ⁇ M) or DMSO for 2 days, followed by ALDEFLUOR analysis and FACS analysis.
  • the right panel shows ALDH positive cells treated with DEAB, an ALDH inhibitor as a negative control, and the left panel shows ALDH positive cells untreated with DEAB.
  • ALDH positive populations are marked in boxes.
  • (A) shows the effect of ciclesonide on STAT3 signaling pathway in mammoth pairs.
  • Nuclear protein expression and activation of STAT3 and NF-kB were measured in mammoth pairs with antibodies to pSTAT3, STAT3, P65 and Lamin B.
  • Cyclasonide reduced levels of nuclear pSTAT3 protein in mammoth pairs.
  • Lane 1 probe alone; Lane 2: probe + nuclear extract; Lane 3: probe plus ciclesonide treated nuclear extract; Lane 4: self competition; Lane 5: nuclear extract incubated with mutant STAT3 probe.
  • the ciclesonide reduced DNA / STAT3 interactions in mammoth nuclear lysates.
  • C shows human inflammatory cytokine analysis of ciclesonide or DMSO treated tumors.
  • the inflammatory cytokines were measured using a BD cytometric bead array (CBA) human inflammatory cytokines kit.
  • CBA analysis was performed using IL-6, IL-8, IL-10, IL-12, IL-1 ⁇ , and TNF antibodies.
  • (B) shows the effect of ciclesonide on mammosphere growth. Cyclasonide inhibits the growth of mammoth pairs. Cyclesonide and DMSO treated mammoth pairs for 2 days were separated into single cells and plated in 6 cm dishes with equal cell numbers. After 24 hours of plating, cells were counted. On days 2 and 3, cells were counted three times and plotted with mean values. The data represent the mean ⁇ SD of three independent experiments. * p ⁇ 0.05 vs. DMSO-treated control.
  • FIG. 7 shows that ciclesonide inhibits various cancer features in lung cancer cell lines.
  • A Survival rate of cylsonide for A549 lung cancer cells. A549 cells were treated with increasing concentrations of ciclesonide for 48 hours. The anti-proliferative effect of ciclesonide was measured by MTS analysis.
  • (E) shows the effect of ciclesonide on the migration potential of human lung cancer cells. Wound healing of A549 cells was taken at 0 and 18 hours, depending on whether ciclesonide was treated.
  • (F) shows the effect of ciclesonide on colony formation in human lung cancer cells.
  • the dissociated 1000 A549 cells were inoculated into 6-well plates and treated with the indicated concentrations of ciclesonide and DMSO for 7 days. Representative images of colonies were recorded. Data shown represent mean ⁇ SD of three independent experiments. * p ⁇ 0.05 vs. DMSO-treated control.
  • FIG. 8 shows the effect of ciclesonide on tumor growth in xenograft models implanted with lung cancer cells. Five million cells were injected into the subcutaneous tissue of immunodeficient NOD-SCID male nude mice.
  • (B) shows the effect of ciclesonide on the weight of the tumor. Tumor weights were measured after treatment.
  • FIG. 9 shows the effect of ciclesonide on tumuspair formation.
  • A549 cells were incubated for 7 days under tomuspher forming conditions.
  • (B) shows the effect of isobutyryl ciclesonide, the active form of ciclesonide on A549 cell derived tomuspher formation.
  • FIG. 10 shows the effect of ciclesonide on ALDH positive cell populations.
  • A549 cells were treated with ciclesonide or DMSO for 2 days, followed by ALDEFLUOR analysis and FACS analysis.
  • the bottom panel shows ALDH positive cells treated with DEAB, an ALDH inhibitor, and the top panel shows ALDH positive cells untreated with DEAB.
  • ALDH positive populations are marked in boxes.
  • FIG 11 shows the effect of ciclesonide on cancer stem cell load in lung cancer.
  • FIG. 12 shows the effect of ciclesonide on protein levels of extracellular IL-8 in two pairs.
  • CBA BD cytometric bead array
  • cancer stem cells are inhibited by using various compounds to inhibit the growth of cancer stem cells.
  • ciclesonide selectively inhibits breast cancer cells and lung cancer stem cells.
  • Cyclasonide is known to be an FDA-approved asthma treatment, but for the first time we have inhibited the growth of breast cancer stem cells and selectively inhibited the STAT3 signaling pathway in breast cancer-derived mammoths as compared to MCF-7 bulk cells. Confirmed.
  • mouse xenograft models were used to effectively inhibit tumor growth. Accordingly, ciclesonide inhibited the growth of cancer stem cells including breast cancer and lung cancer by targeting CSCs, and confirmed that the ciclesonide can be used for treating cancers including breast cancer and lung cancer, and completed the present invention.
  • the present invention provides a composition for inhibiting cancer stem cell growth comprising a ciclesonide represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the ciclesonide (ciclesonide) is known as a treatment for asthma, but the inventors for the first time confirmed that inhibit the growth of breast and lung cancer stem cells.
  • cancer generally refers to or describes the physiological state of a mammal that is characterized by unregulated cell growth.
  • Cancer refers to a condition in which a problem occurs in the regulation of normal division, differentiation and death of cells, abnormally proliferating and invading surrounding tissues and organs to form agglomerates and destroy or modify existing structures.
  • cancer stem cell is an undifferentiated cell having the ability to differentiate into various cancer cells, the cancer including colorectal cancer and colorectal cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer , Brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, liver cancer, esophageal cancer, small intestine cancer, anal muscle cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer , Kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma, intraocular melanoma, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, Penile cancer, central nervous system (
  • breast cancer stem cell refers to an undifferentiated cell having the ability to differentiate into breast cancer cells.
  • lung cancer stem cell refers to an undifferentiated cell having the ability to differentiate into lung cancer cells.
  • breast cancer stem cell growth inhibition is meant to include breast cancer stem cell maintenance (maintenance) inhibition, breast cancer stem cell malignance (inhibition), breast cancer stem cell migration and breast cancer stem cell invasive activity (invasive) inhibition.
  • lung cancer stem cell maintenance maintenance
  • lung cancer stem cell malignance inhibition
  • lung cancer stem cell migration inhibition
  • lung cancer stem cell invasive activity inhibition
  • cicleso to the primary mammosphere (mammosphere) derived from MCF-7 and MDA-MB-231 cells Nade was treated, and the results showed that ciclesonide inhibited the formation of primary mammoths derived from breast cancer cell lines, specifically, mammoths derived from MCF-7 and MDA-MB-231 cells, which are breast cancer cells. Not only did the number of pairs decrease by 90%, but the size of the mammoth pair also decreased (FIGS. 3A and 3B).
  • prednisone prednisone
  • dexamethasone dexamethasone belonging to the same Glucocorticoids
  • the ciclesonide was treated on a primary sphere (tumorsphere) derived from A549 cells, As a result, it was confirmed that ciclesonide inhibited the formation of primary tumourspair derived from lung cancer cell line. Specifically, it was confirmed that the number of tumourspair derived from lung cancer cells A549 cells was reduced by 90%. , It was confirmed that the size of the Tooth Spare also decreased (FIG. 9A).
  • isobutyryl ciclesonide an active form of ciclesonide
  • prednisone and dexamethasone belonging to the same Glucocorticoids did not show lung cancer stem cell inhibitory activity even at 80 ⁇ M (FIG. 9C).
  • the compound of the present invention inhibits the formation of mammosphere (mammosphere) derived from breast cancer, (ii) inhibits the proliferation of mammosphere derived from breast cancer, or (iii) a tumer derived from lung cancer Inhibits the formation of tumorspheres, or (iv) inhibits the proliferation of tumors from lung cancer.
  • the breast cancer stem cells may express one or more self-renewal genes selected from Nanog, C-myc, Oct4, Sox2, and CD44, the lung cancer stem cells are Nanog And one or more self-renewal genes selected from Sox2, C-myc, and Snail.
  • ciclesonide inhibited the expression of self-renewing genes such as Nanog, C-myc, Oct4, Sox2, and CD44, which are known to be characteristically expressed in breast cancer stem cells (FIG. 6A). It was confirmed that the STAT3 signaling pathway was inhibited by being involved in mammosphere formation of cells (FIGS. 5A and 5B). In addition, it was confirmed that the production of IL-6 and IL-8 known to be involved in mammosphere formation of breast cancer stem cells (Fig. 5C). Accordingly, it was confirmed that the compound can inhibit the growth of breast cancer stem cells.
  • self-renewing genes such as Nanog, C-myc, Oct4, Sox2, and CD44
  • ciclesonide inhibited the expression of self-renewing genes such as nanog, sox2, c-myc, and snail, which are known to be characteristically expressed in lung cancer stem cells (FIG. 11A), and are involved in the formation of tumorous stem cells in lung cancer stem cells. It was confirmed that the production of IL-8 known to inhibit (Fig. 12). Accordingly, it was confirmed that the compound can inhibit the growth of lung cancer stem cells.
  • composition of the present invention can be used as a pharmaceutical composition or food composition.
  • composition of the present invention when utilized as a pharmaceutical composition, it may include the ciclesonide or a pharmaceutically acceptable salt thereof.
  • the term "pharmaceutically acceptable salts” refers to all salts that retain the desired biological and / or physiological activity of the compound and exhibit minimal unwanted toxicological effects. Salts prepared according to conventional methods in the art, which methods are known to those skilled in the art. Specifically, the pharmaceutically acceptable salts include, but are not limited to, salts derived from pharmacologically or physiologically acceptable inorganic acids and organic acids and bases.
  • salts derived from inorganic bases may include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts.
  • Salts derived from organic bases include, but are not limited to, primary, secondary and tertiary amines; Substituted amines, including naturally occurring substituted amines; And isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, Hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamine, theobromine, purine, piperazine, piperidine, and / or N-ethylpiperi Salts of cyclic amines, including dean. Also included are other carboxylic
  • salts derived from inorganic acids include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.
  • Salts derived from organic acids are acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid , But may include, but is not limited to, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and / or salicylic acid.
  • the pharmaceutical composition may include a pharmaceutically acceptable carrier or additive.
  • pharmaceutically acceptable means that the subject of application (prescription) is not toxic as long as it is adaptable without inhibiting the activity of the active ingredient.
  • carrier is defined as a compound that facilitates the addition of the compound into cells or tissues.
  • the ciclesonide of the present invention may be administered alone or in admixture with any convenient carrier and the like, and such dosage forms may be single or repeated dose formulations.
  • the pharmaceutical composition may be a solid formulation or a liquid formulation.
  • Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like.
  • Solid form preparations may include, but are not limited to, carriers, flavoring agents, binders, preservatives, disintegrants, lubricants, fillers, and the like.
  • Liquid formulations include, but are not limited to, solutions such as water, propylene glycol solutions, suspensions, emulsions, and the like, and may be prepared by adding suitable colorants, flavors, stabilizers, viscosity agents, and the like.
  • powders may be prepared by simply mixing ciclesonide, the active ingredient of the present invention, with a suitable pharmaceutically acceptable carrier, such as lactose, starch, microcrystalline cellulose.
  • Granules are the ciclesonide of the present invention; Suitable pharmaceutically acceptable carriers; And a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone, hydroxypropyl cellulose, and the like, and then prepared by using a wet granulation method using a solvent such as water, ethanol, isopropanol, or a dry granulation method using a compressive force.
  • a suitable pharmaceutically acceptable lubricant such as magnesium stearate and then tableting using a tableting machine.
  • the ciclesonide of the present invention can be administered orally, by injection (eg, intramuscular injection, intraperitoneal injection, intravenous injection, infusion, subcutaneous injection, implant), inhalation, nasal administration, depending on the condition and condition of the individual to be treated.
  • injection eg, intramuscular injection, intraperitoneal injection, intravenous injection, infusion, subcutaneous injection, implant
  • nasal administration depending on the condition and condition of the individual to be treated.
  • Agents, vaginal agents, rectal agents, sublingual agents, transdermal agents, topical agents, etc. may be administered, but are not limited thereto. It may be formulated into a suitable dosage unit dosage form comprising a pharmaceutically acceptable carrier, excipient, vehicle, conventionally used and nontoxic, depending on the route of administration.
  • the pharmaceutical composition of the present invention may be administered daily from about 0.0001 mg / kg to about 10 g / kg, and may be administered in a daily dosage of about 0.001 mg / kg to about 1 g / kg.
  • the dosage may vary depending on the degree of purification of the mixture, the condition of the patient (age, sex, weight, etc.), the severity of the condition being treated, and the like. If desired, the total daily dose may be divided several times a day for convenience.
  • the content of ciclesonide in the composition can be appropriately adjusted to an effective amount capable of exhibiting anti-inflammatory activity according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, and the like.
  • the amount of ciclesonide may be 0.0001% by weight or more, specifically 0.001% by weight or more, 80% by weight or less, specifically 50% by weight or less, based on the total weight of the total composition, but is not limited thereto.
  • the ciclesonide of the present invention was confirmed that inhibits the growth (proliferation) of breast cancer cell-derived mammoth, can be used as a food composition for inhibiting breast cancer stem cell growth.
  • the ciclesonide inhibits the growth (proliferation) of lung cancer cell-derived tomuspare, it can be used as a food composition for inhibiting lung cancer stem cell growth.
  • composition of the present invention when used as a food composition, it may include an acceptable food supplement additive, and may further include appropriate carriers, excipients and diluents commonly used in the manufacture of food.
  • the food means a natural product or a processed product containing one or more nutrients, and specifically, means a state in which it can be directly eaten through a certain degree of processing.
  • the foods include various foods, beverages, gums, teas, vitamin complexes, and functional foods.
  • the food of the present invention includes special nutritional products (e.g., prepared oils, infants, baby food, etc.), processed meat products, fish products, tofu, jelly, noodles (e.g., ramen, noodles, etc.), health supplements, seasoned foods ( For example, soy sauce, miso, red pepper paste, mixed soy sauce), sauces, confectionery (e.g.
  • snacks dairy products (e.g. fermented milk, cheese, etc.), other processed foods, kimchi, pickles (various kimchi, pickles, etc.), beverages ( Examples include, but are not limited to, fruits, vegetable drinks, soy milk, fermented beverages, ice cream, etc., natural seasonings (eg, ramen soup, etc.), vitamin complexes, alcoholic beverages, alcoholic beverages, and other dietary supplements.
  • the functional food, beverages, food additives or beverage additives may be prepared by a conventional manufacturing method.
  • the term "functional food” refers to the control of biological defense rhythm, disease prevention and recovery of food groups or food compositions that have added value to the food by using physical, biochemical, or biotechnological techniques to act and express the function of the food for a specific purpose. It means a food that is designed and processed to fully express the body control function related to the living body, specifically, it may be a health functional food.
  • the term "health functional food” refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body.
  • the term “function” means obtaining a useful effect for health purposes such as nutrient control or physiological action on the structure and function of the human body.
  • the health functional food of the present invention can be prepared by a method commonly used in the art, and the preparation can be prepared by adding raw materials and ingredients commonly added in the art.
  • the formulation of the health functional food can also be prepared without limitation as long as the formulation is recognized as a health functional food.
  • Food composition of the present invention can be prepared in various forms of formulation, unlike the general medicine has the advantage that there is no side effect that can occur when taking a long-term use of the drug as a raw material, and excellent portability, the present invention Dietary supplements are available as supplements to enhance the effects of breast and lung cancer stem cell growth inhibition.
  • the functional food may include a food-acceptable food supplement additive, and may further include appropriate carriers, excipients and diluents commonly used in the manufacture of functional foods.
  • the amount of ciclesonide may be at least 0.00001% by weight, in particular at least 0.1% by weight, and at most 80% by weight, in particular at most 50% by weight, more specifically at 40% by weight of the total weight of the food composition.
  • the food composition of the present invention may include sweeteners, flavoring agents, bioactive ingredients, minerals, etc. in addition to the active ingredients.
  • Sweeteners may be used in amounts that give the food a suitable sweet taste, and may be natural or synthetic.
  • a natural sweetener is used.
  • natural sweeteners include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose and maltose.
  • Flavoring agents can be used to enhance the taste or aroma, both natural and synthetic. It is the case of using a natural thing specifically ,. In addition to flavors, the use of natural ones can be combined with nutritional purposes.
  • the natural flavor may be obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, and the like, or may be obtained from green tea leaves, round leaves, jujube leaves, cinnamon, chrysanthemum leaves, jasmine and the like. Moreover, what was obtained from ginseng (red ginseng), bamboo shoots, aloe vera, ginkgo, etc. can be used. Natural flavors can be liquid concentrates or solid extracts. In some cases, synthetic flavoring agents may be used, and synthetic flavoring agents may include esters, alcohols, aldehydes, terpenes, and the like.
  • catechins such as catechin, epicatechin, gallocatechin, epigallocatechin, vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine, riboflavin, and the like can be used.
  • mineral calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium, zinc and the like can be used.
  • the food composition of the present invention may contain a preservative, an emulsifier, an acidulant, a thickener, and the like, in addition to the sweetening agent.
  • preservatives, emulsifiers and the like are preferably added and used in very small amounts as long as the use to which they are added can be achieved. By trace amounts it is meant numerically in the range of 0.0005% to about 0.5% by weight based on the total weight of the food composition.
  • preservatives include sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), and the like.
  • Emulsifiers that can be used include acacia gum, carboxymethylcellulose, xanthan gum, pectin and the like.
  • acidulants examples include lead acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, and the like. Such acidulant may be added so that the food composition is at an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing taste.
  • Thickeners that can be used include suspending implements, sedimenters, gel formers, swelling agents and the like.
  • the present invention provides a pharmaceutical composition for treating or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • composition of the present invention can be used as a pharmaceutical composition for the treatment or prevention of breast cancer or lung cancer.
  • the ciclesonide inhibitor reduced the population expressing CD44 high / CD24 low in breast cancer cells (FIG. 4A) and decreased the proportion of ALDH positive breast cancer cells (FIG. 4B). ).
  • the proportion of ALDH positive lung cancer cells was reduced (FIG. 10).
  • the composition can inhibit the growth of breast cancer cells expressing CD44 high / CD24 low , can inhibit the growth of aldehyde dehydrogenase (ALDH) positive breast cancer cells, and is also aldehyde dehydrogenase (ALDH) positive Can inhibit the growth of lung cancer cells.
  • the present invention provides a pharmaceutical composition for inhibiting cancer metastasis, comprising the composition for inhibiting cancer stem cell growth.
  • cancer metastasis refers to a state in which a malignant tumor has propagated to another tissue away from the organ. Cancer cells are formed by spreading through the blood circulation or lymph circulation, usually by blood circulation to other organs and then growing into new tumors. Cancer cells, on the other hand, are formed by moving directly to neighboring tissues.
  • cancer metastasis is a metastasis of cancer cells by invasion in which cancer cells move and penetrate directly into neighboring tissues, and cancer cells move through the bloodstream to form new tumors in organs that are not physically adjacent to primary cancer. Include all metastasis.
  • the movement of cells is essential. Therefore, it is obvious that inhibiting the migration of cancer cells is the primary method of preventing cancer metastasis.
  • the cancer is not limited thereto, but may be breast cancer or lung cancer.
  • the terms "cancer”, “cancer stem cells”, “cancer stem cell growth inhibition”, “pharmaceutical composition” is as described above.
  • ciclesonide inhibits the migration and colony formation of MDA-MB-231 cells in a concentration-dependent manner (FIGS. 1F and 1G).
  • the composition of the present invention can inhibit cancer metastasis by inhibiting the movement of cancer cells, it can be utilized as a pharmaceutical composition for inhibiting cancer metastasis.
  • the present invention provides a food composition for improving or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • the terms "cancer”, “cancer stem cells”, “cancer stem cell growth inhibition”, “food composition” is as described above.
  • the cancer when treated with ciclesonide in MCF-7 cell line and MDA-MB-231 cell line, it was confirmed that the growth of breast cancer cell lines is inhibited, in another embodiment the cylsonide in the A549 cell line When treated, it was confirmed that growth of lung cancer cell lines is suppressed, and thus can be used as a food composition for improving or preventing cancer.
  • the cancer may be breast cancer or lung cancer, but is not limited thereto.
  • the present invention provides a food composition for improving or preventing cancer metastasis, comprising the composition for inhibiting cancer stem cell growth.
  • the terms "cancer metastasis”, “cancer stem cells”, “cancer stem cell growth inhibition”, “food composition” is as described above.
  • ciclesonide inhibited the migration and colony formation of MDA-MB-231 cells in a concentration-dependent manner, and in another embodiment, the ciclesonide inhibited the migration and colony formation of A549 cells. It can be used as a food composition for improving or preventing cancer metastasis.
  • the cancer may be breast cancer or lung cancer, but is not limited thereto.
  • the present invention provides a method of inhibiting the growth of cancer stem cells, comprising administering to a subject a ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the term "individual” means all animals including humans having cancer metastases or having cancer. Mammals, birds, and the like, including cattle, pigs, sheep, chickens, dogs, humans, and the like, wherein the growth of cancer stem cells is inhibited by administration of the composition of the present invention, thereby limiting the individual to whom the cancer is treated. Includes without.
  • Another object of the present invention is to provide a method for inhibiting cancer metastasis, comprising administering to a subject a ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Still another object of the present invention is to provide a method for treating or preventing cancer, comprising administering to a subject a ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a use for the manufacture of a medicament for inhibiting the growth of cancer stem cells using the ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a use for the manufacture of a medicament for inhibiting cancer metastasis of the ciclesonide represented by the formula (1) or a pharmaceutically acceptable salt thereof.
  • Still another object of the present invention is to provide a use for the manufacture of a medicament for the prevention or treatment of cancer using the ciclesonide represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Example 2-1 Human Breast Cancer Cell Culture Mammoth Fair ( mammospheres ) formation
  • MCF-7 Human breast cancer cells, MCF-7, were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). MCF-7 cells and MDA-MB-231 were treated with Dulbecco's Modified Essential Medium (DMEM; Hyclone, 10% fetal bovine serum (FBS; Hyclone), 100 U / ml penicillin, and 100 ⁇ g / ml streptomycin (Hyclone). In Logan, UT, USA). The MCF-7 cells were maintained at 37 ° C. in a humidified incubator containing 5% CO 2 . Cells were plated at a density of 1 ⁇ 10 6 cells in a 10 cm culture dish.
  • DMEM Dulbecco's Modified Essential Medium
  • FBS fetal bovine serum
  • Hyclone fetal bovine serum
  • Hyclone 100 U / ml penicillin
  • streptomycin Hyclone
  • single cell suspended MCF-7 cells were 3.5-4 per well in ultra-low attachment 6-well plates containing 2 ml of complete MammoCult TM medium (StemCell Technologies, Vancouver, BC, Canada). Inoculated at a cell number of 10 4 .
  • the complete MammoCult TM medium was supplemented with 4 ⁇ g / ml heparin, 0.48 ⁇ g / ml hydrocortisone, 100 U / ml penicillin and 100 ⁇ g / ml streptomycin.
  • the cells were incubated for 7 days at 37 ° C., 5% CO 2 incubator.
  • Example 2-2 Human lung cancer cell culture Today Fair ( tumorsphere ) formation
  • Human lung cancer cells were cultured under the same culture conditions as the breast cancer cells of Example 2-1.
  • single cell suspended A549 cells were 5 ⁇ 10 4 per well in ultra-low attachment 6-well plates containing 2 ml of Cancer Stem Premeium medium (ProMab Biotechnologies Inc, Richmond, CA, USA). Inoculated with a cell number of. The cells were incubated for 10 days at 37 ° C., 5% CO 2 incubator.
  • Example 3-1 breast cancer Mammoth Automatic calculation
  • the background signal of the image was negated using a threshold algorithm, and the selected image was automatically counted.
  • the mammosphere formation assay determined the formation efficiency (MFE,%) of mammo pairs corresponding to the number of mammo pairs per well / total number of plated cells per well x 100.
  • Example 3-2 lung cancer Of the spheresphere Automatic calculation
  • Example 3-1 Lung cancer tumour pairs were counted in the same manner as in Example 3-1, and the tumour pair formation assay was based on the number of tumour pairs per well / total number of plated cells per well x100. ) was determined.
  • CD44 and CD24 in MCF-7 cells were measured by FACS analysis. After isolation and harvesting cells using 1 ⁇ Trypsin / EDTA, one million cells were suspended and FITC-bound anti-human CD44 and PE-bound anti-human CD24 antibodies (BD Pharmingen, San Diego, CA, USA) ) And incubated at 4 ° C. for 30 minutes. The cells were then washed three times with 1 ⁇ PBS and analyzed by flow cytometry (Accu C6, BD, San Diego, Calif., USA).
  • Cancer cells were cultured in 6-well plates and cultured for 24 hours with 20 ⁇ M of ciclesonide for breast cancer and 10 and 20 ⁇ M or DMSO for lung cancer. According to the manufacturer's instructions, killed cells were bistained with PI and FITC-Annexin V. The samples were analyzed by flow cytometry (Accuri C6, BD, San Diego, CA, USA).
  • MDA-MB-231 cells were treated with 20 ⁇ M of ciclesonide, or A549 cells at 30 ⁇ M of ciclesonide for 24 hours, and the cells were treated for 30 minutes at 37 ° C. in a Hoechst 33258 solution (10 mg / ml). Incubated. The cells were then observed under a fluorescence microscope.
  • MDA-MB-231 or A549 cells were seeded at low density in 6-well plates and treated with MDA-MB-231 at different ciclesonide concentrations in DMEM medium or with A549 cells with 10 ⁇ M ciclesonide. After 24 hours the medium was replaced with fresh medium and incubated for 7 days of growth. Grown colonies were counted.
  • MDA-MB-231 or A549 cells were seeded in 6-well plates and grown to 90% confluency. Using a sterile white micro pipette tip, the cell layer was scratched. After washing with DMEM medium, breast or lung cancer was treated with ciclesonide or DMSO. At 18 hours, wounded areas were photographed with a 40x optical microscope.
  • Example 10-1 Breast Cancer Cell Proliferation Assay
  • MCF-7 and MDA-MB-231 cells were measured using CellTiter 96® aqueous one solution cell proliferation kit.
  • MCF-7 cells and MDA-MB-231 cells were incubated in 96-well plates in the presence of ciclesonide 0, 5, 10, 20, 40 and 80 ⁇ M for 48 hours.
  • Absorbance was determined at 490 nm using a 96-well plate reader (Dynex Revelation, Dynex Ltd., Billingshurst, UK) according to the manufacturer's protocol. Each data was determined by measuring three sets.
  • Example 10-2 Lung Cancer Cell Proliferation Assay
  • Example 10-1 As lung cancer cells, A549 cells were used, and the same procedure as in Example 10-1 was performed except that ciclesonide was treated at concentrations of 0, 10, 20, 40, 80, and 100 ⁇ M.
  • Proteins isolated from ciclesonide treated MCF-7 and MDA-MB-231 mammospheres were separated on 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, Mass., USA). The membrane was blocked in PBS-Tween 20 (0.1%, v / v) containing 5% skim milk powder at room temperature for 30 minutes. The blots were incubated overnight at 4 ° C. with blocking solutions containing primary antibodies. Primary antibodies used were as follows: Stat3, p65, Lamin B, and phospho-Stat3 (Cell Signaling, Beverly, MA, USA). ⁇ -actin (Santa Cruz Biotechnology) was used as a loading control.
  • the blots were incubated with horseradish peroxidase-bound secondary antibody and photosensitized with a chemiluminescence detection kit (Santa Cruz Biotechnology).
  • the ALDEFLUOR assay system provides a novel approach to the identification, evaluation and isolation of CSCs based on the activity of aldehyde dehydrogenase (ALDH).
  • Active reagent BODIPY-aminoacetaldehyde was added to breast cancer cells or lung cancer cells and converted to fluorescence BODIPY-aminoacetate by aldehyde dehydrogenase (ALDH).
  • Diethylaminobenzaldehyde (DEAB), an ALDH inhibitor was used as a negative control.
  • MCF-7 cells or A549 cells were treated with 10 or 20 ⁇ M of ciclesonide for 24 hours, and the proportion of ALDH positive cells was analyzed by ALDEFLUOR assay.
  • ALDH positive and negative cells were sorted using C6 Accuri flow cytometry (BD Bioscience).
  • Example 13-1 Immunodeficiency NOD- Producing Breast Cancer Cells SCID ( BALB Of cSIc (nu / nu)) chemotherapy in female nude mice
  • NOD-SCID (BALB / cSIc (nu / nu)) female nude mice producing a total of 12 breast cancer cells were divided into two groups. Six mice as negative controls did not receive chemotherapy. Tumor volume of control mice was measured every 3 days and calculated using the formula (width ⁇ length 2 ) / 2. The other six nude mice received the test drug prior to chemotherapy using the infusion process at the optimal dose of 10 mg / kg / day.
  • Example 13-2 Immunodeficiency NOD- Producing Lung Cancer Cells SCID ( BALB Of cSIc (nu / nu)) Chemotherapy in male nude mice
  • NOD-SCID (BALB / cSIc (nu / nu) male nude mice, producing a total of 12 lung cancers, were divided into two groups. Six mice as negative controls did not receive chemotherapy. Measurements were made every 3 days and calculated using the formula (Width ⁇ Length 2 ) / 2 The other six nude mice were treated with the chemotherapy prior to chemotherapy using the infusion process at the optimal dose of 10 mg / kg / day. Received by.
  • transcripts were measured with a One Step SYBR PrimeScript RT-PCR kit (Takara, Tokyo, Japan) using SYBR Green as a double stranded DNA specific dye.
  • One-step RT-PCR reactions were performed on 1 ⁇ g total RNA, 10 ⁇ l 2X One Step SYBR RT-PCR Buffer IV, 1 ⁇ l PrimeScript 1 step Enzyme Mix II, CD44, NANOG, OCT4, C-myc, Sox2, Snail and ⁇ -actin
  • a final volume of 20 ⁇ l per reaction was performed, including 10 ⁇ M PCR forward primer, and PCR reverse primer.
  • the forward and reverse primers are as follows.
  • CD44 forward primer AGAAGGTGTGGGCAGAAGAA (SEQ ID NO: 1)
  • CD44 reverse primer AAATGCACCATTTCCTGAGA (SEQ ID NO: 2)
  • NANOG forward primer ATGCCTCACACGGAGACTGT (SEQ ID NO: 3),
  • NANOG reverse primer AAGTGGGTTGTTTGCCTTTG (SEQ ID NO: 4),
  • OCT4 forward primer AGCAAAACCCGGAGGAGT (SEQ ID NO: 5),
  • OCT4 reverse primer CCACATCGGCCTGTGTATATC (SEQ ID NO: 6),
  • SOX2 forward primer TTGCTGCCTCTTTAAGACTAGGA (SEQ ID NO: 7),
  • SOX2 reverse primer CTGGGGCTCAAACTTCTCTC (SEQ ID NO: 8),
  • C-myc forward primer AATGAAAAGGCCCCCAAGGTAGTTATCC (SEQ ID NO: 9),
  • C-myc reverse primer GTCGTTTCCGCAACAAGTCCTCTTC (SEQ ID NO: 10),
  • ⁇ -actin forward primer TGTTACCAACTGGGACGACA (SEQ ID NO: 11),
  • ⁇ -actin reverse primer GGGGTGTTGAAGGTCTCAAA (SEQ ID NO: 12).
  • Snail forward primer ACCACTATGCCGCGCTCTT (SEQ ID NO: 15),
  • Snail reverse primer GGTCGTAGGGCTGCTGGAA (SEQ ID NO: 16).
  • the relative expression level of mRNA of the target gene was calculated using the comparative CT method. At least three independent PCR procedures were performed following statistical analysis. PCR products were normalized to the ⁇ -actin gene as an internal control.
  • Inflammatory cytokines were measured using a BD cytometric bead array (CBA) human inflammatory cytokines kit, according to the manufacturer's instructions (BD, San Diego, CA, USA).
  • CBA BD cytometric bead array
  • the mixed capture beads were vortexed and 50 ⁇ l of beads were added to the assay tube.
  • 50 ⁇ l of human inflammatory cytokine standard and incubated tomuspher solution were added to the assay tube and the cytokine PE solution was mixed. After 3 hours, the mixed solution was washed and analyzed by flow cytometry (Accuri C6, BD, San Diego, CA, USA).
  • Example 16 Electrophoretic mobility shift assays (EMSA )
  • EMSA was detected using Lightshift's chemiluminscet EMSA kit (Thermoscientific, IL, USA) according to the manufacturer's instructions.
  • the biotin-top and bottom probs of the Stat3 probe (5'-CTTCATTTCCCGGAAATCCCTA-Biotin3 ', SEQ ID NO: 13 and 5'-TAGGGATTTCCGGGAAATGAAG-Biotin3', SEQ ID NO: 14) were annealed and the double-stranded oligonucleotides were terminally labeled with biotin.
  • Biotin-labeled DNA probes were incubated with ciclesonide treated nuclear protein in a final volume of 20 ⁇ L EMSA buffer containing 1 ⁇ g / ⁇ L poly [dI-dC]) at room temperature for 20 minutes.
  • the reaction mixture was electrophoresed on 4% polyacrylamide unmodified gel in 0.5 ⁇ TBE (45 mM Tris borate and 1 mM EDTA) at 4 ° C. and visualized using a chemiluminescent nucleic acid detection kit (Thermoscientific, IL, USA) It was.
  • Ciclesonide ( ciclesonide ) Induction of cell death and inhibition of proliferation of human breast cancer cells
  • Cyclasonide was confirmed in FIG. 1 to inhibit the proliferation of breast cancer cells in vitro.
  • Tumor volume in ciclesonide-administered group was smaller than control group not treated with ciclesonide (FIGS. 2A and 2C).
  • the tumor weight in the ciclesonide treated group was smaller than the control not treated with ciclesonide (FIG. 2B).
  • the body weight of the mice in the ciclesonide treated group was similar to the control (FIG. 2A).
  • Glucocorticoids which are widely used as drugs
  • Cyclasonide inhibited the growth of breast cancer stem cells at a concentration of 10 ⁇ M, but belonged to the same Glucocorticoids.
  • Prednisone (prednisone) and dexamethasone (dexamethasone) confirmed that even at a high concentration of 80 ⁇ M does not inhibit the growth of breast cancer stem cells (Fig. 3C).
  • ciclesonide effectively inhibits breast cancer stem cells, unlike conventional steroids.
  • MCF-7 cells were treated with ciclesonide for 24 hours and the effects of the ciclesonide inhibitors were examined in subpopulations expressing CD44 high / CD24 low in breast cancer cells. As a result, the ciclesonide inhibitor reduced the population expressing CD44 high / CD24 low in breast cancer cells (FIG. 4A). MCF-7 cells were treated with ciclesonide for 24 hours and ALDEFLUOR assay was performed to investigate the effect of ciclesonide inhibitors on the proportion of ALDH positive breast cancer cells. As a result, it was confirmed that ciclesonide reduced the proportion of ALDH positive breast cancer cells (FIG. 4B).
  • IL-6 and IL-8 have been known to play an important role in mammoth pair formation (Sansone P, Storci G, Tavolari S, Guarnieri T, Giovannini C, Taffurelli M, Ceccarelli C, Santini D, Paterini P, Marcu KB, Chieco P and Bonafe M.
  • IL-6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland.J Clin Invest. 2007; 117 (12): 3988-4002).
  • an inflammatory cytokine profiling analysis was performed using a flow cytometer.
  • ciclesonide was treated with mammo pairs, and the number of mammo pair cells was counted. As a result, ciclesonide induced apoptosis of mammoth pairs, and the number of cells observed in cylsonide-treated mammoth pairs was small. These results indicate that ciclesonide greatly reduces mammosphere proliferation (FIG. 6B).
  • ciclesonide treatment confirmed the formation of apoptotic bodies in A549 cells (FIG. 7B).
  • Cyclasonide was confirmed in Figure 7 to inhibit the proliferation of lung cancer cells in vitro.
  • xenograft tumor model was prepared by forming tumors using lung cancer cells, and the effect was assayed by measuring the size of the tumor weekly by treatment with ciclesonide.
  • the tumor volume in the ciclesonide-administered group was smaller than that of the control not treated with ciclesonide (FIGS. 8A and 8C).
  • the tumor weight in the ciclesonide treated group was also smaller than the control not treated with ciclesonide (FIG. 8B).
  • the body weights of the mice in the ciclesonide treated group were similar to the control.
  • isobutyryl ciclesonide an active form of ciclesonide
  • prednisol and dexamethasone belonging to Glucocorticoids did not show lung cancer stem cell inhibitory activity even at 80 ⁇ M (FIG. 9C).
  • ciclesonide and isobutyryl ciclesonide the active form, inhibit cancer cell derived from lung cancer more effectively than conventional steroids, and it was confirmed that all Glucocorticoids do not inhibit the growth of lung cancer stem cells. .
  • lung cancer cells were treated with ALDH inhibitor DEAB and ciclesonide to analyze lung cancer stem cell marker ALDH.
  • A549 cells were treated with ciclesonide for 24 hours, and ALDEFLUOR assay was performed to investigate the effect of ciclesonide inhibitors on the proportion of ALDH positive lung cancer cells. As a result, it was confirmed that ciclesonide reduced the proportion of ALDH positive lung cancer cells (FIG. 10).
  • the cymersonide was treated with the tumuspair, and the number of cells of the tumuspair was counted. After 1, 2, or 3 days of the tumor cancer cell number of the tumosphere after ciclesonide treatment, growth of the tumer spare was inhibited in the ciclesonide-treated group, but the growth of the tomuspare was progressed in the untreated group. It was confirmed (Fig. 11B). Therefore, ciclesonide was found to significantly reduce the tumuspair proliferation (FIG. 11B).
  • IL-8 has been known to play an important role in the formation of tumuspair (Ginestier C, Liu S, Diebel ME, Korkaya H, Luo M, Brown M, Wicinski J, Cabaud O, Charafe-Jauffret E, Birnbaum D, Guan JL, Dontu G and Wicha MS.CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts.J Clin Invest. 2010; 120 (2): 485-497).
  • an inflammatory cytokine profiling assay was performed using a flow cytometer. Inflammatory cytokines were measured using a BD cytometric bead array (CBA) human inflammatory cytokines kit. CBA analysis was performed using IL-6, IL-8, IL-10, IL-12, IL-1 ⁇ , and TNF antibodies. As a result, as shown in the inflammatory cytokine profiling data of FIG. 12, by the ciclesonide treatment, the production level of the inflammatory cytokine IL-8 was reduced. The lower figure of Figure 12 is a graph of IL-8 production. Therefore, it was found that ciclesonide inhibits lung cancer stem cells by inhibiting the IL-8 secretion essential for cancer stem cell maintenance.
  • CBA BD cytometric bead array
  • the ciclesonide of the present invention not only inhibits the proliferation of breast cancer and lung cancer, but also inhibits the growth of stem cells of breast cancer and lung cancer, thereby inhibiting the growth of breast cancer and lung cancer and their stem cells. It can be seen that it can be used for the purpose.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 시클레소나이드 또는 이의 약학적으로 염을 유효성분으로 포함하는, 암 줄기세포 성장 억제용 조성물, 상기 조성물을 포함하는 암의 전이 억제, 또는 암의 치료 또는 예방용 약학적 조성물, 식품 조성물 등에 관한 것이다. 본 발명의 시클레소나이드는 유방암과 폐암 세포의 성장을 억제하며, 유방암과 폐암 줄기세포의 형성을 억제한다. 또한, 유방암과 폐암 줄기세포에서 특징적으로 발현하는 것으로 알려진 Nanog, C-myc, Oct4, Sox2, Snail 및 CD44와 같은 자가 재생 유전자의 발현을 억제하였으며, 유방암 줄기세포의 맘모스페어 형성과 폐암 줄기세포의 투머스페어 형성에 관여하는 것으로 알려진 IL-6와 IL-8의 생산을 억제하였으며, STAT3 신호전달 경로를 억제하는 것을 확인하였다. 이에 따라, 상기 화합물은 유방암과 폐암 등의 암 줄기세포의 성장과 이들 암의 성장을 억제하는 바, 유방암과 폐암 등의 암의 치료에 활용이 가능하다.

Description

시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물
본 발명은 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 암 줄기세포 성장 억제용 조성물, 상기 조성물을 포함하는 암의 전이 억제, 또는 암의 치료 또는 예방용 약학적 조성물, 식품 조성물 등에 관한 것이다.
항암치료가 종양내의 세포군을 효과적으로 표적화하여 치료하지 못하고, 종양의 재발 및 전이로 연결됨에 따라 암 줄기세포에 대한 관심이 대두되었다. 많은 세포독성 항암제는 대개 빠르게 증식하는 세포를 표적으로 하고 있어, 천천히 증식하는 특징을 가진 암 줄기세포는 세포독성 항암요법에서 살아남을 수 있게 된다. 기저세포형(basal cell phenotype) 유방암은 분화과정의 초기 단계의 유선 모세포(earliest mammary progenitor cell)에서 기원한 것으로 여겨지며, 예후가 불량하고 기존의 항암요법에 내성을 나타낸다고 알려져 있는데, 항암 치료의 실패원인이 암 줄기세포에 대한 표적치료가 실패하였기 때문이란 것을 지지하는 좋은 예라 할 수 있다.
암 줄기세포 가설에 근거하여 여러 치료방법들이 고안되었는데, 그 중 많이 알려진 방법은 암 줄기세포의 자가재생(self-renewal) 경로를 이용하는 방법이다. 이러한 치료에서 중요한 점은 정상 줄기세포의 자가재생은 유지하면서 암 줄기세포의 자가재생만을 표적으로 해야 하는 것이다. 예로서, Notch 신호는 secretase라는 효소에 의해 진행되는데, 이에 대한 억제제(secretase inhibitor)를 Notch1이 과발현된 유방암에 사용하면 종양 억제 효과를 볼 수 있다. Hedgehog 신호체계를 표적으로 할 경우에도 항암효과를 보인다는 최근 보고가 있는데, Hedgehog 억제제인 cyclopamine을 종양 이종이식(tumor xenograft)한 동물에 투여했을 때 극적으로 종양이 위축되었다는 것이다.
한편, 유방암은 여성에서 흔한 암이며, 여성 암 환자에서 주요 사망의 원인으로 알려져 있다(al A, Bray F, Center MM, Ferlay J, Ward E and Forman D. Globalcancer statistics. CA Cancer J Clin. 2011; 61(2):69-90). 초기 유방암에 폴리항암화학요법(polychemotherapy), 타목시펜과 함께 광범위한 유방 X 선 촬영 및 보조 요법이 유방암의 사망률을 줄였으나, 유방암은 여전히 재발과 전이로 인해 가장 위험한 질병으로 알려져 있다. 최초로 암 줄기세포(Cancer stem cell, CSCs)가 골수성 백혈병에서 확인되었고, 이후, 유방, 뇌, 결장, 난소, 췌장, 및 전립선 암 등 다양한 고형암에서 발견되었다. 상기 암 줄기세포는 종양-시작 세포(tumor-initiating cells)와 암 줄기 유사 세포(cancer stem-like cell)로 불리기도 한다. 또한 유방암을 포함한 다양한 암 유형이 종양의 소집단인, 암줄기세포(CSCs)로부터 유래되는 것으로 나타났다. 이러한 집단은 자가 재생(self-renewal) 및 분화를 통해 종양 부피에 변화를 유발하는 것으로 알려져 있다. Wnt (wingless), Shh (Sonic hedgehog), Stat3, NF-κB, Wnt/β-catenin, TGF-β 및 Notch 신호 전달 경로는 CSCs의 자가 재생(self-renewal)에 결정적인 것으로 알려져 있다.
암 줄기세포는 화학 요법과 방사선 치료에 대한 약제 내성 및 방사선 내성을 나타내며, 암의 재발과 전이를 유발한다. 따라서 암 줄기세포에 대한 표적 치료는 암 치료에 필수적이다. 암 줄기세포는 Oct4, C-myc, Nanog, 및 알데히드 탈수소효소-1 (Aldehyde dehydrogenase-1, ALDH)을 포함하는 특정 단백질을 발현하는 것으로 알려져 있다. 상기 ALDH는 유전 독성의 알데히드를 산화하는 효소이며, 이의 효소 활성은 백혈병, 두경부, 방광, 뼈, 결장, 간, 폐, 췌장, 전립선, 갑상선 및 자궁경부암의 CSC(cancer stem cells) 마커로 널리 사용되고 있다. ALDH는 암 줄기세포의 치료표적으로 알려져 있다. 또한, 임상 표본에서 CD44+/CD24-를 발현하는 유방암 집단에서 종양을 형성하는 능력이 뛰어난 것으로 알려져 있다(Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ and Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 2003; 100(7):3983-3988).
Stat3(Signal transducers and activators of transcription 3)는 CSCs에서 주로 활성화되어 있고, 맘모스페어(mammosphere) 형성은 JAK1-STAT3 경로와 관련이 있다. 분비된 IL-6는 JAK1-STAT3 경로를 활성화시키고, Oct4 유전자의 발현을 증가시킨다. IL-6/JAK1/STAT3 신호전달 경로는 NSCCs(Non-CSCs)의 CSCs로의 전환에 중요한 것으로 알려져 있다. STAT3 신호 전달경로를 차단하면 유방암 세포유래 CD44+/CD24- 줄기 세포 유사(stem cell-like) 세포의 성장을 억제하는 것으로 알려져 있다. NF-κB(Nuclear factor-κB) 전사 인자는 결장, 유방, 간암을 포함하는 종양 세포에서 구조적으로(일정하게) 활성화되고, IκB 키나제(IKK) 복합체에 의해 조절된다. NF-κB의 억제제인 피롤리딘디티오카르바민산염 (pyrrolidinedithiocarbamate, PDTC)는 유방암 줄기 유사 세포를 억제하는 것으로 알려져 있다.
상기 유방암 줄기세포는 CD44high/CD24low, ESA+(상피 특이 항원)과 ALDH 같은 바이오 마커의 발현에 의해 확인할 수 있다고 알려져 있다. 항암 화학 요법은 CD44+/CD24를 발현하는 암세포의 비율과 맘모스페어 형성을 증가시키는 것으로 알려져 있다. CSCs는 독소로부터 CSCs를 보호하기 위해 특이 ABC 수송체(ABC transporters)를 과발현한다. ABC 펌프는 side population (SP)를 분리하는데 사용되고, ABCG2 transporter-specific Hoechst 33342 dyes에 의해 분류될 수 있다. 유방 CSCs는 종양 세포(tumor cells)에 비해 반응성 산소종 (ROS)을 낮은 수준 생성하기 때문에, 유방암 줄기세포 유사 세포(breast cancer stem-likes cells)는 방사선 저항이 있다. 왜냐하면, ROSs는 이온화 방사선-유도된 세포 사멸의 주요 매개체이기 때문에, CSCs는 비-줄기 암세포(non-stem cancer cells) 보다 DNA 손상이 덜한 것으로 알려져 있다(Diehn M, Cho RW, Lobo NA, Kalisky T, Dorie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, Joshua B, Kaplan MJ, Wapnir I, Dirbas FM, Somlo G, Garberoglio C, et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 2009; 458(7239):780-783).
유방암 세포주 MCF-7은 in vitro에서 부착 없이도 세포 자멸사를 하지 않고 타원 형태로의 성장을 할 수 있는 줄기 세포와 유사한 능력을 가진 세포의 부분집락을 가진 것으로 알려져 있다. 부유배양으로 기층이 없는 조건을 인공적으로 만들면 줄기세포의 성질을 가지는 세포들은 서로 부착되어 구형의 세포 덩어리를 만들게 되며, 이러한 세포 덩어리는 뉴로스페어(neurosphere)로 명명되었다. 인간의 유방 줄기세포에 이러한 개념을 적용한 것이 "맘모스페어(mammosphere)"이다. 맘모스페어에는 일반 인간 유방 세포보다 8배 많은 전구 세포들이 존재하며 지속적으로 계대 배양이 가능하고, 여러 번의 계대 배양 후에는 100%의 세포가 모두 bi-potent 전구체로 자라는 특징이 있다. 맘모스페어는 성인 유방 세포인 유선 상피세포(mammary gland epitherlial cell), 관 상피세포(ductal epithelial cell), 엘비올라 상피세포(alveolar epitherlial cell)들로 모두 분화가 가능하며, 마트리겔(Matrigel)내에서 삼차원 구조를 이루면서 복잡한 기능성 유방 구조물을 형성하는 것이 관찰된다. 맘모스페어는 줄기세포의 가장 특징 중의 하나인 자가 증식을 할 수 있는 성질이 있어서 하나의 맘모스페어에서 여러 개의 맘모스페어 또는 유방줄기세포를 다량으로 얻을 수 있다. 또한 조혈모 세포, 신경 줄기세포, 배아 줄기세포 등과 비교하여 많은 발현 유전자가 중복되는 것이 확인되어, 맘모스페어가 실제적인 유방 줄기세포인 것으로 보고되었다. 이러한, 암 줄기세포의 자가 재생 능력의 표준 분석 방법은 in vivo 에서의 이식(transplantation) 및 in vitro에서의 맘모스페어 형성을 분석하는 것이다.
또한, 유방암 세포주 뿐만 아니라 폐암을 비롯한 다양한 암 세포주에서 줄기세포의 성질을 가지는 세포들이 서로 부착되어 구형의 세포 덩어리를 형성할 수 있으며, 이를 투머스페어(tumorsphere)라 한다. 상기 투머스페어는 하나의 암 줄기세포 또는 암 전구세포의 증식에 의해 발달된 종양구를 의미한다.
한편, 폐암은 전 세계의 암 관련 사망의 주된 원인으로, 두 가지의 주요 아형인, 비소세포 폐암(NSCLC) 및 소세포 폐암(SCLC)로 분류된다. 비소세포 폐암(NSCLC)은 폐암 환자의 85 %를 차지하고, 소세포 폐암(SCLC)은 15%를 차지한다. 상기 비소세포 폐암(NSCLC)은 세 개의 하위 유형, 선암, 편평세포암, 대세포암으로 구분된다. 흡연은 폐암의 주요 위험 인자이다. 폐암은 화학 요법 및 방사선 조사로 치료 가능하나, 내성이 생기게 된다. 폐암의 5 년 생존률은 낮으며, 소세포 폐암의 1 년 생존율은 40%, 5년 생존율은 5% 이하이다. 하지만, 폐암에서 상기 방사선과 항암화학요법에 대한 내성 메카니즘은 잘 알려져 있지 않다. 암줄기세포는 벌크 종양을 근절하는 화학요법과 방사선 치료에 대한 약제 내성 및 방사선 저항 특성을 가지고 있는데, 결과적으로 이에 의해 암의 재발과 전이를 유발하게 된다. 따라서, CSC를 타겟팅하는 치료는 폐암 치료에 필수적이다.
지금까지 암 줄기세포에 대한 연구에는 제한성도 많고, 종양의 형성이나 유지에서의 역할에 대해서는 확실하게 밝혀진 것은 없었다. 정상 줄기세포에는 손상을 주지 않으면서 암 줄기세포만을 표적으로 하는 치료를 효율적으로 수행하기 위해서는 암 줄기세포의 유지와 조절에 중요한 분자생물학적인 특성이나 그 조절 경로에 대한 지식과 이해가 필요하다.
현재까지 암 줄기세포를 직접적으로 타겟팅하는 항암제나 천연물 유래 추출물의 연구는 거의 없는 실정이다. 종래의 기술은 암 줄기세포의 직접적인 타겟 유전자를 억제하는 실험으로 암 줄기세포를 억제하거나 또는 암 줄기세포의 상위 신호전달 단백질을 억제하여 암 줄기세포를 억제하는 연구들이 진행되었다. 그러나 많은 종양환자에 있어서 종양유전자의 변이나 단백질의 변이로 이러한 타겟팅 실험이 어려움이 많았다.
본 발명의 목적은 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 암 줄기세포 성장 억제용 조성물을 제공하는 것이다.
본 발명의 다른 목적은, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암의 치료 또는 예방용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암전이 억제용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암의 개선 또는 예방용 식품 조성물을 제공하는 것이다.
본 발명의 다른 목적은, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암전이 개선 또는 예방용 식품 조성물을 제공하는 것이다.
본 발명의 다른 목적은, 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암 줄기세포의 성장을 억제하는 방법을 제공하는 것이다.
본 발명의 다른 목적은, 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암 전이를 억제하는 방법을 제공하는 것이다.
본 발명의 다른 목적은, 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암의 예방 또는 치료방법을 제공하는 것이다.
본 발명의 다른 목적은, 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 암 줄기세포의 성장을 억제하기 위한 의약품의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 발명의 다른 목적은, 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 암 전이를 억제하기 위한 의약품의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 암의 예방 또는 치료를 위한 의약품의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 발명의 시클레소나이드는 유방암과 폐암 세포의 성장을 억제하며, 유방암과 폐암 줄기세포의 형성을 억제하였다. 또한, 유방암과 폐암 줄기세포에서 특징적으로 발현하는 것으로 알려진 Nanog, C-myc, Oct4, Sox2, Snail 및 CD44와 같은 자가 재생 유전자의 발현을 억제하였으며, 유방암 줄기세포의 맘모스페어 형성과 폐암 줄기세포의 투머스페어 형성에 관여하는 것으로 알려진 IL-6와 IL-8의 생산을 억제하였으며, STAT3 신호전달 경로를 억제하는 것을 확인하였다. 이에 따라, 상기 화합물은 유방암과 폐암 등의 암 줄기세포의 성장과 이들 암의 성장을 억제하는 바, 유방암과 폐암 등의 암의 치료에 활용이 가능하다.
도 1은 시클레소나이드가 유방암 세포주에서 다양한 암 특징을 억제하는 것을 나타낸다. 구체적으로, (A 및 B) 시클레소나이드의 화학적 구조 및 시클레소나이드의 MCF-7 및 MDA-MB-231 세포에 대한 생존률을 나타낸다. MCF-7 및 MDA-MB-231 세포에 48시간 동안 시클레소나이드의 농도를 증가시켜 처리하였다. 시클레소나이드의 항 증식 효과는 MTS 분석에 의해 측정하였다.
(C, D, E) 유방암 세포의 세포 사멸에 미치는 시클레소나이드의 영향을 나타낸다. MDA-MB-231 세포에 시클레소나이드를 24시간 동안 처리하고, 사멸 세포를 아넥신 V-PI 염색 키트를 사용하여 FACS에 의해 분석하였다. MDA-MB-231 세포에서 caspase3/7 활성은 Caspase-Gloss 3/7 kit에 의해 분석하였다. 형광 염색법에 의해 사멸된 세포(apoptotic cells)을 분석하였으며, 유방암에서 핵은 Hoechst 33258로 염색하였다(확대, x100).
(F) 인간의 유방암 세포의 이동 포텐셜에 대한 시클레소나이드의 효과를 나타낸다. MDA-MB-231 세포의 상처 치유는 시클레소나이드 처리 여부에 따라, 0시간, 18시간에 촬영하였다.
(G) 인간의 유방암 세포의 콜로니 형성에 대한 시클레소나이드의 효과를 나타낸다. 상기 해리된 1000개의 MDA-MB-231 세포를 6-웰 플레이트에 접종하고, 7 일간 시클레소나이드 및 DMSO의 표시된 농도로 처리하였다. 콜로니의 대표 이미지가 기록되었다. 표시된 데이터는 3 개의 독립적인 실험의 평균 ± SD를 나타낸다. *p<0.05 vs. DMSO-처리된 대조군.
도 2는 이종이식 모델에서 종양성장에 대한 시클레소나이드의 효과를 나타낸다. 300만개의 세포는 면역 결핍 NOD-SCID 암컷 누드 마우스의 유방 지방 패드에 주입하였다.
(A) MCF-7 세포를 생산하는 면역 결핍 누드 마우스에서 시클레소나이드가 종양 성장에 미치는 효과를 나타낸 것이다. 사용된 약물 투여량은 10mg/kg이다.
(B) 종양의 무게에 대한 시클레소나이드의 효과를 나타낸다. 종양 무게는 치료 후에 측정하였다.
(C) 종양 부피는 캘리퍼를 사용하여 주 2회 측정하였으며, (폭×길이2)/2로 산출하였다. 종양 성장 곡선은 실험 기간 동안 모니터링 하였다.
*는 대조군과 비교하여, p <0.05. 대표적인 이미지는 치료 7주 끝에 캡쳐하였으며, 그 결과는 vehicle 처리된 대조군, 시클레소나이드 처리된 마우스로 나타냈다.
도 3은 맘모스페어 형성에 대한 시클레소나이드의 효과를 나타낸다. MCF-7 및 MDA-MB-231 세포는 7일 동안 맘모스페어 형성 조건에서 배양했다.
(A) MCF-7 세포 유래된 맘모스페어 형성에 대한 시클레소나이드의 효과를 나타낸다. 1차 맘모스페어는 시클레소나이드(5 및 10 μM) 또는 DMSO와 함께 배양하였다.
(B) MDA-MB-231 세포에서 유래된 맘모스페어 형성에 시클레소나이드의 효과를 나타낸다. 상기 맘모스페어는 시클레소나이드(10 μM) 또는 DMSO와 함께 배양하였다. MCF-7 및 MDA-MBB-231 세포는 배양 7일 동안 시클레소나이드와 DMSO로 처리하였다. 이미지는 10배 배율 현미경으로 얻었으며, 대표 맘모스페어였다(스케일 바 = 100μm).
(C) MCF-7과 MDA-MB231 세포에서 유래된 맘모스페어 형성에 대한 프레드니손과 덱사메타손(20 내지 80 μM)의 효과를 조사했다.
도 4는 유방암 세포주에서 암줄기세포 마커의 발현에 대한 시클레소나이드의 효과를 나타낸다.
(A) MDA-MB-231 세포에서 CD44+/CD24- 세포의 수에 대한 시클레소나이드의 효과를 나타낸다. MDA-MB-231 세포에서 시클레소나이드의 처리 유무에 따라, CD44+/CD24- 세포의 비율을 측정하였다. FACS 분석을 위해, 100,000개의 세포를 획득 하였다. 게이팅은 대조군 항체를 기반으로 했다.
(B) ALDH 양성 세포 집단에 대한 시클레소나이드의 효과를 나타낸다. MDA-MB-231 세포는 2 일간 시클레소나이드 (10 μM) 또는 DMSO로 처리한 후, ALDEFLUOR 분석 및 FACS 분석을 실시하였다. 오른쪽 패널은 음성 대조군으로 ALDH 저해제인, DEAB로 처리된 ALDH 양성 세포를 나타내고, 왼쪽 패널은 DEAB 처리되지 않은 ALDH 양성 세포를 나타낸다. ALDH 양성 집단은 박스에 표시하였다.
도 5는 맘모스페어에서 STAT3 신호 경로에 대한 시클레소나이드의 효과를 나타낸다.
(A) 맘모스페어에서 STAT3 신호 전달 경로에 대한 시클레소나이드의 효과를 나타낸다. STAT3 및 NF-kB의 핵 단백질 발현 및 활성화를 pSTAT3, STAT3, P65 및 라민 B에 대한 항체로 맘모스페어에서 측정하였다. 시클레소나이드는 맘모스페어에서 핵 pSTAT3 단백질의 수준을 감소시켰다.
(B) 시클레소나이드로 처리된 MDA-MB-231 세포 유래된 맘모스페어 핵 용해물(lysates)의 EMSA (전기영동 이동성 시프트) 분석을 나타낸다. 핵 용해물은 ?Mbiotin-labeled Stat3 probe로 배양하였으며, 6 % PAGE에 의해 분리하였다.
레인 1: 프로브 단독; 레인 2: 프로브 + 핵 추출물; 레인 3: 프로브 + 시클레소나이드 처리된 핵 추출물; 레인 4: 자기 경쟁; 레인 5: 돌연변이 STAT3 프로브와 함께 배양된 핵 추출물. 상기 시클레소나이드는 맘모스페어 핵 용해물에서 DNA/STAT3 상호 작용을 감소시켰다.
(C) 시클레소나이드 또는 DMSO 처리된 종양의 인간 염증성 사이토카인 분석을 나타낸다. 상기 염증성 사이토카인은 BD cytometric bead array (CBA) human inflammatory cytokines kit를 이용하여 측정하였다. CBA 분석은 IL-6, IL-8, IL-10, IL-12, IL-1β, 및 TNF 항체를 사용하여 수행하였다.
도 6은 유방암에서 암줄기세포 로드에 대한 시클레소나이드의 효과를 나타낸다.
(A) CSC 마커인 Nanog, Sox2, C-myc, Oct4 및 CD44 유전자의 전사 발현 수준은 시클레소나이드 및 DMSO-처리된 맘모스페어에서 CSC 마커 특이적인 프라이머를 사용하여 실시간 PCR(realtime RT-PCR)을 사용하여 분석하였다. β-액틴은 내부 대조군으로 사용하였다.
(B) 맘모스페어 성장에 대한 시클레소나이드의 효과를 나타낸다. 시클레소나이드는 맘모스페어의 성장을 억제한다. 2일간 시클레소나이드 및 DMSO 처리된 맘모스페어는 단일 세포로 분리하였으며, 동등한 세포 수로 6 cm 디쉬에 플레이팅하였다. 플레이팅 24시간 후, 세포를 계수하였다. 2일 및 3일째, 세포는 세번 계수되었고, 평균 값으로 플롯팅하였다. 상기 데이터는 3 개의 독립적인 실험의 평균 ± SD를 나타낸다. *p<0.05 vs. DMSO-처리된 대조군.
도 7은 시클레소나이드가 폐암 세포주에서 다양한 암 특징을 억제하는 것을 나타낸다. (A) 시클레소나이드의 A549 폐암 세포에 대한 생존률을 나타낸다. A549 세포에 48시간 동안 시클레소나이드의 농도를 증가시켜 처리하였다. 시클레소나이드의 항 증식 효과는 MTS 분석에 의해 측정하였다.
(B) 형광 염색법에 의해 사멸된 세포(apoptotic cells)을 분석하였으며, 폐암에서 핵은 Hoechst 33258로 염색하였다(확대, x100).
(C) 폐암 세포의 세포 사멸에 미치는 시클레소나이드의 영향을 나타낸다. A549 세포에 시클레소나이드를 24시간 동안 처리하고, 사멸 세포을 아넥신 V-PI 염색 키트를 사용하여 FACS에 의해 분석하였다.
(D) A549 세포에서 caspase3/7 활성은 Caspase-Gloss 3/7 kit에 의해 분석하였다.
(E) 인간의 폐암 세포의 이동 포텐셜에 대한 시클레소나이드의 효과를 나타낸다. A549 세포의 상처 치유는 시클레소나이드 처리 여부에 따라, 0시간, 18 시간에 촬영하였다.
(F) 인간의 폐암 세포의 콜로니 형성에 대한 시클레소나이드의 효과를 나타낸다. 상기 해리된 1000개의 A549 세포를 6-웰 플레이트에 접종하고, 7 일간 표시된 농도의 시클레소나이드와 DMSO로 처리하였다. 콜로니의 대표 이미지가 기록되었다. 표시된 데이터는 3 개의 독립적인 실험의 평균 ± SD를 나타낸다. *p<0.05 vs. DMSO-처리된 대조군.
도 8은 폐암 세포가 이식된 이종이식 모델에서 종양성장에 대한 시클레소나이드의 효과를 나타낸다. 500만개의 세포는 면역 결핍 NOD-SCID 수컷 누드 마우스의 피하조직에 주입하였다.
(A) A549 세포를 생산하는 면역 결핍 누드 마우스에서 시클레소나이드가 종양 성장에 미치는 효과를 나타낸 것이다. 사용된 약물 투여량은 10mg/kg이다.
(B) 종양의 무게에 대한 시클레소나이드의 효과를 나타낸다. 종양 무게는 치료 후에 측정하였다.
(C) 종양 부피는 캘리퍼를 사용하여 주 2회 측정하였으며, (폭×길이2)/2로 산출하였다. 종양 성장 곡선은 실험 기간 동안 모니터링 하였다.
*는 대조군과 비교하여, p <0.05. 대표적인 이미지는 치료 14주 끝에 캡쳐하였으며, 그 결과는 vehicle 처리된 대조군, 시클레소나이드 처리된 마우스로 나타냈다.
도 9는 투머스페어 형성에 대한 시클레소나이드의 효과를 나타낸다. A549 세포는 7일 동안 투머스페어 형성 조건에서 배양했다.
(A) A549 세포 유래된 투머스페어 형성에 대한 시클레소나이드의 효과를 나타낸다. 1차 투머스페어는 시클레소나이드 (5 및 10 μM) 또는 DMSO와 함께 7일간 배양하였다.
(B) A549 세포 유래된 투머스페어 형성에 대한 시클레소나이드의 활성화형인 이소부티릴 시클레소나이드의 효과를 나타낸다.
(C) A549 세포 유래된 투머스페어 형성에 대한 Glucocorticoids인 프레드니손 및 덱사메타손의 효과를 나타낸다. 1차 투머스페어는 프레드니손 및 덱사메타손 (40 및 80 μM) 또는 DMSO와 함께 7일간 배양하였다.
이미지는 10배 배율 현미경으로 얻었으며, 대표적인 투머스페어였다(스케일 바 = 100μm).
도 10은 ALDH 양성 세포 집단에 대한 시클레소나이드의 효과를 나타낸다. A549 세포는 2 일간 시클레소나이드 또는 DMSO로 처리한 후, ALDEFLUOR 분석 및 FACS 분석을 실시하였다. 하단 패널은 ALDH 저해제인, DEAB로 처리된 ALDH 양성 세포를 나타내고, 상단 패널은 DEAB 처리되지 않은 ALDH 양성 세포를 나타낸다. ALDH 양성 집단은 박스에 표시하였다.
도 11은 폐암에서 암 줄기세포 로드(load)에 대한 시클레소나이드의 효과를 나타낸다.
(A) CSC 마커인 nanog, sox2, c-myc, 및 snail 유전자의 전사 발현 수준은 시클레소나이드 및 DMSO-처리된 투머스페어에서 CSC 마커 특이적인 프라이머를 사용하여 실시간 PCR(RT-PCR)을 사용하여 분석하였다. β-액틴은 내부 대조군으로 사용하였다.
(B) 투머스페어 성장에 시클레소나이드의 효과를 나타낸다. 시클레소나이드는 투머스페어의 성장을 억제한다. 2일간 시클레소나이드 및 DMSO 처리된 투머스페어는 단일 세포로 분리하였으며, 동등한 세포 수로 6 cm 디쉬에 플레이팅하였다. 플레이팅 24시간 후, 세포를 계수하였다. 1일, 2일 및 3일째, 세포는 세번 계수되었고, 평균 값으로 플롯팅하였다. 상기 데이터는 3 개의 독립적인 실험의 평균 ± SD를 나타낸다. *p<0.05 vs. DMSO-처리된 대조군.
도 12는 투머스페어에서 세포 외 IL-8의 단백질 수준에 대한 시클레소나이드의 효과를 나타낸다.
시클레소나이드 또는 DMSO 처리된 종양의 인간 염증성 사이토카인 분석을 나타낸다. 상기 염증성 사이토카인은 BD cytometric bead array (CBA) human inflammatory cytokines kit를 이용하여 측정하였다. CBA 분석은 IL-6, IL-8, IL-10, IL-12, IL-1β, 및 TNF 항체를 사용하여 수행하였다.
본 발명자는 암 줄기 세포의 억제 후보자로, 다양한 화합물을 이용하여 암 줄기 세포의 성장을 억제하는 지를 확인하였으며, 그 중에서 시클레소나이드(ciclesonide)가 유방암 줄기세포와 폐암 줄기세포를 선택적으로 억제하는 것을 확인하였다. 시클레소나이드는 FDA 승인된 천식 치료제로 알려져 있으나, 본 발명자에 의해 최초로 유방암 줄기세포의 성장을 억제하고, MCF-7 벌크 세포에 비해 유방암 유래된 맘모스페어에서 STAT3 신호 전달경로를 선택적으로 억제하는 것을 확인하였다. 또한, 마우스 이종이식 모델을 사용하여 종양의 성장을 효과적으로 억제하는 것을 확인하였다. 이에 따라, 시클레소나이드는 CSCs를 타겟팅함으로써 유방암과 폐암을 비롯한 암 줄기세포의 성장을 억제하고, 유방암과 폐암을 비롯한 암 치료에 이용할 수 있음을 확인하고 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명은 하기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 암 줄기세포 성장 억제용 조성물을 제공한다.
[화학식 1]
Figure PCTKR2017011284-appb-I000001
본 발명에서 상기 시클레소나이드(ciclesonide)는 천식 치료제로 알려져 있으나, 본 발명자에 의해 최초로 유방암과 폐암 줄기세포의 성장을 억제하는 것을 확인하였다.
본 발명에서, 용어 "암"은 일반적으로 비조절된 세포 성장의 특징을 갖는 포유동물의 생리학적 상태를 나타내거나 설명한다. "암"이란 세포의 정상적인 분열, 분화 및 사멸의 조절 기능에 문제가 발생하여 비정상적으로 과다 증식하여 주위 조직 및 장기에 침윤하여 덩어리를 형성하고 기존의 구조를 파괴하거나 변형시키는 상태를 의미한다.
본 발명에서, 용어 "암 줄기세포"는 다양한 암세포로 분화할 수 있는 능력을 가진 미분화세포로, 상기 암으로는 결장암 및 직장암을 포함하는 대장암, 유방암, 자궁암, 자궁경부암, 난소암, 전립선암, 뇌종양, 두경부암종, 흑색종, 골수종, 백혈병, 림프종, 위암, 폐암, 췌장암, 간암, 식도암, 소장암, 항문부근암, 나팔관암종, 자궁내막암종, 질암종, 음문암종, 호지킨병, 방광암, 신장암, 수뇨관암, 신장세포암종, 신장골반암종, 골암, 피부암, 두부암, 경부암, 피부흑색종, 안구내흑색종, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직육종, 요도암, 음경암, 중추신경계(central nervous system;CNS) 종양, 1차 CNS 림프종, 척수종양, 뇌간신경교종 또는 뇌하수체선종일 수 있다. 이에 제한되지 않지만, 상기 암 줄기세포는 유방암 또는 폐의 줄기세포일 수 있다.
본 발명에서 용어 "유방암 줄기세포"는 유방암세포로 분화할 수 있는 능력을 가진 미분화세포를 의미한다.
본 발명에서 용어 "폐암 줄기세포"는 폐암세포로 분화할 수 있는 능력을 가진 미분화세포를 의미한다.
본 발명에서 용어 "유방암 줄기세포 성장 억제"는 유방암 줄기세포 유지 (maintenance) 억제, 유방암 줄기세포 악성화(malignance) 억제, 유방암 줄기세포 이동 및 유방암 줄기세포 침윤활성(invasive) 억제를 포함하는 의미이다.
본 발명에서 용어 "폐암 줄기세포 성장 억제"는 폐암 줄기세포 유지 (maintenance) 억제, 폐암 줄기세포 악성화(malignance) 억제, 폐암 줄기세포 이동 및 폐암 줄기세포 침윤활성(invasive) 억제를 포함하는 의미이다.
본 발명의 일실시예에서는 시클레소나이드가 유방암 줄기세포의 성장을 억제할 수 있는지 여부를 확인하기 위해, MCF-7 및 MDA-MB-231 세포로부터 유래된 1차 맘모스페어(mammosphere)에 시클레소나이드를 처리하였으며, 그 결과, 시클레소나이드는 유방암 세포주로부터 유래된 1차 맘모스페어의 형성을 억제하는 것을 확인하였으며, 구체적으로, 유방암 세포인 MCF-7 및 MDA-MB-231 세포로부터 유래된 맘모스페어의 수가 90%까지 감소하는 것을 확인하였을 뿐만 아니라, 맘모스페어의 크기도 감소하는 것을 확인하였다(도 3A 및 3B). 다만, 같은 Glucocorticoids에 속하는 프레드니손(prednisone)과 덱사메타손(dexamethasone)은 80μM의 고농도에서도 유방암 줄기세포의 성장을 억제하지 못하는 것을 확인하였다(도 3C).
또한, 본 발명의 다른 일실시예에서는 시클레소나이드가 폐암 줄기세포의 성장을 억제할 수 있는지 여부를 확인하기 위해, A549 세포로부터 유래된 1차 투머스페어(tumorsphere)에 시클레소나이드를 처리하였으며, 그 결과, 시클레소나이드는 폐암 세포주로부터 유래된 1차 투머스페어의 형성을 억제하는 것을 확인하였으며, 구체적으로, 폐암 세포인 A549 세포로부터 유래된 투머스페어의 수가 90%까지 감소하는 것을 확인하였을 뿐만 아니라, 투머스페어의 크기도 감소하는 것을 확인하였다(도 9A). 또한, 시클레소나이드의 활성화형인 이소부티릴 시클레소나이드(isobutyryl ciclesonide)를 처리한 결과 5μM 와 10μM에서 폐암 줄기세포 억제활성을 나타내는 것을 확인하였다. 그러나, 동일한 Glucocorticoids에 속하는 프레드니손 및 덱사메타손은 80μM에서도 폐암 줄기세포 억제 활성을 나타내지 않았다(도 9C).
이에 따라, 본 발명의 상기 화합물은 상기 화합물은 (i) 유방암 유래의 맘모스페어(mammosphere)의 형성을 억제하거나, (ii) 유방암 유래의 맘모스페어의 증식을 억제하거나, (iii) 폐암 유래의 투머스페어(tumorsphere)의 형성을 억제하거나, 또는 (iv) 폐암 유래의 투머스페어의 증식을 억제할 수 있다.
본 발명의 일실시예에서, 상기 유방암 줄기세포는 Nanog, C-myc, Oct4, Sox2, 및 CD44로 선택되는 하나 이상의 자가 재생(self-renewal) 유전자를 발현할 수 있으며, 상기 폐암 줄기세포는 Nanog, Sox2, C-myc, 및 Snail로 선택되는 하나 이상의 자가 재생(self-renewal) 유전자를 발현할 수 있다.
본 발명의 일실시예에서는 시클레소나이드가 유방암 줄기세포에서 특징적으로 발현하는 것으로 알려진 Nanog, C-myc, Oct4, Sox2, 및 CD44과 같은 자가 재생 유전자의 발현을 억제하였으며(도 6A), 유방암 줄기세포의 맘모스페어 형성에 관여하는 것으로 STAT3 신호전달 경로를 억제하는 것을 확인하였다(도 5A 및 5B). 또한, 유방암 줄기세포의 맘모스페어 형성에 관여하는 것으로 알려진 IL-6과 IL-8의 생산을 억제하는 것을 확인하였다(도 5C). 이에 따라, 상기 화합물은 유방암 줄기세포의 성장을 억제할 수 있음을 확인하였다.
또한, 시클레소나이드가 폐암 줄기세포에서 특징적으로 발현하는 것으로 알려진 nanog, sox2, c-myc, 및 snail과 같은 자가 재생 유전자의 발현을 억제하였으며(도 11A), 폐암 줄기세포의 투머스페어 형성에 관여하는 것으로 알려진 IL-8의 생산을 억제하는 것을 확인하였다(도 12). 이에 따라, 상기 화합물은 폐암 줄기세포의 성장을 억제할 수 있음을 확인하였다.
본 발명의 상기 조성물은 약학적 조성물 또는 식품조성물로 이용할 수 있다.
본 발명의 상기 조성물이 약학적 조성물로 활용되는 경우, 상기 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 포함할 수 있다.
본 발명에서 사용되는 용어 "약학적으로 허용가능한 염"은 상기 화합물의 원하는 생물학적 및/또는 생리학적 활성을 보유하고 있고, 원하지 않는 독물학적 효과는 최소한으로 나타내는 모든 염을 의미한다. 당해 기술분야에서 통상적인 방법에 따라 제조된 염을 의미하며, 이러한 제조방법은 당업자에게 공지되어 있다. 구체적으로, 상기 약학적으로 허용가능한 염은 약리학적 또는 생리학적으로 허용가능한 무기산과 유기산 및 염기로부터 유도된 염을 포함하지만 이것으로 한정되지는 않는다.
예를 들어, 약제학적으로 허용가능한 염기 부가 염들은 무기 및 유기 염기들로부터 제조될 수 있다. 무기 염기들로부터 유도된 염들은, 이에 제한되는 것은 아니지만, 나트륨, 칼륨, 리튬, 암모늄, 칼슘, 및 마그네슘 염들을 포함할 수 있다. 유기 염기들로부터 유도된 염들은, 이에 제한되는 것은 아니지만, 일차, 이차 및 삼차 아민; 천연적으로 발생하는 치환된 아민들을 포함하는 치환된 아민들; 및 이소프로필아민, 트리메틸아민, 디에틸아민, 트리에틸아민, 트리프로필아민, 에탄올아민, 2-디메틸아미노에탄올, 트로메타민(tromethamine), 라이신, 아르기닌, 히스티딘, 카페인, 프로카인(procaine), 히드라바민 (hydrabamine), 콜린(choline), 베타인(betaine), 에틸렌디아민, 글루코사민, N-알킬글루카민, 테오브로민(theobromine), 퓨린, 피페라진, 피페리딘, 및/또는 N-에틸피페리딘을 포함하는 시클릭 아민들의 염들을 포함할 수 있다. 또한, 다른 카르복실산 유도체, 예를 들어 카르복사미드(carboxamides), 저급 알킬 카르복사미드, 디(저급 알킬) 카르복사미드 등을 포함하는 카르복실산 아미드도 포함될 수 있다.
예를 들어, 약학적으로 허용가능한 산 부가 염들은 무기 및 유기산들로부터 제조될 수 있다. 무기산들로부터 유도된 염들은 염산, 브롬산, 황산, 질산, 인산 등을 포함한다. 유기산들로부터 유도된 염들은 아세트산, 프로피온산, 글리콜산, 피루브산, 옥살산, 말산 (malic acid), 말론산, 숙신산, 말레산(maleic acid), 푸마르산, 타르타르산, 시트르산, 벤조산, 신남산(cinnamic acid), 만델산(mandelic acid), 메탄술폰산, 에탄술폰산, p-톨루엔술폰산, 및/또는 살리실산 등을 포함할 수 있으나, 이에 제한되지 않을 수 있다.
본 발명에서, 상기 약학 조성물은 약학적으로 허용가능한 담체(carrier) 또는 첨가제를 포함할 수 있다. 본 발명에서 상기 "약학적으로 허용가능한" 의미는 유효성분의 활성을 억제하지 않으면서 적용(처방) 대상이 적응 가능한 이상의 독성을 지니지 않는다는 의미이다. 상기 "담체"는 세포 또는 조직 내로의 화합물의 부가를 용이하게 하는 화합물로 정의된다.
본 발명의 시클레소나이드는 단독으로 또는 어떤 편리한 담체 등과 함께 혼합하여 투여될 수 있고, 그러한 투여 제형은 단회투여 또는 반복투여 제형일 수 있다. 상기 약학 조성물은 고형 제제 또는 액상 제제일 수 있다. 고형 제제는 산제, 과립제, 정제, 캅셀제, 좌제 등이 있으나, 이에 한정되는 것은 아니다. 고형 제제에는 담체, 착향제, 결합제, 방부제, 붕해제, 활택제, 충진제 등이 포함될 수 있으나 이에 한정되는 것은 아니다. 액상 제제로는 물, 프로필렌 글리콜 용액 같은 용액제, 현탁액제, 유제 등이 있으나, 이에 한정되는 것은 아니며, 적당한 착색제, 착향제, 안정화제, 점성화제 등을 첨가하여 제조할 수 있다. 예를 들어, 산제는 본 발명의 유효 성분인 시클레소나이드와 유당, 전분, 미결정셀룰로오스 등 약제학적으로 허용가능한 적당한 담체를 단순 혼합함으로써 제조될 수 있다. 과립제는 본 발명의 상기 시클레소나이드; 약학적으로 허용가능한 적당한 담체; 및 폴리비닐피롤리돈, 히드록시프로필셀룰로오스 등의 약학적으로 허용가능한 적당한 결합제를 혼합한 후, 물, 에탄올, 이소프로판올 등의 용매를 이용한 습식과립법 또는 압축력을 이용한 건식과립법을 이용하여 제조될 수 있다. 또한 정제는 상기 과립제를 마그네슘스테아레이트 등의 약학적으로 허용가능한 적당한 활택제와 혼합한 후, 타정기를 이용하여 타정함으로써 제조될 수 있다.
본 발명의 시클레소나이드는 치료해야 할 질환 및 개체의 상태에 따라 경구제, 주사제(예를 들어, 근육주사, 복강주사, 정맥주사, 주입(infusion), 피하주사, 임플란트), 흡입제, 비강투여제, 질제, 직장투여제, 설하제, 트랜스더말제, 토피칼제 등으로 투여될 수 있으나, 이에 한정되는 것은 아니다. 투여 경로에 따라 통상적으로 사용되고 비독성인, 약학적으로 허용가능한 운반체, 첨가제, 비히클을 포함하는 적당한 투여 유닛 제형으로 제제화될 수 있다.
본 발명의 약학 조성물은 매일 약 0.0001 mg/kg 내지 약 10 g/kg이 투여될 수 있으며, 약 0.001 mg/kg 내지 약 1 g/kg의 1일 투여 용량으로 투여될 수 있다. 그러나 상기 투여량은 상기 혼합물의 정제 정도, 환자의 상태(연령, 성별, 체중 등), 치료하고 있는 상태의 심각성 등에 따라 다양할 수 있다. 필요에 따라 편리성을 위하여 1일 총 투여량을 하루 동안 여러 번 나누어 투여될 수 있다.
본 발명의 조성물이 약학 조성물로 사용될 경우, 상기 조성물 내의 시클레소나이드의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 항염 활성을 나타낼 수 있는 유효량을 적절히 조절 가능하며, 예컨대, 상기 시클레소나이드의 양은 전체 조성물 총 중량을 기준으로 0.0001 중량% 이상, 구체적으로 0.001 중량% 이상일 수 있고, 80 중량% 이하, 구체적으로는 50 중량% 이하일 수 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명의 상기 시클레소나이드는 유방암 세포 유래 맘모스페어의 성장(증식)을 억제하는 것을 확인하였는 바, 유방암 줄기세포 성장 억제용 식품 조성물로 이용이 가능하다. 또한, 상기 시클레소나이드는 폐암 세포 유래 투머스페어의 성장(증식)을 억제하는 것을 확인하였는 바, 폐암 줄기세포 성장 억제용 식품 조성물로 이용이 가능하다.
본 발명의 상기 조성물이 식품 조성물로 이용되는 경우, 허용가능한 식품 보조 첨가제를 포함할 수 있으며, 식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.
본 발명에서 식품은 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품을 의미하며, 구체적으로 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것을 의미하며, 통상적인 의미로서, 각종 식품, 기능성 식품, 음료, 식품 첨가제 및 음료 첨가제를 모두 포함하는 의미로 사용된다. 상기 식품의 예로서 각종 식품류, 음료, 껌, 차, 비타민 복합제, 기능성 식품 등이 있다. 추가로, 본 발명의 식품에는 특수영양식품(예, 조제유류, 영,유아식 등), 식육가공품, 어육제품, 두부류, 묵류, 면류(예, 라면류, 국수류 등), 건강보조식품, 조미식품(예, 간장, 된장, 고추장, 혼합장 등), 소스류, 과자류(예, 스넥류), 유가공품(예, 발효유, 치즈 등), 기타 가공식품, 김치, 절임식품(각종 김치류, 장아찌 등), 음료(예, 과실, 채소류 음료, 두유류, 발효음료류, 아이스크림류 등), 천연조미료(예, 라면 스프 등), 비타민 복합제, 알코올 음료, 주류 및 그 밖의 건강보조식품류를 포함하나 이에 한정되지 않는다. 상기 기능성 식품, 음료, 식품첨가제 또는 음료첨가제는 통상의 제조방법으로 제조될 수 있다.
상기 "기능성 식품"이란 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병 방지와 회복 등에 관한 체내조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미하며, 구체적으로는 건강기능식품일 수 있다.
본 발명에서 사용되는 용어 "건강기능식품"이란 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 여기서 "기능"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 본 발명의 건강기능식품은 당업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조시에는 당업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 건강기능식품으로 인정되는 제형이면 제한없이 제조될 수 있다. 본 발명의 식품용 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 본 발명의 건강기능식품은 유방암과 폐암 줄기세포 성장 억제의 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
또한, 상기 기능성 식품에는 식품학적으로 허용 가능한 식품 보조 첨가제를 포함할 수 있으며, 기능성 식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.
또한, 상기 식품 조성물에서, 상기 시클레소나이드의 양은 식품 조성물 총 중량의 0.00001 중량% 이상, 구체적으로 0.1 중량% 이상일 수 있고, 80 중량% 이하, 구체적으로 50 중량% 이하, 더욱 구체적으로 40 중량% 이하로 포함될 수 있으며, 상기 식품이 음료인 경우에는 식품 전체의 부피 100 ml를 기준으로 0.001 g 이상, 구체적으로 0.01 g 이상, 50 g 이하, 구체적으로 10 g 이하, 더욱 구체적으로 2g 이하의 비율로 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 식품 조성물에는 그 유효성분 이외에 감미제, 풍미제, 생리활성 성분, 미네랄 등이 포함될 수 있다. 감미제는 식품이 적당한 단맛을 나게 하는 양으로 사용될 수 있으며, 천연의 것이거나 합성된 것일 수 있다. 구체적으로는 천연 감미제를 사용하는 경우인데, 천연 감미제로서는 옥수수 시럽 고형물, 꿀, 수크로오스, 프록토오스, 락토오스, 말토오스 등의 당 감미제를 들 수 있다. 풍미제는 맛이나 향을 좋게 하기 위하여 사용될 수 있는데, 천연의 것과 합성된 것 모두 사용될 수 있다. 구체적으로는 천연의 것을 사용하는 경우이다. 천연의 것을 사용할 경우에 풍미 이외에 영양 강화의 목적도 병행할 수 있다. 천연 풍미제로서는 사과, 레몬, 감귤, 포도, 딸기, 복숭아 등에서 얻어진 것이거나 녹차잎, 둥굴레, 대잎, 계피, 국화 잎, 자스민 등에서 얻어진 것일 수 있다. 또한, 인삼(홍삼), 죽순, 알로에 베라, 은행 등에서 얻어진 것을 사용할 수 있다. 천연 풍미제는 액상의 농축액이나 고형상의 추출물일 수 있다. 경우에 따라서 합성 풍미제가 사용될 수 있는데, 합성 풍미제는 에스테르, 알콜, 알데하이드, 테르펜 등이 이용될 수 있다. 생리 활성 물질로서는 카테킨, 에피카테킨, 갈로카테킨, 에피갈로카테킨 등의 카테킨류나, 레티놀, 아스코르브산, 토코페롤, 칼시페롤, 티아민, 리보플라빈 등의 비타민류 등이 사용될 수 있다. 미네랄로서는 칼슘, 마그네슘, 크롬, 코발트, 구리, 불소화물, 게르마늄, 요오드, 철, 리튬, 마그네슘, 망간, 몰리브덴, 인, 칼륨, 셀레늄, 규소, 나트륨, 황, 바나듐, 아연 등이 사용될 수 있다.
또한, 본 발명의 식품 조성물은 상기 감미제 등 이외에도 필요에 따라 보존제, 유화제, 산미료, 점증제 등을 포함할 수 있다.
이러한 보존제, 유화제 등은 그것이 첨가되는 용도를 달성할 수 있는 한 극미량으로 첨가되어 사용되는 것이 바람직하다. 극미량이란 수치적으로 표현할 때 식품 조성물 전체 중량을 기준으로 할 때 0.0005 중량％ 내지 약 0.5 중량％ 범위를 의미한다. 사용될 수 있는 보존제로서는 소듐 소르브산칼슘, 소르브산나트륨, 소르브산칼륨, 벤조산칼슘, 벤조산나트륨, 벤조산칼륨, EDTA(에틸렌디아민테트라아세트산) 등을 들 수 있다. 사용될 수 있는 유화제로서는 아카시아검, 카르복시메틸셀룰로스, 잔탄검, 펙틴 등을 들 수 있다. 사용될 수 있는 산미료로서는 연산, 말산, 푸마르산, 아디프산, 인산, 글루콘산, 타르타르산, 아스코르브산, 아세트산, 인산 등을 들 수 있다. 이러한 산미료는 맛을 증진시키는 목적 이외에 미생물의 증식을 억제할 목적으로 식품 조성물이 적정 산도로 되도록 첨가될 수 있다. 사용될 수 있는 점증제로서는 현탁화 구현제, 침강제, 겔형성제, 팽화제 등을 들 수 있다.
본 발명은 다른 하나의 양태로, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암의 치료 또는 예방용 약학적 조성물을 제공한다.
본 발명의 일실시예에서는 MCF-7 세포주와 MDA-MB-231세포주에서 시클레소나이드를 처리한 경우, 유방암 세포주들의 성장이 억제되는 것을 확인하였다(도 1A 및 1B). 또한, 시클레소나이드 처리에 의해, MDA-MB-231 세포에서 세포자멸 소체(apoptotic bodies) 형성을 확인하였다(도 1E).
본 발명의 다른 일실시예에서는 A549 세포에서 시클레소나이드를 처리한 경우, 폐암 세포주들의 성장이 억제되는 것을 확인하였다(도 7A). 또한, 시클레소나이드 처리에 의해, A549 세포에서 세포자멸 소체(apoptotic bodies) 형성을 확인하였다(도 7B).
이에 따라, 본 발명의 조성물은 유방암 또는 폐암의 치료 또는 예방용 약학적 조성물로 이용할 수 있다.
또한, 본 발명의 일실시예에서는 시클레소나이드 억제제가 유방암 세포에서 CD44high/CD24low를 발현하는 모집단을 감소시켰으며(도 4A), ALDH 양성 유방암 세포의 비율을 감소시킨 것을 확인하였다(도 4B). 또한, ALDH 양성 폐암 세포의 비율을 감소시킨 것을 확인하였다(도 10). 이에 따라, 상기 조성물은 CD44high/CD24low를 발현하는 유방암 세포의 성장을 억제할 수 있으며, 알데히드 탈수소효소(ALDH) 양성의 유방암 세포의 성장을 억제할 수 있으며, 또한 알데히드 탈수소효소(ALDH) 양성의 폐암 세포의 성장을 억제할 수 있다.
본 발명은 다른 하나의 양태로, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암전이 억제용 약학적 조성물을 제공한다.
상기 암은 발생한 부위에 존재하는 원발암과 상기 발생 부위로부터 신체의 다른 부위로 퍼져나간 전이암으로 구분된다. 상기 "암전이"는 악성 종양이 발병한 장기에서 떨어진 다른 조직으로 전파한 상태를 의미한다. 암세포가 혈액순환이나 림프순환을 통해 퍼져나가서 형성되는 것으로, 대개는 혈액순환을 타고 다른 장기로 옮겨간 후 새로운 종양으로 자라난 것이다. 이와 달리 암세포가 이웃한 조직으로 직접 이동하여 형성되기도 한다. 본 발명에서 암전이는 암세포가 이웃조직으로 직접 이동하고 침투하는 침윤(invasion)에 의한 암세포의 확산 및 암세포가 혈류를 타고 이동하여 물리적으로 원발암과는 인접하지 않은 장기에서 새로운 종양을 형성하는 전이(metastasis)를 모두 포함한다. 한편, 상기 암전이에 있어서, 세포의 이동은 필수적이다. 따라서, 이러한 암세포의 이동을 저해하는 것이 암전이를 예방하는 일차적인 방법임은 자명하다.
본 발명에서 상기 암은 이에 제한되지 않으나, 유방암 또는 폐암일 수 있다. 본 발명에서 용어 "암", "암 줄기세포", "암 줄기세포 성장 억제", "약학적 조성물"에 대한 설명은 전술한 바와 같다.
본 발명의 일실시예에서는 시클레소나이드가 MDA-MB-231 세포의 이동과 콜로니 형성을 농도 의존적으로 억제하는 것을 확인하였다(도 1F 및 1G).
또한, 본 발명의 다른 일실시예에서는 상기 시클레소나이드가 A549 세포의 이동과 콜로니 형성을 억제하는 것을 확인하였다(도 7E 및 7F)
이에 따라, 상기 본 발명의 조성물은 암세포의 이동을 억제함으로써 암 전이를 억제할 수 있는 바, 암의 전이 억제용 약학적 조성물로 활용이 가능하다.
본 발명은 다른 하나의 양태로, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암의 개선 또는 예방용 식품 조성물을 제공한다.
본 발명에서 용어 "암", "암 줄기세포", "암 줄기세포 성장 억제", "식품 조성물"에 대한 설명은 전술한 바와 같다. 본 발명의 일실시예에서는 MCF-7 세포주와 MDA-MB-231 세포주에서 시클레소나이드를 처리한 경우, 유방암 세포주들의 성장이 억제되는 것을 확인하였으며, 다른 일실시예에서는 A549 세포주에서 시클레소나이드를 처리한 경우, 폐암 세포주들의 성장이 억제되는 것을 확인하였는 바, 암의 개선 또는 예방용 식품 조성물로 이용이 가능하다. 본 발명에서 상기 암은 유방암 또는 폐암일 수 있으나, 이에 제한되지는 않는다.
본 발명은 다른 하나의 양태로, 상기 암 줄기세포 성장 억제용 조성물을 포함하는, 암전이 개선 또는 예방용 식품 조성물을 제공한다.
본 발명에서 용어 "암전이", "암 줄기세포", "암 줄기세포 성장 억제", "식품 조성물"에 대한 설명은 전술한 바와 같다. 본 발명의 일실시예에서는 시클레소나이드가 MDA-MB-231 세포의 이동과 콜로니 형성을 농도 의존적으로 억제하였으며, 다른 일실시예에서는 시클레소나이드가 A549 세포의 이동과 콜로니 형성을 억제하는 것을 확인하였는 바, 암전이 개선 또는 예방용 식품 조성물로 이용이 가능하다. 본 발명에서 상기 암은 유방암 또는 폐암일 수 있으나, 이에 제한되지는 않는다.
본 발명은 다른 하나의 양태로, 하기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암 줄기세포의 성장을 억제하는 방법을 제공한다.
[화학식 1]
Figure PCTKR2017011284-appb-I000002
본 발명에서, 용어 "시클레소나이드", "암", "암 줄기세포", "암 줄기세포 성장 억제"에 대한 설명은 전술한 바와 같다.
본 발명에서 용어 "개체"란 암전이가 발생하였거나 암이 발생한 인간을 포함한 모든 동물을 의미한다. 소, 돼지, 양, 닭, 개, 인간 등을 포함하는 포유동물, 조류 등을 포함하며, 본 발명의 상기 조성물의 투여에 의해 암 줄기세포의 성장이 억제되고 이에 의해 암이 치료되는 개체는 제한없이 포함한다.
본 발명의 다른 목적은, 상기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암 전이를 억제하는 방법을 제공하는 것이다.
본 발명에서, 용어 "시클레소나이드", "암", "개체", "암 전이"에 대한 설명은 전술한 바와 같다.
본 발명의 또 다른 목적은, 상기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암의 치료 또는 예방 방법을 제공하는 것이다.
본 발명에서, 용어 "시클레소나이드", "암", "개체", "치료", "예방"에 대한 설명은 전술한 바와 같다.
본 발명의 다른 목적은, 상기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 암 줄기세포의 성장을 억제하기 위한 의약품의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 발명에서, 용어 "시클레소나이드", "암", "암 줄기세포", "암 줄기세포 성장 억제"에 대한 설명은 전술한 바와 같다.
본 발명의 다른 목적은, 상기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 암 전이를 억제하기 위한 의약품의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 발명에서, 용어 "시클레소나이드", "암", "암 전이"에 대한 설명은 전술한 바와 같다.
본 발명의 또 다른 목적은, 상기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 암의 예방 또는 치료를 위한 의약품의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 발명에서, 용어 "시클레소나이드", "암", "치료", "예방"에 대한 설명은 전술한 바와 같다.
이하, 본 발명을 실시예에 의해 보다 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기의 실시예에 한정되는 것은 아니다.
<A: 실험 재료 및 방법>
실시예 1: 실험재료
매우 낮은 부착 클러스터 플레이트를 포함하는 6-웰 배양 플레이트는 코닝(Tewksbury, MA, USA)로부터 획득했다. 시클레소나이드는 Sigma-Aldrich Co.(St. Louis, MO, USA)로부터 구입하였다. 세포 생존율은 CellTiter 96® aqueous one solution cell proliferation assay kit (Promega, Madison, WI, USA)을 사용하여 측정하였다. ALDEFLUOR™ Kit는 STEMCELL Technologies Inc (Vancouver, BC, Canada)에서 구입하였다.
실시예 2-1: 인간의 유방암 세포 배양과 맘모스페어 ( mammospheres ) 형성
인간의 유방암 세포, MCF-7은 American Type Culture Collection (ATCC; Manassas, VA, USA)로부터 얻었다. MCF-7 세포 및 MDA-MB-231는 10 % 소 태아 혈청(FBS; Hyclone), 100 U/㎖ 페니실린, 및 100 μg/ml 스트렙토마이신(Hyclone)을 포함하는 Dulbecco’s Modified Essential Medium (DMEM; Hyclone, Logan, UT, USA)에서 배양하였다. 상기 MCF-7 세포는 5 % CO2를 함유하는 가습된 배양기에서 37℃로 유지하였다. 세포는 10cm 배양 접시에 1×106 세포의 밀도로 플레이팅 하였다. 1차 맘모스페어를 확립하기 위하여, 싱글 세포 현탁된 MCF-7 세포는 2ml의 complete MammoCultTM medium (StemCell Technologies, Vancouver, BC, Canada)을 포함하는 ultra-low attachment 6-well plates에 웰당 3.5-4×104의 세포수로 접종하였다. 상기 complete MammoCultTM medium은 4 μg/ml의 헤파린, 0.48 μg/㎖의 하이드로코르티손, 100 U/ml 페니실린 및 100 μg/㎖의 스트렙토마이신으로 보충하였다. 상기 세포를 7일 동안 37 ℃, 5 % CO2 배양기에서 배양하였다.
실시예 2-2: 인간의 폐암 세포 배양과 투머스페어 ( tumorsphere ) 형성
인간의 폐암 세포, A549는 실시예 2-1의 유방암 세포와 동일한 배양 조건에서 배양하였다. 1차 투머스페어를 확립하기 위하여, 싱글 세포 현탁된 A549 세포는 2ml의 Cancer Stem Premeium medium(ProMab Biotechnologies Inc, Richmond, CA, USA)을 포함하는 ultra-low attachment 6-well plates에 웰당 5×104의 세포수로 접종하였다. 상기 세포를 10일 동안 37 ℃, 5 % CO2 배양기에서 배양하였다.
실시예 3-1: 유방암 맘모스페어의 자동 계산
배양 10 일째, 세포 배양 플레이트를 스캐너(Epson Perfection V700 PHOTO, Epson Korea, Co, Seoul, Korea)에 배치하여, 맘모스페어의 8 비트 그레이 스케일 이미지를 얻었다. 낮은 해상도 (300 dpi)에서 이미지는 NICE 소프트웨어 프로그램을 사용하여 얻었으며, ftp://ftp.nist.gov/pub/physics/mlclarke/NICE에서 다운로드 했다. 카운팅을 위해, 행과 열의 바람직한 수(예를 들면, 6-웰 플레이트의 경우 2 x3)를 선택하여, 관심 영역(ROIs)을 생성하였으며, NICE program의 타원형 세팅을 선택한 후에, 개개의 ROIs는 제공된 ROI 형상을 이동 및 크기를 조정하여, 디파인(define)하였다. 상기 이미지의 배경 신호는 임계 알고리즘을 이용하여 부정하였으며, 선택된 이미지는 자동적으로 계수하였다. 상기 맘모스페어 형성 분석은 웰당 맘모스페어의 수/웰당 플레이팅된 총 세포의 수x100에 상응하여 맘모스페어의 형성 효율(MFE, %)을 결정하였다.
실시예 3-2: 폐암 투머스페어(tumorsphere)의 자동 계산
상기 실시예 3-1과 동일한 방법으로 폐암 투머스페어를 계수하였으며, 상기 투머스페어 형성 분석은 웰당 투머스페어의 수/웰당 플레이팅된 총 세포의 수 x100에 상응하여 투머스페어의 형성 효율(TFE, %)을 결정하였다.
실시예 4: 카스파제 -3/7( Caspase -3/7) 분석
유방암 세포와 폐암 세포는 24 시간 동안 시클레소나이드의 상이한 농도로 처리하였다. 카스파제-3/7 활성은 Caspase-Glo 3/7 kit (Promega, Wisconsin, USA)에 대한 제조업체의 지시에 따랐다. Caspase-Glo3/7 시약 100 ㎕를 암세포 배양 96-웰에 첨가하였다. 플레이트는 플레이트 실러로 덮고 실온에서 1 시간 동안 배양하였으며, plate-reading luminometer, GloMax® Explorer (Promega, Wisconsin, USA)를 이용하여 측정하였다.
실시예 5: CD44 및 CD24 발현 유세포 분석(Flow cytometric analysis)
MCF-7 세포에서 CD44 및 CD24의 발현은 FACS 분석에 의해 측정하였다. 1X 트립신/EDTA를 사용하여 세포를 분리 및 수확한 후, 백만개의 세포를 현탁시키고, FITC-결합된 항-인간 CD44와 PE-결합된 항-인간 CD24 항체 (BD Pharmingen, San Diego, CA, USA)로 표지하고 4℃에서 30분 동안 배양하였다. 이어서, 상기 세포를 1X PBS로 3회 세척하고, 유동세포 계측법(flow cytometry, Accuri C6, BD, San Diego, CA, USA)으로 분석하였다.
실시예 6: 아넥신 ( Annexin ) V/PI 염색 분석
암 세포는 6-웰 플레이트에서 배양하였으며, 유방암의 경우, 시클레소나이드 20 μM에서, 폐암의 경우, 시클레소나이드 10 및 20 μM 또는 DMSO와 함께 24시간 동안 배양하였다. 제조업체의 지시에 따라, 사멸된 세포는 PI 및 FITC-Annexin V로 이중염색하였다. 상기 샘플은 유동 세포 계측법(Flow cytometry) (Accuri C6, BD, San Diego, CA, USA)으로 분석하였다.
실시예 7: 형광 염색법에 의한 세포 사멸 분석
MDA-MB-231 세포를 시클레소나이드 20 μM, 또는 A549 세포를 시클레소나이드 30 μM에서 24 시간 동안 처리하고, 세포는 훽스트 (Hoechst) 33258 용액 (10 mg/ml)에서 37℃에서 30 분 동안 배양 하였다. 이후 세포를 형광 현미경으로 관찰하였다.
실시예 8: 클론원성 분석
MDA-MB-231 또는 A549 세포를 6-웰 플레이트에서 낮은 밀도로 접종하고, DMEM 배지에서 상이한 시클레소나이드 농도로 MDA-MB-231에 처리하거나, 10 μM 시클레소나이드로 A549 세포에 처리하였다. 24시간 후 배지는 새로운 배지로 교체하였고, 7 일간 성장하도록 배양하였다. 성장한 콜로니를 계수하였다.
실시예 9: 스크래치 이동 분석
MDA-MB-231 또는 A549 세포를 6-웰 플레이트에 접종하고 90 % 컨플루언시로 성장시켰다. 멸균된 백색 마이크로 피펫 팁을 사용하여, 셀층에 스크래치를 만들었다. DMEM 배지로 세척한 후, 유방암 또는 폐암은 시클레소나이드 또는 DMSO로 처리하였다. 18시간째에, 상처영역(wounded areas)을 40배 광학 현미경으로 촬영했다.
실시예 10-1: 유방암 세포 증식 분석
CellTiter 96® aqueous one solution 세포 증식 키트를 이용하여 MCF-7 및 MDA-MB-231 세포의 증식 속도를 측정했다. MCF-7 세포 및 MDA-MB-231 세포를 48 시간 동안 시클레소나이드 0, 5, 10, 20, 40 및 80 μM의 존재 하에 96-웰 플레이트에서 배양하였다. 제조사의 프로토콜에 따라, 96-웰 플레이트 판독기(Dynex Revelation, Dynex Ltd., Billingshurst, UK)를 사용하여, 490 nm에서 흡광도를 결정하였다. 각각의 데이터는 3세트를 측정하여 결정하였다.
실시예 10-2: 폐암 세포 증식 분석
폐암 세포로, A549 세포를 사용하고, 시클레소나이드를 0, 10, 20, 40, 80 및 100μM의 농도로 처리한 것을 제외하고, 실시예 10-1과 동일한 방법으로 수행하였다.
실시예 11: 웨스턴 블랏팅
시클레소나이드 처리된 MCF-7 및 MDA-MB-231 맘모스페어로부터 분리된 단백질은 10 % SDS-PAGE상에서 분리하고 폴리비닐리덴 디플루오라이드 멤브레인(Millipore, Bedford, MA, USA)으로 옮겼다. 상기 멤브레인을 30분 동안 실온에서 5 % 탈지 분유를 함유하는 PBS-트윈 20 (0.1%, v/v)에서 블로킹하였다. 상기 블랏은 밤새 4℃에서 1차 항체를 포함하는 블로킹 용액으로 배양하였다. 사용된 1차 항체는 다음과 같다: Stat3, p65, Lamin B, 및 phospho-Stat3(Cell Signaling, Beverly, MA, USA). β-액틴(Santa Cruz Biotechnology)는 로딩 대조군으로 사용하였다. PBS-트윈 20(0.1%, v/v)으로 세척 한 후, 상기 블랏은 horseradish peroxidase-결합된 2차 항체로 배양하고, 화학발광 검출키트(Santa Cruz Biotechnology)로 감광하였다.
실시예 12: ALDEFLUOR 분석
ALDEFLUOR 분석 시스템은 알데히드 탈수소효소(ALDH)의 활성에 기초된 CSCs의 식별, 평가 및 분리에 대한 신규한 접근법을 제공한다. 활성 시약 BODIPY-아미노아세트알데히드를 유방암 세포 또는 폐암 세포에 첨가하였으며, 알데히드 탈수소효소(ALDH)에 의해 형광의 BODIPY-아미노아세테이트로 전환되었다. ALDH 저해제인, 디에틸아미노벤즈알데히드(diethylaminobenzaldehyde, DEAB)은 음성 대조군으로 사용하였다. MCF-7 세포 또는 A549 세포에 24시간 동안 10 또는 20 μM의 시클레소나이드로 처리하고, ALDH 양성 세포의 비율은 ALDEFLUOR 분석법으로 분석하였다. ALDH 양성 및 음성 세포는 C6 Accuri 유동 세포 계측법 (BD Bioscience)를 사용하여 분류하였다.
실시예 13-1: 유방암 세포를 생산하는 면역 결핍 NOD- SCID ( BALB / cSIc (nu/nu)) female 누드 마우스의 화학 요법
총 12마리의 유방암 세포를 생산하는 NOD-SCID(BALB/cSIc (nu/nu)) 암컷 누드 마우스는 두 개의 그룹으로 구분하였다. 음성 대조군인 6 마리의 마우스는 화학 요법을 받지 않았다. 대조군 마우스의 종양의 부피는 매 3일마다 측정하였고, 식 (폭×길이2)/2를 사용하여 계산하였다. 다른 여섯 마리의 누드 마우스는 10mg/kg/day의 최적 투여량으로 주입공정을 사용하여 시험약물을 선행화학요법으로 받았다.
실시예 13-2: 폐암 세포를 생산하는 면역 결핍 NOD- SCID ( BALB / cSIc (nu/nu)) male 누드 마우스의 화학 요법
총 12 마리의 폐암을 생산하는 NOD-SCID(BALB/cSIc (nu/nu) male 누드 마우스는 2 그룹으로 나누었다. 음성 대조군인 6 마리의 마우스는 화학 요법을 받지 않았다. 대조군 마우스의 종양의 부피는 매 3일마다 측정하였고, 식 (폭×길이2)/2를 사용하여 계산하였다. 다른 여섯 마리의 누드 마우스는 10mg/kg/day의 최적 투여량으로 주입공정을 사용하여 시험약물을 선행화학요법으로 받았다.
실시예 14: 실시간 PCR ( realtime RT- PCR )
제조업체의 지시에 따라, 이중가닥 DNA 특이 염료로 SYBR 그린을 사용하여 One Step SYBR PrimeScript RT-PCR kit(Takara, Tokyo, Japan)로 전사체의 수준을 측정하였다. 원스텝 RT-PCR 반응은 1μg의 total RNA, 10μl의 2X One Step SYBR RT-PCR Buffer IV, 1μl의 PrimeScript 1 step Enzyme Mix II, CD44, NANOG, OCT4, C-myc, Sox2, Snail 및 β-actin에 대한 10 μM의 PCR 정방향 프라이머, 및 PCR 역방향 프라이머를 포함하여, 반응당 20 ㎕의 최종 부피에서 수행하였다.
상기 정방향, 역방향 프라이머는 다음과 같다.
CD44 forward primer: AGAAGGTGTGGGCAGAAGAA(서열번호 1),
CD44 reverse primer: AAATGCACCATTTCCTGAGA(서열번호 2),
NANOG forward primer: ATGCCTCACACGGAGACTGT(서열번호 3),
NANOG reverse primer: AAGTGGGTTGTTTGCCTTTG(서열번호 4),
OCT4 forward primer: AGCAAAACCCGGAGGAGT(서열번호 5),
OCT4 reverse primer: CCACATCGGCCTGTGTATATC(서열번호 6),
SOX2 forward primer: TTGCTGCCTCTTTAAGACTAGGA (서열번호 7),
SOX2 reverse primer: CTGGGGCTCAAACTTCTCTC (서열번호 8),
C-myc forward primer: AATGAAAAGGCCCCCAAGGTAGTTATCC(서열번호 9),
C-myc reverse primer: GTCGTTTCCGCAACAAGTCCTCTTC(서열번호 10),
β-actin forward primer: TGTTACCAACTGGGACGACA(서열번호 11),
β-actin reverse primer: GGGGTGTTGAAGGTCTCAAA(서열번호 12).
Snail forward primer: ACCACTATGCCGCGCTCTT (서열번호 15),
Snail reverse primer: GGTCGTAGGGCTGCTGGAA (서열번호 16).
표적 유전자의 mRNA의 상대적 발현량은 비교 CT 법을 이용하여 계산하였다. 적어도 3 개의 독립적인 PCR 절차는 통계분석을 따라서 수행하였다. PCR 산물은 내부 대조군(internal control)으로 β-actin 유전자로 표준화했다.
실시예 15: 인간 염증성 사이토카인 분석
염증성 사이토 카인은 제조사의 지시에 따라, BD cytometric bead array (CBA) human inflammatory cytokines kit를 이용하여 측정하였다(BD, San Diego, CA, USA).
혼합된 capture beads를 볼텍싱하고, beads 50 μl를 분석 튜브에 첨가했다. 인간 염증성 사이토카인 표준 50 μl와 배양된 투머스페어 용액을 분석 튜브에 더하고 나서, 사이토카인 PE 용액을 혼합하였다. 3시간 후, 상기 혼합된 용액을 세척하고, 유동세포계측법(flow cytometry)으로 분석하였다 (Accuri C6, BD, San Diego, CA, USA).
실시예 16: Electrophoretic mobility shift assays ( EMSA )
EMSA는 제조업체의 지시에 따라, Lightshift의 chemiluminscet EMSA 키트 (Thermoscientific, IL, USA)를 사용하여 검출하였다. Stat3 probe의 비오틴-상부 및 하부 프로부(5′-CTTCATTTCCCGGAAATCCCTA-Biotin3′, 서열번호 13 및 5′-TAGGGATTTCCGGGAAATGAAG-Biotin3′, 서열번호 14)는 어닐링되었고 상기 이중가닥 올리고뉴클레오티드는 비오틴으로 말단 표지하였다. MCF-7, MDA-MB-231 및 A549 세포로부터 핵 추출물은 참고문헌에 제시된 바와 같이 제조하였다 (Choi HS, Hwang CK, Kim CS, Song KY, Law PY, Wei LN and Loh HH. Transcriptional regulation of mouse mu opioid receptor gene: Sp3 isoforms (M1, M2) function as repressors in neuronal cells to regulate the mu opioid receptor gene. Mol Pharmacol. 2005; 67(5):1674-1683).
비오틴-표지된 DNA 프로브는 20분 동안 실온에서 1μg/μL poly [dI-dC])를 포함하는 최종 부피 20 ㎕의 EMSA 버퍼에서, 시클레소나이드 처리된 핵 단백질과 함께 배양하였다. 상기 반응 혼합물을 4℃에서 0.5× TBE (45 mM Tris borate 및 1 mM EDTA)에서 4 % 폴리아크릴아미드 비변성 겔에 전기영동하였으며, 화학발광 핵산 검출 키트 (Thermoscientific, IL, USA)를 사용하여 시각화 하였다.
실시예 17: 통계 분석
모든 데이터는 평균 ± 표준 편차 (SD)로 표시 하였다. 데이터는 student’s t-test를 이용하여 분석하였다. 0.05 보다 낮은 p값은 통계적으로 유의한 것으로 간주되었다(GraphPad Prism 5 Software, San Diego, CA, USA).
<B: 실험예 > 유방암 줄기세포 및 유방암에 대한 효과 분석
실험예 1: 시클레소나이드 ( ciclesonide ) 인간 유방암 세포의 세포 사멸을 유도하고, 증식을 억제하는 효과
도 1A에 도시된 시클레소나이드의 인간 유방암 세포주인, MCF-7 및 MDA-MB-231에서 항증식 효과를 조사하기 위하여 시클레소나이드를 농도별로 처리한 후, MTS 분석을 수행하였다. 그 결과, 시클레소나이드 처리 48시간 후에, MCF-7 및 MDA-MB-231 세포주에서 시클레소나이드 10μM 이상 농도에서 농도 의존적으로 유방암 세포주들의 성장이 억제되는 것을 확인하였다(도 1A 및 1B).
다음으로, MDA-MB-231 세포에서 사멸된 유방암 세포의 수(아넥신 V+)는 각각 시클레소나이드 20μM 처리에 의해 증가하는 것을 확인하였다(도 1C).
다음으로, MDA-MB-231 세포에서 캐스파제3/7의 형광분석을 수행하였으며, 그 결과, 시클레소나이드 40 μM 및 80 μM 에서 캐스파제3/7의 활성이 유도되는 것을 확인하였다(도 1D). 또한, 시클레소나이드 처리에 의해, MDA-MB-231 세포에서 세포자멸 소체(apoptotic bodies) 형성을 확인하였다(도 1E). 또한, 시클레소나이드는 MDA-MB-231세포의 이동과 콜로니 형성을 억제하였다(도 1F 및 1G). 이러한 결과는 시클레소나이드가 효과적으로 다양한 암 특징 (증식, 이동, 세포 사멸 및 콜로니 형성)을 억제하는 것을 의미한다.
실험예 2: 시클레소나이드가 이종 이식 모델에서 종양 성장을 억제하는 효과
시클레소나이드는 시험관에서 유방암 세포의 증식을 억제하는 것을 도 1에서 확인하였다. 다음으로, 시클레소나이드가 이종 이식 종양 모델(xenograft tumor model)에서 종양 유발을 억제하는지를 조사했다. 시클레소나이드 투여군에서 종양 부피는 시클레소나이드를 처리하지 않은 대조군보다 작았다(도 2A 및 2C). 또한 시클레소나이드 처리 군에서 종양 무게도 시클레소나이드를 처리하지 않은 대조군보다 작았다(도 2B). 그러나, 시클레소나이드 처리 군에서의 마우스의 체중은 대조군과 유사했다(도 2A). 이러한 결과는 시클레소나이드가 이종 이식 모델에서 종양 발생을 효과적으로 억제하는 것을 의미한다.
실험예 3: 시클레소나이드가 유방암 줄기세포를 억제하는 효과
시클레소나이드가 맘모스페어의 형성을 억제할 수 있는지 여부를 평가하기 위해, MCF-7 및 MDA-MB-231 세포로부터 유래된 1차 맘모스페어(mammosphere)에 상이한 농도의 시클레소나이드를 처리하였다. 도 3에 나타난 바와 같이, 시클레소나이드는 유방암 세포주로부터 유래된 1차 맘모스페어의 형성을 억제하였다. 맘모스페어의 수는 90%까지 감소하였으며, 맘모스페어의 크기도 감소하였다(도 3A 및 3B).
다음으로, 현재 약으로 많이 사용하고 있는 Glucocorticoids인 프레드니손(prednisone)과 덱사메타손(dexamethasone)을 이용한 비교실험 결과, 10μM 농도에서 시클레소나이드가 유방암 줄기세포의 성장을 현저히 억제한 것과 달리, 같은 Glucocorticoids에 속하는 프레드니손(prednisone)과 덱사메타손(dexamethasone)는 80μM의 고농도에서도 유방암 줄기세포의 성장을 억제하지 못하는 것을 확인하였다(도 3C).
따라서, 시클레소나이드는 기존 스테로이드와 달리, 효과적으로 유방암 줄기 세포를 억제하는 것을 알 수 있었다.
실험예 4: 시클레소나이드가 CD44high / CD24low를 발현하는 집단과 ALDH 양성 유방암 세포의 비율을 감소시키는 효과
MCF-7 세포에 24 시간 동안 시클레소나이드를 처리하였으며, 유방암 세포에서 CD44high/CD24low를 발현하는 집단 (subpopulation)에서 상기 시클레소나이드 저해제의 효과를 조사하였다. 그 결과, 상기 시클레소나이드 저해제는 유방암 세포에서 CD44high/CD24low를 발현하는 집단을 감소시켰다(도 4A). MCF-7 세포에 시클레소나이드를 24 시간 동안 처리하고 ALDH 양성 유방암 세포의 비율에 시클레소나이드 저해제의 효과를 조사하기 위해 ALDEFLUOR 분석을 실시하였다. 그 결과, 시클레소나이드가 ALDH 양성 유방암 세포의 비율을 감소시킨 것을 확인하였다(도 4B).
실험예 5: 시클레소나이드가 맘모스페어에서 STAT3 신호 경로를 저해하는 효과
시클레소나이드의 세포 기능을 조사하기 위해, 시클레소나이드 처리 하에, MCF-7 세포에서 유래된 맘모스페어에서 STAT3의 인산화 상태를 조사하였다. 그 결과, 시클레소나이드는 대조군에 비하여, 핵 STAT3 단백질의 인산화를 감소시켰다(도 5A).
또한, STAT3와 높은 친화성으로 결합하는 비오틴-표지된 SIE 결합 프로브를 이용하여, 시클레소나이드 처리된 핵 추출물과 Stat3 DNA의 결합을 분석했다. 도 5B에 도시된 바와 같이, 시클레소나이드는 비오틴-표지된 SIE 프로브와 Stat3가 결합하는 것을 억제하였다(도 5B, 레인 3). pStat3/비오틴-표지된 SIE 프로브의 특이도는 표지되지 않은 초과 자기 경쟁자(unlabeled excess self-competitor)(도. 5B, 레인 4)와 돌연변이된 SIE 경쟁자(mutated-Stat competitor)(도. 5B, 레인 5)를 사용하여 확인하였다. 이러한 데이터를 통해 Stat3 신호 전달 경로는 맘모스페어의 성장과 자가 재생을 조절하는 데에 중요하다는 것을 알 수 있었다.
실험예 6: MDA -MB-231 세포로부터 유래된 맘모스페어의 증식과 IL-6, IL-8 생산에 대한 시클레소나이드의 효과.
분비된 IL-6와 IL-8는 맘모스페어 형성에 중요한 역할을 하는 것으로 알려져 있었다(Sansone P, Storci G, Tavolari S, Guarnieri T, Giovannini C, Taffurelli M, Ceccarelli C, Santini D, Paterini P, Marcu KB, Chieco P and Bonafe M. IL-6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland. J Clin Invest. 2007; 117(12):3988-4002). 이에, 분비되는 IL-6와 IL-8의 생산량을 확인하기 위해, flow cytometer를 이용하여, 염증성 사이토카인 프로파일링 분석을 수행하였다.
그 결과, 염증성 사이토카인 프로파일링 데이타에 제시된 바와 같이, 시클레소나이드 처리에 의해 분비된 IL-6와 IL-8의 생산 수준이 감소하였다. 내부 대조군은 시클레소나이드 처리하지 않은 MDA-MB-231 맘모스페어 배양액을 이용하였다(도 5C).
실험예 7: 시클레소나이드가 암줄기세포(CSCs)의 자가재생 유전자 발현과 맘모스페어의 증식을 억제하는 효과
시클레소나이드가 자가 재생 유전자의 발현을 억제하는지를 확인하기 위하여, 자가 재생 유전자 발현을 실시간 PCR (realtime RT-PCR)에 의해 조사하였다. 그 결과, 시클레소나이드는 유방암 세포에서 Nanog, Sox2, Oct4, C-myc 및 CD44와 같은 자가 재생 유전자의 발현을 감소시켰다(도 6A).
다음으로, 시클레소나이드가 맘모스페어의 증식을 억제하는지를 확인하기 위하여, 맘모스페어에 시클레소나이드를 처리하였으며, 맘모스페어의 세포 수를 계수 하였다. 그 결과, 시클레소나이드는 맘모스페어의 세포 사멸을 유도하였으며, 시클레소나이드 처리된 맘모스페어에서 관찰된 세포수는 적었다. 이러한 결과를 통해, 시클레소나이드가 맘모스페어 증식을 크게 감소시키는 것을 알 수 있었다(도 6B).
<C: 실험예 > 폐암 줄기세포 및 폐암에 대한 효과 분석
실험예 8: 시클레소나이드가 인간 폐암 세포의 세포 사멸을 유도하고, 증식을 억제하는 효과
인간 폐암 세포주인, A549 세포에서 시클레소나이드의 항증식 효과를 조사하기 위하여 도 7A에 도시된 시클레소나이드를 농도별로 처리한 후, MTS 분석을 수행하였다. 그 결과, 시클레소나이드 처리 48시간 후에, A549 세포주에서 시클레소나이드 40μM 이상에서 농도 의존적으로 폐암 세포주들의 성장이 억제되는 것을 확인하였다(도 7A).
또한, 시클레소나이드 처리에 의해, A549 세포에서 세포자멸 소체(apoptotic bodies) 형성을 확인하였다(도 7B).
다음으로, A549 세포에서 사멸된 폐암 세포의 수(아넥신 V+)는 시클레소나이드 10 및 20 μM 처리에 의해 증가하는 것을 확인하였다(도 7C). 또한, A549 세포에서 캐스파제3/7의 형광분석을 수행하였으며, 그 결과, 시클레소나이드 80μM에서 캐스파제3/7의 활성이 유도되는 것을 확인하였다(도 7D). 또한, 시클레소나이드는 A549 세포의 이동과 콜로니 형성을 억제하였다(도 7E 및 7F). 이러한 결과는 시클레소나이드가 효과적으로 다양한 암 특징 (증식, 이동, 세포 사멸 및 콜로니 형성)을 억제하는 것을 의미한다.
실험예 9: 시클레소나이드가 이종 이식 모델에서 종양 성장을 억제하는 효과
시클레소나이드는 시험관에서 폐암 세포의 증식을 억제하는 것을 도 7에서 확인하였다. 다음으로, 폐암세포를 이용하여 종양을 형성시켜 이종 이식 종양 모델(xenograft tumor model)을 제조하였으며, 시클레소나이드를 처리하여 종양의 크기를 주별로 측정하여 효과를 검정하였다. 그 결과, 시클레소나이드 투여군에서 종양 부피는 시클레소나이드를 처리하지 않은 대조군보다 작았다(도 8A 및 8C). 또한, 시클레소나이드 처리 군에서 종양 무게도 시클레소나이드를 처리하지 않은 대조군보다 작았다(도 8B). 그러나, 시클레소나이드 처리 군에서의 마우스의 체중은 대조군과 유사했다. 이러한 결과는 시클레소나이드가 이종 이식 모델에서 종양 발생을 효과적으로 억제하는 것을 의미한다. 즉, 시클레소나이드는 종양크기 및 무게를 감소하는데 탁월한 효과를 나타내며, 폐암치료에 시클레소나이드가 효과를 나타내는 것을 의미한다.
실험예 10: 시클레소나이드가 폐암 줄기세포를 억제하는 효과
시클레소나이드가 투머스페어(tumorsphere)의 형성을 억제할 수 있는지 여부를 평가하기 위해, A549 세포로부터 유래된 1차 투머스페어(tumorsphere)에 상이한 농도의 시클레소나이드를 처리하였다. 도 9A에 나타난 바와 같이, 시클레소나이드는 폐암 세포주인 A549 세포로부터 유래된 1차 투머스페어의 형성을 억제하였다. 투머스페어의 수는 ~90%까지 감소하였으며, 투머스페어의 크기도 현저히 감소하였다(도 9A).
또한, 시클레소나이드의 활성화형인 이소부티릴 시클레소나이드(isobutyryl ciclesonide)를 처리한 결과 5μM 와 10μM에서 폐암 줄기세포 억제활성을 나타내는 것을 확인하였다.
그러나, Glucocorticoids에 속하는 프레드니솔 및 덱사메타손은 80μM에서도 폐암 줄기세포 억제 활성을 나타내지 않았다(도 9C).
따라서 시클레소나이드와 활성화형인 이소부티릴 시클레소나이드(isobutyryl ciclesonide)는 기존 스테로이드보다 효과적으로 폐암 유래 암줄기 세포를 억제하는 것을 알 수 있었으며, 모든 Glucocorticoids가 폐암줄기세포의 성장을 억제하지 않는 것을 확인하였다.
실험예 11: 시클레소나이드가 ALDH 양성 폐암 세포의 비율을 감소시키는 효과
다음으로, 폐암세포에 ALDH 저해제인 DEAB와 시클레소나이드를 처리하여 폐암 줄기세포 마커인 ALDH를 분석하였다.
A549 세포에 24 시간 동안 시클레소나이드를 처리하였으며, ALDH 양성 폐암 세포의 비율에 시클레소나이드 저해제의 효과를 조사하기 위해 ALDEFLUOR 분석을 실시하였다. 그 결과, 시클레소나이드가 ALDH 양성 폐암 세포의 비율을 감소시킨 것을 확인하였다(도 10).
실험예 12: 시클레소나이드의 암줄기세포 ( CSCs ) 마커의 발현과 투머스페어의 증식 억제 효과
시클레소나이드가 암줄기세포 마커인 자가 재생 유전자의 발현을 억제하는지를 확인하기 위하여, 자가 재생 유전자 발현을 실시간 PCR (RT-PCR)에 의해 조사하였다. 그 결과, 시클레소나이드 처리에 의해, 시클레소나이드를 처리하지 않은 군에 비해, nanog, sox2, c-myc, 및 snail의 유전자 발현이 감소하는 것을 확인하였다(도 11A).
다음으로, 시클레소나이드가 투머스페어의 증식을 억제하는지를 확인하기 위하여, 투머스페어에 시클레소나이드를 처리하였으며, 투머스페어의 세포 수를 계수 하였다. 시클레소나이드 처리 후 투머스페어(tumosphere)의 생존 암세포수를 1, 2, 3일간 분석한 결과, 시클레소나이드 처리 군에서는 투머스페어의 성장이 억제되었지만, 비처리 군에서는 투머스페어의 성장이 진행되는 것을 확인하였다(도 11B). 따라서 시클레소나이드는 투머스페어 증식을 크게 감소시키는 것을 알 수 있었다(도 11B).
실험예 13: 시클레소나이드의 투머스페어에서 IL-8 분비 저해효과
분비된 IL-8는 투머스페어 형성에 중요한 역할을 하는 것으로 알려져 있었다(Ginestier C, Liu S, Diebel ME, Korkaya H, Luo M, Brown M, Wicinski J, Cabaud O, Charafe-Jauffret E, Birnbaum D, Guan JL, Dontu G and Wicha MS. CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts. J Clin Invest. 2010; 120(2):485-497).
이에, 분비되는 IL-8의 생산량을 확인하기 위해, flow cytometer를 사용하여, 염증성 사이토카인 프로파일링 분석을 시행하였다. 염증성 사이토카인은 BD cytometric bead array (CBA) human inflammatory cytokines kit를 이용하여 측정하였다. CBA 분석은 IL-6, IL-8, IL-10, IL-12, IL-1β, 및 TNF 항체를 사용하여 수행하였다. 그 결과, 도 12의 염증성 사이토카인 프로파일링 데이터에 제시된 바와 같이, 시클레소나이드 처리에 의해, 염증성 사이토카인인 IL-8의 생산 수준은 감소하였다. 도 12의 아래 그림은 IL-8 생산량을 그래프로 나타낸 것이다. 따라서, 시클레소나이드가 암 줄기세포 유지에 필수적인 IL- 8 분비를 억제함으로써 폐암 줄기세포를 억제하는 것을 알 수 있었다.
상기 실험예들을 통해, 본 발명의 시클레소나이드는 유방암과 폐암의 증식을 억제할 뿐만 아니라, 유방암과 폐암의 줄기세포의 성장을 억제하는 것을 확인하여, 유방암과 폐암 그리고 이들의 줄기세포의 성장 억제 용도로 사용이 가능하다는 것을 알 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (14)

  1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 암 줄기세포 성장 억제용 조성물.
    [화학식 1]
    Figure PCTKR2017011284-appb-I000003
  2. 제1항에 있어서, 상기 암 줄기세포는 유방암 또는 폐암의 줄기세포인 것인, 조성물.
  3. 제1항에 있어서, 상기 화합물은 시클레소나이드인 것인, 조성물.
  4. 제1항에 있어서, 상기 화합물은 (i) 유방암 유래의 맘모스페어(mammosphere)의 형성을 억제하거나, (ii) 유방암 유래의 맘모스페어의 증식을 억제하거나, (iii) 폐암 유래의 투머스페어(tumorsphere)의 형성을 억제하거나, 또는 (iv) 폐암 유래의 투머스페어의 증식을 억제하는 것인, 조성물.
  5. 제2항에 있어서, 상기 유방암 줄기세포는 Nanog, C-myc, Oct4, Sox2 및 CD44로 선택되는 하나 이상의 자가 재생(self-renewal) 유전자를 발현하거나, 또는 상기 폐암 줄기세포는 Nanog, Sox2, C-myc, 및 Snail로 선택되는 하나 이상의 자가 재생 유전자를 발현하는 것인, 조성물.
  6. 제1항 내지 제5항 중 어느 한 항의 조성물을 포함하는, 암의 치료 또는 예방용 약학적 조성물.
  7. 제6항에 있어서, 상기 암은 유방암 또는 폐암인 것인, 약학적 조성물.
  8. 제6항에 있어서, 상기 조성물은 CD44high/CD24low를 발현하는 유방암 세포의 성장을 억제하는 것인, 약학적 조성물.
  9. 제6항에 있어서, 상기 조성물은 알데히드 탈수소효소(ALDH) 양성의 유방암 세포의 성장을 억제하거나, 또는 알데히드 탈수소효소(ALDH) 양성의 폐암 세포의 성장을 억제하는 것인, 약학적 조성물.
  10. 제1항 내지 제5항 중 어느 한 항의 조성물을 포함하는, 암전이 억제용 약학적 조성물.
  11. 제10항에 있어서, 상기 암은 유방암 또는 폐암인 것인, 약학적 조성물.
  12. 제1항 내지 제5항 중 어느 한 항의 조성물을 포함하는, 암의 개선 또는 예방용 식품 조성물.
  13. 제1항 내지 제5항 중 어느 한 항의 조성물을 포함하는, 암전이 개선 또는 예방용 식품 조성물.
  14. 하기 화학식 1로 표시되는 시클레소나이드 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 암 줄기세포의 성장을 억제하는 방법.
    [화학식 1]
    Figure PCTKR2017011284-appb-I000004
PCT/KR2017/011284 2016-10-14 2017-10-13 시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물 WO2018070819A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201780077650.8A CN110072529B (zh) 2016-10-14 2017-10-13 包含环索奈德的用于抑制癌症干细胞的生长的组合物
US16/341,132 US11191746B2 (en) 2016-10-14 2017-10-13 Composition for inhibiting a growth of cancer stem cells comprising ciclesonide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0133358 2016-10-14
KR20160133358 2016-10-14

Publications (1)

Publication Number Publication Date
WO2018070819A1 true WO2018070819A1 (ko) 2018-04-19

Family

ID=61905799

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/011284 WO2018070819A1 (ko) 2016-10-14 2017-10-13 시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물

Country Status (4)

Country Link
US (1) US11191746B2 (ko)
KR (3) KR102035478B1 (ko)
CN (1) CN110072529B (ko)
WO (1) WO2018070819A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240041441A (ko) 2022-09-23 2024-04-01 제주대학교 산학협력단 제주 황칠나무 유래 화합물을 포함하는 유방암 예방 또는 치료용 약학 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120077786A1 (en) * 2010-09-27 2012-03-29 Byron David A Methods and compositions for disease treatment using inhalation
WO2013082243A1 (en) * 2011-12-02 2013-06-06 Fate Therapeutics, Inc. Enhanced stem cell composition
US20150010503A1 (en) * 2012-02-24 2015-01-08 The University Of Chicago Methods and Compositions Related to Glucocorticoid Receptor Antagonism and Prostate Cancer
KR20150136001A (ko) * 2014-05-26 2015-12-04 숙명여자대학교산학협력단 Ｅｒｋ 신호활성 억제제를 유효성분으로 함유하는 암 줄기세포 성장 억제용 조성물

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100135956A1 (en) * 2008-11-21 2010-06-03 Auspex Pharmaceuticals, Inc. Steroid modulators of progesterone receptor and/or glucocorticoid receptor
US8710035B2 (en) * 2010-03-24 2014-04-29 The University Of Chicago Methods and compositions related to glucocorticoid receptor antagonists and breast cancer
ES2693779T3 (es) * 2012-12-21 2018-12-13 Boehringer Ingelheim Vetmedica Gmbh Ciclesonida para el tratamiento de enfermedades de las vías respiratorias en caballos

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120077786A1 (en) * 2010-09-27 2012-03-29 Byron David A Methods and compositions for disease treatment using inhalation
WO2013082243A1 (en) * 2011-12-02 2013-06-06 Fate Therapeutics, Inc. Enhanced stem cell composition
US20150010503A1 (en) * 2012-02-24 2015-01-08 The University Of Chicago Methods and Compositions Related to Glucocorticoid Receptor Antagonism and Prostate Cancer
KR20150136001A (ko) * 2014-05-26 2015-12-04 숙명여자대학교산학협력단 Ｅｒｋ 신호활성 억제제를 유효성분으로 함유하는 암 줄기세포 성장 억제용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
COORAY, HIRAN C. ET AL.: "Modulation of P-glycoprotein and Breast Cancer Resistance Protein by Some Prescribed Corticosteroids", EUROPEAN JOURNAL OF PHARMACOLOGY, vol. 531, 2006, pages 25 - 33, XP005286351 *
STOECK, MICHAEL ET AL.: "In Vitro and in Vivo Anti-inflammatory Activity of the New Glucocorticoid Ciclesonide", THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 309, no. 1, 2004, pages 249 - 258, XP002635617 *

Also Published As

Publication number Publication date
KR20190110982A (ko) 2019-10-01
KR20190110981A (ko) 2019-10-01
US11191746B2 (en) 2021-12-07
KR102035478B1 (ko) 2019-10-23
KR102039299B1 (ko) 2019-10-31
KR20180041595A (ko) 2018-04-24
CN110072529B (zh) 2022-11-22
CN110072529A (zh) 2019-07-30
KR102039298B1 (ko) 2019-10-31
US20200246307A1 (en) 2020-08-06

Similar Documents

Publication Publication Date Title
WO2012148247A2 (ko) 올레아놀린산 아세테이트를 유효성분으로 포함하는 tlr 및 il-6 매개성 질환예방 또는 치료용 약학적 조성물
WO2022035115A1 (ko) 오리나무 추출물 또는 이로부터 분리된 화합물을 함유하는 골격근 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2016108446A1 (ko) 락테이트 금속염을 포함하는 암 치료용 약학 조성물
WO2015037778A1 (ko) 리그난 화합물을 유효 성분으로 포함하는 암의 예방 또는 치료용 조성물
WO2019098699A1 (ko) 다이터펜계 화합물을 포함하는 신경퇴행성 질환 예방 또는 치료용 조성물
WO2017188690A1 (ko) 페닐아세트알데히드를 포함하는, 유방암 줄기세포 성장 억제용 조성물
WO2016080796A2 (ko) 세스퀴테르펜 화합물을 포함하는, stat3 매개 질환의 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2020040502A1 (ko) 금속이온에 결합된 이온화합물을 포함하는 암 치료용 약학 조성물
WO2012043949A1 (ko) 화학식 1 내지 8로 표시되는 화합물 또는 고삼 추출물을 유효성분으로 포함하는 면역 증강용 조성물
WO2018070819A1 (ko) 시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물
WO2019221453A1 (ko) 관동화 추출물로부터 분리된 투실라곤 화합물을 함유하는 암 질환의 예방 및 치료용 조성물 및 이의 용도
WO2020055129A1 (ko) 베르베논 유도체를 포함하는 암 치료 또는 예방용 조성물
WO2017200194A2 (ko) 디아세틸을 포함하는, 암 줄기세포 성장 억제용 조성물
WO2019231261A1 (ko) 신규 바이페닐 유도체 화합물 및 이의 용도
WO2018221922A1 (ko) 황련 추출물을 함유하는 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2018048008A1 (ko) 프리마퀸을 포함하는, 암 줄기세포 성장 억제용 조성물
WO2018147612A1 (ko) 암의 전이 억제 및 치료용 조성물
WO2018021618A1 (ko) 시스-3-헥센알을 포함하는, 암 줄기세포 성장 억제용 조성물
WO2016190689A2 (ko) 근육 질환 예방, 개선 또는 치료용 또는 근 기능 개선용 조성물
WO2017048069A1 (ko) 신규한 피라졸린 유도체 및 이의 용도
WO2023249288A1 (ko) 신규한 신남아마이드 유도체 및 이의 용도
WO2018217009A1 (ko) 신선초 추출물 또는 이로부터 분리된 화합물을 함유하는 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2019245347A2 (ko) 신경퇴행성 질환 예방 또는 치료용 조성물
WO2019083286A2 (ko) 아이론을 유효성분으로 포함 하는 탈모 방지 또는 발모 촉진용 조성물
WO2023003193A1 (ko) 페오니플로린을 포함하는 악액질 및 근손실 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17859747

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17859747

Country of ref document: EP

Kind code of ref document: A1