WO2017100236A1 - Methods and compositions for treating a serpinc1-associated disorder - Google Patents

Methods and compositions for treating a serpinc1-associated disorder Download PDF

Info

Publication number
WO2017100236A1
WO2017100236A1 PCT/US2016/065245 US2016065245W WO2017100236A1 WO 2017100236 A1 WO2017100236 A1 WO 2017100236A1 US 2016065245 W US2016065245 W US 2016065245W WO 2017100236 A1 WO2017100236 A1 WO 2017100236A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
nucleotides
double stranded
rnai agent
stranded rnai
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/065245
Other languages
English (en)
French (fr)
Other versions
WO2017100236A8 (en
Inventor
Akin Akinc
Benny Sorensen
Pushkal Garg
Gabriel ROBBIE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alnylam Pharmaceuticals Inc
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL308717A priority Critical patent/IL308717A/en
Priority to CN201680081199.2A priority patent/CN108601795A/zh
Priority to IL259795A priority patent/IL259795B2/en
Priority to JP2018549141A priority patent/JP6985283B2/ja
Priority to SG11201804729RA priority patent/SG11201804729RA/en
Priority to RU2018123712A priority patent/RU2754188C2/ru
Priority to ES16822817T priority patent/ES3041380T3/es
Priority to EP24157647.9A priority patent/EP4424828A1/en
Priority to RS20250930A priority patent/RS67250B1/sr
Priority to KR1020187019085A priority patent/KR20180095843A/ko
Priority to EP16822817.9A priority patent/EP3386518B1/en
Priority to HRP20251125TT priority patent/HRP20251125T1/hr
Priority to CN202510290024.3A priority patent/CN120284999A/zh
Priority to LTEPPCT/US2016/065245T priority patent/LT3386518T/lt
Priority to AU2016368289A priority patent/AU2016368289C1/en
Priority to KR1020237025828A priority patent/KR20230119027A/ko
Priority to CA3007014A priority patent/CA3007014A1/en
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Priority to SI201631919T priority patent/SI3386518T1/sl
Priority to PL16822817.9T priority patent/PL3386518T3/pl
Priority to KR1020217041486A priority patent/KR20210157474A/ko
Priority to DK16822817.9T priority patent/DK3386518T3/da
Priority to FIEP16822817.9T priority patent/FI3386518T3/fi
Priority to BR112018011450-2A priority patent/BR112018011450A2/en
Priority to MX2018006989A priority patent/MX2018006989A/es
Publication of WO2017100236A1 publication Critical patent/WO2017100236A1/en
Publication of WO2017100236A8 publication Critical patent/WO2017100236A8/en
Anticipated expiration legal-status Critical
Priority to CONC2018/0006590A priority patent/CO2018006590A2/es
Priority to JP2021189823A priority patent/JP7422120B2/ja
Priority to AU2023200828A priority patent/AU2023200828B2/en
Priority to JP2024002987A priority patent/JP7820420B2/ja
Priority to AU2025201684A priority patent/AU2025201684A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/335Modified T or U
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533Halogen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/35Special therapeutic applications based on a specific dosage / administration regimen

Definitions

  • Serpincl is a member of the serine proteinase inhibitor (serpin) superfamily.
  • hemophilia is a group of hereditary genetic bleeding disorders that impair the body's ability to control blood clotting or coagulation.
  • Hemophilia A is a recessive X-linked genetic disorder involving a lack of functional clotting Factor VIII and represents 80% of hemophilia cases.
  • Hemophilia B is a recessive X-linked genetic disorder involving a lack of functional clotting Factor IX. It comprises approximately 20% of haemophilia cases.
  • Hemophilia C is an autosomal genetic disorder involving a lack of functional clotting Factor XI. Hemophilia C is not completely recessive, as heterozygous individuals also show increased bleeding.
  • the present invention is based, at least in part, on the surprising discovery that very low doses (e.g., doses at least about 30 times lower than doses taught in the art) of a GalNAc linked double stranded RNAi agent comprising particular chemical modifications shows an exceptional potency to inhibit expression of Serpincl, as well as an exceptional duration of inhibition of Serpincl expression.
  • the methods include administering to the subject a dose of about 0.200 mg/kg to about 1.825 mg/kg of a double stranded RNAi agent which comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:5, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense strand of the double stranded RNAi agent is conjugated to a ligand, e
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a dose of about 0.200 mg/kg to about 1.825 mg/kg of a double stranded RNAi agent, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:5, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a
  • At least one strand comprises a 3' overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5' overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3' and the 5' end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
  • the double stranded RNAi agents of the invention comprise a plurality, e.g., 2, 3, 4, 5, or 6, of GalNAc, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a dose of about 0.200 mg/kg to about 1.825 mg/kg of a double stranded RNAi agent, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region of complementary to part of an mRNA encoding Serpincl, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (Hie):
  • n p ' is a 2 nucleotide overhang and each nucleotide within n p ' is linked to a
  • YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-0- methyl or 2'-fluoro modifications;
  • the subject may be a human, such as a human having a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • a bleeding disorder such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • the subject has hemophilia A and is an inhibitor subject. In another embodiment, the subject has hemophilia B and is an inhibitor subject. In yet another embodiment, the subject has hemophilia C and is an inhibitor subject.
  • the double stranded RNAi agent may be administered subcutaneously or intravenously.
  • the Y'Y'Y' motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5'-end.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the ligand is attached to the 3' end of the sense strand.
  • the base pair at the 1 position of the 5'-end of the antisense strand of the duplex is an AU base pair.
  • the agent is administered as a pharmaceutical compositon.
  • the RNAi agent is administered in an unbuffered solution, such as saline or water.
  • the siRNA is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense strand of the double stranded RNAi agent is conjugated to a ligand attached at the 3 '-terminus of the sense strand.
  • the double stranded RNAi agent is administered to the subject once a month. In another embodiment, the double stranded RNAi agent is administered to the subject once every six weeks. In one embodiment, the double stranded RNAi agent is administered to the subject once every 2 months. In yet another embodiment, the double stranded RNAi agent is administered to the subject once a quarter.
  • the double stranded RNAi agent may be administered to the subject as, e.g., a monthly dose of about 0.200 to about 1.825 mg/kg, 0.200 to about 1.800 mg/kg, about 0.200 to about 1.700 mg/kg, about 0.200 to about 1.600 mg/kg, about 0.200 to about 1.500 mg/kg, about 0.200 to about 1.400 mg/kg, about 0.200 to about 1.400 mg/kg, about 0.200 to about 1.200 mg/kg, about 0.200 to about 1.100 mg/kg, about 0.200 to about 1.000 mg/kg, about 0.200 to about 0.900 mg/kg, about 0.200 to about 0.800 mg/kg, about 0.200 to about 0.700 mg/kg, about 0.200 to about 0.600 mg/kg, about 0.200 to about 0.500 mg/kg, about 0.200 to about 0.400 mg/kg, about 0.225 to about 1.825 mg/kg, about 0.225 to about 1.800 mg/kg, about 0.225 to about 1.700 mg/kg, about 0.225 to about 1.600 mg/kg, about 0.225 to
  • the double stranded RNAi agent is administered to the subject as a monthly dose of 0.225 mg/kg.
  • the double stranded RNAi agent is administered to the subject as a monthly dose of 1.800 mg/kg.
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • administration of the dose of the double stranded RNAi agent to the subject increases peak thrombin levels in the subject to within the range of peak thrombin levels in a subject that does not have a disorder that would benefit from reduction in Serpincl expression.
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels of greater than about 40% in the subject.
  • administration of the dose of the double stranded RNAi agent to the subject decreases the annual bleed rate (ABR) of the subject by about 80 to about 95% as compared to the median historical on-demand ABR of subjects having a disorder that would benefit from reduction in Serpincl expression that are not administered the double stranded RNAi agent.
  • ABR annual bleed rate
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
  • the region of complementarity may be at least 17 nucleotides in length or 19 nucleotides in length.
  • the region of complementarity is between 19 and 21 nucleotides in length. In another embodiment, the region of complementarity is between 21 and 23 nucleotides in length.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the RNAi agent is conjugated to the ligand as shown follow
  • the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3'(SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'- UUGAAGUAAAUGGUGUUAACC AG-3 ' (SEQ ID NO: 15).
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage.
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 25 mg to about 100 mg of a double stranded RNAi agent which comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:5, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
  • the sense strand and the antisense strand comprise a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the sequences listed in any one of Tables 2 and 3.
  • the modified nucleotides are independently selected from the group consisting of a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a nucleotide comprising a 5 '-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.
  • the modified nucleotide is selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide a conformationally restricted nucleotide, a contrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2' -alky 1- modified nucleotide, a 2'-0-allyl modified nucleotide, a 2'-C-allyl modified nucleotide, a 2'-hydroxyl modified nucleotide, a
  • At least one strand comprises a 3' overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5' overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3' and the 5' end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
  • YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-0- methyl or 2'-fluoro modifications;
  • sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 5'-terminus
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 25 mg to about 100 mg of a double stranded RNAi agent, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region of complementary to part of an mRNA encoding Serpincl, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (Hie):
  • n p ' is a 2 nucleotide overhang and each nucleotide within n p ' is linked to a
  • each N a and N a ' independently represents an oligonucleotide sequence comprising 0- 25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;
  • YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-0- methyl or 2'-fluoro modifications;
  • sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 5'-terminus
  • the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a monovalent, a bivalent or a trivalent branched linker,
  • the double stranded RNAi agent is administered to the subject in a single dose or in two or more doses, e.g., in 3, 4, 5, or 6 doses.
  • the double stranded RNAi agent is administered to the subject once a month, once every five weeks, once every six weeks, once every seven weeks, once every 2 months, once a quarter, or as needed.
  • the double stranded RNAi agent may be administered to the subject as a fixed dose of about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg.
  • the subject may be a human, such as a human having a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • a bleeding disorder such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • the subject has hemophilia A and is an inhibitor subject. In another embodiment, the subject has hemophilia B and is an inhibitor subject. In yet another embodiment, the subject has hemophilia C and is an inhibitor subject.
  • the administration of the double stranded RNAi agent to the subject causes an increase in blood clotting and/or a decrease in Serpincl protein
  • the double stranded RNAi agent may be administered subcutaneously or
  • the Y'Y'Y' motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5'-end.
  • the base pair at the 1 position of the 5'-end of the antisense strand of the duplex is an AU base pair.
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 25 mg to about 100 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3'(SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense strand of the double
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 25 mg to about 100 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' -
  • RNAi double stranded ribonucleic acid
  • RNAi agent comprises a ligand, e.g., the sense strand of the double stranded RNAi agent is conjugated to a ligand attached at the 3 '-terminus of the sense strand.
  • the double stranded RNAi agent is administered to the subject once a month, once every five weeks, once every six weeks, once every seven weeks, once every 2 months, once a quarter, or as needed.
  • the double stranded RNAi agent is administered to the subject once a month. In another embodiment, the double stranded RNAi agent is administered to the subject once every six weeks. In one embodiment, the double stranded RNAi agent is administered to the subject once every 2 months. In yet another embodiment, the double stranded RNAi agent is administered to the subject once a quarter.
  • the double stranded RNAi agent may be administered to the subject as, e.g., a fixed dose of between about 25 mg to about 100 mg, e.g., between about 25 mg to about 95 mg, between about 25 mg to about 90 mg, between about 25 mg to about 85 mg, between about 25 mg to about 80 mg, between about 25 mg to about 75 mg, between about 25 mg to about 70 mg, between about 25 mg to about 65 mg, between about 25 mg to about 60 mg, between about 25 mg to about 50 mg, between about 50 mg to about 100 mg, between about 50 mg to about 95 mg, between about 50 mg to about 90 mg, between about 50 mg to about 85 mg, between about 50 mg to about 80 mg, between about 30 mg to about 100 mg, between about 30 mg to about 90 mg, between about 30 mg to about 80 mg, between about 40 mg to about 100 mg, between about 40 mg to about 90 mg, between about 40 mg to about 80 mg, between about 60 mg to about 100 mg, between about 60 mg to about 90 mg, between about 25 mg to about 55 mg, between about 25
  • the double stranded RNAi agent may be administered as a fixed dose of about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg.
  • the double stranded RNAi agent is administered to the subject as a fixed dose of about 25 mg; or as a fixed dose of about 50 mg; or as a fixed dose of about 80 mg; or as a fixed dose of about 100 mg.
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • administration of the dose of the double stranded RNAi agent to the subject lowers Serpincl activity in the subject by about 70% to about 95%, about 70% to about 80%, about 80% to about 90%, about 90% to about 95%, or by more than 95%.
  • administration of the dose of the double stranded RNAi agent to the subject increases peak thrombin levels in the subject to within the range of peak thrombin levels in a subject that does not have a disorder that would benefit from reduction in Serpincl expression.
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels of greater than about 40%, 45%, 50%, 55%, or greater than about 60% in the subject.
  • administration of the dose of the double stranded RNAi agent to the subject decreases the annual bleed rate (ABR) of the subject by about 80% to about 95%, about 80% to about 85%, about 85% to about 90%, or about 90% to about 95%, as compared to the median historical on-demand ABR of subjects having a disorder that would benefit from reduction in Serpincl expression that are not administered the double stranded RNAi agent.
  • ABR annual bleed rate
  • double stranded RNAi agent is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the subject is a human.
  • the disorder may be a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • a bleeding disorder such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • the subject has hemophilia A and is an inhibitor subject. In another embodiment, the subject has hemophilia B and is an inhibitor subject. In yet another embodiment, the subject has hemophilia C and is an inhibitor subject.
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • the modified nucleotides are independently selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2' -alky 1- modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a no n- natural base comprising nucleotide.
  • the region of complementarity may be at least 17 nucleotides in length or 19 nucleotides in length.
  • the region of complementarity is between 19 and 21 nucleotides in length. In another embodiment, the region of complementarity is between 21 and 23 nucleotides in length.
  • each strand is no more than 30 nucleotides in length.
  • the ligand is an N-acetylgalactosamine (GalNAc).
  • the ligand may be one or more GalNAc attached to the RNAi agent through a monovalent, a bivalent, or a trivalent branched linker.
  • the ligand may be conjugated to the 3' end of the sense strand of the double stranded RNAi agent, the 5' end of the sense strand of the double stranded RNAi agent, the 3' end of the antisense strand of the double stranded RNAi agent, or the 5' end of the antisense strand of the double stranded RNAi agent.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the X is O.
  • the region of complementarity consists of the nucleotide sequence of 5'-UUGAAGUAAAUGGUGUUAACCAG-3'(SEQ ID NO: 15).
  • the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3'(SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'- UUGAAGUAAAUGGUGUUAACCAG-3'(SEQ ID NO: 15).
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage.
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage; and wherein the sense strand is conjugated to the ligand as shown in the following schematic
  • the agent is administered as a pharmaceutical compositon.
  • the RNAi agent is administered in an unbuffered solution, such as saline or water.
  • the siRNA is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 50 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 50 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 80 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to
  • administration of the dose of the double stranded RNAi agent to the subject lowers Serpincl activity in the subject by about 70% to about 95%, about 70% to about 80%, about 80% to about 90%, about 90% to about 95%, or by more than 95%.
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels in the subject to about the same level achieved by administration to the subject of Factor VIII.
  • administration of the dose of the double stranded RNAi agent to the subject decreases the annual bleed rate (ABR) of the subject by about 80% to about 95%, about 80% to about 85%, about 85% to about 90%, or about 90% to about 95%, as compared to the median historical on-demand ABR of subjects having a disorder that would benefit from reduction in Serpincl expression that are not administered the double stranded RNAi agent.
  • ABR annual bleed rate
  • double stranded RNAi agent is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the subject is a human.
  • the disorder may be a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • a bleeding disorder such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • the subject has hemophilia A and is an inhibitor subject. In another embodiment, the subject has hemophilia B and is an inhibitor subject. In yet another embodiment, the subject has hemophilia C and is an inhibitor subject.
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • the double stranded RNAi agent is administered to the subject chronically.
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
  • the modified nucleotides are independently selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2' -alky 1- modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a no n- natural base comprising nucleotide.
  • the region of complementarity may be at least 17 nucleotides in length or 19 nucleotides in length.
  • At least one strand of the double stranded RNAi agent may comprise a 3' overhang of at least 1 nucleotide or a 3' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
  • at least one strand of the RNAi agent comprises a 5' overhang of at least 1 nucleotide.
  • at least one strand comprises a 5' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
  • both the 3' and the 5' end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
  • the ligand is an N-acetylgalactosamine (GalNAc).
  • the ligand may be one or more GalNAc attached to the RNAi agent through a monovalent, a bivalent, or a trivalent branched linker.
  • the ligand may be conjugated to the 3' end of the sense strand of the double stranded RNAi agent, the 5' end of the sense strand of the double stranded RNAi agent, the 3' end of the antisense strand of the double stranded RNAi agent, or the 5' end of the antisense strand of the double stranded RNAi agent.
  • the double stranded RNAi agents of the invention comprise a plurality, e.g., 2, 3, 4, 5, or 6, of GalNAc, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the RNAi agent is conjugated to the ligand as shown in the following schematic
  • the X is O.
  • the region of complementarity consists of the nucleotide sequence of 5'-UUGAAGUAAAUGGUGUUAACCAG-3' (SEQ ID NO: 15).
  • the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3'(SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'- UUGAAGUAAAUGGUGUUAACC AG-3 ' (SEQ ID NO: 15).
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage.
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage; and wherein the sense strand is conjugated to the ligand as shown in the following schematic
  • the agent is administered as a pharmaceutical compositon.
  • the RNAi agent is administered in an unbuffered solution, such as saline or water.
  • the siRNA is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • kits for performing the methods of the invention may include an RNAi agent of the invention, and instructions for use, and optionally, means for administering the RNAi agent to the subject.
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 50 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3' (SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'-UUGAAGUAAAUGGUGUUAACCAG-3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 50 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3' (SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'-
  • RNAi double stranded ribonucleic acid
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 80 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3' (SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'-UUGAAGUAAAUGGUGUUAACCAG-3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 80 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the fixed dose of the double stranded RNAi agent is administered to the subject about once per month, wherein the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5 ' - GGUUAAC ACC AUUUACUUC AA -3 ' (SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'- UUGAAGUAAAUGGUGUUAACC AG-3 ' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the
  • administration of the dose of the double stranded RNAi agent to the subject lowers Serpincl activity in the subject by about 70% to about 95%, about 70% to about 80%, about 80% to about 90%, about 90% to about 95%, or by more than 95%.
  • administration of the dose of the double stranded RNAi agent to the subject increases peak thrombin levels in the subject to within the range of peak thrombin levels in a subject that does not have a disorder that would benefit from reduction in Serpincl expression.
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels of greater than about 40%, 45%, 50%, 55%, or greater than about 60% in the subject.
  • administration of the dose of the double stranded RNAi agent to the subject decreases the annual bleed rate (ABR) of the subject by about 80% to about 95%, about 80% to about 85%, about 85% to about 90%, or about 90% to about 95%, as compared to the median historical on-demand ABR of subjects having a disorder that would benefit from reduction in Serpincl expression that are not administered the double stranded RNAi agent.
  • ABR annual bleed rate
  • double stranded RNAi agent is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the subject is a human.
  • the disorder may be a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • a bleeding disorder such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • the subject has hemophilia A and is an inhibitor subject. In another embodiment, the subject has hemophilia B and is an inhibitor subject. In yet another embodiment, the subject has hemophilia C and is an inhibitor subject.
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
  • the modified nucleotides are independently selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2' -alky 1- modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a no n- natural base comprising nucleotide.
  • each strand is no more than 30 nucleotides in length.
  • the double stranded RNAi agents of the invention comprise a plurality, e.g., 2, 3, 4, 5, or 6, of GalNAc, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • the siRNA is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels in the subject to about the same level achieved by administration to the subject of Factor VIII.
  • the subject is a human.
  • the RNAi agent is conjugated to the ligand as shown
  • the X is O.
  • the present invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 40 mg to about 90 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense strand of the double
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression.
  • the methods include administering to the subject a fixed dose of about 40 mg to about 90 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense strand of the double stranded RNAi agent
  • the double stranded RNAi agent is administered to the subject once a month, once every five weeks, once every six weeks, once every seven weeks, once every 2 months, once a quarter, or as needed.
  • the double stranded RNAi agent may be administered to the subject as, e.g., a fixed dose of between between about 50 mg to about 90 mg, between about 50 mg to about 85 mg, between about 50 mg to about 80 mg, between about 40 mg to about 80 mg, between about 60 mg to about 90 mg, between about 25 mg to about 55 mg, between about 25 mg to about 65 mg, between about 40 mg to about 85 mg, between about 40 mg to about 75 mg, between about 40 mg to about 65 mg, or between about 40 mg to about 55 mg.
  • the double stranded RNAi agent is administered to the subject as a fixed dose of about 40 mg; or as a fixed dose of about 50 mg; or as a fixed dose of about 80 mg; or as a fixed dose of about 90 mg.
  • administration of the dose of the double stranded RNAi agent to the subject decreases the annual bleed rate (ABR) of the subject by about 80 to about 95% as compared to the median historical on-demand ABR of subjects having a disorder that would benefit from reduction in Serpincl expression that are not administered the double stranded RNAi agent.
  • ABR annual bleed rate
  • double stranded RNAi agent is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the subject is a human.
  • the disorder may be a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • the modified nucleotides are independently selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2' -alky 1- modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a no n- natural base comprising nucleotide.
  • the region of complementarity may be at least 17 nucleotides in length or 19 nucleotides in length.
  • the region of complementarity is between 19 and 21 nucleotides in length. In another embodiment, the region of complementarity is between 21 and 23 nucleotides in length.
  • each strand is no more than 30 nucleotides in length.
  • At least one strand of the double stranded RNAi agent may comprise a 3' overhang of at least 1 nucleotide or a 3' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
  • at least one strand of the RNAi agent comprises a 5' overhang of at least 1 nucleotide.
  • at least one strand comprises a 5' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
  • both the 3' and the 5' end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
  • the ligand is an N-acetylgalactosamine (GalNAc).
  • the ligand may be one or more GalNAc attached to the RNAi agent through a monovalent, a bivalent, or a trivalent branched linker.
  • the ligand may be conjugated to the 3' end of the sense strand of the double stranded RNAi agent, the 5' end of the sense strand of the double stranded RNAi agent, the 3' end of the antisense strand of the double stranded RNAi agent, or the 5' end of the antisense strand of the double stranded RNAi agent.
  • the X is O.
  • the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3' (SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'- UUGAAGUAAAUGGUGUUAACC AG-3 ' (SEQ ID NO: 15).
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage.
  • the siRNA is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the present invention provides methods of inhibiting expression of
  • the methods include administering to the subject a fixed dose of about 40 mg to about 90 mg of a double stranded ribonucleic acid (RNAi) agent, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the double stranded RNAi agent comprises a ligand, e.g., the sense strand of the double stranded RNAi agent is conjugated to a ligand attached at the 3 '-terminus of the RNAi agent.
  • the double stranded RNAi agent may be administered to the subject in two or more doses.
  • the double stranded RNAi agent is administered to the subject once a month, once every five weeks, once every six weeks, once every seven weeks, once every 2 months, once a quarter, or as needed.
  • the double stranded RNAi agent is administered to the subject once a month. In another embodiment, the double stranded RNAi agent is administered to the subject once every six weeks. In one embodiment, the double stranded RNAi agent is administered to the subject once every 2 months. In yet another embodiment, the double stranded RNAi agent is administered to the subject once a quarter.
  • the double stranded RNAi agent may be administered to the subject as, e.g., a fixed dose of between between about 50 mg to about 90 mg, between about 50 mg to about 85 mg, between about 50 mg to about 80 mg, between about 40 mg to about 80 mg, between about 60 mg to about 90 mg, between about 25 mg to about 55 mg, between about 25 mg to about 65 mg, between about 40 mg to about 85 mg, between about 40 mg to about 75 mg, between about 40 mg to about 65 mg, or between about 40 mg to about 55 mg.
  • the double stranded RNAi agent is administered to the subject as a fixed dose of about 40 mg; or as a fixed dose of about 50 mg; or as a fixed dose of about 80 mg; or as a fixed dose of about 90 mg.
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • administration of the dose of the double stranded RNAi agent to the subject lowers Serpincl activity in the subject by about 70% to about 95%.
  • the subject is a human.
  • the subject has having a disorder that would benefit from reduction in Serpincl expression.
  • the disorder may be a bleeding disorder, such as an acquired bleeding disorder or an inherited bleeding disorder, e.g., a hemophilia, e.g., hemophilia A, hemophilia B, or hemophilia C.
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels in the subject to about the same level achieved by administration to the subject of Factor VIII.
  • administration of the dose of the double stranded RNAi agent to the subject is sufficient to achieve peak thrombin generation levels of greater than about 40% in the subject.
  • administration of the dose of the double stranded RNAi agent to the subject decreases the annual bleed rate (ABR) of the subject by about 80 to about 95% as compared to the median historical on-demand ABR of subjects having a disorder that would benefit from reduction in Serpincl expression that are not administered the double stranded RNAi agent.
  • ABR annual bleed rate
  • double stranded RNAi agent is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the double stranded RNAi agent is administered to the subject subcutaneously.
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
  • the modified nucleotides are independently selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2' -alky 1- modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a no n- natural base comprising nucleotide.
  • the region of complementarity may be at least 17 nucleotides in length or 19 nucleotides in length.
  • the region of complementarity is between 19 and 21 nucleotides in length. In another embodiment, the region of complementarity is between 21 and 23 nucleotides in length.
  • each strand is no more than 30 nucleotides in length.
  • At least one strand of the double stranded RNAi agent may comprise a 3' overhang of at least 1 nucleotide or a 3' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
  • at least one strand of the RNAi agent comprises a 5' overhang of at least 1 nucleotide.
  • at least one strand comprises a 5' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
  • both the 3' and the 5' end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
  • the double stranded RNAi agents of the invention comprise a plurality, e.g., 2, 3, 4, 5, or 6, of GalNAc, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the RNAi agent is conjugated to the ligand as shown follow
  • the X is O.
  • the region of complementarity consists of the nucleotide sequence of 5'-UUGAAGUAAAUGGUGUUAACCAG-3' (SEQ ID NO: 15).
  • the double stranded RNAi agent comprises a sense strand comprising the nucleotide sequence of 5'- GGUUAACACCAUUUACUUCAA -3' (SEQ ID NO: 16), and an antisense strand comprising the nucleotide sequence of 5'- UUGAAGUAAAUGGUGUUAACC AG-3 ' (SEQ ID NO: 15).
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage.
  • the sense strand comprises 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and the antisense strand comprises 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage; and wherein the sense strand is conjugated to the ligand as shown in the following schematic
  • the agent is administered as a pharmaceutical compositon.
  • the RNAi agent is administered in an unbuffered solution, such as saline or water.
  • the siRNA is administered with a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • a buffer solution such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline
  • kits for performing the methods of the invention may include an RNAi agent of the invention, and instructions for use, and optionally, means for administering the RNAi agent to the subject.
  • Figure 1A is a graph depicting the effects of a single subcutaneous 0.03 mg/kg dose of AD-57213 on plasma thrombin generation levels in one healthy human subject.
  • Figure IB is a graph depicting the effects of a single subcutaneous 0.03 mg/kg dose of AD-57213 on plasma thrombin generation levels in one healthy human subject.
  • Figure 1C is a graph depicting the effects of a single subcutaneous 0.03 mg/kg dose of AD-57213 on plasma thrombin generation levels in one healthy human subject.
  • Figure ID is a graph depicting the effects of a single subcutaneous 0.03 mg/kg dose of AD-57213 on plasma thrombin generation levels in one healthy human subject.
  • Figures 2A is a graph depicting the effects of a single subcutaneous 0.03 mg/kg dose of AD-57213 on plasma AT (Serpincl) protein levels in one healthy human subject.
  • Figure 3 is a graph depicting the association between the percent of AT (Serpincl) knockdown and the percent increase in peak thrombin generation in healthy subjects administered a single subcutaneous 0.03 mg/kg dose of AD-57213.
  • Figure 4 is a graph depicting the effect of multiple 0.015 mg/kg, 0.045 mg/kg, or 0.075 mg/kg doses of AD-57213 on plasma AT (Serpincl) protein levels in human subjects having Hemophilia A or B.
  • Figure 5A is a graph depicting the effect of multiple 0.225 mg/kg, 0.450 mg/kg, 0.900 mg/kg, 1.800 mg/kg, or 80 mg doses of AD-57213 on plasma AT (Serpincl) protein levels in human subjects having Hemophilia A or B.
  • Figure 5B is a graph depicting the dose dependent effect of AD-57213 on plasma AT (Serpincl) protein levels in human subjects.
  • Figure 6B is a graph depicting the effect of multiple 0.015 mg/kg or 0.045 mg/kg doses of AD-57213 on thrombin generation as a percent change relative to group baseline in human subjects having Hemophilia A or B.
  • Figure 7 is a graph depicting the effect of multiple 0.045 mg/kg doses of AD-57213 on clot formation time and clotting time in one subject having Hemophilia A (subject 101- 009).
  • Figure 8 is a graph depicting the mean maximum AT lowering by monthly equivalent dose.
  • Figure 9 is a graph depicting the effect of multiple doses of AD-57213 on thrombin generation by AT lowering quartiles.
  • Figure 10A is a graph depicting the relative AT activity in relation to the percent peak thrombin generation achieved with Factor VIII as determined in a subject administered 225 mcg/kg qM of AD-57213.
  • Figure 10B is a graph depicting the relative AT activity in relation to the percent peak thrombin generation achieved with Factor VIII as determined in a subject administered 1800 mcg/kg qM of AD-57213.
  • Figure IOC is a graph depicting the relative AT activity in relation to the percent peak thrombin generation achieved with Factor VIII as determined in a subject administered 80 mg qM of AD-57213.
  • Figure 11 is a graph depicting the effect of multiple doses of AD-57213 on bleed events by AT lowering quartiles.
  • Figure 12 is a table showing the bleed event data for the subjects enrolled in Part C of the Phase I clinical trial of AD-57213.
  • Figure 13 A is a graph showing the median annual bleed rate (ABR) prior to the initiation of the study, at the onset portion of the study, and during the observation portion of the study for all of the dosing cohorts in Part C of the Phase I clinical trial of AD-57213.
  • ABR median annual bleed rate
  • Figure 13B is a graph showing the median annual bleed rate (ABR) prior to the initiation of the study, at the onset portion of the study, and during the observation portion of the study for the monthly 80 mg (80 mg qM x3) cohort in Part C of the Phase I clinical trial of AD-57213.
  • ABR median annual bleed rate
  • Figure 14A is a graph depicting the relative AT activity in relation to the percent peak thrombin generation achieved with Factor VIII as determined in an inhibitor subject administered a fixed monthly 50 mg dose of AD-57213.
  • Figure 14B is a graph depicting the relative AT activity in relation to the percent peak thrombin generation achieved with Factor VIII as determined in an inhibitor subject administered a fixed monthly 50 mg dose of AD-57213.
  • Figure 14C is a graph depicting the relative AT activity in relation to the percent peak thrombin generation achieved with Factor VIII as determined in an inhibitor subject administered a fixed monthly 50 mg dose of AD-57213.
  • Figure 15 is a graph depicting the effect of multiple 50 mg or 80 mg doses of AD- 57213 on the mean AT (Serpincl) activity relative to baseline in human subjects having Hemophilia A or B with inhibitors.
  • Figure 16 is a graph depicting that the AT lowering effect of multiple 50 mg doses of AD-57213 correlates with increased thrombin generation in a subject having Hemophilia A.
  • treating refers to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms, diminishing the extent of bleeding, stabilized (i.e., not worsening) state of bleeding, amelioration or palliation of the bleeding, whether detectable or undetectable.
  • Treatment can also mean prolonging survival as compared to expected survival in the absence of treatment.
  • treatment includes on demand treatment and control of bleeding episodes, perioperative management of bleeding and routine prophylaxis to reduce the frequency of bleeding episodes.
  • each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide.
  • an "RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides.
  • nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA.
  • a dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a
  • the overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.
  • the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3'-end and/or the 5'-end.
  • the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3'-end and/or the 5'-end.
  • one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
  • sense strand refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
  • the term "complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
  • Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12- 16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).
  • stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12- 16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).
  • Other conditions such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
  • Complementary sequences within an iRNA include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences.
  • Such sequences can be referred to as "fully complementary" with respect to each other herein.
  • first sequence is referred to as “substantially complementary” with respect to a second sequence herein
  • the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g. , inhibition of gene expression via a RISC pathway.
  • two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity.
  • a polynucleotide that is "substantially complementary to at least part of a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding Serpincl).
  • mRNA messenger RNA
  • a polynucleotide is complementary to at least a part of a Serpincl mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding Serpincl .
  • the antisense strand polynucleotides disclosed herein are fully complementary to the target Serpincl sequence.
  • the antisense strand polynucleotides disclosed herein are substantially complementary to the target Serpincl sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: l, or a fragment of SEQ ID NO: l, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
  • an agent for use in the methods and compositions of the invention is a single- stranded antisense RNA molecule that inhibits a target mRNA via an antisense inhibition mechanism.
  • the single- stranded antisense RNA molecule is
  • inhibitors expression of a Serpincl includes inhibition of expression of any Serpincl gene (such as, e.g., a mouse Serpincl gene, a rat Serpincl gene, a monkey Serpincl gene, or a human Serpincl gene) as well as variants or mutants of a Serpincl gene that encode a Serpincl protein.
  • Serpincl gene such as, e.g., a mouse Serpincl gene, a rat Serpincl gene, a monkey Serpincl gene, or a human Serpincl gene
  • “Inhibiting expression of a Serpincl gene” includes any level of inhibition of a Serpincl gene, e.g., at least partial suppression of the expression of a Serpincl gene, such as an inhibition by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
  • At least partial suppression of the expression of a Serpincl gene is assessed by a reduction of the amount of Serpincl mRNA which can be isolated from or detected in a first cell or group of cells in which a Serpincl gene is transcribed and which has or have been treated such that the expression of a Serpincl gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).
  • the degree of inhibition may be expressed in terms of
  • contacting a cell with an RNAi agent includes contacting a cell by any possible means.
  • Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA.
  • the contacting may be done directly or indirectly.
  • the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
  • Contacting a cell in vitro may be done, for example, by incubating the cell with the
  • RNAi agent a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located.
  • the RNAi agent may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver.
  • a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.
  • contacting a cell with an iRNA includes "introducing" or "delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell.
  • Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices.
  • Introducing an iRNA into a cell may be in vitro and/or in vivo.
  • iRNA can be injected into a tissue site or administered systemically.
  • In vivo delivery can also be done by a beta-glucan delivery system, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, the entire contents of which are hereby incorporated herein by reference.
  • In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.
  • the present invention provides therapeutic and prophylactic methods which include administering to a subject having a Serpincl -associated disease, e.g., a bleeding disorder, e.g., a hemophilia ⁇ e.g., hemophilia A, hemophilia B, or hemophilia C), an iRNA agent or a pharmaceutical composition comprising an iRNA agent of the invention.
  • a Serpincl -associated disease e.g., a bleeding disorder, e.g., a hemophilia ⁇ e.g., hemophilia A, hemophilia B, or hemophilia C
  • the methods further include administering to the subject an additional therapeutic agent.
  • RNAi agent when a double stranded RNAi agent includes one or more motifs of three identical modifications on three consecutive nucleotides, including one such motif at or near the cleavage site of the agent, six phosphorothioate linkages, and a GalNAc ligand, such an agent is administered at a dose of about 0.200 to about 1.825 mg/kg, 0.200 to about 1.800 mg/kg, about 0.200 to about 1.700 mg/kg, about 0.200 to about 1.600 mg/kg, about 0.200 to about 1.500 mg/kg, about 0.200 to about 1.400 mg/kg, about 0.200 to about 1.400 mg/kg, about 0.200 to about 1.200 mg/kg, about 0.200 to about 1.100 mg/kg, about 0.200 to about 1.000 mg/kg, about 0.200 to about 0.900 mg/kg, about 0.200 to about 0.800 mg/kg, about 0.200 to about 0.700 mg/kg, about 0.200 to about 0.600 mg/kg, about 0.200 to about 0.500 mg/kg,
  • RNAi agent may be administered to the subject at a dose of about 0.015 mg/kg to about 0.45 mg/mg.
  • the RNAi agent e.g. , RNAi agent in a pharmaceutical composition
  • the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression, e.g., a bleeding disorder, e.g., a hemophilia.
  • the methods include administering to the subject a prophylactically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of the iRNA agent, e.g., dsRNA, of the invention, (e.g., a pharmaceutical composition comprising a dsRNA of the invention), thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a prophylactically effective dose e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg
  • the iRNA agent e.g., dsRNA
  • the invention e.g., a pharmaceutical composition comprising a dsRNA of the invention
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression, e.g., a bleeding disorder, e.g., a hemophilia, which include administering to the subject, e.g., a human, a therapeutically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.800 mg/kg, of an iRNA agent targeting a Serpincl gene or a pharmaceutical composition comprising an iRNA agent targeting a Serpincl gene, thereby treating the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a bleeding disorder e.g., a hemophilia
  • the invention provides uses of a prophylactically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of an iRNA, e.g., a dsRNA, of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • a prophylactically effective dose e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg
  • an iRNA e.g., a dsRNA
  • Serpincl expression such as a bleeding disorder, e.g., a hemophilia.
  • the present invention provides uses of a therapeutically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of an iRNA agent of the invention for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • a therapeutically effective dose e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg
  • an iRNA agent of the invention for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a Serpincl gene or a pharmaceutical composition comprising a therapeutically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of an iRNA agent targeting a Serpincl gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder, e.g., a hemophilia.
  • a therapeutically effective dose e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg
  • an iRNA agent targeting a Serpincl gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder, e.
  • RNAi agent when a double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' -
  • the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression, e.g., a bleeding disorder, e.g., a hemophilia.
  • the methods include administering to the subject a prophylactically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucle
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression, e.g., a bleeding disorder, e.g., a hemophilia, which include administering to the subject, e.g., a human, a therapeutically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein
  • substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3'-terminus or a pharmaceutical composition comprising the iRNA agent targeting a Serpincl gene, thereby treating the subject having a disorder that would benefit from reduction in Serpincl expression.
  • the present invention provides uses of a prohylactically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a
  • RNAi
  • the present invention provides uses of a therapeutically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein
  • RNAi double stranded ribonucleic acid
  • substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus for treating a subject, e.g. , a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a Serpincl gene or a pharmaceutical composition comprising a therapeutically effective dose, e.g., a dose of about 0.200 mg/kg to about 1.825 mg/kg, of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3'
  • an iRNA agent of the invention is administered to a subject as a fixed dose.
  • a "fixed dose” e.g., a dose in mg
  • a fixed dose of an iRNA agent of the invention is based on a predetermined weight or age.
  • the RNAi agent is administered as a fixed dose of between about 25 mg to about 100 mg, e.g., between about 25 mg to about 95 mg, between about 25 mg to about 90 mg, between about 25 mg to about 85 mg, between about 25 mg to about 80 mg, between about 25 mg to about 75 mg, between about 25 mg to about 70 mg, between about 25 mg to about 65 mg, between about 25 mg to about 60 mg, between about 25 mg to about 50 mg, between about 50 mg to about 100 mg, between about 50 mg to about 95 mg, between about 50 mg to about 90 mg, between about 50 mg to about 85 mg, between about 50 mg to about 80 mg, between about 30 mg to about 100 mg, between about 30 mg to about 90 mg, between about 30 mg to about 80 mg, between about 40 mg to about 100 mg, between about 40 mg to about 90 mg, between about 40 mg to about 80 mg, between about 60 mg to about 100 mg, between about 60 mg to about 90 mg,, between about 25 mg to about 55 mg, between about 25 mg to about 65 mg, between about 30 mg to
  • the RNAi agent is administered as a fixed dose of about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg.
  • the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpincl expression, e.g., a bleeding disorder, e.g., a hemophilia.
  • the methods include administering to the subject a prophylactically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of the iRNA agent, e.g., dsRNA, of the invention, (e.g., a pharmaceutical composition comprising a dsRNA of the invention), thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a prophylactically effective dose e.g., a fixed dose of about 25 mg to about 100 mg
  • the iRNA agent e.g., dsRNA
  • the invention e.g., a pharmaceutical composition comprising a dsRNA of the invention
  • the methods include administering to the subject a prophylactically effective dose, e.g., a fixed dose of about 80 mg, of the iRNA agent, e.g., dsRNA, of the invention, (e.g., a pharmaceutical composition comprising a dsRNA of the invention), thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a prophylactically effective dose e.g., a fixed dose of about 80 mg
  • the iRNA agent e.g., dsRNA
  • the invention e.g., a pharmaceutical composition comprising a dsRNA of the invention
  • the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpincl expression, e.g., a bleeding disorder, e.g., a hemophilia, which include administering to the subject, e.g., a human, a therapeutically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of an iRNA agent targeting a Serpincl gene or a pharmaceutical composition comprising an iRNA agent targeting a Serpincl gene, thereby treating the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a bleeding disorder e.g., a hemophilia
  • a therapeutically effective dose e.g., a fixed dose of about 25 mg to about 100 mg
  • an iRNA agent targeting a Serpincl gene or a pharmaceutical composition comprising an iRNA agent targeting a Serpincl gene
  • the methods include administering to the subject a therapeutically effective dose, e.g., a fixed dose of about 50 mg, of the iRNA agent, e.g., dsRNA, of the invention, (e.g., a pharmaceutical composition comprising a dsRNA of the invention), thereby treating the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a therapeutically effective dose e.g., a fixed dose of about 50 mg
  • the iRNA agent e.g., dsRNA
  • the invention e.g., a pharmaceutical composition comprising a dsRNA of the invention
  • the methods include administering to the subject a therapeutically effective dose, e.g., a fixed dose of about 80 mg, of the iRNA agent, e.g., dsRNA, of the invention, (e.g., a pharmaceutical composition comprising a dsRNA of the invention), thereby treating the subject having a disorder that would benefit from reduction in Serpincl expression.
  • a therapeutically effective dose e.g., a fixed dose of about 80 mg
  • the iRNA agent e.g., dsRNA
  • the invention e.g., a pharmaceutical composition comprising a dsRNA of the invention
  • the invention provides uses of a prophylactically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of an iRNA, e.g., a dsRNA, of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • a prophylactically effective dose e.g., a fixed dose of about 25 mg to about 100 mg
  • an iRNA e.g., a dsRNA
  • the invention provides uses of a prophylactically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of an iRNA, e.g., a dsRNA, of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder
  • prophylactically effective dose e.g., a fixed dose of about 50 mg, of an iRNA, e.g., a dsRNA, of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • the invention provides uses of a prophylactically effective dose, e.g., a fixed dose of about 80 mg, of an iRNA, e.g., a dsRNA, of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • a prophylactically effective dose e.g., a fixed dose of about 80 mg
  • an iRNA e.g., a dsRNA
  • Serpincl expression such as a bleeding disorder, e.g., a hemophilia.
  • the present invention provides uses of a prohylactically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg of an iRNA agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • a prohylactically effective dose e.g., a fixed dose of about 25 mg to about 100 mg of an iRNA agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • the present invention provides uses of a prohylactically effective dose, e.g., a fixed dose of about 50 mg of an iRNA agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • a prohylactically effective dose e.g., a fixed dose of about 50 mg of an iRNA agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • the present invention provides uses of a prohylactically effective dose, e.g., a fixed dose of about 80 mg of an iRNA agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • a prohylactically effective dose e.g., a fixed dose of about 80 mg of an iRNA agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a bleeding disorder, e.g., a hemophilia.
  • the present invention provides uses of a therapeutically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of an iRNA agent of the invention for treating a subject, e.g. , a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • a therapeutically effective dose e.g., a fixed dose of about 25 mg to about 100 mg
  • an iRNA agent of the invention for treating a subject, e.g. , a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • the present invention provides uses of a therapeutically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of an iRNA agent of the invention for treating a subject, e.g. , a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • the present invention provides uses of a therapeutically effective dose, e.g., a fixed dose of about 25 mg to about 100
  • therapeutically effective dose e.g., a fixed dose of about 50 mg, of an iRNA agent of the invention for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • the present invention provides uses of a therapeutically effective dose, e.g., a fixed dose of about 80 mg, of an iRNA agent of the invention for treating a subject, e.g. , a subject that would benefit from a reduction and/or inhibition of Serpincl expression.
  • the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a Serpincl gene or a pharmaceutical composition comprising a therapeutically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of an iRNA agent targeting a Serpincl gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder, e.g., a hemophilia.
  • a therapeutically effective dose e.g., a fixed dose of about 25 mg to about 100 mg
  • an iRNA agent targeting a Serpincl gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder, e.g., a hemophilia.
  • the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a Serpincl gene or a pharmaceutical composition comprising a therapeutically effective dose, e.g., a fixed dose of about 50 mg, of an iRNA agent targeting a Serpincl gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder, e.g., a hemophilia.
  • a therapeutically effective dose e.g., a fixed dose of about 50 mg
  • a therapeutically effective dose e.g., a fixed dose of about 50 mg
  • an iRNA agent targeting a Serpincl gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder,
  • the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a Serpincl gene or a pharmaceutical composition comprising a therapeutically effective dose, e.g., a fixed dose of about 80 mg, of an iRNA agent targeting a Serpinc l gene in the manufacture of a
  • medicament for treating a subject e.g. , a subject that would benefit from a reduction and/or inhibition of Serpincl expression, such as a subject having a bleeding disorder, e.g., a hemophilia.
  • RNAi agent when a double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3'-terminus, such an agent is administered at a fixed dose of about 25 mg to about 100 mg, e.g., as a fixed dose of about 25 mg; or as a fixed dose of about 50 mg; or as a fixed dose of about 80 mg; or as a fixed dose of about 100 mg.
  • the fixed dose is administered at a fixed dose of
  • the invention provides uses of a prophylactically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpincl expression, such as a
  • the present invention provides uses of a therapeutically effective dose, e.g., a fixed dose of about 25 mg to about 100 mg, of a double stranded ribonucleic acid (RNAi) agent, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' -
  • RNAi double stranded ribonucleic acid
  • the fixed dose is 50 mg. In another embodiment, the fixed dose is 80 mg.
  • expression of the target Serpincl gene is decreased for an extended duration, e.g., at least about seven days or more, e.g., about one week, two weeks, three weeks, about four weeks, about 5 weeks, about 6 weeks, about 2 months, about a quarter, or longer.
  • Reduction in gene expression can be assessed by any methods known in the art.
  • a reduction in the expression of Serpincl may be determined by determining the mRNA expression level of Serpincl using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR, by determining the protein level of Serpincl using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques, and/or by determining a biological activity of Serpincl, such as affecting one or more molecules associated with the cellular blood clotting mechanism (or in an in vivo setting, blood clotting itself).
  • thrombin generation time, clot formation time and/or clotting time are determined to assess Serpincl expression using, e.g., ROTEM® Thromboelastometry analysis of whole blood.
  • Administration of the dsRNA according to the methods and uses of the invention may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a Serpincl-associated disease.
  • reduction in this context is meant a statistically significant decrease in such level.
  • the reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
  • Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, frequency of bleeds, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of a bleeding disorder may be assessed, for example, by periodic monitoring of thrombin:anti-thrombin levels.
  • Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
  • "effective against" a bleeding disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating bleeding disorders and the related causes.
  • a treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated.
  • a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment.
  • Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.
  • the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale. Any positive change resulting in e.g. , lessening of severity of disease measured using the appropriate scale, represents adequate treatment using an iRNA or iRNA formulation as described herein.
  • the iRNA (or pharmaceutical compositions comprising the iRNA) may be administered to the subject about once a week, about twice a month, about once every six weeks, about once every 2 months, or once a quarter.
  • a double stranded iRNA agent may be administered to a subject as one or more doses.
  • a double stranded iRNA agent may be administered to a subject as a monthly dose of about 0.200 mg/kg to about 1.825 mg/kg.
  • a double stranded iRNA agent may be administered to a subject as a fixed dose of about 25 mg to about 100 mg.
  • a double stranded RNAi agent comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus is administered is administered to the subject as a monthly dose of about 0.200 mg/kg to about 0.250 mg/kg, e.g., about 0.225 mg/kg.
  • a double stranded RNAi agent comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus is administered is administered to the subject as a monthly dose of about 0.425 mg/kg to about 0.475 mg/kg, e.g., about 0.450 mg/kg.
  • a double stranded RNAi agent comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus is administered is administered to the subject as a monthly dose of about 0.875 mg/kg to about 0.925 mg/kg, , e.g., about
  • a double stranded RNAi agent comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' - UUGAAGUAAAUGGUGUUAACCAG - 3' (SEQ ID NO: 15), wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3 '-terminus is administered is administered to the subject as a monthly dose of about 1.775 mg/kg to about 1.825, mg/kg, e.g., about 1.800 mg/kg.
  • the RNAi agent is administered in a dosing regimen that includes a "loading phase” of closely spaced administrations that may be followed by a “maintenance phase", in which the RNAi agent is administred at longer spaced intervals.
  • a loading dosing schedule and/or maintenance dosing schedule may optionally be repeated for one or more iterations. The number of iterations may depend on the
  • achievement of a desired effect e.g., the suppression of a Serpincl gene
  • a therapeutic or prophylactic effect e.g., increasing blood clotting, reducing clot formation time, and/or reducing clotting time.
  • the iRNA can be administered by intravenous infusion over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or about a 25 minute period.
  • patients Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion, and monitored for adverse effects, such as an allergic reaction.
  • the patient can be monitored for unwanted immuno stimulatory effects, such as increased cytokine (e.g. , TNF-alpha or INF-alpha) levels.
  • cytokine e.g. , TNF-alpha or INF-alpha
  • An iRNA of the invention may be administered in "naked” form, or as a "free iRNA.”
  • a naked iRNA is administered in the absence of a pharmaceutical composition.
  • the naked iRNA may be in a suitable buffer solution.
  • the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject.
  • an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
  • Subjects that would benefit from a reduction and/or inhibition of Serpinclgene expression are those having a bleeding disorder, e.g., an inherited bleeding disorder or an acquired bleeding disorder as described herein.
  • a subject having an inherited bleeding disorder has a hemophilia, e.g., hemophilia A, B, or C.
  • a hemophilia e.g., hemophilia A, B, or C.
  • the invention further provides methods and uses for the use of an iRNA or a pharmaceutical composition thereof, e.g. , for treating a subject that would benefit from reduction and/or inhibition of Serpincl expression, e.g., a subject having a bleeding disorder, in combination with other pharmaceuticals and/or other therapeutic methods, e.g. , with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders.
  • an iRNA targeting Serpincl is administered in combination with, e.g. , an agent useful in treating a bleeding disorder as described elsewhere herein.
  • additional therapeutics and therapeutic methods suitable for treating a subject that would benefit from reducton in Serpincl expression include fresh-frozen plasma (FFP); recombinant FVIIa; recombinant FIX; FXI concentrates; virus-inactivated, vWF-containing FVIII concentrates; desensitization therapy which may include large doses of FVIII or FIX, along with steroids or intravenous immunoglobulin (IVIG) and cyclophosphamide; plasmapheresis in conjunction with immunosuppression and infusion of FVIII or FIX, with or without antifibrino lytic therapy; immune tolerance induction (ITI), with or without immunosuppressive therapy (e.g., cyclophospham
  • antifibrinolytics such as aminocaproic acid and tranexamic acid; activated prothrombin complex concentrate (PCC); antihemophilic agents; corticosteroids; immunosuppressive agents; and estrogens.
  • PCC prothrombin complex concentrate
  • the iRNA and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein.
  • the present invention provides methods for treating a subject suffering from a bleeding disorder, e.g., a hemophilia, by subcutaneously administering to the subject compound AD-57213 (Sense strand: 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf
  • the present invention provides methods for treating a subject suffering from a bleeding disorder, e.g., a hemophilia, by subcutaneously administering to the subject compound AD-57213 (Sense strand: 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf
  • RNAi agents which inhibit the expression of a Serpincl gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a Serpincl-associated disorder, e.g., a bleeding dosorder, e.g., hemophilia.
  • the invention provides double stranded RNAi agents with chemical modifications capable of inhibiting the expression of a target gene (i.e., a Serpincl gene) in vivo.
  • a target gene i.e., a Serpincl gene
  • substantially all of the nucleotides of an iRNA of the invention are modified.
  • all of the nucleotides of an iRNA of the invention are modified.
  • iRNAs of the invention in which "substantially all of the nucleotides are modified" are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
  • the RNAi agent comprises a sense strand and an antisense strand.
  • Each strand of the RNAi agent may range from 12-30 nucleotides in length.
  • each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 19-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
  • RNAi agent a duplex double stranded RNA
  • the duplex region of an RNAi agent may be 12-30 nucleotide pairs in length.
  • the duplex region can be between 14- 30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
  • the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
  • RNAs with phosphorothioate backbones and oligonucleo sides with heteroatom backbones and in particular— CH 2 — NH— CH 2 -, ⁇ CH 2 ⁇ N(CH 3 ) ⁇ 0 ⁇ CH 2 ⁇ [known as a methylene (methylimino) or MMI backbone], -- CH 2 -0-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 - and -N(CH 3 )-CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as— O— P— O— CH 2 — ] of the above-referenced U.S.
  • the modification includes a 2'-methoxyethoxy (2'-0— CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al, Helv. Chim. Acta, 1995, 78:486- 504) i.e., an alkoxy-alkoxy group.
  • Another exemplary modification is 2'- dimethylaminooxyethoxy, i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0-CH 2 -0-CH 2 -N(CH 2 ) 2 .
  • nucleobase can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • base nucleobase
  • unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as deoxy-thymine (dT) s 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6- azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8- thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-
  • 5- substituted pyrimidines 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to 4'-(CH2)— 0-2' (LNA); 4'- (CH2)— S-2'; 4'-(CH2)2— 0-2' (ENA); 4'-CH(CH3)— 0-2' (also referred to as "constrained ethyl” or "cEt") and 4'-CH(CH20CH3)— 0-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)— 0-2' (and analogs thereof; see e.g., US Patent No.
  • nucleotides of an iRNA of the invention may also include a hydroxymethyl substituted nucleotide.
  • a "hydroxymethyl substituted nucleotide” is an acyclic 2'-3'-seco-nucleotide, also referred to as an "unlocked nucleic acid" (“UNA”) modification
  • RNAi agent may be optionally conjugated with a GalNAc derivative ligand, for instance on the sense strand.
  • the resulting RNAi agents present superior gene silencing activity.
  • RNAi agent when the sense strand and antisense strand of the double stranded RNAi agent are modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of an RNAi agent, the gene silencing acitivity of the RNAi agent was superiorly enhanced.
  • the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5'end.
  • the antisense strand contains at least one motif of three 2' -O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.
  • the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5'end.
  • the antisense strand contains at least one motif of three 2' -O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.
  • the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5'end; the antisense strand contains at least one motif of three 2' -O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.
  • the 2 nucleotide overhang is at the 3 '-end of the antisense strand.
  • the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5 '-end of the sense strand and at the 5 '-end of the antisense strand.
  • every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is
  • the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
  • the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand
  • the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5'-end.
  • the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1 st nucleotide from the 5 '-end of the antisense strand, or, the count starting from the 1 st paired nucleotide within the duplex region from the 5'- end of the antisense strand.
  • the cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5 '-end.
  • the sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand.
  • the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand.
  • at least two nucleotides may overlap, or all three nucleotides may overlap.
  • wing modification refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand.
  • the wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides.
  • the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different.
  • Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
  • the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand.
  • This antisense strand may also contain one or more wing modifications in an alignment similar to the wing
  • the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3'- end, 5'-end or both ends of the strand.
  • the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
  • every nucleotide in the sense strand and antisense strand of the RNAi agent may be modified.
  • Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g. , of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with
  • dephospho linkers modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
  • nucleotides or nucleotide surrogates may be included in single strand overhangs, e.g., in a 5' or 3' overhang, or in both.
  • all or some of the bases in a 3' or 5' overhang may be modified, e.g., with a modification described herein.
  • Modifications can include, e.g., the use of modifications at the 2' position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, , 2'-deoxy-2'-fluoro (2'-F) or 2'-0-methyl modified instead of the ribosugar of the nucleobase , and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.
  • each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2' -methoxyethyl, 2'- O-methyl, 2' -O-allyl, 2'-C- allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro.
  • the strands can contain more than one modification.
  • each residue of the sense strand and antisense strand is independently modified with 2'- O-methyl or 2'-fluoro.
  • At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2'- O-methyl or 2'-fluoro
  • the alternating motif in the sense strand may start with "AABBAABB” from 5 '-3' of the strand and the alternating motif in the antisenese strand may start with "BBAABBAA” from 5'-3' of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.
  • the RNAi agent comprises the pattern of the alternating motif of 2'-0-methyl modification and 2'-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'-0-methyl modification and 2'-F modification on the antisense strand initially, i.e., the 2'-0-methyl modified nucleotide on the sense strand base pairs with a 2'-F modified nucleotide on the antisense strand and vice versa.
  • the 1 position of the sense strand may start with the 2'-F modification
  • the 1 position of the antisense strand may start with the 2'- O-methyl modification.
  • the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
  • terminal three nucleotides may be at the 3 '-end of the antisense strand, the 3 '-end of the sense strand, the 5'-end of the antisense strand, and/or the 5'end of the antisense strand.
  • the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof.
  • a "mismatch” may be non-canonical base pairing or other than canonical pairing of nucleotides.
  • the mistmatch may occur in the overhang region or the duplex region.
  • the base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g. , on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
  • A:U is preferred over G:C
  • G:U is preferred over G:C
  • a “universal base” is a base that exhibits the ability to replace any of the four normal bases (G, C, A, and U) without significantly destabilizing neighboring base-pair interactions or disrupting the expected functional biochemical utility of the modified oligonucleotide.
  • Non-limiting examples of universal bases include 2'-deoxyinosine (hypoxanthine deoxynucleotide) or its derivatives, nitroazole analogues, and hydrophobic aromatic non-hydrogen-bonding bases.
  • the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5'- end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g. , non-canonical or other than canonical pairings or pairings which include a universal base, to promote the
  • the nucleotide at the 3 '-end of the sense strand is deoxy- thymine (dT).
  • the nucleotide at the 3 '-end of the antisense strand is deoxy-thymine (dT).
  • the sense strand sequence may be represented by formula (I): 5' n p -N a -(X X X )i-N b -Y Y Y -N b -(Z Z Z ) N a -n q 3' (I)
  • i and j are each independently 0 or 1 ;
  • p and q are each independently 0-6;
  • each n p and n q independently represent an overhang nucleotide
  • the N a and/or N b comprise modifications of alternating pattern.
  • the YYY motif occurs at or near the cleavage site of the sense strand.
  • the YYY motif can occur at or the vicinity of the cleavage site (e.g. : can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11,12 or 11, 12, 13) of - the sense strand, the count starting from the I s nucleotide, from the 5'-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end.
  • N b represents an
  • oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • N b is 0, 1, 2, 3, 4, 5 or 6
  • Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of X, Y and Z may be the same or different from each other.
  • each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • the antisense strand sequence of the RNAi may be represented by formula (II):
  • k and 1 are each independently 0 or 1;
  • p' and q' are each independently 0-6;
  • each N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified
  • each N b ' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides
  • each n p ' and n q ' independently represent an overhang nucleotide
  • ⁇ ' ⁇ ' ⁇ ', Y'Y'Y' and ⁇ ' ⁇ ' ⁇ ' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • the Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand.
  • the Y'Y'Y' motif can occur at positions 9, 10, 11;10, 11, 12; 11, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count starting from the 1 st nucleotide, from the 5'-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end.
  • the Y'Y'Y' motif occurs at positions 11, 12, 13.
  • k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
  • the antisense strand can therefore be represented by the following formulas:
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2- 20, 2-15, or 2-10 modified nucleotides.
  • N b ' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2- 20, 2-15, or 2-10 modified nucleotides.
  • each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of X', Y' and Z' may be the same or different from each other.
  • Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-0-methyl, 2'-0-allyl, 2'-C- allyl, 2'- hydroxyl, or 2' -fluoro.
  • each nucleotide of the sense strand and antisense strand is independently modified with 2'-0-methyl or 2'-fluoro.
  • Each X, Y, Z, X', Y' and Z' in particular, may represent a 2'-0-methyl modification or a 2' -fluoro modification.
  • the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1 st nucleotide from the 5 '-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end; and Y represents 2'-F modification.
  • the sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each
  • i, j, k, and 1 are each independently 0 or 1;
  • p, p', q, and q' are each independently 0-6;
  • each N b and N b independently represents an oligonucleotide sequence comprising 0-
  • each n p ', n p , n q ', and n q independently represents an overhang nucleotide
  • XXX, YYY, ZZZ, ⁇ ' ⁇ ' ⁇ ', ⁇ ' ⁇ ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1 ; or both i and j are 0; or both i and j are 1.
  • k is 0 and 1 is 0; or k is 1 and 1 is 0; k is 0 and 1 is 1 ; or both k and 1 are 0; or both k and 1 are 1.
  • Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
  • each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • RNAi agent is represented by formula (III), (Ilia), (Illb), (IIIc), (Hid), and
  • RNAi agent When the RNAi agent is represented by formula (Illb) or (Hid), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.
  • RNAi agent When the RNAi agent is represented as formula (IIIc) or (Hid), at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.
  • the N a modifications are 2'-0-methyl or 2'-fluoro modifications.
  • the N a modifications are 2'-0-methyl or 2'- fluoro modifications and n p ' >0 and at least one n p ' is linked to a neighboring nucleotide a via phosphorothioate linkage.
  • the N a modifications are 2'-0-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, a bivalent or a trivalent branched linker.
  • the N a modifications are 2'-0-methyl or 2'- fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, a bivalent or a trivalent branched linker.
  • the N a modifications are 2'-0-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, a bivalent or a trivalent branched linker.
  • the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (Ilia), (Mb), (IIIc), (Hid), and (Hie), wherein the duplexes are connected by a linker.
  • the linker can be cleavable or non-cleavable.
  • the multimer further comprises a ligand.
  • Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
  • the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (Ilia), (Illb), (IIIc), (Hid), and (Hie), wherein the duplexes are connected by a linker.
  • the linker can be cleavable or non-cleavable.
  • the multimer further comprises a ligand.
  • Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
  • two RNAi agents represented by formula (III), (Ilia), (Mb), (Mc), (Md), and (Me) are linked to each other at the 5' end, and one or both of the 3' ends and are optionally conjugated to to a ligand.
  • Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
  • RNAi agents that can be used in the methods of the invention. Such publications include WO2007/091269, US Patent No.
  • the RNAi agent for use in the methods of the invention is AD-57213 (Sense strand: 5'- GfsgsUfuAfaCfaCfCfAfuUfuAfcUfuCfaAf - 3' (SEQ ID NO: 13) and Antisense strand: 5'- usUfsgAfaGfuAfaAfuggUfgUfuAfaCfcsasg - 3' (SEQ ID NO: 14), wherein A, C, G, and U are ribose A, C, G or U; a, c, g, and u are 2'-0- methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf or Uf are 2'-fluoro A, C, G or U; and s is a phosphorothioate linkage.
  • the double stranded RNA (dsRNA) agents of the invention may optionally be conjugated to one or more ligands.
  • the ligand can be attached to the sense strand, antisense strand or both strands, at the 3'-end, 5'-end or both ends.
  • the ligand may be conjugated to the sense strand.
  • the ligand is conjgated to the 3'- end of the sense strand.
  • a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
  • the GalNAc or a GalNAc derivative is GalNAc 3 :
  • X is O or S. In one embodiment, X is O.
  • RNAi agents of the present invention A wide variety of entities can be coupled to the RNAi agents of the present invention.
  • Preferred moieties are ligands, which are coupled, preferably covalently, either directly or indirectly via an intervening tether.
  • Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; and nuclease-resistance conferring moieties.
  • therapeutic modifiers e.g., for enhancing uptake
  • diagnostic compounds or reporter groups e.g., for monitoring distribution
  • cross-linking agents e.g., for monitoring distribution
  • nuclease-resistance conferring moieties lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimics.
  • polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, pep tido mimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
  • Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N- acetylgalactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate,
  • a cell or tissue targeting agent e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a targeting group can be
  • polyglutamate polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B 12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer.
  • ligands include dyes, intercalating agents (e.g., acridines), cross- linkers (e.g., psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial
  • Ligands can be proteins, e.g. , glycoproteins, or peptides, e.g. , molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell.
  • Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl- galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, or aptamers.
  • the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF- ⁇ .
  • the ligand can increase the uptake of the oligonucleotide into the cell by, for example, activating an inflammatory response.
  • exemplary ligands that would have such an effect include tumor necrosis factor alpha (TNFalpha), interleukin- 1 beta, or gamma interferon.
  • the ligand is a lipid or lipid-based molecule.
  • a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA).
  • HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g. , a non- kidney target tissue of the body.
  • the target tissue can be the liver, including parenchymal cells of the liver.
  • Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used.
  • a lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g. , HSA.
  • a serum protein e.g. , HSA.
  • a lipid based ligand can be used to modulate, e.g., control the binding of the conjugate to a target tissue.
  • a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body.
  • a lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
  • the lipid based ligand binds HSA.
  • it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non- kidney tissue.
  • the affinity it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.
  • the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney.
  • Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
  • the ligand is a moiety, e.g. , a vitamin, which is taken up by a target cell, e.g. , a proliferating cell.
  • a target cell e.g. , a proliferating cell.
  • exemplary vitamins include vitamin A, E, and K.
  • B vitamins e.g. , folic acid, B 12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells.
  • HAS low density lipoprotein
  • HDL high-density lipoprotein
  • the ligand is a cell-permeation agent, preferably a helical cell- permeation agent.
  • the agent is amphipathic.
  • An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a pep tidy lmimetic, invertomers, non-peptide or pseudo -peptide linkages, and use of D-amino acids.
  • the helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.
  • the ligand can be a peptide or peptido mimetic.
  • a peptido mimetic also referred to herein as an oligopeptidomimetic is a molecule capable of folding into a defined three- dimensional structure similar to a natural peptide.
  • the peptide or peptido mimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • a peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g. , consisting primarily of Tyr, Trp or Phe).
  • the peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide.
  • the peptide moiety can include a hydrophobic membrane translocation sequence (MTS).
  • An exemplary hydrophobic MTS -containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP(SEQ ID NO: 9).
  • An RFGF analogue e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 10)
  • the peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes.
  • sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 11)
  • the Drosophila Antennapedia protein RQIKIWFQNRRMKWKK (SEQ ID NO: 12)
  • a peptide or peptido mimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one- compound (OBOC) combinatorial library (Lam et ah, Nature, 354:82-84, 1991).
  • the peptide or peptido mimetic tethered to an iRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic.
  • RGD arginine-glycine-aspartic acid
  • a peptide moiety can range in length from about 5 amino acids to about 40 amino acids.
  • the peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
  • An RGD peptide moiety can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et ah, Cancer Res., 62:5139-43, 2002).
  • a "cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell.
  • a microbial cell-permeating peptide can be, for example, an a- helical linear peptide ⁇ e.g., LL-31 or Ceropin PI), a disulfide bond-containing peptide (e.g., a -defensin, ⁇ -defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin).
  • a cell permeation peptide can also include a nuclear localization signal (NLS).
  • NLS nuclear localization signal
  • a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV- 1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
  • a targeting peptide can be an amphipathic a-helical peptide.
  • amphipathic a-helical peptides include, but are not limited to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins,
  • stabilization residues will be utilized (e.g. , leu, ala, or lys), and a minimum number helix destabilization residues will be utilized (e.g. , proline, or cyclic monomeric units.
  • the capping residue will be considered (for example Gly is an exemplary N-capping residue and/or C-terminal amidation can be used to provide an extra H-bond to stabilize the helix.
  • Formation of salt bridges between residues with opposite charges, separated by i + 3, or i + 4 positions can provide stability.
  • cationic residues such as lysine, arginine, homo-arginine, ornithine or histidine can form salt bridges with the anionic residues glutamate or aspartate.
  • the targeting ligand can be any ligand that is capable of targeting a specific receptor. Examples are: folate, GalNAc, galactose, mannose, mannose-6P, clusters of sugars such as GalNAc cluster, mannose cluster, galactose cluster, or an apatamer.
  • a cluster is a
  • the targeting ligands also include integrin receptor ligands, Chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands.
  • the ligands can also be based on nucleic acid, e.g. , an aptamer. The aptamer can be unmodified or have any combination of modifications disclosed herein.
  • oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple phosphorothioate linkages in the backbaone are also amenable to the present invention as ligands (e.g. , as PK modulating ligands).
  • ligands e.g. , as PK modulating ligands
  • aptamers that bind serum components e.g., serum proteins
  • the ligands can all have same properties, all have different properties or some ligands have the same properties while others have different properties.
  • a ligand can have targeting properties, have endosomolytic activity or have PK modulating properties.
  • all the ligands have different properties.
  • Ligands can be coupled to the oligonucleotides at various places, for example, 3 '-end, 5'-end, and/or at an internal position.
  • the ligand is attached to the oligonucleotides via an intervening tether, e.g. , a carrier described herein.
  • the ligand or tethered ligand may be present on a monomer when the monomer is incorporated into the growing strand.
  • the ligand may be incorporated via coupling to a "precursor" monomer after the "precursor" monomer has been incorporated into the growing strand.
  • Click Chemistry reaction may be incorporated, e.g., an azide or alkyne terminated
  • ligands can be attached to one or both strands.
  • the dsRNA of the invention is conjugated to a bivalent and trivalent branched linkers include the structures shown in any of formula (IV) - (VII):
  • any method of delivering a nucleic acid molecule can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139- 144 and WO94/02595, which are incorporated herein by reference in their entireties).
  • factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue.
  • the non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation.
  • AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.
  • RNAi agent when a double stranded RNAi agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5' -
  • mice models for the study of various human diseases, such as a bleeding disorder that would benefit from reduction in the expression of Serpincl. Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose.
  • Suitable mouse models are known in the art and include, for example, Hemophilia A mouse models and Hemohphilia B mouse models, e.g., mice containing a knock-out of a clotting factor gene, such as those described in
  • administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
  • compositions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
  • Such complex formulations often provide certain advantages that simple binary emulsions do not.
  • Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
  • a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2016/065245 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder Ceased WO2017100236A1 (en)

Priority Applications (29)

Application Number Priority Date Filing Date Title
CA3007014A CA3007014A1 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
IL259795A IL259795B2 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
JP2018549141A JP6985283B2 (ja) 2015-12-07 2016-12-07 Serpinc1関連障害を処置するための方法および組成物
SG11201804729RA SG11201804729RA (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
RU2018123712A RU2754188C2 (ru) 2015-12-07 2016-12-07 Способы и композиции для лечения ассоциированного с serpinc1 расстройства
ES16822817T ES3041380T3 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
EP24157647.9A EP4424828A1 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
RS20250930A RS67250B1 (sr) 2015-12-07 2016-12-07 Metode i kompozicije za lečenje poremećaja povezanog sa serpinc1
KR1020187019085A KR20180095843A (ko) 2015-12-07 2016-12-07 Serpinc1-연관 장애의 치료를 위한 방법 및 조성물
SI201631919T SI3386518T1 (sl) 2015-12-07 2016-12-07 Postopki in sestavki za zdravljenje motnje, povezane s Serpinc1
HRP20251125TT HRP20251125T1 (hr) 2015-12-07 2016-12-07 Postupci i pripravci za liječenje poremećaja povezanog sa serpinc1
CN202510290024.3A CN120284999A (zh) 2015-12-07 2016-12-07 用于治疗serpinc1相关病症的方法和组合物
LTEPPCT/US2016/065245T LT3386518T (lt) 2015-12-07 2016-12-07 Būdai ir kompozicijos, skirti gydyti su serpinc1 susijusį sutrikimą
AU2016368289A AU2016368289C1 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a Serpinc1-associated disorder
KR1020237025828A KR20230119027A (ko) 2015-12-07 2016-12-07 Serpinc1-연관 장애의 치료를 위한 방법 및 조성물
IL308717A IL308717A (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
CN201680081199.2A CN108601795A (zh) 2015-12-07 2016-12-07 用于治疗serpinc1相关病症的方法和组合物
EP16822817.9A EP3386518B1 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder
PL16822817.9T PL3386518T3 (pl) 2015-12-07 2016-12-07 Sposoby i kompozycje do leczenia zaburzeń związanych z serpinc1
KR1020217041486A KR20210157474A (ko) 2015-12-07 2016-12-07 Serpinc1-연관 장애의 치료를 위한 방법 및 조성물
DK16822817.9T DK3386518T3 (da) 2015-12-07 2016-12-07 Metoder og sammensætninger til behandling af en serpinc1-associeret forstyrrelse
FIEP16822817.9T FI3386518T3 (fi) 2015-12-07 2016-12-07 Menetelmiä ja koostumuksia serpinc1:een liittyvän häiriön hoitamiseksi
BR112018011450-2A BR112018011450A2 (en) 2015-12-07 2016-12-07 methods and compositions for treating a serpinc1-associated disorder
MX2018006989A MX2018006989A (es) 2015-12-07 2016-12-07 Metodos y composiciones para el tratamiento contra un trastorno asociado a serpinc1.
CONC2018/0006590A CO2018006590A2 (es) 2015-12-07 2018-06-26 Métodos y composiciones para el tratamiento de un trastorno asociado a serpinc1
JP2021189823A JP7422120B2 (ja) 2015-12-07 2021-11-24 Serpinc1関連障害を処置するための方法および組成物
AU2023200828A AU2023200828B2 (en) 2015-12-07 2023-02-14 Methods and compositions for treating a Serpinc1-associated disorder
JP2024002987A JP7820420B2 (ja) 2015-12-07 2024-01-12 Serpinc1関連障害を処置するための方法および組成物
AU2025201684A AU2025201684A1 (en) 2015-12-07 2025-03-07 Methods and compositions for treating a Serpinc1-associated disorder

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US201562264013P 2015-12-07 2015-12-07
US62/264,013 2015-12-07
US201662315228P 2016-03-30 2016-03-30
US62/315,228 2016-03-30
US201662366304P 2016-07-25 2016-07-25
US62/366,304 2016-07-25
US201662429241P 2016-12-02 2016-12-02
US62/429,241 2016-12-02

Publications (2)

Publication Number Publication Date
WO2017100236A1 true WO2017100236A1 (en) 2017-06-15
WO2017100236A8 WO2017100236A8 (en) 2017-07-20

Family

ID=58800158

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/065245 Ceased WO2017100236A1 (en) 2015-12-07 2016-12-07 Methods and compositions for treating a serpinc1-associated disorder

Country Status (25)

Country Link
US (2) US11091759B2 (https=)
EP (2) EP4424828A1 (https=)
JP (3) JP6985283B2 (https=)
KR (3) KR20230119027A (https=)
CN (2) CN108601795A (https=)
AU (3) AU2016368289C1 (https=)
BR (1) BR112018011450A2 (https=)
CA (1) CA3007014A1 (https=)
CO (1) CO2018006590A2 (https=)
DK (1) DK3386518T3 (https=)
ES (1) ES3041380T3 (https=)
FI (1) FI3386518T3 (https=)
HR (1) HRP20251125T1 (https=)
HU (1) HUE072861T2 (https=)
IL (2) IL259795B2 (https=)
LT (1) LT3386518T (https=)
MX (2) MX2018006989A (https=)
PL (1) PL3386518T3 (https=)
PT (1) PT3386518T (https=)
RS (1) RS67250B1 (https=)
RU (1) RU2754188C2 (https=)
SG (2) SG10201913085TA (https=)
SI (1) SI3386518T1 (https=)
TW (3) TWI836281B (https=)
WO (1) WO2017100236A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019010342A1 (en) * 2017-07-07 2019-01-10 Alnylam Pharmaceuticals, Inc. METHODS OF TREATING OR PREVENTING DISEASES ASSOCIATED WITH THE CONTACT ACTIVATION PATHWAY USING FIBER XII-TARGETING RNAI COMPOSITIONS (FACTOR HAGEMAN) (F12)
EP3550021A1 (en) * 2018-04-05 2019-10-09 Silence Therapeutics GmbH Products and compositions for inhibiting expression of a target gene
WO2019193189A1 (en) * 2018-04-05 2019-10-10 Silence Therapeutics Gmbh siRNAs WITH AT LEAST TWO LIGANDS AT DIFFERENT ENDS
US11091759B2 (en) 2015-12-07 2021-08-17 Genzyme Corporation Methods and compositions for treating a Serpinc1-associated disorder
WO2022120291A1 (en) 2020-12-06 2022-06-09 Genzyme Corporation Treatment of hemophilia with fitusiran
WO2022120292A1 (en) 2020-12-06 2022-06-09 Genzyme Corporation Treatment of hemophilia with fitusiran

Families Citing this family (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3212794B1 (en) 2014-10-30 2021-04-07 Genzyme Corporation Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
UY37803A (es) * 2017-07-10 2019-02-28 Genzyme Corp Métodos y composiciones para tratar un evento de sangrado en un sujeto que padece hemofilia
JP7511563B2 (ja) * 2018-09-10 2024-07-05 アイオーニス ファーマシューティカルズ, インコーポレーテッド Cln3の発現を調節するための化合物及び方法
US20220056455A1 (en) * 2018-12-20 2022-02-24 Praxis Precision Medicines, Inc. Compositions and methods for the treatment of kcnt1 related disorders
KR20210116509A (ko) * 2019-01-16 2021-09-27 젠자임 코포레이션 Serpinc1 irna 조성물 및 그의 이용 방법
KR20220163960A (ko) * 2020-03-06 2022-12-12 알리고스 테라퓨틱스 인코포레이티드 변경된 짧은 개재성 핵산(siNA) 분자 및 이의 용도
AU2021296786A1 (en) 2020-06-22 2023-02-23 Genzyme Corporation Methods and compositions for treating hemophilia
WO2023118150A1 (en) 2021-12-22 2023-06-29 Royal College Of Surgeons In Ireland A conjugate for use in localising a molecule to the vascular endothelium.
TW202342065A (zh) 2021-12-22 2023-11-01 美商健臻公司 治療血友病的方法和組成物
WO2023240193A2 (en) 2022-06-08 2023-12-14 Genzyme Corporation Treatment of hemophilia with fitusiran in pediatric patients
IL317440A (en) 2022-06-08 2025-02-01 Genzyme Corp FITUSIRAN for the treatment of hemophilia A and B
WO2024094704A1 (en) 2022-10-31 2024-05-10 Sanofi Arrangement for a drug delivery device, drug delivery device and method for assembly
EP4611846A1 (en) 2022-10-31 2025-09-10 Sanofi Plunger for expelling a drug, drug delivery device, rear sub-assembly and corresponding methods
EP4611847A1 (en) 2022-10-31 2025-09-10 Sanofi Container holder and drug delivery device comprising the container holder
EP4611851A1 (en) 2022-10-31 2025-09-10 Sanofi Drug delivery device with feedback element and method for providing a user of a drug delivery device feedback regarding a dose dispensing process
WO2024094705A1 (en) 2022-10-31 2024-05-10 Sanofi Drug delivery device having a two-part user indicator
WO2024094700A1 (en) 2022-10-31 2024-05-10 Sanofi Method for assembling an assembly for a drug delivery device and drug delivery device.
EP4611853A1 (en) 2022-10-31 2025-09-10 Sanofi Assembly for a drug delivery device
CN120476001A (zh) 2022-10-31 2025-08-12 赛诺菲 用于药物递送装置的前子组件
CN120129547A (zh) 2022-10-31 2025-06-10 赛诺菲 用于药物递送装置的装置本体、用于药物递送装置的组件以及药物递送装置
WO2024094706A1 (en) 2022-10-31 2024-05-10 Sanofi Audible indicator, indicator holder and method of assembling an audible indicator
EP4612687A1 (en) 2022-11-02 2025-09-10 Genzyme Corporation Systems and methods for modeling thrombin-antithrombin
WO2024222898A1 (zh) * 2023-04-28 2024-10-31 北京福元医药股份有限公司 用于抑制marc1基因表达的双链核糖核酸及其修饰物、缀合物和用途
EP4719527A1 (en) 2023-06-05 2026-04-08 Sanofi Drug delivery device
CN121285406A (zh) 2023-06-05 2026-01-06 赛诺菲 药物递送装置
WO2024251797A1 (en) 2023-06-05 2024-12-12 Sanofi Drug delivery device
WO2024251792A1 (en) 2023-06-05 2024-12-12 Sanofi Drug delivery device
WO2024251796A1 (en) 2023-06-05 2024-12-12 Sanofi Drug delivery device having two drug delivery arrangements
CN121240902A (zh) 2023-06-05 2025-12-30 赛诺菲 自驱动药剂容器和药剂递送装置
EP4719531A1 (en) 2023-06-05 2026-04-08 Sanofi Drug delivery device and method for decoupling a drug administration element and at least one part of a drug delivery device
EP4719538A1 (en) 2023-06-05 2026-04-08 Sanofi Drug delivery device
CN121240901A (zh) 2023-06-05 2025-12-30 赛诺菲 具有侧向柔性针头套筒的药物递送装置
CN121263160A (zh) 2023-06-05 2026-01-02 赛诺菲 刺孔封闭辅助构件、药物递送装置和方法
EP4719537A1 (en) 2023-06-05 2026-04-08 Sanofi Drug delivery device
CN121816187A (zh) 2023-09-15 2026-04-07 建新公司 用非妥西兰治疗血友病a
WO2025162926A1 (en) 2024-01-29 2025-08-07 Sanofi Needle arrangement, drug delivery device comprising the needle arrangement and method for operating the drug delivery device
WO2025162927A1 (en) 2024-01-29 2025-08-07 Sanofi Purifying device, system and method for purifying a needle for delivering a medicament
WO2025162928A1 (en) 2024-01-29 2025-08-07 Sanofi Needle shroud unlock device for a medicament delivery device
WO2025171279A1 (en) 2024-02-09 2025-08-14 Genzyme Corporation Treatment of hemophilia with fitusiran
WO2025212516A1 (en) 2024-04-01 2025-10-09 Genzyme Corporation Treatment of factor x deficiency with fitusiran
CN118557756B (zh) * 2024-05-24 2025-04-29 华中科技大学同济医学院附属协和医院 一种基于aav的遗传性抗凝血酶缺乏的基因疗法
WO2026012399A1 (zh) * 2024-07-10 2026-01-15 正大天晴药业集团股份有限公司 靶向serpinc1的双链核糖核酸

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994012649A2 (en) 1992-12-03 1994-06-09 Genzyme Corporation Gene therapy for cystic fibrosis
WO1997030731A2 (en) 1996-02-21 1997-08-28 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
US5705188A (en) 1993-02-19 1998-01-06 Nippon Shinyaku Company, Ltd. Drug composition containing nucleic acid copolymer
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US6191105B1 (en) 1993-05-10 2001-02-20 Protein Delivery, Inc. Hydrophilic and lipophilic balanced microemulsion formulations of free-form and/or conjugation-stabilized therapeutic agents such as insulin
US20030144217A1 (en) 1997-12-24 2003-07-31 Vertex Pharmaceuticals Incorporated Prodrugs of aspartyl protease inhibitors
US20040127488A1 (en) 1999-02-12 2004-07-01 Vertex Pharmaceuticals Incorporated Inhibitors of aspartyl protease
US20040167116A1 (en) 1992-09-08 2004-08-26 Vertex Pharmaceuticals Incorporated Novel sulfonamide inhibitors of aspartyl protease
US20050148548A1 (en) 1997-12-24 2005-07-07 Vertex Pharmaceuticals Inc. Sulphonamide derivatives as prodrugs of aspartyl protease inhibitors
US7063860B2 (en) 2001-08-13 2006-06-20 University Of Pittsburgh Application of lipid vehicles and use for drug delivery
US7070802B1 (en) 1996-01-22 2006-07-04 Pliva, Inc. Pharmaceutical compositions for lipophilic drugs
US7157099B2 (en) 2000-05-26 2007-01-02 Italfarmaco S.P.A. Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2013163430A2 (en) * 2012-04-26 2013-10-31 Alnylam Pharmaceuticals Serpinc1 irna compositions and methods of use thereof
WO2015175510A1 (en) * 2014-05-12 2015-11-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating a serpinc1-associated disorder

Family Cites Families (229)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4517294A (en) 1982-03-03 1985-05-14 Genentech, Inc. Human antithrombin III
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
JPS5927900A (ja) 1982-08-09 1984-02-14 Wakunaga Seiyaku Kk 固定化オリゴヌクレオチド
FR2540122B1 (fr) 1983-01-27 1985-11-29 Centre Nat Rech Scient Nouveaux composes comportant une sequence d'oligonucleotide liee a un agent d'intercalation, leur procede de synthese et leur application
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5430136A (en) 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5130300A (en) 1986-03-07 1992-07-14 Monsanto Company Method for enhancing growth of mammary parenchyma
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
JPS638396A (ja) 1986-06-30 1988-01-14 Wakunaga Pharmaceut Co Ltd ポリ標識化オリゴヌクレオチド誘導体
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
AU598946B2 (en) 1987-06-24 1990-07-05 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
DE3738460A1 (de) 1987-11-12 1989-05-24 Max Planck Gesellschaft Modifizierte oligonukleotide
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
WO1989009221A1 (en) 1988-03-25 1989-10-05 University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5457183A (en) 1989-03-06 1995-10-10 Board Of Regents, The University Of Texas System Hydroxylated texaphyrins
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5032401A (en) 1989-06-15 1991-07-16 Alpha Beta Technology Glucan drug delivery system and adjuvant
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
ATE269870T1 (de) 1989-10-24 2004-07-15 Isis Pharmaceuticals Inc 2'-modifizierte oligonukleotide
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
CA2029273A1 (en) 1989-12-04 1991-06-05 Christine L. Brakel Modified nucleotide compounds
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5852188A (en) 1990-01-11 1998-12-22 Isis Pharmaceuticals, Inc. Oligonucleotides having chiral phosphorus linkages
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
AU7579991A (en) 1990-02-20 1991-09-18 Gilead Sciences, Inc. Pseudonucleosides and pseudonucleotides and their polymers
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5981276A (en) 1990-06-20 1999-11-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
BR9106702A (pt) 1990-07-27 1993-06-08 Isis Pharmaceuticals Inc Analogo de oligonucleotideos e processos para modular a producao de uma proteina por um organismo e para tratar um organismo
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
ES2083593T3 (es) 1990-08-03 1996-04-16 Sterling Winthrop Inc Compuestos y metodos para inhibir la expresion de genes.
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
CA2092002A1 (en) 1990-09-20 1992-03-21 Mark Matteucci Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
WO1992008728A1 (en) 1990-11-08 1992-05-29 Hybridon, Inc. Incorporation of multiple reporter groups on synthetic oligonucleotides
GB9100304D0 (en) 1991-01-08 1991-02-20 Ici Plc Compound
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US6235887B1 (en) 1991-11-26 2001-05-22 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US6277603B1 (en) 1991-12-24 2001-08-21 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
KR940703846A (ko) 1991-12-24 1994-12-12 비. 린네 파샬 갭(gap)이 형성된 2′ 변성된 올리고뉴클레오티드(gapped 2′ modifed oligonucleotides)
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
DE4203923A1 (de) 1992-02-11 1993-08-12 Henkel Kgaa Verfahren zur herstellung von polycarboxylaten auf polysaccharid-basis
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5587308A (en) 1992-06-02 1996-12-24 The United States Of America As Represented By The Department Of Health & Human Services Modified adeno-associated virus vector capable of expression from a novel promoter
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US6346614B1 (en) 1992-07-23 2002-02-12 Hybridon, Inc. Hybrid oligonucleotide phosphorothioates
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
AU6449394A (en) 1993-03-30 1994-10-24 Sterling Winthrop Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
CA2159629A1 (en) 1993-03-31 1994-10-13 Sanofi Oligonucleotides with amide linkages replacing phosphodiester linkages
DE4311944A1 (de) 1993-04-10 1994-10-13 Degussa Umhüllte Natriumpercarbonatpartikel, Verfahren zu deren Herstellung und sie enthaltende Wasch-, Reinigungs- und Bleichmittelzusammensetzungen
US5955591A (en) 1993-05-12 1999-09-21 Imbach; Jean-Louis Phosphotriester oligonucleotides, amidites and method of preparation
US6015886A (en) 1993-05-24 2000-01-18 Chemgenes Corporation Oligonucleotide phosphate esters
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
AU678085B2 (en) 1993-11-16 1997-05-15 Genta Incorporated Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5599922A (en) 1994-03-18 1997-02-04 Lynx Therapeutics, Inc. Oligonucleotide N3'-P5' phosphoramidates: hybridization and nuclease resistance properties
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US6608035B1 (en) 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
US5665557A (en) 1994-11-14 1997-09-09 Systemix, Inc. Method of purifying a population of cells enriched for hematopoietic stem cells populations of cells obtained thereby and methods of use thereof
AU5359496A (en) 1995-03-06 1996-09-23 Isis Pharmaceuticals, Inc. Improved process for the synthesis of 2'-o-substituted pyrimidines and oligomeric compounds therefrom
US6166197A (en) 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
US5645620A (en) 1995-05-25 1997-07-08 Foster Wheeler Development Corp. System for separating particulates and condensable species from a gas stream
WO1997014809A2 (en) 1995-10-16 1997-04-24 Dana-Farber Cancer Institute Novel expression vectors and methods of use
US6160109A (en) 1995-10-20 2000-12-12 Isis Pharmaceuticals, Inc. Preparation of phosphorothioate and boranophosphate oligomers
US6444423B1 (en) 1996-06-07 2002-09-03 Molecular Dynamics, Inc. Nucleosides comprising polydentate ligands
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6172209B1 (en) 1997-02-14 2001-01-09 Isis Pharmaceuticals Inc. Aminooxy-modified oligonucleotides and methods for making same
US6639062B2 (en) 1997-02-14 2003-10-28 Isis Pharmaceuticals, Inc. Aminooxy-modified nucleosidic compounds and oligomeric compounds prepared therefrom
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
DE69834038D1 (de) 1997-07-01 2006-05-18 Isis Pharmaceutical Inc Zusammensetzungen und verfahren zur verabreichung von oligonukleotiden über die speiseröhre
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US6528640B1 (en) 1997-11-05 2003-03-04 Ribozyme Pharmaceuticals, Incorporated Synthetic ribonucleic acids with RNAse activity
US6617438B1 (en) 1997-11-05 2003-09-09 Sirna Therapeutics, Inc. Oligoribonucleotides with enzymatic activity
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US7273933B1 (en) 1998-02-26 2007-09-25 Isis Pharmaceuticals, Inc. Methods for synthesis of oligonucleotides
US7045610B2 (en) 1998-04-03 2006-05-16 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
US6531590B1 (en) 1998-04-24 2003-03-11 Isis Pharmaceuticals, Inc. Processes for the synthesis of oligonucleotide compounds
US6867294B1 (en) 1998-07-14 2005-03-15 Isis Pharmaceuticals, Inc. Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US6465628B1 (en) 1999-02-04 2002-10-15 Isis Pharmaceuticals, Inc. Process for the synthesis of oligomeric compounds
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
EP1178999B1 (en) 1999-05-04 2007-03-14 Santaris Pharma A/S L-ribo-lna analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US8137695B2 (en) 2006-08-18 2012-03-20 Arrowhead Madison Inc. Polyconjugates for in vivo delivery of polynucleotides
US6593466B1 (en) 1999-07-07 2003-07-15 Isis Pharmaceuticals, Inc. Guanidinium functionalized nucleotides and precursors thereof
US6147200A (en) 1999-08-19 2000-11-14 Isis Pharmaceuticals, Inc. 2'-O-acetamido modified monomers and oligomers
US7321029B2 (en) 2000-01-21 2008-01-22 Geron Corporation 2′-arabino-fluorooligonucleotide N3′→P5′ phosphoramidates: their synthesis and use
US6794493B2 (en) 2000-04-07 2004-09-21 Wisys Technology Foundation, Inc. Antithrombin H-helix mutants
JP4413493B2 (ja) 2000-10-04 2010-02-10 サンタリス ファーマ アー/エス プリンlna類似体の改善された合成方法
WO2005078097A2 (en) 2004-02-10 2005-08-25 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING MULTIFUNCTIONAL SHORT INTERFERING NUCLEIC ACID (Multifunctional siNA)
WO2004007718A2 (en) 2002-07-10 2004-01-22 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna-interference by single-stranded rna molecules
US6878805B2 (en) 2002-08-16 2005-04-12 Isis Pharmaceuticals, Inc. Peptide-conjugated oligomeric compounds
CA2504694C (en) 2002-11-05 2013-10-01 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
WO2006006948A2 (en) 2002-11-14 2006-01-19 Dharmacon, Inc. METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY
EP2305812A3 (en) 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
WO2005005613A2 (en) 2003-07-02 2005-01-20 Medical University Of South Carolina Dsrna induced specific and non-specific immunity in crustaceans and other invertebrates and biodelivery vehicles for use therein
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
JP2005117918A (ja) 2003-10-14 2005-05-12 Glycomedics Inc 新規糖鎖プライマー
EP1752536A4 (en) 2004-05-11 2008-04-16 Alphagen Co Ltd POLYNUCLEOTIDE CAUSING RNA INTERFERENCE AND METHOD OF REGULATING GENE EXPRESSION WITH THE USE OF THE SAME
US7740861B2 (en) 2004-06-16 2010-06-22 University Of Massachusetts Drug delivery product and methods
EP1866414B9 (en) 2005-03-31 2012-10-03 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
JP5342881B2 (ja) 2006-01-27 2013-11-13 アイシス ファーマシューティカルズ, インコーポレーテッド 6−修飾された二環式核酸類似体
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
EP1989307B1 (en) 2006-02-08 2012-08-08 Quark Pharmaceuticals, Inc. NOVEL TANDEM siRNAS
EP2021008B1 (en) 2006-04-07 2015-12-02 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
AU2007299629C1 (en) 2006-09-21 2012-05-10 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the HAMP gene
US20100105134A1 (en) 2007-03-02 2010-04-29 Mdrna, Inc. Nucleic acid compounds for inhibiting gene expression and uses thereof
WO2008109361A1 (en) 2007-03-02 2008-09-12 Mdrna, Inc, Nucleic acid compounds for inhibiting erbb family gene expression and uses thereof
BRPI0811170B8 (pt) 2007-05-22 2021-05-25 Arcturus Therapeutics Inc oligonucleotídeos de rna e complexos de rna substituídos por hidroximetila
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
CA2692579C (en) 2007-07-05 2016-05-03 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
CA2692161C (en) 2007-07-09 2015-09-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
US8741844B2 (en) 2007-07-20 2014-06-03 Universite Paris-Sud Xi Use of mutated antithrombins for treating or preventing coagulation disorders
WO2009082607A2 (en) 2007-12-04 2009-07-02 Alnylam Pharmaceuticals, Inc. Targeting lipids
MX2010008394A (es) 2008-01-31 2010-11-12 Alnylam Pharmaceuticals Inc Metodos optimizados para administracion de arndc focalizando el gen pcsk9.
JP5409658B2 (ja) 2008-03-13 2014-02-05 セレラ コーポレーション 静脈血栓症に関連した遺伝子多型、その検出方法および使用
SG171879A1 (en) 2008-12-03 2011-07-28 Marina Biotech Inc Usirna complexes
CA2749772C (en) 2009-01-16 2018-02-20 Assistance Publique-Hopitaux De Paris Mutated antithrombins, a process for preparing the same and their use as drugs
WO2010120526A2 (en) 2009-03-31 2010-10-21 Emory University Methods and systems for screening for and diagnosing dna methylation associated with autism spectrum disorders
EP2253715A1 (en) 2009-05-14 2010-11-24 RWTH Aachen New targets for cancer therapy and/or diagnosis
ES2804764T3 (es) 2009-06-01 2021-02-09 Halo Bio Rnai Therapeutics Inc Polinucleótidos para la interferencia de ARN multivalente, composiciones y métodos de uso de los mismos
MX342785B (es) 2009-06-10 2016-10-12 Alnylam Pharmaceuticals Inc Formulacion mejorada de lipido.
DK2470656T3 (da) 2009-08-27 2015-06-22 Idera Pharmaceuticals Inc Sammensætning til hæmning af genekspression og anvendelser heraf
DK2539451T3 (da) 2010-02-24 2016-04-04 Arrowhead Res Corp Sammensætninger til målrettet tilførsel af siRNA
US20130190383A1 (en) 2010-04-26 2013-07-25 Marina Biotech, Inc. Nucleic acid compounds with conformationally restricted monomers and uses thereof
ES2923573T3 (es) 2011-06-21 2022-09-28 Alnylam Pharmaceuticals Inc Composiciones de ARNi de proteína 3 de tipo angiopoyetina (ANGPTL3) y métodos de uso de las mismas
US20140356377A1 (en) 2011-08-25 2014-12-04 Umc Utrecht Holding B.V. Compounds for use in boosting coagulation
CN104136451A (zh) 2011-09-07 2014-11-05 玛瑞纳生物技术有限公司 具有构象限制的单体的核酸化合物的合成和用途
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
TW201936624A (zh) 2013-05-22 2019-09-16 美商阿尼拉製藥公司 絲胺酸蛋白酶抑制因子A1 iRNA組成物及其使用方法
US10689647B2 (en) 2015-05-08 2020-06-23 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of antithrombin 3 (AT3) by double-stranded RNA
FI3386518T3 (fi) 2015-12-07 2025-09-25 Genzyme Corp Menetelmiä ja koostumuksia serpinc1:een liittyvän häiriön hoitamiseksi
KR102318555B1 (ko) 2020-03-19 2021-10-29 한국과학기술연구원 광소자용 역나노콘과 그 제조방법

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040167116A1 (en) 1992-09-08 2004-08-26 Vertex Pharmaceuticals Incorporated Novel sulfonamide inhibitors of aspartyl protease
WO1994012649A2 (en) 1992-12-03 1994-06-09 Genzyme Corporation Gene therapy for cystic fibrosis
US5705188A (en) 1993-02-19 1998-01-06 Nippon Shinyaku Company, Ltd. Drug composition containing nucleic acid copolymer
US6191105B1 (en) 1993-05-10 2001-02-20 Protein Delivery, Inc. Hydrophilic and lipophilic balanced microemulsion formulations of free-form and/or conjugation-stabilized therapeutic agents such as insulin
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US7070802B1 (en) 1996-01-22 2006-07-04 Pliva, Inc. Pharmaceutical compositions for lipophilic drugs
WO1997030731A2 (en) 1996-02-21 1997-08-28 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US20030144217A1 (en) 1997-12-24 2003-07-31 Vertex Pharmaceuticals Incorporated Prodrugs of aspartyl protease inhibitors
US20050148548A1 (en) 1997-12-24 2005-07-07 Vertex Pharmaceuticals Inc. Sulphonamide derivatives as prodrugs of aspartyl protease inhibitors
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
US20040127488A1 (en) 1999-02-12 2004-07-01 Vertex Pharmaceuticals Incorporated Inhibitors of aspartyl protease
US7157099B2 (en) 2000-05-26 2007-01-02 Italfarmaco S.P.A. Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds
US7063860B2 (en) 2001-08-13 2006-06-20 University Of Pittsburgh Application of lipid vehicles and use for drug delivery
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2013163430A2 (en) * 2012-04-26 2013-10-31 Alnylam Pharmaceuticals Serpinc1 irna compositions and methods of use thereof
WO2015175510A1 (en) * 2014-05-12 2015-11-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating a serpinc1-associated disorder

Non-Patent Citations (141)

* Cited by examiner, † Cited by third party
Title
"dsRNA Research and Applications", 1993, CRC PRESS, pages: 276 - 278
"Modified Nucleosides in Biochemistry, Biotechnology and Medicine", 2008, WILEY-VCH
"The Concise Encyclopedia Of Polymer Science", 1990, JOHN WILEY & SONS, pages: 858 - 859
AIGNER, A., J. BIOMED. BIOTECHNOL., 2006, pages 71659
AKANEYA,Y. ET AL., J. NEUROPHYSIOL., vol. 93, 2005, pages 594 - 602
AKHTAR S.; JULIAN RL., TRENDS CELL. BIOL., vol. 2, no. 5, 1992, pages 139 - 144
AKIN AKINC ET AL: "An RNAi Therapeutic Targeting Antithrombin Increases Thrombin Generation in Nonhuman Primates", 54TH ANNUAL MEETING AND EXPOSITION OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY (ASH), 7 December 2012 (2012-12-07), XP055206448, Retrieved from the Internet <URL:http://www.alnylam.com/web/wp-content/uploads/2012/12/ALNY-ASH-AT3posterXpanel-Dec2012-r.pdf> [retrieved on 20150805] *
AKIN AKINC: "ALN-AT3: An Investigational RNAi Therapeutic Targeting Antithrombin for the Treatment of Hemophilia", 1 January 2014 (2014-01-01), XP055206418, Retrieved from the Internet <URL:http://www.alnylam.com/web/assets/ALNY-HemophiliaProgram-WFH-May2014.pdf> [retrieved on 20150805] *
AKIN AKINC: "An RNAi Therapeutic Targeting Antithrombin Increases Thrombin Generation and Improves Hemostasis", XXIV CONGRESS OF THE ISTH, 2 July 2013 (2013-07-02), XP055206432, Retrieved from the Internet <URL:http://www.alnylam.com/web/wp-content/uploads/2013/07/ALN-AT3-preclin-ISTH-July2013.pdf> [retrieved on 20150805] *
ALFICA SEHGAL ET AL: "An RNAi therapeutic targeting antithrombin to rebalance the coagulation system and promote hemostasis in hemophilia", NATURE MEDICINE., vol. 21, no. 5, 13 April 2015 (2015-04-13), US, pages 492 - 497, XP055245044, ISSN: 1078-8956, DOI: 10.1038/nm.3847 *
ALLEN, LV.; POPOVICH NG.; ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS
AOKI ET AL., CANCER GENE THERAPY, vol. 8, 2001, pages 783 - 787
ARNOLD, AS ET AL., J. HYPERTENS., vol. 25, 2007, pages 197 - 205
BEAUCAGE, S.L. ET AL: "Current protocols in nucleic acid chemistry", JOHN WILEY & SONS, INC.
BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363
BI L ET AL., NAT GENET, vol. 10, 1995, pages 119 - 121
BITKO, V. ET AL., NAT. MED., vol. 11, 2005, pages 50 - 55
BLOCK: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 335
BLOCK: "Pharmaceutical Dosage Forms", vol. 2, 1988, MARCEL DEKKER, INC., pages: 335
BLOCK: "Pharmaceutical Dosage Forms, Lieberman", vol. 1, 1988, MARCEL DEKKER, INC., pages: 335
BLOOD, vol. 122, no. 21, November 2013 (2013-11-01), 55TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; NEW ORLEANS, LA, USA; DECEMBER 07 -10, 2013, pages 3585, ISSN: 0006-4971 *
BLOOD, vol. 124, no. 21, December 2014 (2014-12-01), 56TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; SAN FRANCISCO, CA, USA; DECEMBER 06 -09, 2014, ISSN: 0006-4971(print) *
BLOOD, vol. 126, no. 23, 3 December 2015 (2015-12-03), 57TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; ORLANDO, FL, USA; DECEMBER 05 -08, 2015, ISSN: 0006-4971 *
BOESEN ET AL., BIOTHERAPY, vol. 6, 1994, pages 291 - 302
BOLLIGER ET AL., THROMB HAEMOST, vol. 103, 2010, pages 1233 - 1238
BONNET ME. ET AL., PHARM. RES., 16 August 2008 (2008-08-16)
BOUT ET AL., HUMAN GENE THERAPY, vol. 5, 1994, pages 3 - 10
BRUNTON ET AL.: "Goodman & Gilman's The Pharmacological Basis of Therapeutics", 1996, MCGRAW-HILL, pages: 934 - 935
BUUR ET AL., J. CONTROL REL.,, vol. 14, 1990, pages 43 - 51
CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134
CHIEN, PY. ET AL., CANCER GENE THER., vol. 12, 2005, pages 321 - 328
CLOWES ET AL., J. CLIN. INVEST., vol. 93, 1994, pages 644 - 651
CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385
CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH,, vol. 11, 1994, pages 1385 - 1390
COUTURE, A ET AL., TIG, vol. 12, 1996, pages 5 - 10
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; December 2014 (2014-12-01), SORENSEN BENNY ET AL: "A Subcutaneously Administered RNAi Therapeutic (ALN-AT3) Targeting Antithrombin for Treatment of Hemophilia: Interim Phase 1 Study Results in Healthy Volunteers and Patients with Hemophilia a or B", XP002767451, Database accession no. PREV201500278306 *
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; December 2015 (2015-12-01), KENET GILI ET AL: "Antithrombin Reduction Corrected Thrombin Generation in Samples from Hemophilia A and B Patients with Inhibitors", XP002767450, Database accession no. PREV201600270427 *
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; December 2015 (2015-12-01), PASI K JOHN ET AL: "A Subcutaneously Administered Investigational RNAi Therapeutic (ALN-AT3) Targeting Antithrombin for Treatment of Hemophilia: Interim Weekly and Monthly Dosing Results in Patients with Hemophilia A or B", XP002767449, Database accession no. PREV201600270426 *
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; January 2016 (2016-01-01), BARROS S ET AL: "Safety Evaluation of Chronic Antithrombin Silencing in Nonhuman Primate and Expanded Therapeutic Index in an Hemophilia A Mouse Model", XP002767453, Database accession no. PREV201600358454 *
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; November 2013 (2013-11-01), BURROS SCOTT A ET AL: "Expanded Therapeutic Index Of Antithrombin Silencing and Correction Of Aptt In a Hemophilia A Mouse Model", XP002767452, Database accession no. PREV201400362486 *
DIAS, N. ET AL., MOL CANCER THER, vol. 1, 2002, pages 347 - 355
DOCHERTY ET AL., FASEB J., vol. 8, 1994, pages 20 - 24
DORN, G. ET AL., NUCLEIC ACIDS, vol. 32, 2004, pages E49
EL HARIRI ET AL., J. PHARM. PHARMACOL.,, vol. 44, 1992, pages 651 - 654
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188
ELMEN, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 1, 2005, pages 439 - 447
ENGLISCH ET AL., ANGEWANDTE CHEMIE, vol. 30, 1991, pages 613
FISHER K J ET AL., J. VIROL, vol. 70, 1996, pages 520 - 532
GASSMANN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 1292
GROSSMAN; WILSON, CURR. OPIN. IN GENETICS AND DEVEL., vol. 3, 1993, pages 110 - 114
GRUNWELLER, A. ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 2003, pages 3185 - 3193
HAUBNER ET AL., JOUR. NUCL. MED., vol. 42, 2001, pages 326 - 336
HIGUCHI ET AL.: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 301
HO ET AL., J. PHARM. SCI., vol. 85, 1996, pages 138 - 143
HOWARD, KA. ET AL., MOL. THER., vol. 14, 2006, pages 476 - 484
IDSON: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 199
IDSON: "Pharmaceutical Dosage Forms, Lieberman", vol. 1, 1988, MARCEL DEKKER, INC., pages: 199
INTERNATIONAL JOURNAL OF TOXICOLOGY, vol. 35, no. 1, Sp. Iss. SI, January 2016 (2016-01-01), 36TH ANNUAL MEETING OF THE AMERICAN-COLLEGE-OF-TOXICOLOGY (ACT); SUMMERLIN, NV, USA; NOVEMBER 08 -11, 2015, pages 79, XP008183278, ISSN: 1091-5818 *
JARRETT, J. CHROMATOGR., vol. 618, 1993, pages 315 - 339
JIN ET AL., BLOOD, vol. 104, 2004, pages 1733
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327
KATDARE, A. ET AL.: "Excipient development for pharmaceutical, biotechnology, and drug delivery", 2006, CRC PRESS
KIEM ET AL., BLOOD, vol. 83, 1994, pages 1467 - 1473
KIM SH. ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 129, no. 2, 2008, pages 107 - 116
KIM, WJ. ET AL., MOL. THER., vol. 14, 2006, pages 343 - 350
KOZARSKY; WILSON, CURRENT OPINION IN GENETICS AND DEVELOPMENT, vol. 3, 1993, pages 499 - 503
KUBO, T. ET AL., BIOCHEM. BIOPHYS. RES. COMM.,, vol. 365, no. 1, 2007, pages 54 - 61
KUNDU ET AL., BLOOD, vol. 92, 1998, pages 168 - 174
LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84
LEE ET AL., CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, 1991, pages 92
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553
LEUNG; SHAH: "Controlled Release of Drugs: Polymers and Aggregate Systems", 1989, VCH PUBLISHERS, pages: 185 - 215
LI, S. ET AL., MOL. THER., vol. 15, 2007, pages 515 - 523
LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894
LIN ET AL., BLOOD, vol. 90, 1997, pages 3962 - 6966
LIU, S., MOL. PHARM., vol. 3, 2006, pages 472 - 487
MAKIMURA, H. ET AL., BMC NEUROSCI., vol. 3, 2002, pages 18
MALMSTEN, M.: "Surfactants and polymers in drug delivery", 2002, INFORMA HEALTH CARE
MANOHARAN ET AL., ANN. N. Y. ACAD. SCI., vol. 660, 1992, pages 306
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MASTRANGELI ET AL., J. CLIN. INVEST., vol. 91, 1993, pages 225 - 234
MCNAMARA, JO. ET AL., NAT. BIOTECHNOL., vol. 24, 2006, pages 1005 - 1015
MILLER ET AL., METH. ENZYMOL., vol. 217, 1993, pages 581 - 599
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229
MOOK, OR. ET AL., MOL CANC THER, vol. 6, no. 3, 2007, pages 833 - 843
MURANISHI, CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, vol. 7, 1990, pages 1 - 33
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
NYKANEN ET AL., CELL, vol. 107, 2001, pages 309
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533
PAL, A. ET AL., INT J. ONCOL., vol. 26, 2005, pages 1087 - 1091
PILLE, J. ET AL., MOL. THER., vol. 11, 2005, pages 267 - 274
RABINOWITZ J E ET AL., J VIROL, vol. 76, 2002, pages 791 - 801
REICH, SJ. ET AL., MOL. VIS., vol. 9, 2003, pages 210 - 216
RIEGER: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 285
RIEGER: "Pharmaceutical Dosage Forms, Lieberman", vol. 1, 1988, MARCEL DEKKER, INC., pages: 285
RITSCHEL, METH. FIND. EXP. CLIN. PHARMACOL., vol. 13, 1993, pages 205
ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 - 155
ROSENFELD ET AL., SCIENCE, vol. 252, 1991, pages 431 - 434
ROSOFF: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 245
SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111
SALMONS; GUNZBERG, HUMAN GENE THERAPY, vol. 4, 1993, pages 129 - 141
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMULSKI R ET AL., J. VIROL., vol. 61, 1987, pages 3096 - 3101
SAMULSKI R ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3826
SANGHVI, Y S.: "dsRNA Research and Applications", 1993, CRC PRESS, pages: 289 - 302
SCHOTT: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 271
SHARP ET AL., GENES DEV., vol. 15, 2001, pages 485
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777
SHISHKINA, GT. ET AL., NEUROSCIENCE, vol. 129, 2004, pages 521 - 528
SIMEONI ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages 2717 - 2724
SORENSEN, DR. ET AL., J. MOL. BIOL, vol. 327, 2003, pages 761 - 766
SOUTSCHEK, J. ET AL., NATURE, vol. 432, 2004, pages 173 - 178
SUBBARAO ET AL., BIOCHEMISTRY, vol. 26, 1987, pages 2964 - 2972
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49
SWINYARD: "Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO., pages: 782 - 783
TAKAHASHI ET AL., J. PHARM. PHARMACOL., vol. 40, 1988, pages 252
TAN, PH. ET AL., GENE THER., vol. 12, 2005, pages 59 - 66
THAKKER, ER. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17270 - 17275
TOLENTINO, MJ. ET AL., RETINA, vol. 24, 2004, pages 132 - 138
TOMALIA, DA. ET AL., BIOCHEM. SOC. TRANS., vol. 35, 2007, pages 61 - 67
TOUITOU, E. ET AL.: "Enhancement in Drug Delivery", 2006, CRC PRESS
TURK ET AL., BIOCHEM. BIOPHYS. ACTA, vol. 1559, 2002, pages 56 - 68
VERMA, UN. ET AL., CLIN. CANCER RES., vol. 9, 2003, pages 1291 - 1300
VOGEL ET AL., J. AM. CHEM. SOC., vol. 118, 1996, pages 1581 - 1586
WALSH ET AL., PROC. SOC. EXP. BIOL. MED., vol. 204, 1993, pages 289 - 300
WANG ET AL., GENE THERAPY, vol. 2, 1995, pages 775 - 783
WANG ET AL., PROC NATLACAD SCI USA, vol. 94, 1997, pages 11563 - 11566
XIA H ET AL., NAT. BIOTECH., vol. 20, 2002, pages 1006 - 1010
YAMAMOTO ET AL., J. PHARM. EXP. THER., vol. 263, 1992, pages 25
YAMASHITA ET AL., J. PHARM. PHARMACOL., vol. 39, 1987, pages 621 - 626
YAMASHITA ET AL., J. PHARM. SCI.,, vol. 79, 1990, pages 579 - 583
YOO, H. ET AL., PHARM. RES., vol. 16, 1999, pages 1799 - 1804
YOUNG ET AL., BLOOD, vol. 121, 2013, pages 1944
ZHANG, X. ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 10677 - 10684
ZIMMERMANN, TS. ET AL., NATURE, vol. 441, 2006, pages 111 - 114
ZITZMANN ET AL., CANCER RES., vol. 62, 2002, pages 5139 - 5143

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11091759B2 (en) 2015-12-07 2021-08-17 Genzyme Corporation Methods and compositions for treating a Serpinc1-associated disorder
WO2019010342A1 (en) * 2017-07-07 2019-01-10 Alnylam Pharmaceuticals, Inc. METHODS OF TREATING OR PREVENTING DISEASES ASSOCIATED WITH THE CONTACT ACTIVATION PATHWAY USING FIBER XII-TARGETING RNAI COMPOSITIONS (FACTOR HAGEMAN) (F12)
EP3550021A1 (en) * 2018-04-05 2019-10-09 Silence Therapeutics GmbH Products and compositions for inhibiting expression of a target gene
WO2019193189A1 (en) * 2018-04-05 2019-10-10 Silence Therapeutics Gmbh siRNAs WITH AT LEAST TWO LIGANDS AT DIFFERENT ENDS
WO2022120291A1 (en) 2020-12-06 2022-06-09 Genzyme Corporation Treatment of hemophilia with fitusiran
WO2022120292A1 (en) 2020-12-06 2022-06-09 Genzyme Corporation Treatment of hemophilia with fitusiran

Also Published As

Publication number Publication date
TW202206597A (zh) 2022-02-16
CO2018006590A2 (es) 2018-07-10
TW202423457A (zh) 2024-06-16
DK3386518T3 (da) 2025-09-15
HUE072861T2 (hu) 2025-12-28
RS67250B1 (sr) 2025-10-31
AU2023200828A1 (en) 2023-03-16
RU2018123712A3 (https=) 2020-04-30
AU2016368289A1 (en) 2018-06-21
SG10201913085TA (en) 2020-02-27
MX2024008022A (es) 2024-07-12
LT3386518T (lt) 2025-12-10
CN108601795A (zh) 2018-09-28
PL3386518T3 (pl) 2025-10-20
IL259795B1 (en) 2023-12-01
KR20210157474A (ko) 2021-12-28
KR20180095843A (ko) 2018-08-28
EP3386518B1 (en) 2025-06-25
IL308717A (en) 2024-01-01
CN120284999A (zh) 2025-07-11
PT3386518T (pt) 2025-09-16
US20220017902A1 (en) 2022-01-20
RU2021124592A (ru) 2021-11-01
IL259795A (en) 2018-07-31
EP4424828A1 (en) 2024-09-04
AU2025201684A1 (en) 2025-03-27
RU2754188C2 (ru) 2021-08-30
WO2017100236A8 (en) 2017-07-20
ES3041380T3 (en) 2025-11-11
FI3386518T3 (fi) 2025-09-25
SI3386518T1 (sl) 2025-10-30
AU2023200828B2 (en) 2025-04-03
IL259795B2 (en) 2024-04-01
US20170159053A1 (en) 2017-06-08
AU2016368289C1 (en) 2023-11-16
KR20230119027A (ko) 2023-08-14
JP2019504112A (ja) 2019-02-14
HRP20251125T1 (hr) 2025-11-21
MX2018006989A (es) 2018-09-05
TWI743069B (zh) 2021-10-21
AU2016368289B2 (en) 2022-11-17
JP7820420B2 (ja) 2026-02-25
CA3007014A1 (en) 2017-06-15
US11091759B2 (en) 2021-08-17
JP7422120B2 (ja) 2024-01-25
RU2018123712A (ru) 2020-01-10
JP2024046760A (ja) 2024-04-04
BR112018011450A2 (en) 2018-11-27
TW201726148A (zh) 2017-08-01
JP2022031772A (ja) 2022-02-22
TWI836281B (zh) 2024-03-21
SG11201804729RA (en) 2018-07-30
JP6985283B2 (ja) 2021-12-22
EP3386518A1 (en) 2018-10-17

Similar Documents

Publication Publication Date Title
AU2023200828B2 (en) Methods and compositions for treating a Serpinc1-associated disorder
US20230158058A1 (en) Methods and compositions for treating a bleeding event in a subject having hemophilia
WO2015175510A1 (en) Methods and compositions for treating a serpinc1-associated disorder
RU2858264C2 (ru) Способы и композиции для лечения ассоциированного с serpinc1 расстройства
HK40115220A (en) Methods and compositions for treating a serpinc1-associated disorder
HK40128162A (en) Methods and compositions for treating a bleeding event in a subject having hemophilia
RU2801263C2 (ru) Способы и композиции для лечения явления кровотечения у больного гемофилией
HK1261505B (en) Methods and compositions for treating a serpinc1-associated disorder
HK1261505A1 (en) Methods and compositions for treating a serpinc1-associated disorder

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16822817

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3007014

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 11201804729R

Country of ref document: SG

Ref document number: 259795

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2018549141

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/006989

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018011450

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2016368289

Country of ref document: AU

Date of ref document: 20161207

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187019085

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020187019085

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2018123712

Country of ref document: RU

Ref document number: 2016822817

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016822817

Country of ref document: EP

Effective date: 20180709

ENP Entry into the national phase

Ref document number: 112018011450

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180606

WWG Wipo information: grant in national office

Ref document number: 2016822817

Country of ref document: EP