WO2016135168A1 - Biomarker panel for the detection of cancer - Google Patents

Biomarker panel for the detection of cancer Download PDF

Info

Publication number
WO2016135168A1
WO2016135168A1 PCT/EP2016/053813 EP2016053813W WO2016135168A1 WO 2016135168 A1 WO2016135168 A1 WO 2016135168A1 EP 2016053813 W EP2016053813 W EP 2016053813W WO 2016135168 A1 WO2016135168 A1 WO 2016135168A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
methylation
marker
cancer
hyal2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/053813
Other languages
English (en)
French (fr)
Inventor
Barbara BURWINKEL
Rongxi YANG
Andreas Schneeweiss
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitaet Heidelberg
Original Assignee
Universitaet Heidelberg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US15/552,421 priority Critical patent/US10941451B2/en
Priority to MX2017010836A priority patent/MX386750B/es
Priority to EP16710678.0A priority patent/EP3262190B1/en
Priority to KR1020177025428A priority patent/KR20170120124A/ko
Priority to BR112017018008-1A priority patent/BR112017018008B1/pt
Priority to DK16710678.0T priority patent/DK3262190T3/da
Priority to AU2016223532A priority patent/AU2016223532B2/en
Priority to JP2017562131A priority patent/JP6807873B2/ja
Priority to HK18105993.6A priority patent/HK1246828A1/zh
Priority to EA201791578A priority patent/EA037995B1/ru
Priority to PL16710678T priority patent/PL3262190T3/pl
Priority to CN201680010907.3A priority patent/CN107406880A/zh
Application filed by Universitaet Heidelberg filed Critical Universitaet Heidelberg
Priority to UAA201708275A priority patent/UA124612C2/uk
Priority to ES16710678T priority patent/ES2893297T3/es
Priority to CA2975952A priority patent/CA2975952C/en
Publication of WO2016135168A1 publication Critical patent/WO2016135168A1/en
Priority to IL253756A priority patent/IL253756B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to panels of methylation and miRNA marker as well as their use in the prognosing, diagnosing and/or treatment of cancer, means for detecting said marker, kits comprising said means, and devices for analysing the marker panel.
  • BACKGROUND Cancer is one of the most important medical and health problems in the world. As the leading cause of death worldwide, there were 12.4 million new cancer cases and 7.6 million cancer related deaths in 2008. It has been predicted that the deaths from cancer worldwide is continuously rising and 12 million deaths would be caused by cancer in the year of 2030.
  • Breast cancer is the most common cancer among women. About one out of nine women will develop breast cancer during her life (Feuer, E.J., et al., The lifetime risk of developing breast cancer. J Natl Cancer Inst 85, 892-897 (1993)). Worldwide approximately 1.3 million women develop breast cancer each year.
  • ovarian cancer Compared to BC, ovarian cancer (OvCa) is comparable rare in occurrence, but is the leading cause of death from gynecologic cancers because of its high malignancy. In 2008, 225,000 women were diagnosed with ovarian cancer worldwide, and 140,000 of these women died from the disease. Typically, women with the OvCa present with few early symptoms, and thus nearly three-quarters of ovarian cancer cases present at an advanced stage, with the disease spread well beyond the ovaries. Pancreatic cancer (PaCa) is the most aggressive of all epithelial malignancies. With 279,000 new diagnoses of PaCa worldwide, the 5-year overall survival rate of PaCa patients is less than 5%. Although recent genome- wide association studies (GWAS) have successfully detected several genetic variants associated with the risk of BC, OvCa and PaCa, no valuable marker for the early detection of BC has been identified.
  • GWAS genome- wide association studies
  • MBC Metastatic breast cancer
  • Circulating tumor cells have been proposed as an FDA approved independent prognostic marker for metastasis, specifically for progression- free survival and overall survival.
  • a cardinal cut off of greater than 5 CTCs per 7.5ml of blood has been defined as CTC positive (Cristofanilli M, Budd GT, Ellis MJ, Stopeck A, et al; Circulating tumor cells, disease progression, and survival in metastatic breast cancer; N Engl J Med. 2004 Aug 19;351 (8):781-91).
  • CTC positive Cristofanilli M, Budd GT, Ellis MJ, Stopeck A, et al; Circulating tumor cells, disease progression, and survival in metastatic breast cancer; N Engl J Med. 2004 Aug 19;351 (8):781-91).
  • Beside CTCs also protein based circulating tumor markers like carcinoembryonic antigen (CEA) and carbohydrate antigen 15-3 (CA 15-3) are widely used as prognostic markers, as well as in monitoring breast cancer treatment success and follow-up (Uehara M, Kinoshita T, Hojo T, Akashi- Tanaka S, Iwamoto E, Fukutomi T. Long-term prognostic study of carcinoembryonic antigen (CEA) and carbohydrate antigen 15-3 (CA 15-3) in breast cancer.
  • CEA carcinoembryonic antigen
  • CA 15-3 carbohydrate antigen 15-3
  • Epigenetic changes are defined as changes in gene expression that are not due to any alterations in the genomic DNA sequence. Aberrant epigenetic signatures have been considered as a hallmark of human cancer (Esteller, M. Cancer epigenomics: DNA methylomes and histone-modification maps. Nat Rev Genet 8, 286-298 (2007).).
  • DNA methylation One of the most important epigenetic signatures, DNA methylation, has critical roles in the control of gene activities and in the architecture of the nucleus of the cell Weber, M., et al. Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nat Genet 37, 853-862 (2005)). Furthermore, unlike genetic markers or variants, DNA methylation is principally reversible.
  • DNA methylation profile of specific genes are considered as therapeutic targets (Mack, G.S. Epigenetic cancer therapy makes headway. J Natl Cancer Inst 98, 1443-1444 (2006)).
  • DNA methylation may serve as a link between environmental factors and the genome. DNA methylation modulated by environmental factors or aging may alter the expression of critical genes of cells and consequently induce malignant transformation of cells or even a cancer (Widschwendter, M., et al. Epigenotyping in peripheral blood cell DNA and breast cancer risk: a proof of principle study. P LoS One 3, e2656 (2008)).
  • MiRNAs are small, non-coding RNAs (-18-25 nucleotides in length) that regulate gene expression on a post-transcriptional level by degrading mRNA molecules or blocking their translation (Bartel DP.: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 1 16: 281-97). Hence, they play an essential role in the regulation of a large number of biological processes, including cancer (Calin GA, Chester CD, Shimizu M, Bichi R, Zupo S, Rick E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, et al.
  • Circulating miRNAs are defined as miRNAs present in the cell- free component of body fluids like plasma, serum, and the like. Lawrie et al. (Lawrie CH, Gal S, Dunlop HM, Pushkaran B, Liggins AP, Pulford K, Banham AH, Pezzella F, Boultwood J, Wainscoat JS, Hatton CS, Harris AL. Detection of elevated levels of tumour-associated microRNAs in serum of patients with diffuse large B-cell lymphoma. Br J Haematol 2008; 141 :672-5) were among the first to demonstrate the presence of miRNAs in bodily fluids.
  • circulating miRNAs have been reported as aberrantly expressed in blood plasma or serum in different types of cancer, e.g. prostate, colorectal or esophageal carcinoma (Brase JC, Johannes M, Schlomm T, Faith M, Haese A, Steuber T, Beissbarth T, Kuner R, Sultmann H. Circulating miRNAs are correlated with tumor progression in prostate cancer.
  • Brase JC Johannes M, Schlomm T, Faith M, Haese A, Steuber T, Beissbarth T, Kuner R, Sultmann H. Circulating miRNAs are correlated with tumor progression in prostate cancer.
  • Huang Z Huang D, Ni S, Peng Z, Sheng W, Du X.
  • Plasma microRNAs are promising novel markers for early detection of colorectal cancer.
  • the present invention relates to a method of prognosing and/or diagnosing cancer, in particular BC, OvaCa, and/or PaCA, in a subject, comprising (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S I OOP, DYRK4, and (b) determining the presence, in particular the amount, of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127-3p, miR-409-3p, miR-148b , in a subject, wherein the methylation status and/or expression level of at least one methylation marker and the presence of at least one miRNA is indicative of the prognosis and/or diagnosis of said subject.
  • the present invention relates to a method for determining the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer in a subject, comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a sample of a subject, and optionally determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a reference for comparison with the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in the sample of interest, and (b) determining the dosage of a pharmaceutical depending on the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in the sample of interest, optionally depending on the comparison of the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker a in the sample of interest and the
  • the present invention relates to a method for adapting the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer, comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a sample, (b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miR A marker in one or more references or reference samples, (c) examining the tested sample as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker present in said sample of interest is different from the level in the one or more references or reference samples, and (d) adapting the dosage of a pharmaceutical depending on whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in the sample of interest is different from the level in the one or more references or reference samples.
  • the present invention relates to a method of determining the beneficial and/or adverse effects of a substance on cancer or the development of cancer, comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a sample of interest, (b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, and (c) examining the sample of interest as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker present in said sample of interest is different from the level in the one or more references or reference samples, wherein the sample of interest was exposed differently to said substance than the one or more references or reference samples.
  • the present invention relates to a method for identifying a patient as a responder to a cancer treatment, comprising determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in a first and in one or more further samples taken subsequently to the first sample, wherein an increased methylation status of the at least one methylation marker and/or a lower expression level of the at least one methylation marker, and the absence or decreased amount of the at least one miRNA marker indicates a response to the treatment.
  • the present invention relates to a method for identifying a patient as a non- responder to a cancer treatment, comprising determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in a first and in one or more further samples taken subsequently to the first sample, wherein a decreased methylation status of the at least one methylation marker and/or an increased expression level of the at least one methylation marker, and the presence or increased amount of the at least one miRNA marker indicates a lack of response to the treatment.
  • the present invention relates to a method for treating cancer, comprising the steps: (i) determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in a first sample of a subject; (ii) starting treatment of said patient with a first treatment regimen comprising one or more anti-cancer agents or therapies, (iii) determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in one or more subsequently taken further samples of said subject; (iv) optionally repeating steps (ii) and (iii) one or more times; (v) continuing treating the patient with the first treatment regimen if there is a substantial increase of the methylation status of the at least one methylation marker and/or a lower expression level of the at least one methylation marker, and a decreased amount or absence of the at least one miRNA marker, or
  • the present invention relates to means for prognosing and/or diagnosing i. the risk of developing cancer, in particular BC, OvaCa, and/or PaCA, ii. the presence of cancer, in particular BC, OvaCa, and/or PaCA, and/or iii. the progression of cancer, in particular BC, OvaCa, and/or PaCA, comprising a) one or more means of detecting the methylation status and/or expression level of at least one methylation marker, and b)one or more means of detecting the amount of at least one miRNA marker.
  • the present invention relates to a kit comprising the means of the eighth aspect.
  • the present invention relates tothe use of the means of the eighth aspect, or the kit of the ninth aspect for prognosing and/or diagnosing i. the risk of developing cancer, in particular BC, OvaCa, and/or PaCA, ii. the presence of cancer, in particular BC, OvaCa, and/or PaCA, and/or iii. the progression of cancer, in particular BC, OvaCa, and/or PaCA.
  • the present invention relates to a device for identifying cancer, in particular BC, OvaCa, and/or PaCA, comprising: (a) an analyzing unit comprising (i) a detection agent for determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, and (ii) a detection agent for determining the presence of at least one miRNA selected from the group consisting of: miR-652, miR-801, miR-376c, miR-376a, miR-127-3p, miR-409-3p, miR-148b in a sample of a subject; and (b) an evaluation unit comprising a data processor having tangibly embedded an algorithm for carrying out a comparison of the amount determined by the analyzing unit with a reference and which is capable of generating an output file containing a diagnosis established based on the
  • Fig. 3 The discriminatory power of DNA methylation marker sets to distinguish BC cases from healthy controls in samples of other centres
  • Fig. 4 The discriminatory power of DNA methylation marker sets and miRNA marker sets to distinguish BC cases from healthy controls in samples from our group
  • Fig. 5 The methylation level of the eight genes in sporadic BC patients with different clinical characteristics (cases from the second validation round)
  • Fig. 6 The methylation level of the eight genes in sporadic BC patients with different clinical characteristics (cases from our group)
  • Fig. 7 Sample Description of blood-based biomarker panel for the early detection of pancreatic cancer
  • Fig. 8 Methylation differences in genes comparing PaCa cases and controls
  • Fig. 9 Methylation differences in genes comparing PaCa cases and controls stratified by gender
  • Fig. 10 The discriminatory power of the methylation in genes to distinguish PaCa cases from healthy controls
  • Fig. 11 The methylation of genes in PaCa patients with different clinical characteristics
  • Fig. 12 Sample Description of blood-based biomarker panel for the early detection of ovarian cancer
  • Fig. 13 Methylation differences in genes comparing OvCa cases and controls
  • Fig. 14 The discriminatory power of the methylation in genes to distinguish OvCa cases from healthy controls
  • Fig. 15 The determination of breast cancer related CpG island shore in HYAL2
  • Fig. 16 The inverse correlation between the methylation and expression of SI OOP, SLC22A18 and DYRK4 in leucocytes
  • Fig. 17 The methylation levels of HYAL2 CpG sites by Illumina 450K
  • Fig. 18 The methylation levels of S 1 OOP CpG sites by Illumina 450K
  • Fig. 19 The methylation levels of SLC22A18 CpG sites by Illumina 450K
  • Fig. 20 The methylation levels of DYRK4 CpG sites by Illumina 450K
  • Fig. 21 The methylation levels of FUT7 CpG sites by Illumina 450K
  • Fig. 22 The methylation levels of RAPSN CpG sites by Illumina 450K
  • Fig. 23 The methylation levels of RPTOR CpG sites by Illumina 450K
  • Fig. 24 The methylation levels of MGRNl CpG sites by Illumina 450K
  • Fig. 25 The inverse correlation between the methylation and expression of HYAL2 in leucocytes, (a) The box plots show the methylation levels of cg27091787 and adjacent
  • the methylation levels were measured in triplicates in the samples (DNA from whole blood and from sorted leucocytes fractions) from seven sporadic BC cases and 14 healthy controls. The methylation difference between cases and controls was calculated by t-test. The methylation levels of cg27091787 are presented by box and whisker plot. The circle indicates an outlier.
  • SEQ ID NO: 2 hsa-miR-652-5p (MIMAT0022709): caacccuaggagagggugccauuca
  • SEQ ID NO: 40 S100P (NM_005980.2)
  • SEQ ID NO: 33 sense sequence of HYAL2 primer
  • SEQ ID NO: 33 sense sequence of HYAL2-is-310 primer
  • SEQ ID NO: 33 sense sequence of HYAL2-is-325 primer
  • SEQ ID NO: 37 sense sequence RPTOR primer
  • SEQ ID NO: 39 sense sequence of SLC22A18 primer
  • SEQ ID NO: 45 sense sequence S 1 OOP primer
  • SEQ ID NO: 47 sense sequence DYRK4 primer
  • Nucleic acid molecules are understood as a polymeric or oligomeric macromolecule made from nucleotide monomers. Nucleotide monomers are composed of a nucleobase, a five-carbon sugar (such as but not limited to ribose or 2'-deoxyribose), and one to three phosphate groups. Typically, a polynucleotide is formed through phosphodiester bonds between the individual nucleotide monomers. In the context of the present invention referred to nucleic acid molecules include but are not limited to ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and mixtures thereof such as e.g. RNA-DNA hybrids.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • mixtures thereof such as e.g. RNA-DNA hybrids.
  • nucleic acids can e.g. be synthesized chemically, e.g. in accordance with the phosphotriester method (see, for example, Uhlmann, E. & Peyman, A. (1990) Chemical Reviews, 90, 543-584).
  • Aptamers are nucleic acids which bind with high affinity to a polypeptide, here mirl46- a.
  • Aptamers can be isolated by selection methods such as SELEmirl46-a (see e.g. Jayasena (1999) Clin. Chem., 45, 1628-50; Klug and Famulok (1994) M. Mol.
  • RNA molecules from a large pool of different single-stranded RNA molecules.
  • Aptamers can also be synthesized and selected in their mirror- image form, for example as the L-ribonucleotide (Nolte et al. (1996) Nat. Biotechnol., 14, 1 1 16-9; Klussmann et al. (1996) Nat. Biotechnol., 14, 1 1 12-5).
  • L-ribonucleotide Nolte et al. (1996) Nat. Biotechnol., 14, 1 1 16-9; Klussmann et al. (1996) Nat. Biotechnol., 14, 1 1 12-5).
  • Nucleic acids may be degraded by endonucleases or exonucleases, in particular by DNases and RNases which can be found in the cell. It is, therefore, advantageous to modify the nucleic acids in order to stabilize them against degradation, thereby ensuring that a high concentration of the nucleic acid is maintained in the cell over a long period of time (Beigelman et al. (1995) Nucleic Acids Res. 23:3989-94; W095/1 1910; WO98/37240; W097/29116). Typically, such a stabilization can be obtained by introducing one or more internucleotide phosphorus groups or by introducing one or more non-phosphorus internucleotides.
  • Suitable modified internucleotides are compiled in Uhlmann and Peyman (1990), supra (see also Beigelman et al. (1995) Nucleic Acids Res. 23:3989-94; W095/1 1910; WO98/37240; WO 97/291 16).
  • Modified internucleotide phosphate radicals and/or non-phosphorus bridges in a nucleic acid which can be employed in one of the uses according to the invention contain, for example, methyl phosphonate, phosphorothioate, phosphoramidate, phosphorodithioate and/or phosphate esters, whereas non-phosphorus internucleotide analogues contain, for example, siloxane bridges, carbonate bridges, carboxymethyl esters, acetamidate bridges and/or thioether bridges. It is also the intention that this modification should improve the durability of a pharmaceutical composition which can be employed in one of the uses according to the invention.
  • Nucleic acids may be selected from the group consisting of, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a glycol nucleic acid (GNA), a threose nucleic acid (TNA), a microRNA (miRNA), and a small interfering RNA (siRNA), a polynucleotide probe, a primer(s) (e.g. a primer pair), in particular a primer(s) for polymerase chain reaction (PCR), reverse transcription (RT) reaction, or DNA sequencing.
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • GNA glycol nucleic acid
  • TAA threose nucleic acid
  • miRNA microRNA
  • siRNA small interfering RNA
  • a polynucleotide probe e.g. a primer pair
  • PCR polymerase chain reaction
  • RT reverse transcription
  • nucleic acid comprises genomic DNA, cDNA, recombinant DNA, cRNA, mRNA, microRNA (miRNA) and small interfering RNA (siRNA).
  • a nucleic acid may consist of an entire gene, or a portion thereof.
  • the nucleic acid can also be an artificial nucleic acid.
  • Artificial nucleic acids include polyamide or peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule as well known to the person skilled in the art.
  • miRNA short ribonucleic acid
  • miRNA include human miRNAs, mature single stranded miRNAs, precursor miRNAs (pre -miR), and variants thereof, which may be naturally occurring.
  • miRNA also includes primary miRNA transcripts (pri-miRNAs) and duplex miRNAs. Unless otherwise noted, when used herein, the name of a specific miRNA refers to the mature miRNA.
  • MiRNA-precursor may consists of 25 to several thousand nucleotides, typically 40 to 130, 50 to 120, or 60 to 1 10 nucleotides. Typically, a mature miRNA consists of 5 to 100 nucleotides, often 10 to 50, 12 to 40, or 18 to 26 nucleotides.
  • miRNA also includes the "guide" strand which eventually enters the RNA-induced silencing complex (RISC) as well as to the "passenger” strand complementary thereto.
  • RISC RNA-induced silencing complex
  • miRNAs The sequence of several miRNAs is known in the art and readily assessable to the skilled person via well-known sequence databases, such as e.g. miRBase (http://www.mirbase.org/), (Griffiths-Jones S., NAR 2004 32(Database Issue) :D109-D1 1 1 ; Kozomara A, Griffiths-Jones S., NAR 201 1 39(Database Issue):D 152-D 157). It is understood that below indicated database accession numbers of the individual miRNAs are those of miRNAs of human origin. However these database entries also provide the database accession numbers of the respective miRNA of different origin, such as e.g.
  • mirNAs of any mammal, reptile, or bird origin such as e.g. those selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, and gorillas miRNA. It is also understood that the reference to a specific miRNA by its number (e.g. miR-652) equally refers to the -3p and -5p sequence (miR-652-3p and miR-652-5p).
  • miR-652 is deposited at miRBase ID MI0003667 which comprises hsa-miR- 652-3p (MIMAT0003322) and hsa-miR-652-5p (MIMAT0022709), which corresponds to SEQ ID NO: 1 and 2, respectively, of the present invention.
  • miR-801 was deposited at miRBase ID MI0005202: 5'- GAUUGCUCUGCGUGCGGAAUCGAC-3', however, it is now considered as a fragment of Ul l spliceosomal RNA and was thus remove from miRBase.
  • the pre-miRNA-801 is located at chrl : 28847698 - 28847793. Its sequence corresponds to SEQ ID NO: 3 of the present invention.
  • miR-376c also referred to as miR-368, is deposited at miRBase ID MI0000776, which comprises miR-376c-3p (MIMAT0000720) and hsa-miR-376c-5p (MIMAT0022861), which corresponds to SEQ ID NO: 4 and 5, respectively, of the present invention.
  • miR-376a is deposited at miRBase ID MI0000784, which comprises hsa-miR- 376a-3p (MIMAT0000729) and hsa-miR-376a-5p (MIMAT0003386), which corresponds to SEQ ID NO: 6 and 7, respectively, of the present invention.
  • miR-127 is deposited at miRBase ID MI0000472, which comprises hsa-miR- 127-3p (MIMAT0000446) and hsa-miR- 127-5p (MIMAT0004604), which corresponds to SEQ ID NO: 8 and 9, respectively, of the present invention.
  • miR-409 is deposited at miRBase ID MI0001735, which comprises hsa-miR- 409-3p (MIMAT0001639) and hsa-miR-409-5p (MIMAT0001638), which corresponds to SEQ ID NO: 10 and 1 1, respectively, of the present invention.
  • miR-148b The sequence of miR-148b is deposited at miRBase ID MI000081 1, which comprises hsa-miR-
  • the term "combination of miRNAs” relates to combinations of the miRNAs of the present invention.
  • the amount of a miRNA can be determined in a sample of a subject by techniques well known in the art. Depending on the nature of the sample, the amount may be determined by PCR based techniques for quantifying the amount of a polynucleotide or by other methods like mass spectrometry or (next generation) sequencing or one of the methods described in the examples (Cissell KA, Deo SK. Trends in microRNA detection. Anal Bioanal Chem. 2009;394(4): 1 109-1 116 or de Planell-Saguer M, Rodicio MC. Analytical aspects of microRNA in diagnostics: a review.
  • determining the amounts of at least the miRNAs of a combination of miRNAs preferably relates to determining the amount of each of the miRNAs of the combination separately in order to be able to compare the amount of each miRNA of the combination to a reference specific for said miRNA.
  • probe refers to a single-strand oligonucleotide which is typically used for the detection of target RNA and/or DNA sequences that is complementary to the sequence of the probe.
  • a probe hybridizes to single-stranded nucleic acid (DNA or RNA) whose nucleotide sequence allows for nucleotide pairing due to complementarity between the probe and the target sequence.
  • the length of a probe depends on the intended use as well as the required specificity of the probe. Typically, a probe is 20-500 (i.e.
  • probes are used in various 5 experimental set ups such as but not limited to Southern and Northern Blots, for real-time PCR and In Situ Hybridization (ISH) as well as for microarray experiments.
  • a probe may be unlabeled, directly labelled, or indirectly labelled, such as with biotin to which a streptavidin complex may later bind.
  • Said label may be a molecule detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means.
  • suitable labels include 32P, fluorescent dyes, electronic) dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and other entities which are or can be made detectable.
  • a label may be incorporated into nucleic acids at any position, e.g. at the 3' end, at the 5' end or internally.
  • probe also encompasses nucleic acids differing in the composition of their backbone such as but not limited to peptide nucleic acids (PNAs), locked nucleic acids (LNAs), glycol nucleic acids (GNAs) and threose nucleic acids (TNAs).
  • PNAs peptide nucleic acids
  • LNAs locked nucleic acids
  • GNAs glycol nucleic acids
  • TAAs threose nucleic acids
  • primer refers to a single-strand oligonucleotide which typically serves as a starting point for DNA-replicating enzymes.
  • a primer binds to or hybridises with a DNA template and typically comprises a sequence being complementary to the DNA sequence to which it is supposed to bind.
  • a primer may also comprise additional sequences e.g. sequences serving as nuclease cleavage sites (e.g. Bam HI, Hind III, etc.). The length of a primer is chosen depending on the intended use.
  • primers used for the amplification of DNA in Polymerase-Chain Reactions typically have a length of at least 10 nucleotides, preferably between 10 to 50 (i.e. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50) nucleotides, more preferably between 15 and 30 nucleotides. Shorter primers of at least 5 nucleotides are used for sequencing of DNA templates. Also encompassed in the term "primer” are "degenerate primers" which are a mixture of 5 similar, but not identical primers. A primer may be tagged or labelled with a marker molecule detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means.
  • the term "expression level" refers to the amount of gene product present in the body or a sample at a certain point of time.
  • the expression level can e.g. be measured/quantified/detected by means of the protein or mRNA expressed from the gene.
  • the expression level can for example be quantified by 0 normalizing the amount of gene product of interest present in a sample with the total amount of gene product of the same category (total protein or mRNA) in the same sample or a reference sample (e.g. a sample taken at the same time from the same individual or a part of identical size (weight, volume) of the same sample) or by identifying the amount of gene product of interest per defined sample size (weight, volume, etc.).
  • the expression level can be measured or detected by means of any method as 5 known in the art, e.g. methods for the direct detection and quantification of the gene product of interest (such as mass spectrometry) or methods for the indirect detection and measurement of the gene product of interest that usually work via binding of the gene product of interest with one or more different molecules or detection means (e.g. primer(s), probes, antibodies, protein scaffolds) specific for the gene product of interest.
  • detection means e.g. primer(s), probes, antibodies, protein scaffolds
  • the determination of the level of gene copies comprising also the determination of the absence or presence of one or more fragments (e.g. via nucleic acid probes or primers, e.g. quantitative PCR, Multiplex ligation-dependent probe amplification (MLPA) PCR) is also within the knowledge of the skilled artisan.
  • MLPA Multiplex ligation-dependent probe amplification
  • Proteins usable in the present invention can be further modified by chemical modification.
  • This means such a chemically modified polypeptide comprises other chemical groups than the 20 naturally occurring amino acids. Examples of such other chemical groups include without limitation glycosylated amino acids and phosphorylated amino acids.
  • Chemical modifications of a polypeptide may provide advantageous properties as compared to the parent polypeptide, e.g. one or more of enhanced stability, increased biological half-life, or increased water solubility.
  • Chemical modifications applicable to the variants usable in the present invention include without limitation: PEGylation, glycosylation of non- glycosylated parent polypeptides, or the modification of the glycosylation pattern present in the parent polypeptide.
  • peptide refers to a short polymer of amino acids linked by peptide bonds. It has the same chemical (peptide) bonds as proteins, but is commonly shorter in length.
  • the shortest peptide is a dipeptide, consisting of two amino acids joined by a single peptide bond. There can also be a tripeptide, tetrapeptide, pentapeptide, etc.
  • the peptide has a length of up to 8, 10, 12, 15, 18 or 20 amino acids.
  • a peptide has an amino end and a carboxyl end, unless it is a cyclic peptide.
  • polypeptide refers to a single linear chain of amino acids bonded together by peptide bonds and preferably comprises at least about 21 amino acids.
  • a polypeptide can be one chain of a protein that is composed of more than one chain or it can be the protein itself if the protein is composed of one chain.
  • the term "protein” refers to a molecule comprising one or more polypeptides that resume a secondary and tertiary structure and additionally refers to a protein that is made up of several polypeptides, i.e. several subunits, forming quaternary structures.
  • the protein has sometimes non-peptide groups attached, which can be called prosthetic groups or cofactors.
  • the primary structure of a protein or polypeptide is the sequence of amino acids in the polypeptide chain.
  • the secondary structure in a protein is the general three-dimensional form of local segments of the protein. It does not, however, describe specific atomic positions in three- dimensional space, which are considered to be tertiary structure.
  • the secondary structure is defined by patterns of hydrogen bonds between backbone amide and carboxyl groups.
  • the tertiary structure of a protein is the three-dimensional structure of the protein determined by the atomic coordinates.
  • the quaternary structure is the arrangement of multiple folded or coiled protein or polypeptide molecules molecules in a multi-subunit complex.
  • post- translational used herein refers to events that occur after the translation of a nucleotide triplet into an amino acid and the formation of a peptide bond to the proceeding amino acid in the sequence.
  • post-translational events may occur after the entire polypeptide was formed or already during the translation process on those parts of the polypeptide that have already been translated.
  • Post-translational events typically alter or modify the chemical or structural properties of the resultant polypeptide.
  • post-translational events include but are not limited to events such as glycosylation or phosphorylation of amino acids, or cleavage of the peptide chain, e.g. by an endopeptidase.
  • co-translational used herein refers to events that occur during the translation process of a nucleotide triplet into an amino acid chain. Those events typically alter or modify the chemical or structural properties of the resultant amino acid chain.
  • co-translational events include but are not limited to events that may stop the translation process entirely or interrupted the peptide bond formation resulting in two discreet translation products.
  • segment refers to any part of a macromolecule (e.g. a polypeptide, protein or polyprotein) into which this macromolecule can be divided.
  • a macromolecule may consist of one or more segments. Such segmentation may exist due to functional (e.g. having immunoreactive features or membrane attachment functions) or structural (e.g. nucleotide or amino acid sequence, or secondary or tertiary structure) properties of the macromolecule and/or the individual segment.
  • functional e.g. having immunoreactive features or membrane attachment functions
  • structural e.g. nucleotide or amino acid sequence, or secondary or tertiary structure
  • an “epitope”, also known as antigenic determinant, is the segment of a macromolecule that is recognized by the immune system, specifically by antibodies, B cells, or T cells. Such epitope is that part or segment of a macromolecule capable of binding to an antibody or antigen-binding fragment thereof.
  • binding preferably relates to a specific binding.
  • epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three- dimensional structural characteristics, as well as specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
  • domain refers to the segment of a protein or polyprotein sequence or structure (or corresponding nucleotide sequence) that can evolve, function, and/or exist independently of the rest of the protein chain.
  • a protein consists of one or several domains with each of them being three-dimensional structure that are stable and folded independently of the rest of the protein chain.
  • Such domain typically forms an independent functional unit within the protein (e.g. transmembrane-domains, immunoglobulin- like domains, or DNA-binding domains).
  • amino acid sequence of several peptides and proteins, as well as the nucleotide sequences encoding the respective peptides and proteins are well known in the art and readily assessable to the skilled person via well-known sequence databases, such as e.g. Genbank (http://www.ncbi.nlm.nih.gov/genbank/). It is understood that below indicated database accession numbers of the individual sequence are those of human origin. However these database entries also provide the database accession numbers of the respective nucleotide sequences of different origin, such as e.g. amino acid or nucleotides sequences of any mammal, reptile, or bird origin, such as e.g. those selected from the group consisting of laboratory animals (e.g.
  • HYAL2 HYAL2:
  • Genbank Acc No: NP 003764.3 (GI: 15022801), for the HYAL2 polypeptide encoded by transcript variant 1, which corresponds to SEQ ID NO: 16 of the present invention, and
  • Genbank Acc No: NP 149348.2 (GL34304377), for the HYAL2 polypeptide encoded by transcript variant 2, which corresponds to SEQ ID NO: 17 of the present invention MGRN1 :
  • Genbank Acc No: NM 004479.3 for the transcript which corresponds to SEQ ID NO:34 of the present invention
  • Genbank Acc No: NM 005980.2 for the transcript which corresponds to SEQ ID NO:40 of the present invention
  • variant is to be understood as a polynucleotide or protein which differs in comparison to the polynucleotide or protein from which it is derived by one or more changes in its length or sequence.
  • the polypeptide or polynucleotide from which a protein or nucleic acid variant is derived is also known as the parent polypeptide or polynucleotide.
  • variant comprises "fragments” or “derivatives” of the parent molecule. Typically, “fragments” are smaller in length or size than the parent molecule, whilst “derivatives” exhibit one or more differences in their sequence in comparison to the parent molecule.
  • modified molecules such as but not limited to post-translationally modified proteins (e.g. glycosylated, biotinylated, phosphorylated, ubiquitinated, palmitoylated, or proteolytically cleaved proteins) and modified nucleic acids such as methylated DNA.
  • modified molecules such as but not limited to post-translationally modified proteins (e.g. glycosylated, biotinylated, phosphorylated, ubiquitinated, palmitoylated, or proteolytically cleaved proteins) and modified nucleic acids such as methylated DNA.
  • variants such as but not limited to RNA-DNA hybrids.
  • a variant is constructed artificially, preferably by gene -technological means whilst the parent polypeptide or polynucleotide is a wild-type protein or polynucleotide.
  • variants are to be understood to be encompassed by the term "variant" as used herein.
  • variants usable in the present invention may also be derived from homologs, orthologs, or paralogs of the parent molecule or from artificially constructed variant, provided that the variant exhibits at least one biological activity of the parent molecule, i.e. is functionally active.
  • a variant usable in the present invention exhibits a total number of up to 200 (up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, or 200) changes in the amino acid or nucleotide sequence (i.e. exchanges, insertions, deletions, 5'-, 3'-, N-terminal, and/or C-terminal truncations). Amino acid exchanges may be conservative and/or non-conservative.
  • a variant usable in the present invention differs from the protein or polynucleotide from which it is derived by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid or nucleic acid exchanges.
  • a "variant" as used herein can be characterized by a certain degree of sequence identity to the parent polypeptide or parent polynucleotide from which it is derived. More precisely, a protein variant in the context of the present invention exhibits at least 80% sequence identity to its parent polypeptide.
  • a polynucleotide variant in the context of the present invention exhibits at least 80% sequence identity to its parent polynucleotide.
  • the sequence identity of protein variants is over a continuous stretch of 20, 30, 40, 45, 50, 60, 70, 80, 90, 100 or more amino acids.
  • the sequence identity of polynucleotide variants is over a continuous stretch of 60, 90, 120, 135, 150, 180, 210, 240, 270, 300 or more nucleotides.
  • sequence identity is used throughout the specification with regard to polypeptide and polynucleotide sequence comparisons. This expression preferably refers to a sequence identity of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to the respective reference polypeptide or to the respective reference polynucleotide.
  • the polypeptide in question and the reference polypeptide exhibit the indicated sequence identity over a continuous stretch of 20, 30, 40, 45, 50, 60, 70, 80, 90, 100 or more amino acids or over the entire length of the reference polypeptide.
  • the polynucleotide in question and the reference polynucleotide exhibit the indicated sequence identity over a continuous stretch of 60, 90, 120, 135, 150, 180, 210, 240, 270, 300 or more nucleotides or over the entire length of the reference polypeptide.
  • a fragment may be naturally occurring (e.g. splice variants) or it may be constructed artificially, preferably by gene- technological means.
  • a fragment (or deletion variant) has a deletion of up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids or nucleic acids as compared to the parent polypeptide.
  • sequence identity is to be calculated with reference to the longer of the two sequences to be compared, if not specifically indicated otherwise. If the reference sequence is indicated, the sequence identity is determined on the basis of the full length of the reference sequence indicated by SEQ ID, if not specifically indicated otherwise.
  • sequence alignments can be carried out with several art-known algorithms, preferably with the mathematical algorithm of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877), with hmmalign (HMMER package, http://hmmer.wustl.edu/) or with the CLUSTAL algorithm (Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-80) available e.g.
  • sequence identity may be calculated using e.g.
  • BLAST, BLAT or BlastZ (or BlastX).
  • BLASTN and BLASTP programs Altschul et al. (1990) J. Mol. Biol. 215: 403-410.
  • Hybridization can also be used as a measure of sequence identity or homology between two nucleic acid sequences.
  • a nucleic acid sequence encoding F, N, or M2- 1, or a portion of any of these can be used as a hybridization probe according to standard hybridization techniques.
  • the hybridization of an F, N, or M2- 1 probe to DNA or RNA from a test source is an indication of the presence of the F DNA or RNA, N DNA or RNA, or M2- 1 DNA or RNA, respectively, in the test source.
  • Hybridization conditions are known to those skilled in the art and can be found, for example, in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y., 6.3.1-6.3.6, 1991.
  • Mode hybridization conditions are defined as equivalent to hybridization in 2X sodium chloride/sodium citrate (SSC) at 30°C, followed by a wash in IX SSC, 0.1% SDS at 50°C.
  • Highly stringent conditions are defined as equivalent to hybridization in 6X sodium chloride/sodium citrate (SSC) at 45°C, followed by a wash in 0.2 X SSC, 0.1 % SDS at 65°C.
  • Semi-conservative and especially conservative amino acid substitutions wherein an amino acid is substituted with a chemically related amino acid are preferred.
  • Typical substitutions are among the aliphatic amino acids, among the amino acids having aliphatic hydroxyl side chain, among the amino acids having acidic residues, among the amide derivatives, among the amino acids with basic residues, or the amino acids having aromatic residues.
  • Typical semi-conservative and conservative substitutions are: Amino acid Conservative substitution Semi-conservative substitution
  • tissue refers to an ensemble of cells of the same origin which fulfil a specific function concertedly.
  • tissue include but are not limited to connective tissue, muscle tissue, nervous tissue, and epithelial tissue. Multiple tissues together form an "organ” to carry out a specific function.
  • organ include but are not limited to glands, muscle, blood, brain, heart, liver, kidney, stomach, skeleton, joint, and skin.
  • disease and “disorder” are used interchangeably herein, referring to an abnormal condition, especially an abnormal medical condition such as an illness or injury, wherein a tissue, an organ or an individual is not able to efficiently fulfil its function anymore.
  • a disease is associated with specific symptoms or signs indicating the presence of such disease. The presence of such symptoms or signs may thus, be indicative for a tissue, an organ or an individual suffering from a disease. An alteration of these symptoms or signs may be indicative for the progression of such a disease.
  • a progression of a disease is typically characterised by an increase or decrease of such symptoms or signs which may indicate a "worsening" or “bettering” of the disease.
  • the "worsening" of a disease is characterised by a decreasing ability of a tissue, organ or organism to fulfil its function efficiently, whereas the “bettering" of a disease is typically characterised by an increase in the ability of a tissue, an organ or an individual to fulfil its function efficiently.
  • a tissue, an organ or an individual being at "risk of developing" a disease is in a healthy state but shows potential of a disease emerging.
  • the risk of developing a disease is associated with early or weak signs or symptoms of such disease. In such case, the onset of the disease may still be prevented by treatment.
  • Examples of a disease include but are not limited to traumatic diseases, inflammatory diseases, infectious diseases, cutaneous conditions, endocrine diseases, intestinal diseases, neurological disorders, joint diseases, genetic disorders, autoimmune diseases, and various types of cancer.
  • Cancer refers to a proliferative disorder involving abnormal cell growth which may invade or spread to other tissues or organs of a subject. Cancers are classified by the type of cell that the tumor cells resemble and is therefore presumed to be the origin of the tumor. These types include but are not limited to carcinoma (cancers derived from epithelial cells) sarcoma (cancers arising from connective tissue such as e.g.
  • lymphoma and leukemia cancer arising from hematopoietic cells that leave the marrow and tend to mature in the lymph nodes and blood
  • germ cell tumor cancers derived from pluripotent cells
  • blastoma cancers derived from immature "precursor" cells or embryonic tissue.
  • cancer includes but is not limited to acute lymphoblastic leukemia (ALL), acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, childhood cerebellar or cerebral cancer, basal-cell carcinoma, bile duct cancer, extrahepatic, bladder cancer, bone tumor, osteosarcoma/malignant fibrous histiocytoma, brainstem glioma, brain cancer, brain tumor (cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma), breast cancer, bronchial adenomas/carcinoids, Burkitt's lymphoma, carcinoid tumor, central nervous system lymphoma, cerebellar a
  • breast tumor relates to an abnormal hyperproliferation of breast tissue cells in a subject, which may be a benign (non-cancerous) tumor or a malign (cancerous) tumor.
  • Benign breast tumors preferably, include fibroadenomas, granular cell tumors, intraductal papillomas, and phyllodes tumors.
  • a malign tumor is a breast cancer (BC) as specified herein above.
  • the term "metastatic breast cancer” relates to a breast cancer wherein cancer cells grow as a metastasis at least one secondary site, i.e. a non-adjacent organ or part of the body of a subject.
  • ovary tumor relates to an abnormal hyperproliferation of ovary tissue cells in a subject, which may be a benign (non-cancerous) tumor or a malign (cancerous) tumor.
  • a malign tumor is an ovary cancer (OvaCa) as specified herein above.
  • pancreatic tumor relates to an abnormal hyperproliferation of ovary tissue cells in a subject, which may be a benign (non-cancerous) tumor or a malign (cancerous) tumor.
  • a malign tumor is a pancreatic cancer (PaCa) as specified herein above.
  • CTC circulating tumor cell
  • CTC status relates to the presence or absence of more than a reference amount of CTC in a sample.
  • the reference amount of CTC is 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, or 7.5 CTC / 7.5 ml blood, 5 CTC / 7.5 ml blood being more preferred.
  • the CTC status is unfavorable, indicating a low probability of successful treatment and a low progression-free and overall survival probability. Conversely, in subjects where a blood sample comprises less than said reference amount of CTC, the CTC status is favorable, indicating a high probability of successful treatment and a high progression-free and overall survival probability.
  • the amounts of the miR As used for determining the CTC status of a subject as defined herein below are indicative of the CTC status of a subject.
  • determining the CTC status in a subject as used herein relates to determining the amount or amounts of said miRNA or miRNAs and thus obtaining an indication of the subject's CTC status.
  • the status can be diagnosed to be "favorable” or "unfavorable”
  • Symptoms of a disease are implication of the disease noticeable by the tissue, organ or organism having such disease and include but are not limited to pain, weakness, tenderness, strain, stiffness, and spasm of the tissue, an organ or an individual.
  • “Signs” or “signals” of a disease include but are not limited to the change or alteration such as the presence, absence, increase or elevation, decrease or decline, of specific indicators such as biomarkers or molecular markers, or the development, presence, or worsening of symptoms.
  • indicator and “marker” are used interchangeably herein, and refer to a sign or signal for a condition or is used to monitor a condition.
  • a condition refers to the biological status of a cell, tissue or organ or to the health and/or disease status of an individual.
  • An indicator may be the presence or absence of a molecule, including but not limited to peptide, protein, and nucleic acid, or may be a change in the expression level or pattern of such molecule in a cell, or tissue, organ or individual.
  • An indicator may be a sign for the onset, development or presence of a disease in an individual or for the further progression of such disease.
  • An indicator may also be a sign for the risk of developing a disease in an individual.
  • the term "gene product” relates to a, preferably macromolecular, physical entity, the presence of which in a cell depends on the expression of said gene in said cell.
  • the mechanisms of gene expression are well-known to the one skilled in the art to include the basic mechanisms of transcription, i.e. formation of R A corresponding to the said gene or parts thereof, and translation, i.e. production of polypeptide molecules having an amino acid sequence encoded by said RNA according to the genetic code; it is well-known to the one skilled in the art that other cellular processes may be involved in gene expression as well, e.g. RNA processing, RNA editing, proteolytic processing, protein editing, and the like.
  • gene product thus includes RNA, preferably mRNA, as well as polypeptides expressed from said gene. It is clear from the above that the term gene product also includes fragments of said RNA(s), preferably with a length of at least ten, at least twelve, at least 20, at least 50, or at least 100 nucleotides, and fragments (peptides) from said polypeptides, preferably with a length of at least eight, at least ten, at least twelve, at least 15, at least 20 amino acids.
  • Determining the amount of a gene product relates to measuring the amount of said gene product, preferably semi-quantitatively or quantitatively. Measuring can be done directly or indirectly. Preferably, measuring is performed on a processed sample, said processing comprising extraction of polynucleotides or polypeptides from the sample. It is, however, also envisaged by the present invention that the gene product is determined in situ, e.g. by immune-histochemistry (IHC)
  • the amount of the polynucleotides of the present invention can be determined with several methods well-known in the art.
  • Quantification preferably is absolute, i.e. relating to a specific number of polynucleotides or, more preferably, relative, i.e. measured in arbitrary normalized units.
  • a normalization is carried out by calculating the ratio of a number of specific polynucleotides and total number of polynucleotides or a reference amplification product.
  • Methods allowing for absolute or relative quantification are well known in the art.
  • quantitative PCR methods are methods for relative quantification; if a calibration curve is incorporated in such an assay, the relative quantification can be used to obtain an absolute quantification.
  • the polynucleotide amounts are normalized polynucleotide amounts, i.e. the polynucleotide amounts obtained are set into relation to at least one reference amplification product, thereby, preferably, setting the polynucleotide amounts into relation to the number of cells in the sample and/or the efficiency of polynucleotide amplification.
  • the reference amplification product is a product obtained from a polynucleotide known to have a constant abundancy in each cell, i.e. a polynucleotide comprised in most, preferably all, cells of a sample in approximately the same amount. More preferably, the reference amplification product is amplified from a chromosomal or mitochondrial gene or from the mRNA of a housekeeping gene.
  • the amout of polynucleotides could be determined by Shotgun sequencing, Bridge PCR, Sanger sequencing, pyrosequencing, next-generation sequecing, Single-molecule real-time sequencing, Ion Torrent sequencing, Sequencing by synthesis, Sequencing by ligation, Massively parallel signature sequencing, Polony sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, Single molecule real time (SMRT) sequencing, Nanopore DNA sequencing, Tunnelling currents DNA sequencing, Sequencing by hybridization, Sequencing with mass spectrometry, Microfluidic Sanger sequencing, Transmission electron microscopy DNA sequencing, RNA polymerase sequencing, In vitro virus high- throughput sequencing, Chromatin Isolation by RNA Purification (ChlRP-Seq), Global Run-on Sequencing (GRO-Seq), Ribosome Profiling Sequencing (Ribo-Seq)/ARTseq, RNA Immunoprecipitation Sequencing (RIP-Seq), High- Throughput Sequencing of
  • the amount of peptides or polypeptides of the present invention can be determined in various ways.
  • Direct measuring relates to measuring the amount of the peptide or polypeptide based on a signal which is obtained from the peptide or polypeptide itself and the intensity of which directly correlates with the number of molecules of the peptide present in the sample.
  • a signal sometimes referred to as intensity signal -may be obtained, e.g., by measuring an intensity value of a specific physical or chemical property of the peptide or polypeptide.
  • Indirect measuring includes measuring of a signal obtained from a secondary component (i.e. a component not being the peptide or polypeptide itself) or a biological read out system, e.g., measurable cellular responses, ligands, labels, or enzymatic reaction products.
  • Determining the amount of a peptide or polypeptide can be achieved by all known means for determining the amount of a peptide in a sample.
  • Said means comprise immunoassay and / or immunohistochemistry devices and methods which may utilize labeled molecules in various sandwich, competition, or other assay formats.
  • Said assays will develop a signal which is indicative for the presence or absence of the peptide or polypeptide.
  • the signal strength can, preferably, be correlated directly or indirectly (e.g. reverse- proportional) to the amount of polypeptide present in a sample.
  • Further suitable methods comprise measuring a physical or chemical property specific for the peptide or polypeptide such as its precise molecular mass or NMR spectrum.
  • Said methods comprise, preferably, biosensors, optical devices coupled to immunoassays, biochips, analytical devices such as mass- spectrometers, NMR- analyzers, or chromatography devices. Further, methods include micro-plate ELISA-based methods, fully-automated or robotic immunoassays, Cobalt Binding Assays, and latex agglutination assays.
  • Determining the amount of a peptide or polypeptide comprises the step of measuring a specific intensity signal obtainable from the peptide or polypeptide in the sample.
  • a specific intensity signal may be the signal intensity observed at an m/z variable specific for the peptide or polypeptide observed in mass spectra or a NMR spectrum specific for the peptide or polypeptide.
  • Determining the amount of a peptide or polypeptide may, preferably, comprise the steps of (a) contacting the peptide with a specific ligand, (b) (optionally) removing non-bound ligand, (c) measuring the amount of bound ligand.
  • the bound ligand will generate an intensity signal.
  • Binding according to the present invention includes both covalent and non-covalent binding.
  • a ligand according to the present invention can be any compound, e.g., a peptide, polypeptide, nucleic acid, or small molecule, binding to the peptide or polypeptide described herein.
  • Preferred ligands include antibodies, nucleic acids, peptides or polypeptides such as receptors or binding partners for the peptide or polypeptide and fragments thereof comprising the binding domains for the peptides, and aptamers, e.g. nucleic acid or peptide aptamers.
  • Methods to prepare such ligands are well-known in the art. For example, identification and production of suitable antibodies or aptamers is also offered by commercial suppliers. The person skilled in the art is familiar with methods to develop derivatives of such ligands with higher affinity or specificity. For example, random mutations can be introduced into the nucleic acids, peptides or polypeptides.
  • antibody refers to secreted immunoglobulins which lack the transmembrane region and can thus, be released into the bloodstream and body cavities.
  • Antibodies are typically made of four polypeptide chains comprising two identical heavy chains and identical two light chains which are connected via disulfide bonds and resemble a "Y"-shaped macro-molecule. Papain digestion of antibodies produces two identical antigen binding fragments, called “Fab fragments” (also referred to as “Fab portion” or “Fab region”) each with a single antigen binding site, and a residual “Fc fragment” (also referred to as "Fc portion” or “Fc region”) whose name reflects its ability to crystallize readily.
  • the crystal structure of the human IgG Fc region has been determined (Deisenhofer (1981) Biochemistry 20:2361-2370).
  • the Fc region is composed of two identical protein fragments, derived from the CH2 and CH3 domains of the antibody's two heavy chains; in IgM and IgE isotypes, the Fc regions contain three heavy chain constant domains (CH2 - 4) in each polypeptide chain.
  • CH2 - 4 heavy chain constant domains
  • Fab' fragment refers to a Fab fragment additionally comprising the hinge region of an Ig molecule whilst “F(a')2 fragments” are understood to comprise two Fab ' fragments being either chemically linked or connected via a disulfide bond.
  • sdAb single domain antibodies
  • scFv single chain Fv
  • Divalent single-chain variable fragments can be engineered by linking two scFvs (scFvA-scFvB). This can be done by producing a single peptide chain with two VH and two VL regions, yielding "tandem scFvs" (VHA-VLA-VHB-VLB).
  • Another possibility is the creation of scFvs with linkers that are too short for the two variable regions to fold together, forcing scFvs to dimerize. Usually linkers with a length of 5 residues are used to generate these dimers. This type is known as "diabodies”.
  • Bispecific diabodies are formed by expressing to chains with the arrangement VHA-VLB and VHB- VLA or VLA-VHB and VLB-VHA, respectively.
  • Single-chain diabodies (scDb) comprise a VHA-VLB and a VHB-VLA fragment which are linked by a linker peptide (P) of 12-20 amino acids, preferably 14 amino acids, (VHA-VLB-P-VHB-VLA).
  • Bi-specific T-cell engagers are fusion proteins consisting of two scFvs of different antibodies wherein one of the scFvs binds to T cells via the CD3 receptor, and the other to a tumor cell via a tumor specific molecule (Kufer et al. (2004) Trends Biotechnol. 22:238-244).
  • Dual affinity retargeting molecules (“DART” molecules) are diabodies additionally stabilized through a C-terminal disulfide bridge.
  • the present invention also includes single chain antibodies and humanized hybrid antibodies wherein amino acid sequences of a non-human donor antibody exhibiting a desired antigen-specificity are combined with sequences of a human acceptor antibody.
  • the donor sequences will usually include at least the antigen-binding amino acid residues of the donor but may comprise other structurally and/or functionally relevant amino acid residues of the donor antibody as well.
  • Such hybrids can be prepared by several methods well known in the art.
  • the ligand or agent binds specifically to the peptide or polypeptide.
  • Specific binding according to the present invention means that the ligand or agent should not bind substantially to ("cross-react" with) another peptide, polypeptide or substance present in the sample to be analyzed.
  • the specifically bound peptide or polypeptide should be bound with at least 3 times higher, more preferably at least 10 times higher and even more preferably at least 50 times higher affinity than any other relevant peptide or polypeptide.
  • Nonspecific binding may be tolerable, if it can still be distinguished and measured unequivocally, e.g. according to its size on a Western Blot, or by its relatively higher abundance in the sample.
  • Binding of the ligand can be measured by any method known in the art. Preferably, said method is semi-quantitative or quantitative. Suitable methods are described in the following.
  • binding of a ligand may be measured directly, e.g. by NMR or surface plasmon resonance.
  • an enzymatic reaction product may be measured (e.g. the amount of a protease can be measured by measuring the amount of cleaved substrate, e.g. on a Western Blot).
  • the ligand may exhibit enzymatic properties itself and the "ligand/peptide or polypeptide" complex or the ligand which was bound by the peptide or polypeptide, respectively, may be contacted with a suitable substrate allowing detection by the generation of an intensity signal.
  • the amount of substrate is saturating.
  • the substrate may also be labeled with a detectable label prior to the reaction.
  • the sample is contacted with the substrate for an adequate period of time.
  • An adequate period of time refers to the time necessary for a detectable, preferably measurable, amount of product to be produced. Instead of measuring the amount of product, the time necessary for appearance of a given (e.g. detectable) amount of product can be measured.
  • the ligand may be coupled covalently or non-covalently to a label allowing detection and measurement of the ligand. Labelling may be done by direct or indirect methods. Direct labelling involves coupling of the label directly (covalently or non-covalently) to the ligand.
  • Indirect labelling involves binding (covalently or non-covalently) of a secondary ligand to the first ligand.
  • the secondary ligand should specifically bind to the first ligand.
  • Said secondary ligand may be coupled with a suitable label and/or be the target (receptor) of tertiary ligand binding to the secondary ligand.
  • the use of secondary, tertiary or even higher order ligands is often used to increase the signal intensity.
  • Suitable secondary and higher order ligands may include antibodies, secondary antibodies, and the well-known streptavidin-biotin system (Vector Laboratories, Inc.).
  • the ligand or substrate may also be "tagged" with one or more tags as known in the art.
  • tags may then be targets for higher order ligands.
  • Suitable tags include biotin, digoxygenin, His-Tag, Glutathion-S-Transferase, FLAG, GFP, myc-tag, influenza A virus haemagglutinin (HA), maltose binding protein, and the like.
  • the tag is preferably at the N-terminus and/or C-terminus.
  • Suitable labels are any labels detectable by an appropriate detection method. Typical labels include gold particles, latex beads, acridan ester, luminol, ruthenium, enzymatically active labels, radioactive labels, magnetic labels ("e.g.
  • Enzymatically active labels include e.g. horseradish peroxidase, alkaline phosphatase, beta-Galactosidase, Luciferase, and derivatives thereof.
  • Suitable substrates for detection include di-amino-benzidine (DAB), 3,3'-5,5'- tetramethylbenzidine, NBT-BCIP (4-nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl- phosphate), CDP-StarTM (Amersham Biosciences), ECFTM (Amersham Biosciences).
  • a suitable enzyme-substrate combination may result in a colored reaction product, fluorescence or chemo luminescence, which can be measured according to methods known in the art (e.g. using a light-sensitive film or a suitable camera system).
  • fluorescent labels include fluorescent proteins (such as GFP and its derivatives), Cy3, Cy5, Texas Red, Fluorescein, and the Alexa dyes (e.g. Alexa 568). Further fluorescent labels are available e.g. from Molecular Probes (Oregon). Also the use of quantum dots as fluorescent labels is contemplated.
  • Typical radioactive labels include 35S, 1251, 32P, 33P and the like.
  • a radioactive label can be detected by any method known and appropriate, e.g. a light-sensitive film or a phosphor imager.
  • Suitable measurement methods according the present invention also include precipitation (particularly immunoprecipitation), electrochemilummescence (electro-generated chemiluminescence), RIA (radioimmunoassay), ELISA (enzyme- linked immunosorbent assay), sandwich enzyme immune tests, electrochemilummescence sandwich immunoassays (ECLIA), dissociation-enhanced lanthanide fluoro immuno assay (DELFIA), scintillation proximity assay (SPA), turbidimetry, nephelometry, latex- enhanced turbidimetry or nephelometry, or solid phase immune tests, like e.g.
  • reverse phase protein arrays or antibody arrays can be reverse phase protein arrays or antibody arrays.
  • Further methods known in the art such as gel electrophoresis, 2D gel electrophoresis, SDS polyacrylamid gel electrophoresis (SDS-PAGE), Western Blotting, and mass spectrometry, can be used alone or in combination with labelling or other detection methods as described above.
  • the amount of a peptide or polypeptide may also be determined as follows: (a) contacting a solid support comprising a ligand for the peptide or polypeptide as specified above with a sample comprising the peptide or polypeptide and (b) measuring the amount peptide or polypeptide which is bound to the support.
  • the ligand preferably chosen from the group consisting of nucleic acids, peptides, polypeptides, antibodies and aptamers, is preferably present on a solid support in immobilized form.
  • Materials for manufacturing solid supports include, inter alia, commercially available column materials, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, membranes, sheets, duracytes, wells and walls of reaction trays, plastic tubes etc.
  • the ligand or agent may be bound to many different carriers. Examples of well-known carriers include glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite.
  • the nature of the carrier can be either soluble or insoluble for the purposes of the invention.
  • Suitable methods for fixing/immobilizing said ligand are well known and include, but are not limited to ionic, hydrophobic, covalent interactions and the like. It is also contemplated to use "suspension arrays" as arrays according to the present invention (Nolan 2002, Trends Biotechnol. 20(1):9-12).
  • the carrier e.g. a microbead or microsphere
  • the array consists of different microbeads or microspheres, possibly labeled, carrying different ligands.
  • Methods of producing such arrays for example based on solid-phase chemistry and photo-labile protective groups, are generally known (US 5,744,305).
  • CpG site relates to a dinucleotide sequence 5'-CG-3' comprised in a polynucleotide, preferably comprised in DNA, more preferably comprised in genomic DNA of a subject.
  • the CpG sites to be analyzed according to the present invention are the CpG sites located in the intron, exon or promoter region of a gene of interest. In case the CpG sites are located in the promoter region, said region is preferably 3000 nucleotides, 2500 nucleotides, 2100 nucleotides, or 1750 nucleotides upstream of the translation start site of the respective gene of interest.
  • the CpG sites to be analyzed according to the present invention are the CpG sites located in the region 1750-3000 nucleotides, 2100-3000 nucleotides, or 2500-3000 nucleotides upstream of the translation start site of the gene of interest gene.
  • analysis of a CpG site corresponding to a CpG site of the present invention is also encompassed by the present invention.
  • the skilled person knows how to determine the CpG sites in a sample corresponding to the CpG sites detailed herein above, e.g. by determining the translation start site of the gene of interest and / or by aligning said sequence from a sample to the sequence of the gene of interest. Further, it is also envisaged by the present invention that the methylation status of other CpG sites is determined in addition to determining the methylation status of a CpG site of the present invention.
  • determining the methylation status relates to determining if a methyl group is present at the 5 position of the pyrimidine ring of a cytosine in a polynucleotide.
  • the cytosine residue is followed in 3' direction by a guanosine residue, the two residues forming a CpG site.
  • methylation-specific PCR MSP
  • BS-Seq whole genome bisulfite sequencing or other sequencing based methods
  • PBAT Post-Bisulfite Adapter Tagging
  • T-WGBS Tagmentation-Based Whole Genome Bisulfite Sequencing
  • Oxidative Bisulfite Sequencing oxBS-Seq
  • Tet- Assisted Bisulfite Sequencing TAB-Seq
  • Methylated DNA Immunoprecipitation Sequencing Methylation-Capture (MethylCap) Sequencing, Methyl-Binding-Domain - Capture (MBDCap) Sequencing, Reduced-Representation Bisulfite Sequencing (RRBS-Seq)
  • real-time PCR based methods of bisulfite treated DNA e.g.
  • Methylight restriction with a methylation- sensitive restriction enzyme, e.g. in the Hpall tiny fragment enrichment by ligation-mediated PCR (HELP)-Assay, pyrosequencing of bisulfite treated DNA, or the like AIMS, amplification of inter-methylated sites; BC-seq, bisulphite conversion followed by capture and sequencing; BiMP, bisulphite methylation profiling; BS, bisulphite sequencing; BSPP, bisulphite padlock probes; CHARM, comprehensive high-throughput arrays for relative methylation; COBRA, combined bisulphite restriction analysis; DMH, differential methylation hybridization; HELP, Hpall tiny fragment enrichment by ligation-mediated PCR; MCA, methylated CpG island amplification; MCAM, MCA with microarray hybridization; MeDIP, mDIP and mCIP, methylated DNA immunoprecipitation; MIRA, methylated CpG island recovery assay; MMASS
  • the methylation status is determined by the methods described in the examples herein below, e.g. the sequencing-based Infinium 27K methylation assay or the mass spectrometry based method of MALDI-TOF mass spectrometry.
  • the methylation status of a specific cytosine residue in a specific polynucleotide molecule can only be "unmethylated” (meaning 0% methylation) or "methylated” (meaning 100% methylation).
  • the methylation status can be "unmethylated” (meaning 0% methylation, i.e. none of the two cytosine residues methylated), "hemimethylated” (meaning 50% methylation, i.e. one of the two cystosine residues methylated), or "methylated” or "fully methylated” (meaning 100% methylation, i.e.
  • an average methylation status is determined, which can e.g, preferably, be expressed as a percentage (% methylation), and which can assume any value between 0% and 100%. It is also understood by the skilled person, that the methylation status can be expressed as a percentage in case the average methylation of different cell populations is determined.
  • the blood cells according to the present invention are a mixture of variant cell types. It is possible that certain cell types have high methylation levels whereas other cell types have lower methylation levels, and finally reach an average methylation of e.g. 50 %.
  • the term "detection agent” relates to an agent specifically interacting with, and thus recognizing, the expression level of a gene of interest, the methylation status of a gene of interest, or the presence or amount of a miRNA of the present invention.
  • said detection agent is a protein, polypeptide, peptide, polynucleotide or an oligonucleotide.
  • the detection agent is labeled in a way allowing detection of said detection agent by appropriate measures. Labeling can be done by various techniques well known in the art and depending of the label to be used. Preferred labels to be used are fluorescent labels comprising, inter alia, fluorochromes such as fluorescein, rhodamin, or Texas Red.
  • the label may also be an enzyme or an antibody. It is envisaged that an enzyme to be used as a label will generate a detectable signal by reacting with a substrate. Suitable enzymes, substrates and techniques are well known in the art.
  • An detection agent to be used as label may specifically recognize a target molecule which can be detected directly (e.g., a target molecule which is itself fluorescent) or indirectly (e.g., a target molecule which generates a detectable signal, such as an enzyme).
  • the labeled detection agents of the sample will be contacted to the sample to allow specific interaction. Washing may be required to remove non-specifically bound detection agent which otherwise would yield false values. After this interaction step is complete, a researcher will place the detection device into a reader device or scanner.
  • a device for detecting fluorescent labels preferably, consists of some lasers, preferably a special microscope, and a camera.
  • the fluorescent labels will be excited by the laser, and the microscope and camera work together to create a digital image of the sample.
  • These data may be then stored in a computer, and a special program will be used, e.g., to subtract out background data.
  • the resulting data are, preferably, normalized, and may be converted into a numeric and common unit format.
  • the data will be analyzed to compare samples to references and to identify significant changes.
  • Comparing encompasses comparing the presence, absence or amount of an indicator referred to herein which is comprised by the sample to be analyzed with the presence, absence or amount of said indicator in a suitable reference sample. It is to be understood that comparing as used herein refers to a comparison of corresponding parameters or values, e.g., an absolute amount of the indicator as referred to herein is compared to an absolute reference amount of said indicator; a concentration of the indicator is compared to a reference concentration of said indicator; an intensity signal obtained from the indicator as referred to herein in a sample is compared to the same type of intensity signal of said indicator in a reference sample. The comparison referred to may be carried out manually or computer assisted.
  • the value of the determined amount may be compared to values corresponding to suitable references which are stored in a database by a computer program.
  • the computer program may further evaluate the result of the comparison by means of an expert system. Accordingly, the result of the identification referred to herein may be automatically provided in a suitable output format.
  • sample or “sample of interest” are used interchangeably herein, referring to a part or piece of a tissue, organ or individual, typically being smaller than such tissue, organ or individual, intended to represent the whole of the tissue, organ or individual.
  • a sample provides information about the tissue status or the health or diseased status of an organ or individual.
  • samples include but are not limited to fluid samples such as blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate, or tissue samples such as e.g. tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • tissue samples such as e.g. tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • Samples can be obtained by well known techniques and include, preferably, scrapes, swabs or biopsies from the digestive tract, liver, pancreas, anal canal, the oral cavity, the upper aerodigestive tract and the epidermis. Such samples can be obtained by use of brushes, (cotton) swabs, spatula, rinse/wash fluids, punch biopsy devices, puncture of cavities with needles or surgical instrumentation. Tissue or organ samples may be obtained from any tissue or organ by, e.g., biopsy or other surgical procedures. More preferably, samples are samples of body fluids, e.g., preferably, blood, plasma, serum, urine, saliva, lacrimal fluid, and fluids obtainable from the breast glands, e.g. milk.
  • body fluids e.g., preferably, blood, plasma, serum, urine, saliva, lacrimal fluid, and fluids obtainable from the breast glands, e.g. milk.
  • the sample of a body fluid comprises cells of the subject.
  • Separated cells may be obtained from the body fluids or the tissues or organs by separating techniques such as filtration, centrifugation or cell sorting.
  • samples are obtained from those body fluids described herein below. More preferably, cells are isolated from said body fluids as described herein below.
  • Analysis of a sample may be accomplished on a visual or chemical basis.
  • Visual analysis includes but is not limited to microscopic imaging or radiographic scanning of a tissue, organ or individual allowing for morphological evaluation of a sample.
  • Chemical analysis includes but is not limited to the detection of the presence or absence of specific indicators or alterations in their amount or level.
  • reference sample refers to a sample which is analysed in a substantially identical manner as the sample of interest and whose information is compared to that of the sample of interest.
  • a reference sample thereby provides a standard allowing for the evaluation of the information obtained from the sample of interest.
  • a reference sample may be derived from a healthy or normal tissue, organ or individual, thereby providing a standard of a healthy status of a tissue, organ or individual. Differences between the status of the normal reference sample and the status of the sample of interest may be indicative of the risk of disease development or the presence or further progression of such disease or disorder.
  • a reference sample may be derived from an abnormal or diseased tissue, organ or individual thereby providing a standard of a diseased status of a tissue, organ or individual.
  • Differences between the status of the abnormal reference sample and the status of the sample of interest may be indicative of a lowered risk of disease development or the absence or bettering of such disease or disorder.
  • a reference sample may also be derived from the same tissue, organ, or individual as the sample of interest but has been taken at an earlier time point. Differences between the status of the earlier taken reference sample and the status of the sample of interest may be indicative of the progression of the disease, i.e. a bettering or worsening of the disease over time.
  • a reference sample was taken at an earlier or later time point in case a period of time has lapsed between taking of the reference sample and taking of the sample of interest. Such period of time may represent years (e.g.
  • a reference sample may be "treated differently” or “exposed differently” than a sample of interest in case both samples are treated in a substantially identical way except from a single factor.
  • single factors include but are not limited to the time of exposure, the concentration of exposure, or the temperature of exposure to a certain substance.
  • a sample of interest may be exposed to a different dosage of a certain substance than the reference sample or may be exposed for a different time interval than the reference sample or may be exposed at a different temperature than the reference sample.
  • Different dosages to which a sample of interest may be exposed to include but are not limited to the 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold and/or 1000-fold increased or decreased dosage of the dosage the reference sample is exposed to.
  • Different exposure times to which a sample of interest may be exposed to include but are not limited to the 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold and/or 1000-fold longer or shorter time period than the exposure of the reference.
  • Different temperatures of exposure to which a sample of interest may be exposed to include but are not limited to the 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold and/or 1000-fold increased or decreased temperature than the exposure of the reference.
  • a sample of interest may be exposed to a 10-fold increased concentration of a substance than the reference sample.
  • the analysis of both samples is then conducted in a substantially identical manner allowing determining the effects, i.e. a beneficial or an adverse effect, of the increased concentration of such substance on the sample of interest.
  • this example applies mutatis mutandis to different ranges of concentrations, different exposure times, and/or different temperatures at exposure.
  • lowered or decreased level of an indicator refer to the level of such indicator in the sample being reduced in comparison to the reference or reference sample.
  • elevated or increased level of an indicator refer to the level of such indicator in the sample being higher in comparison to the reference or reference sample.
  • Reference amounts can, in principle, be calculated for a group or cohort of subjects as specified herein based on the average or median values for a given miRNA by applying standard methods of statistics.
  • accuracy of a test such as a method aiming to diagnose an event, or not, is best described by its receiver-operating characteristics (ROC) (see especially Zweig 1993, Clin. Chem. 39:561-577).
  • ROC receiver-operating characteristics
  • the ROC graph is a plot of all of the sensitivity versus specificity pairs resulting from continuously varying the decision threshold over the entire range of data observed.
  • the clinical performance of a diagnostic method depends on its accuracy, i.e. its ability to correctly allocate subjects to a certain prognosis or diagnosis.
  • the ROC plot indicates the overlap between the two distributions by plotting the sensitivity versus 1 -specificity for the complete range of thresholds suitable for making a distinction.
  • sensitivity or the true-positive fraction, which is defined as the ratio of number of true-positive test results to the sum of number of true -positive and number of false-negative test results. This has also been referred to as positivity in the presence of a disease or condition. It is calculated solely from the affected subgroup.
  • the false-positive fraction, or 1 -specificity which is defined as the ratio of number of false-positive results to the sum of number of true-negative and number of false-positive results. It is an index of specificity and is calculated entirely from the unaffected subgroup.
  • the ROC plot is independent of the prevalence of the event in the cohort.
  • Each point on the ROC plot represents a sensitivity/-specificity pair corresponding to a particular decision threshold.
  • a test with perfect discrimination has an ROC plot that passes through the upper left corner, where the true -positive fraction is 1.0, or 100% (perfect sensitivity), and the false-positive fraction is 0 (perfect specificity).
  • the theoretical plot for a test with no discrimination is a 45° diagonal line from the lower left corner to the upper right corner. Most plots fall in between these two extremes.
  • a threshold can be derived from the ROC curve allowing for the diagnosis or prediction for a given event with a proper balance of sensitivity and specificity, respectively. Accordingly, the reference to be used for the methods of the present invention can be generated, preferably, by establishing a ROC for said cohort as described above and deriving a threshold amount there from.
  • the ROC plot allows deriving suitable thresholds.
  • the reference amounts lie within the range of values that represent a sensitivity of at least 75% and a specificity of at least 45%, or a sensitivity of at least 80% and a specificity of at least 40%, or a sensitivity of at least 85% and a specificity of at least 33%, or a sensitivity of at least 90% and a specificity of at least 25%.
  • the reference amount as used herein is derived from samples of subjects obtained before treatment, but for which it is known if their donors were being afflicted with BC or MBC or not.
  • This reference amount level may be a discrete figure or may be a range of figures.
  • the reference level or amount may vary between individual species of miRNA.
  • the measuring system therefore, preferably, is calibrated with a sample or with a series of samples comprising known amounts of each specific miRNA. It is understood by the skilled person that in such case the amount of miRNA can preferably be expressed as arbitrary units (AU).
  • the amounts of miRNA are determined by comparing the signal obtained from the sample to signals comprised in a calibration curve.
  • the reference amount applicable for an individual subject may vary depending on various physiological parameters such as age or subpopulation.
  • a suitable reference amount may be determined by the methods of the present invention from a reference sample to be analyzed together, i.e. simultaneously or subsequently, with the test sample.
  • a threshold amount can be preferably used as a reference amount.
  • a reference amount may, preferably, be derived from a sample of a subject or group of subjects being afflicted with BC or MBC which is/are known to be afflicted with BC or MBC.
  • a reference amount may, preferably, also be derived from a sample of a subject or group of subjects known to be not afflicted with BC or MBC.
  • a deviation i.e. a decrease or an increase of the miR A amounts referred to herein is, preferably, a statistically significant deviation, i.e. a statistically significant decrease or a statistically significant increase.
  • treat means accomplishing one or more of the following: (a) reducing the severity of the disorder; (b) limiting or preventing development of symptoms characteristic of the disorder(s) being treated; (c) inhibiting worsening of symptoms characteristic of the disorder(s) being treated; (d) limiting or preventing recurrence of the disorder(s) in an individual that have previously had the disorder(s); and (e) limiting or preventing recurrence of symptoms in individuals that were previously symptomatic for the disorder(s).
  • prevent means preventing that such disease or disorder occurs in patient.
  • the term "therapy” refers to all measures applied to a subject to ameliorate the diseases or disorders referred to herein or the symptoms accompanied therewith to a significant extent. Said therapy as used herein also includes measures leading to an entire restoration of the health with respect to the diseases or disorders referred to herein. It is to be understood that therapy as used in accordance with the present invention may not be effective in all subjects to be treated. However, the term shall require that a statistically significant portion of subjects being afflicted with a disease or disorder referred to herein can be successfully treated. Whether a portion is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools discussed herein above.
  • breast cancer therapy relates to applying to a subject afflicted with breast cancer, including metastasizing breast cancer, measures to remove cancer cells from the subject, to inhibit growth of cancer cells, to kill cancer cells, or to cause the body of a patient to inhibit the growth of or to kill cancer cells.
  • breast cancer therapy is chemotherapy, anti-hormone therapy, targeted therapy, immunotherapy, or any combination thereof. It is, however, also envisaged that the cancer therapy is radiation therapy or surgery, alone or combination with other therapy regimens. It is understood by the skilled person that the selection of the breast cancer therapy depends on several factors, like age of the subject, tumor staging, and receptor status of tumor cells.
  • the selection of the breast cancer therapy can be assisted by the methods of the present invention: if, e.g. BC is diagnosed by the method for diagnosing BC, but no MBC is diagnosed by the method for diagnosing MBC, surgical removal of tumor may be sufficient. If, e.g. BC is diagnosed by the method for diagnosing BC and MBC is diagnosed by the method for diagnosing MBC, therapy measures in addition to surgery, e.g. chemotherapy and / or targeted therapy, may be appropriate. Likewise, if, e.g. BC is diagnosed by the method for diagnosing BC, and an unfavorable CTC status is determined by the method for determining the CTC status, e.g. a further addition of immunotherapy to the therapy regimen may be required.
  • chemotherapy relates to treatment of a subject with an antineoplastic drug.
  • chemotherapy is a treatment including alkylating agents (e.g. cyclophosphamide), platinum (e.g. carboplatin), anthracyclines (e.g. doxorubicin, epirubicin, idarubicin, or daunorubicin) and topoisomerase II inhibitors (e.g. etoposide, irinotecan, topotecan, camptothecin, or VP 16), anaplastic lymphoma kinase (ALK) -inhibitors (e.g.
  • alkylating agents e.g. cyclophosphamide
  • platinum e.g. carboplatin
  • anthracyclines e.g. doxorubicin, epirubicin, idarubicin, or daunorubicin
  • topoisomerase II inhibitors e.g. etoposide,
  • aurora kinase inhibitors e.g. N-[4-[4-(4-Methylpiperazin-l-yl)-6-[(5-methyl-lH-pyrazol-3-yl)amino]pyrimidin-2- yl]sulfanylphenyl]cyclopropanecarboxamide (VX-680)
  • antiangiogenic agents e.g. Bevacizumab
  • Iodinel31- l-(3-iodobenzyl)guanidine therapeutic metaiodobenzylguanidine
  • HDAC histone deacetylase
  • chemotherapy preferably, relates to a complete cycle of treatment, i.e. a series of several (e.g. four, six, or eight) doses of antineoplastic drug or drugs applied to a subject separated by several days or weeks without such application.
  • anti-hormone therapy relates to breast cancer therapy by blocking hormone receptors, e.g. estrogen receptor or progesterone receptor, expressed on tumor cells, or by blocking the biosynthesis of estrogen.
  • Blocking of hormone receptors can preferably be achieved by administering compounds, e.g. tamoxifen, binding specifically and thereby blocking the activity of said hormone receptors.
  • Blocking of estrogen biosynthesis is preferably achieved by administration of aromatase inhibitors like, e.g. anastrozole or letrozole. It is known to the skilled artisan that anti-hormone therapy is only advisable in cases where tumor cells are expressing hormone receptors.
  • targeted therapy relates to application to a patient a chemical substance known to block growth of cancer cells by interfering with specific molecules known to be necessary for tumorigenesis or cancer or cancer cell growth.
  • Examples known to the skilled artisan are small molecules like, e.g. PARP-inhibitors (e.g. Iniparib), or monoclonal antibodies like, e.g., Trastuzumab.
  • immunotherapy as used herein relates to the treatment of cancer by modulation of the immune response of a subject. Said modulation may be inducing, enhancing, or suppressing said immune response.
  • cell based immunotherapy relates to a breast cancer therapy comprising application of immune cells, e.g. T-cells, preferably tumor-specific NK cells, to a subject.
  • radiation therapy or “radiotherapy” is known to the skilled artisan.
  • the term relates to the use of ionizing radiation to treat or control cancer.
  • the skilled person also knows the term “surgery”, relating to operative measures for treating breast cancer, e.g. excision of tumor tissue.
  • therapy monitoring relates to obtaining an indication on the effect of a treatment against cancer on the cancer status of a subject afflicted with said cancer.
  • therapy monitoring comprises application of a method of the present invention on two samples from the same subject, wherein a first sample is obtained at a time point before the second sample.
  • the time point of obtaining the first sample is separated from the time point of obtaining the second sample by about one week, about two weeks, about three weeks, about for weeks, about five weeks, about, six weeks, about seven weeks, about two months, about three months, about five months, about six month, or more than about six months.
  • the method of therapy monitoring is used for long-term monitoring of subjects, e.g. monitoring the time of relapse- free survival or the like.
  • the time point of obtaining the first sample is separated from the time point of obtaining the second sample, preferably, by at least six months, at least one year, at least two years, at least three years, at least four years, at least five years, or at least six years.
  • the first sample is preferably obtained before cancer therapy is started, while the second sample is preferably obtained after therapy is started. It is, however, also envisaged by the present invention that both samples are obtained after therapy is started.
  • sample obtained at the first point in time may be used as the first sample relative to the second sample as well as for a third sample.
  • the sample obtained at the second point in time may nonetheless be used as a first sample relative to a third sample, and the like.
  • treatment success preferably relates to an amelioration of the diseases or disorders referred to herein or the symptoms accompanied therewith to a significant extent. More preferably, the term relates to a complete cure of said subject, i.e. to the prevention of progression and/or relapse of metastasizing breast cancer for at least five years. Accordingly, "determining treatment success” relates to assessing the probability according to which a subject was successfully treated. Preferably, the term relates to predicting progression free survival and/or overall survival of the subject, more preferably for a specific period of time. The term “predicting progression free survival” relates to determining the probability of a subject surviving without relapse and/or progression of metastatic breast cancer for a specific period of time. Accordingly, the term “predicting overall survival” relates to determining the probability according to which a subject will survive for a specific period of time. Preferably, said period of time is at least 12 months, more preferably at least 24 months.
  • kit refers to a collection of the aforementioned components, preferably, provided separately or within a single container.
  • the container also preferably, comprises instructions for carrying out the method of the present invention. Examples for such the components of the kit as well as methods for their use have been given in this specification.
  • the kit preferably, contains the aforementioned components in a ready-to-use formulation.
  • the kit may additionally comprise instructions, e.g., a user's manual for adjusting the components, e.g. concentrations of the detection agents, and for interpreting the results of any determination(s) with respect to the diagnoses provided by the methods of the present invention.
  • a user's manual for adjusting the components, e.g. concentrations of the detection agents, and for interpreting the results of any determination(s) with respect to the diagnoses provided by the methods of the present invention.
  • such manual may include information for allocating the amounts of the determined a gene product to the kind of diagnosis.
  • Such user's manual may provide instructions about correctly using the components of the kit for determining the amount(s) of the respective biomarker.
  • a user's manual may be provided in paper or electronic form, e.g., stored on CD or CD ROM.
  • the present invention also relates to the use of said kit in any of the methods according to the present invention.
  • the term "device” as used herein relates to a system of means comprising at least the aforementioned means operative ly linked to each other as to allow the diagnosis.
  • Preferred means for determining the methylation status or the amount of gene product and means for carrying out the comparison are disclosed above in connection with the methods of the invention. How to link the means in an operating manner will depend on the type of means included into the device. For example, where means for automatically determining the methylation status or the amount of a gene product are applied, the data obtained by said automatically operating means can be processed by, e.g., a computer program in order to establish a diagnosis.
  • the means are comprised by a single device in such a case.
  • Said device may accordingly include an analyzing unit for determining the methylation status or the amount of a gene product in a sample and an evaluation unit for processing the resulting data for the diagnosis.
  • Preferred means for detection are disclosed in connection with embodiments relating to the methods of the invention above.
  • the means are operatively linked in that the user of the system brings together the result of the determination of the amount and the diagnostic value thereof due to the instructions and interpretations given in a manual.
  • the means may appear as separate devices in such an embodiment and are, preferably, packaged together as a kit. The person skilled in the art will realize how to link the means without further inventive skills.
  • Preferred devices are those which can be applied without the particular knowledge of a specialized clinician, e.g., test stripes or electronic devices which merely require loading with a sample.
  • the results may be given as output of parametric diagnostic raw data, preferably, as absolute or relative amounts. It is to be understood that these data will need interpretation by the clinician.
  • expert system devices wherein the output comprises processed diagnostic raw data the interpretation of which does not require a specialized clinician.
  • analyzing units/devices e.g., biosensors, arrays, solid supports coupled to ligands specifically recognizing the polypeptides, Plasmon surface resonance devices, NMR spectrometers, mass- spectrometers etc.
  • evaluation units/devices referred to above in accordance with the methods of the invention.
  • the present invention relates to a method of prognosing and/or diagnosing a disease in a subject, comprising
  • the disease is a proliferative cell disease.
  • the disease is cancer.
  • the cancer is selected from the group consisting of breast cancer, pancreatic cancer and ovarian cancer.
  • the term miR-652 refers to the sequence of the -3p or -5p strand (in particular miR-652-3p )
  • the term miR-801 refers to the sequence of the -3p or -5p strand
  • the term miR- 376c refers to the sequence of the -3p or -5p strand (in particular miR-376c-3p )
  • the term miR-376a refers to the sequence of the -3p or -5p strand (in particular miR-376a-3p )
  • the term miR-127 refers to the sequence of the -3p or -5p strand (in particular miR- 127-3p )
  • the term miR-409 refers to the sequence of the -3p or -5p strand (in particular miR-409-3p )
  • the term miR- 148b refers to the sequence of the - 3p or -5p strand (in particular miR-148-3p ).
  • an alteration in the methylation status and/or expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S IOOP, and/or DYRK4 indicates a change in tissue status or disease such as the worsening or bettering of a tissue status or disease, in particular cancer.
  • a decreased methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4 is indicative of a worsening of a tissue status or disease.
  • An increased methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4, is indicative of a bettering of a tissue status or disease.
  • An alteration in the methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4, is also indicative of the risk of developing an altered tissue status or a disease, in particular cancer.
  • a decreased methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4 is indicative of the risk of developing a degenerative tissue status or disease, in particular cancer.
  • An altered methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S IOOP, and/or DYRK4, in particular decreased methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S 1 OOP, and/or DYRK4, is also indicative of an individual suffering from an altered tissue status or a disease, in particular cancer.
  • an altered methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S IOOP, and/or DYRK4 indicates the progression or a stage of a tissue status or a disease, in particular cancer, in a subject.
  • a decreased methylation status of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, and/or DYRK4 is indicative of a worsening of a tissue status or disease, in particular cancer.
  • an increased expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, and/or DYRK4 is indicative of a worsening of a tissue status or disease.
  • a decreased expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, and/or DYRK4, is indicative of a bettering of a tissue status or disease.
  • An alteration in the expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, and/or DYRK4, is also indicative of the risk of developing an altered tissue status or a disease, in particular cancer.
  • an increased expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, and/or DYRK4 is indicative of the risk of developing a degenerative tissue status or disease, in particular cancer.
  • An altered expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4, in particular increased expression level of HYAL2, MGRNl , RPTOR, SLC22A18, FUT7, RAPSN, S 1 OOP, and/or DYRK4, is also indicative of an individual suffering from an altered tissue status or a disease, in particular cancer.
  • an altered expression level of HYAL2, MGRN 1 , RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4 indicates the progression or a stage of a tissue status or a disease, in particular cancer, in a subject.
  • an increased expression level of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SIOOP, and/or DYRK4 is indicative of a worsening of a tissue status or disease, in particular cancer.
  • an alteration in the miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR-148b level indicates a change in tissue status or disease such as the worsening or bettering of a tissue status or disease, in particular cancer.
  • an elevated level of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, and/or miR-148b is indicative of a worsening of a tissue status or disease.
  • a lowered level of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR- 148b is indicative of a bettering of a tissue status or disease.
  • An alteration in the miR-652, miR-801, miR-376c, miR-376a, miR-127, miR- 409, and/or miR-148b level is also indicative of the risk of developing an altered tissue status or a disease, in particular cancer. More specifically an elevated level of miR-652, miR-801, miR-376c, miR- 376a, miR-127, miR-409, and/or miR-148b is indicative of the risk of developing a degenerative tissue status or disease, in particular cancer.
  • An altered miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR-148b level in particular an elevated miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR- 148b level, is also indicative of an individual suffering from an altered tissue status or a disease, in particular cancer.
  • an altered miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR- 148b level e.g.
  • an elevated or lowered level of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR-148b indicates the progression or a stage of a tissue status or a disease, in a subject.
  • an elevated miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and/or miR-148b level is indicative of a worsening of a tissue status or disease, in particular cancer.
  • the methylation status and/or expression level of the at least one methylation marker and the presence, in particular the amount, of at least one miRNA is indicative of the prognosis and/or diagnosis of said subject.
  • the prognosis and/or diagnosis of cancer includes
  • the presence, in particular the amount, of one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127p, miR-409, and miR- 148b, is determined.
  • the methylation status and/or expression level of one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, SI OOP, and DYRK4 is determined.
  • miRNA-7 encompasses all seven miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR- 127p, miR-409, and miR- 148b.
  • methylation marker and miRNAs may be used for prognosing and/or diagnosing cancer.
  • the methylation status and/or expression level of one or more of the following combinations of methylation markers is determined:
  • the methylation status and/or expression level of the methylation marker RPTOR, MGRN 1 , and RAPSN is determined, and the presence, in particular the amount, of the miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR-127-3p, miR-409-3p, and miR-148b is determined.
  • the methylation status and/or expression level of HYAL2 is also determined.
  • the methylation status and/or expression level of the methylation marker DYRK4, SIOOP, FUT7, and SLC22A18 is determined, and the presence, in particular the amount, of the miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR-127-3p, miR-409-3p, and miR- 148b is determined.
  • the methylation status and/or expression level of HYAL2 is also determined.
  • the methylation status and/or expression level of the methylation marker MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S IOOP, and DYRK4 is determined, and the presence of the miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR-127-3p, miR-409-3p, and miR- 148b is determined.
  • the methylation status and/or expression level of HYAL2 is also determined.
  • the determination of the methylation status comprises determining methylation of at least one CpG site within the HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S IOOP, and/or DYRK4 gene.
  • the methylation status of the promoter, intron and/or exon region of said genes is determined.
  • the HYAL2 gene is the human HYAL2 gene located on human chromosome 3
  • the methylation status of at least one of the CpG sites located between position 50334760 and position 50335700 on human chromosome 3 is determined. More specifically, in particular referring to build 36.1/hgl 8 of the human genome, the methylation status of at least one ofthe CpG sites located at position 50335694 (cg27091787), 50335584 (HYAL CpG l), 50335646 (HYAL_CpG_2), or 50335671 (HYAL_CpG_3), 50335166 (HYAL-is- 310 CpG_l), 50335180 (HYAL-is-310 CpG_2), 50335192 (HYAL-is-310 CpG_3), 50335195 (HYAL- is-310 CpG_4), 50335227 (HYAL-is-310 CpG_5), 50335233 (HYAL-is-310 CpG
  • At least one CpG site is selected from the list consisting of cg27091787 at position 50335694, HYAL CpG l at position 50335584, HYAL_CpG_2 at position 50335646, and HYAL_CpG_3 at position 50335671.
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined.
  • CpG sites may depend on the specific genomic sequence and on the specific sequence of the HYAL2 promoter region comprised in the sample to be analyzed.
  • the HYAL2 gene is located on Chromosome 3: positions 50,355,221-50,360,337 in build37/hgl9, but on Chromosome 3: positions 50,330,244-50,335, 146 in build36/hgl 8.
  • the MGRNl gene is the human MGRNl gene located at human chromosome 16 (Genbank Acc No: NC 000016.10, range: 4624824-4690974, Reference GRCh38 Primary Assembly; Genbank Acc No: NC_018927.2, range: 4674882-4741756, alternate assembly CHMl l . l ; Genbank Acc No: AC 000148.1, range: 4641815-4707494, alternate assembly HuRef).
  • the methylation status of at least one of the CpG sites located between position 4654000 and position 4681000 on human chromosome 16 is determined.
  • the CpG site(s) is/are located in one or more of the following regions of chromosome 16: 4670069-4670542, 4654000-4655000, 4669000-4674000, and 4678000- 4681000. More specifically, in particular referring to build 36.1/hgl 8 of the human genome, the methylation status of at least one of the CpG sites located at position: 4670487 (MGRNl CpG l), 4670481 (MGRNl_CpG_2), 4670466 (MGRNl_CpG_3), 4670459 (MGRNl_CpG_4), 4670442 (MGRNl _CpG_5), 4670440 (MGRNl_CpG_6), 4670435 (MGRNl_CpG_7), 4670433
  • MRNl _CpG_26 4670234 (MGRNl _CpG_27), 467021 1 (MGRNl_CpG_28), 4670180 (MGRNl _CpG_29), 4670174 (MGRNl _CpG_30), 4670157 (MGRNl_CpG_31), 4670137 (MGRNl_CpG_32), 4670123 (MGRNl_CpG_33), 46701 17 (MGRNl_CpG_34).
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the MGRNl promoter region comprised in the sample to be analyzed.
  • the RPTOR gene is the human RPTOR gene located at human chromosome 17 (Genbank Acc No: NC_000017.1 1, range: 80544825-80966373, GRCh38 Primary Assembly; Genbank Acc No: NG 013034.1, range: 5001-426549, RefSeqGene; Genbank Acc No: NC 018928.2, range: 78604958-79026514, Alternate assembly CHMl l . l ; Genbank Acc No: NG 013034.1 ; Genbank Acc No: AC_000149.1,range: 73954508-74378467, alternate assembly HuRef).
  • the methylation status of at least one of the CpG sites located between position 76.297.000 and position 76.416.000 on human chromosome 17 is determined.
  • the CpG site(s) is/are located in one or more of the following regions of chromosome 17: 76.369.937-76.370.536. 76.297.000-76.310.000, 76.333.000-76.341.000, 76.360.000-76.380.000, and 76.41 1.000-76.416.000.
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the
  • the SLC22A18 gene is the human SLC22A18 gene located at human chromosome 1 1 (Genbank Acc No: NC OOOOl 1.10, range: 2899721-2925246, Reference GRCh38 primary assembly; Genbank Acc No: NG 01 1512.1, range: 5001-30526, RefSeqGene; Genbank Acc No: NT 187585.1, range: 131932- 157362, Reference GRCh38 ALT REF LOCI l ; Genbank Acc No: AC 000143.1, range: 2709509-2734907, alternate assembly HuRef; Genbank Acc No: NC 018922.2, range:2919878-2945340, alternate assembly CHMl l . l).
  • the methylation status of at least one of the CpG sites located between position 2876000 and position 2883000 on human chromosome 11 is determined.
  • the CpG sites are located at 2.877.1 13-2.877.442.
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the SLC22A18 promoter region comprised in the sample to be analyzed.
  • the FUT7 gene is the human FUT7 gene located at human chromosome 9 (Genbank Acc No: NC 000009.12, range: 137030174-137032840, Reference GRCh38 primary assembly; Genbank Acc No: NG 007527.1, range: 5001-7667, RefSeqGene; Genbank Acc No: AC 000141.1, range: 109383478- 109386144, Alternate assembly HuRef; Genbank Acc No: NC 018920.2, range: 140073389-140076055, Alternate assembly CHMl l . l).
  • the methylation status of at least one of the CpG sites located between position 139046000 and position 139048000 on human chromosome 9 is determined. More specifically, a 2000 bp BC, OvaCa, and/or PaCA-associated differential methylation region located at the promoter region of FUT7.
  • the CpG sites are located at 139.047.218-139.047.610, 139.046.000- 139.048.000, and 139.045.065- 139.045.817.
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the FUT7 promoter region comprised in the sample to be analyzed.
  • the RAPSN gene is the human RAPSN gene located at human chromosome 1 1 (Genbank Acc No: NC OOOOl 1.10, range: 47437757-.47449178, Reference GRCh38 primary assembly; Genbank Acc No: NG 008312.1, range: 5001-16423, RefSeqGene; Genbank Acc No: NC 018922.2, range: 47458570-47469991, alternate assembly CHMl l . l ; Genbank Acc No: AC 000143.1, range: 47159075-47170494, alternate assembly HuRef).
  • the methylation status of at least one of the CpG sites located between position 47427500 and position 47428500 on human chromosome 1 1 is determined.
  • the CpG sites are located at 47427500 -47428300.
  • a 1000 bp cancer-associated, preferably BC, OvaCa, and/or PaCA-associated, differential methylation region located at the promoter region of RAPSN.
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the RAPSN promoter region comprised in the sample to be analyzed.
  • the S I OOP gene is the human S I OOP gene located at human chromosome 4 (Genbank Acc No: NC 000004.12, range: 6693839-6697170, Reference GRCh38 primary assembly; Genbank Acc No: AC 000136.1, range: 6627254-6630595, alternate assembly HuRef; Genbank Acc No: NC 018915.2, range: 6693944-6697285, alternate assembly CHMl l . l).
  • the methylation status of at least one of the CpG sites located between position 6746000 and position 6747000 on human chromosome 4 is determined.
  • a 1000 bp cancer-associated (preferably BC, OvaCa, and/or PaCA-associated) differential methylation region located from the promoter region till the first exon of S I OOP.
  • the CpG sites are located at 6.746.537- 6.746.823.
  • 6746565 SlOOP CpG l
  • 6746599 S100P_CpG_2
  • 6746609 S 100P_CpG_3
  • 6746616 S100P_
  • the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the S 1 OOP promoter region comprised in the sample to be analyzed.
  • the DYRK4 gene is the human DYRK4 gene located at human chromosome 12
  • the methylation status of at least one of the CpG sites located between position 4569000 and position 4571000 on human chromosome 12 is determined. More specifically, a 2000 bp cancer-associated, preferably BC, OvaCa, and/or PaCA associated, differential methylation region located at the promoter region of DYRK4.
  • the CpG sites are located at 4569448 -4569945. More specifically, in particular referring to build 36.1/hgl 8 of the human genome, the methylation status of at least one of the CpG sites located at position: 4569879 (DYRK4_CpG_l), 4569809 (DYRK4_CpG_2), 4569707 (DYRK4_CpG_3), 4569493 (DYRK4_CpG_4), In particular, the methylation status of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least fifteen CpG sites of the present invention is determined. It is understood by the skilled person that the exact numbering of said CpG sites may depend on the specific genomic sequence and on the specific sequence of the DYRK4 promoter region comprised in the sample to be analyzed.
  • the method of prognosing and/or diagnosing cancer further comprises the step of comparing the methylation status of the at least one methylation marker and the presence, in particular the amount, of the at least one miRNA marker, in said subject, to the methylation status of the at least one methylation marker and the presence, in particular the amount, of the at least one miRNA marker in one or more reference(s).
  • the reference is a threshold value, a reference value or a reference sample.
  • a methylation status of the at least on methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, and DYRK4, which is below a threshold value is indicative of a subject being afflicted with cancer, an increased risk of developing cancer, or a worsening of the disease; whereas a methylation status which is equal to or above the threshold value is indicative of a subject not afflicted with cancer, of a decreased risk of developing cancer, or of a bettering of the disease.
  • the aforementioned level may vary due to statistics and errors of measurement.
  • an expression level of the at least on methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 1 OOP, and DYRK4, which is equal to or above the threshold value is indicative of a subject being afflicted with cancer, an increased risk of developing cancer, or a worsening of the disease; whereas an expression level which is below the threshold value is indicative of a subject not being afflicted with cancer, of a decreased risk of developing cancer, or of a bettering of the disease. It is to be understood that the aforementioned level may vary due to statistics and errors of measurement.
  • an amount of the at least on miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR- 409, and miR-148b, which is equal to or above the threshold value is indicative of a subject being afflicted with cancer, an increased risk of developing cancer, or a worsening of the disease; whereas an amount which is below the threshold value is indicative of a subject not being afflicted with cancer, of a decreased risk of developing cancer, or of a bettering of the disease.
  • the aforementioned amounts may vary due to statistics and errors of measurement.
  • the threshold value for a subject being afflicted with cancer, an increased risk of developing cancer, or a worsening of the disease; for HYAL2 is a methylation status of less than 90% of the controls and an expression level of more than 1.2 folds higher than the controls .
  • the threshold value for MGRNl is a methylation status of less than 90% of the controls.
  • the threshold value for RPTOR is a methylation status of less than 95% of the controls.
  • the threshold value for SLC22A18 is a methylation status of less than 95% of the controls and an expression level of more than 1.1 folds higher than the controls.
  • the threshold value for FUT7 is a methylation status of less than 92% of the controls.
  • the threshold value for RAPSN is a methylation status of less than 98% of the controls.
  • the threshold value for SI OOP is a methylation status of less than 90% of the controls and an expression level of more than 2 folds higher than the controls.
  • the threshold value for DYRK4 is a methylation status of less than 85% of the controls.
  • the threshold level for miR-652 is an amount of at least 0.5Ct value less than the controls (or more than 1.4 folds higher than the controls).
  • the threshold level for miR-801 is an amount of at least 0.6Ct value less than the controls (or more than 1.5 folds higher than the controls).
  • the threshold level for miR-376c is an amount of at least 0.5Ct value less than the controls (or more than 1.4 folds higher than the controls).
  • the threshold level for miR-376a is an amount of at least 0.6Ct value less than the controls (or more than 1.5 folds higher than the controls).
  • the threshold level for miR- 127 is an amount of at least 0.5Ct value less than the controls (or more than 1.4 folds higher than the controls).
  • the threshold level for miR-409 is an amount of at least 0.4Ct value less than the controls (or more than 1.3 folds higher than the controls).
  • the threshold level for miR- 148b is an amount of at least 0.3Ct value less than the controls (or more than 1.2 folds higher than the controls).
  • said reference value is a representative value of the absence of cancer, of the presence of cancer, or of an increased or decreased risk of developing cancer.
  • the reference sample is selected from the group consisting of a reference sample derived from a healthy individual, a reference sample derived from a diseased individual, a reference sample derived from the same individual as the sample of interest taken at an earlier or later time point, and a reference sample representative for a healthy individual or representative for the presence or absence of cancer or representative for an increased or decreased risk of developing cancer.
  • a decreased methylation level and/or an increased expression of the at least one methylation marker and the presence or an increased amount of the at least one miRNA marker compared to the reference indicates
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • a similar methylation status or expression level of the at least one methylation marker and a similar amount of the at least one miRNA marker indicates
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • the reference sample is derived from the same subject as the sample of interest and was taken at an earlier time point
  • a persistence of cancer in particular BC, OvaCa, and/or PaCA, in the subject.
  • the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, miR-148b is determined.
  • an amount of at least 0.5Ct value less than the controls (or more than 1.4 folds higher than the controls) miR-652 is indicative of cancer.
  • an amount of at least 0.6Ct value less than the controls (or more than 1.5 folds higher than the controls) miR-801 is indicative of cancer.
  • an amount of at least 0.5Ct value less than the controls (or more than 1.4 folds higher than the controls) miR-376c is indicative of cancer.
  • an amount of at least 0.6Ct value less than the controls (or more than 1.5 folds higher than the controls) miR-376a is indicative of cancer.
  • an amount of at least 0.5Ct value less than the controls (or more than 1.4 folds higher than the controls) miR- 127 is indicative of cancer.
  • an amount of at least 0.4Ct value less than the controls (or more than 1.3 folds higher than the controls) miR-409 is indicative of cancer.
  • an amount of at least 0.3Ct value less than the controls (or more than 1.2 folds higher than the controls) miR-148b is indicative of cancer.
  • the sample of interest and/or the reference sample is a body fluid samples or a tissue samples.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the body fluid is blood.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the present invention relates to a method for determining the dosage of a pharmaceutical for the alteration of cancer or the prevention of cancer or the treatment of cancer in a subject, comprising the steps of
  • the dosage of a pharmaceutical is determined depending on the comparison of the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker a in the sample of interest and the reference or reference sample.
  • the sample of interest and/or the reference sample is a body fluid samples or a tissue samples.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the body fluid is blood.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the present invention relates to a method for adapting the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer, comprising the steps of
  • the dosage of a pharmaceutical is increased if
  • the methylation status of the at least one methylation marker is decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the methylation status of the at least one methylation marker is equal to or decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the methylation status of the at least one methylation marker is equal to decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the expression level of the at least one methylation marker is increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the expression level of the at least one methylation marker is equal to or increased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the expression level of the at least one methylation marker is equal to increased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the amount of the at least one miR A is increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the amount of the at least one miRNA marker is equal to or increased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the amount of the at least one miRNA marker is equal to or increased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the dosage of a pharmaceutical is decreased if
  • the methylation status of the at least one methylation marker is equal to or increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the methylation status of the at least one methylation marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the methylation status of the at least one methylation marker is equal to decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the expression level of the at least one methylation marker is equal to or decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the expression level of the at least one methylation marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the expression level of the at least one methylation marker is decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the amount of the at least one miR A is equal to or decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the amount of the at least one miRNA marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the amount of the at least one miRNA marker is decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the sample of interest and/or the reference sample is a body fluid sample or a tissue sample.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the body fluid sample is a blood sample.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the present invention relates to a method of determining the beneficial and/or adverse effects of a substance on cancer or the development of cancer, comprising the steps of
  • the sample of interest is exposed differently to said substance with regard to time and/or concentration.
  • the sample of interest may be exposed to said substance for a longer or shorter time interval, and/or at a higher or lower concentration of said substance.
  • an adverse effect of a substance is determined if the sample of interest is exposed to a higher concentration and/or for a longer time interval.
  • the methylation status of the at least one methylation marker is decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the methylation status of the at least one methylation marker is equal to or decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the methylation status of the at least one methylation marker is equal to decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the expression level of the at least one methylation marker is increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the expression level of the at least one methylation marker is equal to or increased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the expression level of the at least one methylation marker is equal to increased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the amount of the at least one miRNA is increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the amount of the at least one miRNA marker is equal to or increased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the amount of the at least one miRNA marker is equal to or increased in comparison to a reference sample obtained from said subject at an earlier time point.
  • a beneficial effect of a substance is determined if
  • the methylation status of the at least one methylation marker is equal to or increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the methylation status of the at least one methylation marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the methylation status of the at least one methylation marker is equal to decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the expression level of the at least one methylation marker is equal to or decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the expression level of the at least one methylation marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the expression level of the at least one methylation marker is decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the amount of the at least one miRNA is equal to or decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the amount of the at least one miRNA marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the amount of the at least one miRNA marker is decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the methylation status of the at least one methylation marker is decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the methylation status of the at least one methylation marker is equal to or decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the methylation status of the at least one methylation marker is equal to decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the expression level of the at least one methylation marker is increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the expression level of the at least one methylation marker is equal to or increased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the expression level of the at least one methylation marker is equal to increased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the amount of the at least one miR A is increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the amount of the at least one miRNA marker is equal to or increased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the amount of the at least one miRNA marker is equal to or increased in comparison to a reference sample obtained from said subject at an earlier time point.
  • a beneficial effect of a substance is determined if
  • the methylation status of the at least one methylation marker is equal to or increased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the methylation status of the at least one methylation marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the methylation status of the at least one methylation marker is equal to decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the expression level of the at least one methylation marker is equal to or decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the expression level of the at least one methylation marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the expression level of the at least one methylation marker is decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the amount of the at least one miR A is equal to or decreased in comparison to a reference indicative of the absence of the disease or the decreased risk of developing a disease, or reference sample of a healthy subject or representative of the absence of the disease.
  • the amount of the at least one miRNA marker is decreased in comparison to a reference indicative of the presence of the disease or the increased risk of developing a disease, or reference sample of a diseased subject or representative of the presence of the disease.
  • the amount of the at least one miRNA marker is decreased in comparison to a reference sample obtained from said subject at an earlier time point.
  • the sample of interest and/or the reference sample is a body fluid samples or a tissue samples.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the body fluid sample is a blood sample.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the present invention relates to a method for identifying a patient as a responder to a cancer treatment, comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 1 OOP, and DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR- 409, miR- 148b, as specified in detail above, in a first sample and in one or more further samples taken from the subject subsequently to the first sample, wherein an increased methylation status of the at least one methylation marker and/or a lower expression level of the at least one methylation marker, and the absence or decreased amount of the at least one miRNA marker indicates a response to the treatment.
  • the sample of interest and/or the reference sample is a body fluid samples or a tissue samples.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the body fluid sample is a blood sample.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the present invention relates to a method for identifying a patient as a non- responder to a cancer treatment, comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGR 1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, and DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, miR-148b, as specified in detail above, in a first sample and in one or more further samples taken subsequently to the first sample, wherein a decreased methylation status of the at least one methylation marker and/or an increased expression level of the at least one methylation marker, and the presence or increased amount of the at least one miRNA marker indicates a lack of response to the treatment.
  • the sample of interest and/or the reference sample is a body fluid samples or a tissue samples.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the present invention relates to a method for treating cancer, comprising the steps:
  • the sample of interest and/or the reference sample is a body fluid samples or a tissue samples.
  • the body fluid sample is selected from the group consisting of blood, serum, plasma, synovial fluid, urine, saliva, lymphatic fluid, lacrimal fluid, and fluid obtainable from the glands such as e.g. breast or prostate.
  • the body fluid sample is a blood sample.
  • the tissue sample is a tissue extracts obtained from tumour tissue or tissue adjacent to a tumour.
  • the sample of interest and/or the reference sample is a cell cultures or tissue cultures such as but not limited to cultures of various cancer cells.
  • the sample of interest and/or the reference sample is medium obtained from said cell cultures or tissue cultures.
  • the subject is a mammal, reptile, or bird.
  • the subject is selected from the group consisting of laboratory animals (e.g. mouse or rat), domestic animals (including e.g. guinea pig, rabbit, horse, donkey, cow, sheep, goat, pig, chicken, camel, cat, dog, turtle, tortoise, snake, or lizard), or primates including chimpanzees, bonobos, gorillas, and human being. Human beings are particularly preferred.
  • the treatment regime is selected from the list consisting of chemotherapy, anti-hormone therapy, immunotherapy, and radiation therapy.
  • the present invention relates to means for prognosing and/or diagnosing
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • said means detect the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, SI OOP, DYRK4, as specified in detail above.
  • the one or more means for detecting the methylation status of at least one methylation marker comprise at least one methylation-specific polynucleotide.
  • the methylation-specific polynucleotide is a methylation-specific primer and/or a methylation-specific probe.
  • the one or more means for detecting the expression level of at least one methylation marker comprise a binding moiety.
  • Said binding moiety is in particular a polynucleotide, peptide, protein, or aptamer.
  • the binding moiety is selected from the group consisting of monoclonal antibodies, polyclonal antibodies, Fab fragments, Fc fragments, Fab' fragments, F(ab')2 fragments, single domain antibodies (sdAb), nanobodies, single chain Fv (scFv), divalent single-chain variable fragments (di-scFvs), tandem scFvs, diabodies, triabodies, bispecific diabodies, single-chain diabodies (scDb), bi-specific T-cell engagers (BiTEs), and DART" molecules.
  • the binding moiety binds to a part of the gene product of the methylation marker. Accordingly, in embodiments wherein the binding moiety is a polynucleotide, said polynucleotide binds to the mRNA transcribed from the gene of the respective methylation marker, i.e. the gene of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, or DYRK4.
  • the binding moiety is a peptide, protein or aptamer
  • said peptide, protein, or aptamer binds to a part, in particular an epitope, of the protein translated from the gene of the respective methylation marker, i.e. the gene of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, or DYRK4.
  • said means detect at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, miR-148b, as specified in detail above.
  • the one or more means for detecting the amount of at least one miRNA marker comprise at least one miRNA specific polynucleotide.
  • said at least one miRNA specific polynucleotide has a sequence according to SEQ ID NO: 1-13
  • the said means are for use in the method of specified in detail above.
  • said means are for use in a method selected from the group consisting of:
  • PaCA in a subject, comprising (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S 1 OOP, DYRK4, and (b) determining the presence, in particular the amount, of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, miR-148b, in a subject, wherein the methylation status and/or expression level of at least one methylation marker and the presence of at least one miRNA is indicative of the prognosis and/or diagnosis of said subject,
  • a method for determining the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer in a subject comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR- 652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR- 148b, as specified in detail above, in a sample of a subject, and optionally determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a reference for comparison with the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in the sample of interest
  • a method for adapting the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR- 376c, miR-376a, miR- 127, miR-409, miR-148b, as specified in detail above, in a sample, (b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, (c) examining the tested sample as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA
  • a method of determining the beneficial and/or adverse effects of a substance on cancer or the development of cancer comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR- 376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a sample of interest,(b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, and (c) examining the sample of interest as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA
  • a method for identifying a patient as a responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample and in one or more further samples taken subsequently to the first sample, wherein an increased methylation status of the at least one methylation marker and/or a lower expression level of the at least one methylation marker, and the absence or decreased amount of the at least one miRNA marker indicates a response to the treatment,
  • a method for identifying a patient as a non-responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample and in one or more further samples taken subsequently to the first sample, wherein a decreased methylation status of the at least one methylation marker and/or an increased expression level of the at least one methylation marker, and the presence or increased amount of the at least one miR A marker indicates a lack of response to the treatment, and
  • a method for treating cancer comprising the steps: (i) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGR 1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample of a subject; (ii) starting treatment of said patient with a first treatment regimen comprising one or more anticancer agents or therapies, (iii) determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in one or more subsequently taken further samples of said subject; (iv) optionally repeating steps (ii) and (
  • the present invention relates to a kit comprising above specified means for detecting the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, as specified in detail above, and the presence, in particular the amount, of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR- 148b, as specified in detail above.
  • the kit further comprises
  • quality information such as information about the lot/batch number of the means for detecting the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker and/or of the kit, the manufacturing or assembly site or the expiry or sell-by date, information concerning the correct storage or handling of the kit,
  • the kid is for use in the method of specified in detail above.
  • the kid is for use in a method selected from the group consisting of:
  • a method of prognosing and/or diagnosing cancer, in particular BC, OvaCa, and/or PaCA, in a subject comprising (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S 1 OOP, DYRK4, and (b) determining the presence, in particular the amount, of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, miR-148b, in a subject, wherein the methylation status and/or expression level of at least one methylation marker and the presence of at least one miRNA is indicative of the prognosis and/or diagnosis of said subject,
  • a method for determining the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer in a subject comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR- 652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR- 148b, as specified in detail above, in a sample of a subject, and optionally determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a reference for comparison with the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in the sample of interest
  • a method for adapting the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR- 376c, miR-376a, miR- 127, miR-409, miR-148b, as specified in detail above, in a sample, (b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, (c) examining the tested sample as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA
  • a method of determining the beneficial and/or adverse effects of a substance on cancer or the development of cancer comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR- 376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a sample of interest,(b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, and (c) examining the sample of interest as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA
  • a method for identifying a patient as a non-responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting ofmiR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample and in one or more further samples taken subsequently to the first sample, wherein a decreased methylation status of the at least one methylation marker and/or an increased expression level of the at least one methylation marker, and the presence or increased amount of the at least one miRNA marker indicates a lack of response to the treatment, and
  • a method for treating cancer comprising the steps: (i) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample of a subject; (ii) starting treatment of said patient with a first treatment regimen comprising one or more anticancer agents or therapies, (iii) determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in one or more subsequently taken further samples of said subject; (iv) optionally repeating steps (ii) and
  • the present invention relates to the use of the means for detecting the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the presence, in particular the amount, of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, or the kit comprising said means, as specified in detail above, for prognosing and/or diagnosing
  • the use of said means and/or said kit is a use in one of the methods specified in detail above.
  • a method of prognosing and/or diagnosing cancer preferably BC, OvaCa, and/or PaCA, in a subject, comprising (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, PvAPSN, S 1 OOP, DYRK4, and (b) determining the presence, in particular the amount, of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR- 127, miR-409, miR-148b, in a subject, wherein the methylation status and/or expression level of at least one methylation marker and the presence of at least one miRNA is indicative of the prognosis and/or diagnosis of said subject,
  • a method for determining the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer in a subject comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR- 652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR- 148b, as specified in detail above, in a sample of a subject, and optionally determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in a reference for comparison with the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in the sample of interest,
  • a method for adapting the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR- 376c, miR-376a, miR- 127, miR-409, miR-148b, as specified in detail above, in a sample, (b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, (c) examining the tested sample as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA
  • a method of determining the beneficial and/or adverse effects of a substance on cancer or the development of cancer comprising the steps of (a) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR- 376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a sample of interest,(b) determining the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA marker in one or more references or reference samples, and (c) examining the sample of interest as to whether the methylation status and/or expression level of at least one methylation marker and the amount of at least one miRNA
  • a method for identifying a patient as a responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample and in one or more further samples taken subsequently to the first sample, wherein an increased methylation status of the at least one methylation marker and/or a lower expression level of the at least one methylation marker, and the absence or decreased amount of the at least one miRNA marker indicates a response to the treatment,
  • a method for identifying a patient as a non-responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample and in one or more further samples taken subsequently to the first sample, wherein a decreased methylation status of the at least one methylation marker and/or an increased expression level of the at least one methylation marker, and the presence or increased amount of the at least one miRNA marker indicates a lack of response to the treatment, and
  • a method for treating cancer comprising the steps: (i) determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, as specified in detail above, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, as specified in detail above, in a first sample of a subject; (ii) starting treatment of said patient with a first treatment regimen comprising one or more anti- cancer agents or therapies, (iii) determining the methylation status of at least one methylation marker and/or the expression level of at least one methylation marker, and the amount of at least one miRNA in one or more subsequently taken further samples of said subject; (iv) optionally repeating steps (ii) and
  • the present invention relates to the device for identifying cancer, in particular BC, OvaCa, and/or PaCA, comprising:
  • a detection agent for determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, and
  • an evaluation unit comprising a data processor having tangibly embedded an algorithm for carrying out a comparison of the amount determined by the analyzing unit with a reference and which is capable of generating an output file containing a diagnosis established based on the said comparison.
  • said detection agent is a means as specified in detail above.
  • Particular devices are those which can be applied without the particular knowledge of a specialized clinician, e.g., test stripes or electronic devices which merely require loading with a sample.
  • the results may be given as output of parametric diagnostic raw data, in particular, as absolute or relative amounts. It is to be understood that these data will need interpretation by the clinician.
  • expert system devices wherein the output comprises processed diagnostic raw data the interpretation of which does not require a specialized clinician.
  • Further preferred devices comprise the analyzing units/devices (e.g., biosensors, arrays, solid supports coupled to ligands specifically recognizing the miRNAs of the present invention, Plasmon surface resonance devices, NMR spectrometers, mass- spectrometers etc.) or evaluation units/devices.
  • methylation status and/or expression level of at least one methylation marker and the presence of at least one miRNA is indicative of the prognosis and/or diagnosis of said subject.
  • the prognosis and/or diagnosis of cancer includes i. the risk of developing cancer, in particular BC, OvaCa, and/or PaCA,
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • the progression, preferably the worsening or bettering, of cancer in particular BC, OvaCa, and/or PaCA.
  • methylation status and/or expression level of at least 2, 3, 4, 5, 6, or 7 different methylation markers is determined, and/or
  • miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and miR- 148b is determined.
  • miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and miR- 148b is determined.
  • miRNA marker miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, and miR- 148b is determined.
  • the determination of the methylation status comprises determining methylation of at least one CpG site within the HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S I OOP, DYRK4, gene, in particular the promoter, intron or exon region of said genes.
  • the at least one CpG site is selected from the group consisting of cg22266967 in SI OOP, cg21019522 in SLC22A18, cg09418321 in DYRK4, and cg0279745 in FUT7, cg06418238 in RPTOR, cg00736299 in MGRNl, cg01662869 in MGRN1, cg27466532 in RAPSN, cg27091787 in HYAL2
  • the reference sample is selected from the group consisting of a healthy individual, a diseased individual or the same individual as the tested individual at an earlier or later time point or a representative value in absence of cancer, in presence of cancer, or for an increased or decreased risk of developing cancer.
  • the method of aspect 10 or 1 wherein the reference sample is selected from the group consisting of a reference sample derived from a healthy individual, a reference sample derived from a diseased individual, a reference sample derived from the same individual as the sample of interest taken at an earlier or later time point, and a reference sample representative for a healthy individual or representative for the presence or absence of cancer or representative for an increased or decreased risk of developing cancer.
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • any of aspects 10 to 12 wherein the reference is a diseased individual or an individual with an increased risk of developing cancer or a value representative of the presence of cancer, wherein a similar methylation status or expression of the at least one methylation marker and a similar amount of the at least one miRNA marker indicates
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • an increased methylation and/or lower expression of the at least one methylation marker and the absence or a decreased amount of the at least one miRNA marker compared to the reference indicates iv. a decreased risk to develop cancer, in particular BC, OvaCa, and/or PaCA, v. the absence of cancer, in particular BC, OvaCa, and/or PaCA, and/or vi. a declined progression of cancer, in particular BC, OvaCa, and/or PaCA, and/or
  • a method for determining the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer in a subject comprising the steps of
  • a method for adapting the dosage of a pharmaceutical for the alteration of cancer or the prevention or treatment of cancer comprising the steps of
  • a method for identifying a patient as a responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S100P, DYRK4, and the amount of at least one miRNA marker selected from the group consisting of miR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR-148b, in a first sample and in one or more further samples taken subsequently to the first sample, wherein an increased methylation status of the at least one methylation marker and/or a lower expression level of the at least one methylation marker, and the absence or decreased amount of the at least one miRNA marker indicates a response to the treatment.
  • a method for identifying a patient as a non-responder to a cancer treatment comprising determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S I OOP, DYRK4, and the amount of at least one miRNA marker selected from the group consisting ofmiR-652, miR-801, miR-376c, miR-376a, miR-127, miR-409, miR- 148b, in a first sample and in one or more further samples taken subsequently to the first sample, wherein a decreased methylation status of the at least one methylation marker and/or an increased expression level of the at least one methylation marker, and the presence or increased amount of the at least one miRNA marker indicates a lack of response to the treatment.
  • a method for treating cancer comprising the steps:
  • tissue sample is a tumor sample and/or the body fluid sample is selected from the group consisting of blood, plasma, serum, urine, saliva, lacrimal fluid and fluids obtainable from breast glands.
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • the one or more means for detecting the methylation status of at least one methylation marker comprise at least one methylation-specific polynucleotide, and/or
  • the one or more means for detecting the expression level of at least one methylation marker comprise mRNA specific polynucleotide, a binding moiety, in particular selected from the group consisting of a protein or peptide, more specifically a monoclonal or polyclonal antibody, and
  • the one or more means for detecting the amount of at least one miRNA marker comprise at least one miRNA specific polynucleotide.
  • a kit comprising the means of aspect 24 or 25.
  • kit according to aspect 26, wherein the kit further comprises
  • cancer in particular BC, OvaCa, and/or PaCA, and/or
  • a device for identifying cancer in particular BC, OvaCa, and/or PaCA, comprising:
  • a detection agent for determining the methylation status and/or expression level of at least one methylation marker selected from the group consisting of HYAL2, MGRNl, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, DYRK4, and
  • an evaluation unit comprising a data processor having tangibly embedded an algorithm for carrying out a comparison of the amount determined by the analyzing unit with a reference and which is capable of generating an output file containing a diagnosis established based on the said comparison.
  • Genomic DNA was isolated from peripheral whole blood using DNA isolation kits from Qiagen.
  • the leucocytes were immediately frozen in liquid nitrogen after isolation and stored at -80°C until use.
  • DNA and RNA were isolated from leucocytes using AllPrep DNA/RNA/Protein Mini Kit from Qiagen. Detailed information for the samples was shown in Table 1. Please see the clinical data of the sporadic BC patients in Table 5 and Table 6.
  • Peripheral blood samples from 270 BRCAl/2 mutation-negative index familial BC patients were collected by the centers of the German Consortium for Hereditary Breast and Ovarian Cancer in Heidelberg and Cologne. All the familial BC cases were recruited according to the criteria of family history.
  • Peripheral blood samples from 350 sporadic BC patients (189 in the second validation round and 161 in the third validation round) were collected at the time point of first BC diagnosis before any BC treatment and surgery at the University Hospital of Heidelberg. The clinical characteristics of sporadic BC patients were defined according to the American Joint Committee on Cancer (AJCC) cancer staging manual.
  • AJCC American Joint Committee on Cancer
  • Peripheral blood samples from 459 healthy female controls (251 in the first validation round and 189 in the second validation round) were collected from blood donors by the German Red Cross Blood Service of Baden- Wiirttemberg-Hessen.
  • Peripheral blood samples from 151 healthy female controls (third validation round) were collected at the University Hospital of Heidelberg. All the cases and controls in the third validation round were processed with the same manner in parallel.
  • Leucocytes were isolated from peripheral blood using red blood cell lysis buffer within four hours after blood collection at the University Hospital of Heidelberg. All the leucocytes from cases and controls were processed in parallel.
  • Peripheral blood samples from 147 sporadic PaCa patients were collected from multiple centers in Germany. The PaCa cases were specially selected with higher percentage of early stage cases.
  • Peripheral blood samples from 191 healthy controls (1 15 male cases and 76 female cases) were collected from blood donors by the German Red Cross Blood Service of Baden- Wurttemberg-Hessen.
  • Peripheral blood samples from 84 sporadic OvCa patients were collected at the University Hospital of Heidelberg.
  • the OvCa cases were specially selected with higher percentage of early stage cases.
  • Peripheral blood samples from 148 healthy controls were collected at the University Hospital of Heidelberg.
  • MALDI-TOF mass spectrometry described by Breitling et al. (Breitling LP, Yang R, Korn B, Burwmkel B, Brenner H. Tobacco-smoking-related differential DNA methylation: 27K discovery and replication. Am J Hum Genet 2011 ;88:450-7.) was used in various verification rounds. DNA was bisulfite converted by EZ-96 DNA Methylation Gold Kit (Zymo Research) and amplified by bisulfite - specific primers (Fig.1). The PCR products were treated according to the standard protocol of Sequenom EpiTyper Assay and dispensed to a 384 SpectroCHIP by a Nanodispenser.
  • the chips were read by a Sequenom Mass Spectrometer system. Data were collected by SpectroACQUIRE v3.3.1.3 software and visualized with MassArray EpiTyper vl .O software. 5% samples were randomly chosen for the duplication analysis.
  • RNA from each sample was transcribed to cDNA by TaqMan® Reverse Transcription Reagents (Applied Biosystems).
  • Quantitative real-time PCR was performed using a LightCycler480 (Roche) in combination with TaqMan gene expression assays (Applied Biosystems) for HYAL2, MGRN1, RPTOR, SLC22A18, FUT7, RAPSN, S 100P, and DYRK4 gene and housekeeping gene HPRT1 as endogenous control.
  • Crossing point values were calculated using the second-derivative maximum method by the LightCycler 480 basic software (Roche). Relative expression of genes for each sample was calculated according to the AACt method by normalization to HPRT1. All the cases and controls were processed in parallel.
  • cagtaatacgactcactatagggagaaggctCTATCCCTCTTACCTCTAAACCCCT sense aggaagagag lAAG IGGAA 1 1 I I G IA 1 1 I I I IGGA
  • cagtaatacgactcactatagggagaaggctACAAACCTTAACCTCCCAAAATACT sense aggaagagagG I GGGG I 1 1 I I G IAG IAG I IGAGA
  • cagtaatacgactcactatagggagaaggctCCTAACCAACAAAAAACCTAAAAAA sense aggaagagagGA I I I I I AG I I GG I GAGAGG I I I GA
  • cagtaatacgactcactatagggagaaggctCTCATCCATATTATAAAAAACCCCC sense aggaagagag I I 1 1 I I I I GGGG I GAG I I 1 1 I I IAG I
  • the Illumina 27K Array data were processed by the Illumina BeadStudio software with default settings. Probes with detection P-value > 0.01 were removed and samples were quantile -normalized. Association of probes with case/control status was assessed by beta-regression models with a logistic link and associated Wald tests using the R package betareg v2.2-3 30. Likelihood ratio tests were used to compare the case/control model with the nested model for chip differences in order to identify possible false hits due to confounding by chip effects. Multiple testing adjustments were done with the Benjamini- Hochberg method controlling the false discovery rate at the level of 0.05. All analysis was performed with the statistical software R v2.1 1.1.
  • EDTA blood samples were collected from cases and control individuals and processed for plasma within 2 hours of collection. To avoid contamination with epithelial cells from the initial skin puncture the first blood tube collected during phlebotomy was not processed for plasma. Blood was centrifuged at 1300g for 20 minutes at 10°C. The supernatant (plasma) was transferred into microcentrifuge tubes followed by a second high-speed centrifugation step at 15500 g for 10 minutes at 10°C to remove cell debris and fragments. The plasma was aliquoted into cryo vials, snap-frozen in liquid nitrogen and stored at -80°C until use. Total RNA (including miRNAs) was extracted from 400 ⁇ ⁇ of plasma.
  • RT Reverse transcription
  • Singleplex (primary breast cancer) or multiplex (metastatic breast cancer) reactions were carried out in a volume of 7.5 ⁇ or 15 ⁇ , respectively.
  • Each reaction comprised lx RT buffer, 1 mM dNTPs, 0.3x miRNA-specific RT primers, 0.25 U RNase inhibitor, 3.3U Multiscribe Reverse Transcriptase and a fixed volume of miRNA template (2 or 1 ⁇ , respectively).
  • RNA samples For benign and malignant breast cancer tissue samples the reactions were carried out in 15 ⁇ and comprised the following: lx RT buffer, ImM dNTPs, 0.6x miRNA-specific and RNU6B RT primers, 0.25U RNase inhibitor, 3.3U Multiscribe Reverse Transcriptase and 5 ng RNA. Blinding of samples and a randomized, simultaneous investigation of cases and controls on reaction plates was intended to minimize bias and batch effects during validation. RT was carried out in a G- STORM GS2 PCR cycler (Alphametrix, Germany) under the following conditions: 16°C for 30 min, 42°C for 30 min and 85°C for 5 min, followed by a hold at 4°C.
  • TaqMan real-time PCR reactions were performed in triplicates in scaled-down reactions comprising 2.5 ⁇ .
  • TaqMan 2x Universal PCR Master Mix with No AmpErase UNG (Applied Biosystems, Germany), 0.25 ⁇ ⁇ 20x miRNA-specific primer/probe mix (Applied Biosystems, Germany) and 2.25 ⁇ ⁇ of the reverse transcription product (diluted 1 :4).
  • Real-time PCR was carried out in a LightCycler 480 thermocycler (Roche, Germany) under the following conditions: 95°C for 10 min, then 50 cycles of 95°C for 15 s, 60°C for 30 s and 72°C for 30 s, followed by a hold at 4°C.
  • Raw data from validation studies in blood plasma was normalized to spiked-in cel-miR-39 as described in Kroh et al. (Kroh EM, Parkin RK, Mitchell PS, Tewari M. Analysis of circulating microRNA biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR). Methods 2010;50:298-301).
  • Raw Ct values from breast tissue samples were normalized to RNU6B as described in User Bulletin #2: ABI PRISM 7700 Sequence Detection System (Applied Biosystems). Comparison of cancer cases with controls
  • ROC receiver operating characteristic
  • ROC curve analysis was performed to evaluate the diagnostic potential of miR-652, miR-801, miR- 376c, miR-376a, miR-127, miR-409, and miR- 148b for breast cancer and prostate cancer detection in blood plasma.
  • the discriminatory power between tumor and control samples is depicted by the areas under the curves (AUC).
  • Peripheral blood samples from 161 sporadic BC patients were collected at the time point of first BC diagnosis before any BC treatment and surgery at the University Hospital of Heidelberg.
  • the clinical characteristics of sporadic BC patients were defined according to the American Joint Committee on Cancer (AJCC) cancer staging manual.
  • Peripheral blood samples from 151 healthy female controls were collected at the University Hospital of Heidelberg. All the cases and controls in the third validation round were processed with the same manner in parallel. The DNA from the whole blood and the miRNA from plasma were extracted from each sample.
  • DNA methylation level Determination of DNA methylation level and miRNA level.
  • the DNA methylation levels were determined by MALDI-TOF mass spectrometry (Sequenom) as described in Example 1.
  • the miRNA levels from Alfam were determined by real-time PCR as described in Exapmle 2.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
PCT/EP2016/053813 2015-02-24 2016-02-24 Biomarker panel for the detection of cancer Ceased WO2016135168A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
MX2017010836A MX386750B (es) 2015-02-24 2016-02-24 MARCADORES DE METILACIÓN Y DE miARN PARA LA DETECCIÓN DE CÁNCER.
EP16710678.0A EP3262190B1 (en) 2015-02-24 2016-02-24 Biomarker panel for the detection of cancer
KR1020177025428A KR20170120124A (ko) 2015-02-24 2016-02-24 암 검출을 위한 바이오마커 패널
BR112017018008-1A BR112017018008B1 (pt) 2015-02-24 2016-02-24 Métodos in vitro de diagnóstico de câncer de mama (bc), para identificar um paciente como responsivo ou não responsivo a um tratamento de bc, uso de um kit e dispositivo para a identificação de bc
DK16710678.0T DK3262190T3 (da) 2015-02-24 2016-02-24 Biomarkørpanel til påvisning af cancer
AU2016223532A AU2016223532B2 (en) 2015-02-24 2016-02-24 Biomarker panel for the detection of cancer
JP2017562131A JP6807873B2 (ja) 2015-02-24 2016-02-24 癌の検出のためのバイオマーカーパネル
EA201791578A EA037995B1 (ru) 2015-02-24 2016-02-24 Панель биомаркеров для обнаружения рака
HK18105993.6A HK1246828A1 (zh) 2015-02-24 2016-02-24 用於检测癌症的生物标志物组
US15/552,421 US10941451B2 (en) 2015-02-24 2016-02-24 Biomarker panel for the detection of cancer
CN201680010907.3A CN107406880A (zh) 2015-02-24 2016-02-24 用于检测癌症的生物标志物组
PL16710678T PL3262190T3 (pl) 2015-02-24 2016-02-24 Panel biomarkerów do wykrywania nowotworu
UAA201708275A UA124612C2 (uk) 2015-02-24 2016-02-24 Панель біомаркерів для виявлення раку
ES16710678T ES2893297T3 (es) 2015-02-24 2016-02-24 Panel de biomarcadores para la detección de cáncer
CA2975952A CA2975952C (en) 2015-02-24 2016-02-24 PANEL OF BIOMARKERS INTENDED FOR CANCER DETECTION
IL253756A IL253756B (en) 2015-02-24 2017-07-31 A panel of biomarkers for cancer detection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15156389 2015-02-24
EP15156389.7 2015-02-24

Publications (1)

Publication Number Publication Date
WO2016135168A1 true WO2016135168A1 (en) 2016-09-01

Family

ID=52589264

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/053813 Ceased WO2016135168A1 (en) 2015-02-24 2016-02-24 Biomarker panel for the detection of cancer

Country Status (16)

Country Link
US (1) US10941451B2 (enExample)
EP (1) EP3262190B1 (enExample)
JP (2) JP6807873B2 (enExample)
KR (1) KR20170120124A (enExample)
CN (1) CN107406880A (enExample)
AU (1) AU2016223532B2 (enExample)
CA (1) CA2975952C (enExample)
DK (1) DK3262190T3 (enExample)
EA (1) EA037995B1 (enExample)
ES (1) ES2893297T3 (enExample)
HK (1) HK1246828A1 (enExample)
IL (1) IL253756B (enExample)
MX (1) MX386750B (enExample)
PL (1) PL3262190T3 (enExample)
UA (1) UA124612C2 (enExample)
WO (1) WO2016135168A1 (enExample)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018236065A1 (ko) * 2017-06-21 2018-12-27 사회복지법인 삼성생명공익재단 대장암 환자의 항암제 치료 반응성 예측용 마커
KR20180138523A (ko) * 2017-06-21 2018-12-31 사회복지법인 삼성생명공익재단 대장암 환자의 항암제 치료 반응성 예측용 마커
WO2019081507A1 (en) 2017-10-23 2019-05-02 Universität Heidelberg NEW MARKERS DERIVED FROM BLOOD FOR CANCER DETECTION
CN110997915A (zh) * 2017-08-23 2020-04-10 国立研究开发法人国立癌研究中心 肝细胞癌的风险评价方法
WO2020169826A1 (en) * 2019-02-21 2020-08-27 Universität Heidelberg Biomarker panel for diagnosis and prognosis of cancer

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7326764B2 (ja) * 2018-03-09 2023-08-16 東ソー株式会社 腫瘍マーカーならびに腫瘍細胞を夾雑細胞と区別して回収および検出する方法
GB201906199D0 (en) * 2019-05-02 2019-06-19 Belgian Volition Sprl Method for the detection of cancer
CN110136776B (zh) * 2019-05-15 2021-04-20 深圳大学 一种从低质量核糖体印迹数据预测基因编码框的方法和系统
CN110269869B (zh) * 2019-07-30 2023-03-31 宁夏医科大学 一种以蜥蜴为主的抗肿瘤药物及验证方法
CN112176419B (zh) * 2019-10-16 2022-03-22 中国医学科学院肿瘤医院 一种检测ctDNA中肿瘤特异基因的变异和甲基化的方法
CN113186279B (zh) * 2020-01-14 2024-07-02 腾辰生物科技(上海)有限公司 用于辅助诊断癌症的透明质酸酶甲基化标志物及试剂盒
CN113122630B (zh) * 2020-01-15 2024-04-30 腾辰生物科技(上海)有限公司 一种用于辅助诊断癌症的钙结合蛋白甲基化标志物
CN118360405A (zh) * 2020-01-19 2024-07-19 腾辰生物科技(上海)有限公司 一种甲基化标志物在辅助诊断食管癌中的应用
CN113215251B (zh) * 2020-02-04 2024-04-26 腾辰生物科技(上海)有限公司 一种辅助诊断癌症的甲基化标志物
CN113215250B (zh) * 2020-02-04 2024-04-30 腾辰生物科技(上海)有限公司 一个基因的甲基化水平在辅助诊断癌症中的应用
CN113528635B (zh) * 2020-04-16 2024-06-11 腾辰生物科技(上海)有限公司 一种印记基因的甲基化作为心脑血管疾病早期诊断的标志物
US20230340607A1 (en) * 2020-07-13 2023-10-26 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Compositions and methods for detecting gene fusions of rad51ap1 and dyrk4 and for diagnosing and treating cancer
CN114480630B (zh) * 2020-10-26 2024-09-06 腾辰生物科技(上海)有限公司 用于辅助诊断癌症的一种甲基化标志物
WO2022170133A1 (en) * 2021-02-04 2022-08-11 The Cleveland Clinic Foundation Micro rna liver cancer markers and uses thereof
CN115341027B (zh) * 2021-05-13 2025-08-26 高飞 急性淋巴细胞白血病dna甲基化标志物及其应用
JP7143480B1 (ja) * 2021-06-10 2022-09-28 株式会社大一商会 遊技機
CN114875131A (zh) * 2022-04-24 2022-08-09 上海市东方医院(同济大学附属东方医院) 靶向膜蛋白甲基化作为印记基因综合征标志物的检测方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003095679A1 (en) * 2002-05-10 2003-11-20 Isis Pharmaceuticals, Inc. Antisense modulation of dyrk4 expression
WO2005007892A1 (en) * 2003-07-03 2005-01-27 Gentron, Llc Methods and systems for diagnosis of non-cenral nervous system (cns) diseases in cns samples
WO2009067655A2 (en) * 2007-11-21 2009-05-28 University Of Florida Research Foundation, Inc. Methods of feature selection through local learning; breast and prostate cancer prognostic markers
WO2013190091A1 (en) * 2012-06-21 2013-12-27 Ruprecht-Karls-Universität Heidelberg CIRCULATING miRNAs AS MARKERS FOR BREAST CANCER
WO2014006160A1 (en) * 2012-07-06 2014-01-09 National University Of Ireland, Galway A mirna oncologic biomarker of breast cancer
WO2014020048A1 (en) * 2012-07-31 2014-02-06 Ruprecht-Karls-Universität Heidelberg Hyal2 methylation and expression as a cancer marker

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005081867A2 (en) 2004-02-20 2005-09-09 The Regents Of The University Of C Alifornia Salivary mrna profiling, biomarkers, and related methods and kits of parts
EP2129796B1 (en) * 2007-02-21 2013-10-23 Oslo Universitetssykehus HF New markers for cancer
CN101245386A (zh) 2008-03-26 2008-08-20 中南大学 用于多种肿瘤抑瘤基因检测的cDNA芯片
EP3181705A1 (en) 2008-11-12 2017-06-21 Caris Life Sciences Switzerland Holdings GmbH Methods and systems of using exosomes for determining phenotypes
JP2011097833A (ja) * 2009-11-04 2011-05-19 Takeshi Zama 特定の遺伝子のメチル化の頻度を、頭頸部腫瘍のバイオマーカーとして使用する方法
WO2011105570A1 (ja) * 2010-02-26 2011-09-01 シスメックス株式会社 生体試料中の癌細胞の存否を判定する方法、判定用分子マーカーおよびキット
BR112013032232A2 (pt) 2011-06-16 2016-09-20 Caris Life Sciences Switzerland Holdings S A R L método de caracterização de câncer através do uso de biomarcador de ácido nucleico
JP2013027387A (ja) 2011-06-21 2013-02-07 Tohoku Univ 膵臓癌バイオマーカー
WO2012175562A2 (en) * 2011-06-21 2012-12-27 University Of Tartu Methylation and microrna markers of early-stage non-small cell lung cancer
JP2014036637A (ja) * 2012-08-20 2014-02-27 Hitachi Chemical Co Ltd 癌の切除手術後の予後を判定するためのデータ分析方法

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003095679A1 (en) * 2002-05-10 2003-11-20 Isis Pharmaceuticals, Inc. Antisense modulation of dyrk4 expression
WO2005007892A1 (en) * 2003-07-03 2005-01-27 Gentron, Llc Methods and systems for diagnosis of non-cenral nervous system (cns) diseases in cns samples
WO2009067655A2 (en) * 2007-11-21 2009-05-28 University Of Florida Research Foundation, Inc. Methods of feature selection through local learning; breast and prostate cancer prognostic markers
WO2013190091A1 (en) * 2012-06-21 2013-12-27 Ruprecht-Karls-Universität Heidelberg CIRCULATING miRNAs AS MARKERS FOR BREAST CANCER
WO2014006160A1 (en) * 2012-07-06 2014-01-09 National University Of Ireland, Galway A mirna oncologic biomarker of breast cancer
WO2014020048A1 (en) * 2012-07-31 2014-02-06 Ruprecht-Karls-Universität Heidelberg Hyal2 methylation and expression as a cancer marker

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
D. CIMINO ET AL: "miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1", THE FASEB JOURNAL, vol. 27, no. 3, 1 March 2013 (2013-03-01), pages 1223 - 1235, XP055209261, ISSN: 0892-6638, DOI: 10.1096/fj.12-214692 *
E. MAS ET AL: "Fucosyltransferase activities in human pancreatic tissue: comparative study between cancer tissues and established tumoral cell lines", GLYCOBIOLOGY, vol. 8, no. 6, 1 June 1998 (1998-06-01), pages 605 - 613, XP055209523, ISSN: 0959-6658, DOI: 10.1093/glycob/8.6.605 *
FARAH J. NASSAR ET AL: "miRNA as Potential Biomarkers of Breast Cancer in the Lebanese Population and in Young Women: A Pilot Study", PLOS ONE, vol. 9, no. 9, 18 September 2014 (2014-09-18), pages e107566, XP055209245, DOI: 10.1371/journal.pone.0107566 *
KATARINA CUK ET AL: "Plasma MicroRNA Panel for Minimally Invasive Detection of Breast Cancer", PLOS ONE, vol. 8, no. 10, 23 October 2013 (2013-10-23), pages e76729, XP055209256, DOI: 10.1371/journal.pone.0076729 *
KOIKE T ET AL: "Hypoxia induces adhesion molecules on cancer cells: A missing link between Warburg effect and induction of selectin-ligand carbohydrates", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 101, no. 21, 25 May 2004 (2004-05-25), pages 8132 - 8137, XP003017165, ISSN: 0027-8424, DOI: 10.1073/PNAS.0402088101 *
M. A. ALVI ET AL: "DNA Methylation as an Adjunct to Histopathology to Detect Prevalent, Inconspicuous Dysplasia and Early-Stage Neoplasia in Barrett's Esophagus", CLINICAL CANCER RESEARCH, vol. 19, no. 4, 15 February 2013 (2013-02-15), pages 878 - 888, XP055081565, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-12-2880 *
MACIEJCZYK ADAM ET AL: "Elevated nuclear S100P expression is associated with poor survival in early breast cancer patients", HISTOLOGY AND HISTOPATHOLOGY, vol. 28, no. 4, April 2013 (2013-04-01), pages 513 - 524, XP009180267 *
MCDERMOTT AILBHE M ET AL: "Identification and Validation of Oncologic miRNA Biomarkers for Luminal A-like Breast Cancer", PLOS ONE, vol. 9, no. 1, January 2014 (2014-01-01), XP002743623 *
MING-BING XIAO: "S100 family signaling network and related proteins in pancreatic cancer (Review)", INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 33, 1 January 2014 (2014-01-01), pages 769 - 776, XP055209195, ISSN: 1107-3756, DOI: 10.3892/ijmm.2014.1633 *
MOHELNIKOVA-DUCHONOVA BEATRICE ET AL: "The association between the expression of solute carrier transporters and the prognosis of pancreatic cancer", CANCER CHEMOTHERAPY AND PHARMACOLOGY, vol. 72, no. 3, September 2013 (2013-09-01), pages 669 - 682, XP002743622 *
WILLIAM COLEMAN: "Dysregulation of microRNA expression drives aberrant DNA hypermethylation in basal-like breast cancer", INTERNATIONAL JOURNAL OF ONCOLOGY, vol. 44, 1 January 2014 (2014-01-01), pages 563 - 572, XP055209248, ISSN: 1019-6439, DOI: 10.3892/ijo.2013.2197 *
WOONG SHICK AHN ET AL: "Differential microRNA expression signatures and cell type-specific association with Taxol resistance in ovarian cancer cells", DRUG DESIGN, DEVELOPMENT AND THERAPY, vol. 8, 1 January 2014 (2014-01-01), pages 293 - 314, XP055209251, DOI: 10.2147/DDDT.S51969 *
YANG RONGXI ET AL: "DNA methylation array analyses identified breast cancer-associated HYAL2 methylation in peripheral blood.", INTERNATIONAL JOURNAL OF CANCER. JOURNAL INTERNATIONAL DU CANCER 15 APR 2015, vol. 136, no. 8, 12 September 2014 (2014-09-12), pages 1845 - 1855, XP002743621, ISSN: 1097-0215 *
ZHAO XIUJUAN ET AL: "MicroRNA-127 Is Downregulated by Tudor-SN Protein and Contributes to Metastasis and Proliferation in Breast Cancer Cell Line MDA-MB-231", ANATOMICAL RECORD, vol. 296, no. 12, December 2013 (2013-12-01), pages 1842 - 1849, XP002743624 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018236065A1 (ko) * 2017-06-21 2018-12-27 사회복지법인 삼성생명공익재단 대장암 환자의 항암제 치료 반응성 예측용 마커
KR20180138523A (ko) * 2017-06-21 2018-12-31 사회복지법인 삼성생명공익재단 대장암 환자의 항암제 치료 반응성 예측용 마커
KR102100557B1 (ko) * 2017-06-21 2020-04-14 사회복지법인 삼성생명공익재단 대장암 환자의 항암제 치료 반응성 예측용 마커
CN110997915A (zh) * 2017-08-23 2020-04-10 国立研究开发法人国立癌研究中心 肝细胞癌的风险评价方法
EP3674405A4 (en) * 2017-08-23 2021-05-19 National Cancer Center PROCEDURE FOR EVALUATING THE RISK OF LIVER CELL CARCINOMA
WO2019081507A1 (en) 2017-10-23 2019-05-02 Universität Heidelberg NEW MARKERS DERIVED FROM BLOOD FOR CANCER DETECTION
WO2020169826A1 (en) * 2019-02-21 2020-08-27 Universität Heidelberg Biomarker panel for diagnosis and prognosis of cancer

Also Published As

Publication number Publication date
DK3262190T3 (da) 2021-10-11
MX386750B (es) 2025-03-19
AU2016223532A1 (en) 2017-08-17
UA124612C2 (uk) 2021-10-20
EP3262190B1 (en) 2021-09-01
US20180245159A1 (en) 2018-08-30
EA201791578A1 (ru) 2018-02-28
IL253756B (en) 2021-04-29
JP2021052777A (ja) 2021-04-08
PL3262190T3 (pl) 2021-12-20
EA037995B1 (ru) 2021-06-21
HK1246828A1 (zh) 2018-09-14
JP6807873B2 (ja) 2021-01-13
ES2893297T3 (es) 2022-02-08
AU2016223532B2 (en) 2021-07-01
BR112017018008A2 (pt) 2018-04-10
JP2018509934A (ja) 2018-04-12
IL253756A0 (en) 2017-09-28
US10941451B2 (en) 2021-03-09
EP3262190A1 (en) 2018-01-03
MX2017010836A (es) 2018-02-09
CN107406880A (zh) 2017-11-28
CA2975952C (en) 2025-02-06
KR20170120124A (ko) 2017-10-30
CA2975952A1 (en) 2016-09-01

Similar Documents

Publication Publication Date Title
US10941451B2 (en) Biomarker panel for the detection of cancer
US12129522B2 (en) MicroRNA assay for detection and management of pancreatic cancer precursors
US20160251729A1 (en) ncRNA AND USES THEREOF
EP2873740A1 (en) Methods for the surveillance, diagnosis and screening of bladder cancer
JP2014036672A (ja) 新しい癌マーカー
US20220127678A1 (en) Biomarker panel for diagnosis and prognosis of cancer
WO2016024915A1 (en) A method for prognosis of ovarian cancer, patient's stratification
AU2015317893A1 (en) Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm
US20120148561A1 (en) Use of runx3 and mir-532-5p as cancer markers and therapeutic targets
Sin et al. Down‐regulation of TROP‐2 predicts poor prognosis of hepatocellular carcinoma patients
WO2014020048A1 (en) Hyal2 methylation and expression as a cancer marker
ES2352777B1 (es) Metodo y kit para el pronostico del linfoma de celulas del manto
BR112017018008B1 (pt) Métodos in vitro de diagnóstico de câncer de mama (bc), para identificar um paciente como responsivo ou não responsivo a um tratamento de bc, uso de um kit e dispositivo para a identificação de bc
KR20240041438A (ko) 아포크린아형 삼중음성유방암의 진단 또는 예후 예측용 신규한 바이오마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16710678

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 253756

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2975952

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 201791578

Country of ref document: EA

REEP Request for entry into the european phase

Ref document number: 2016710678

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016223532

Country of ref document: AU

Date of ref document: 20160224

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15552421

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2017562131

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/010836

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017018008

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20177025428

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: A201708275

Country of ref document: UA

ENP Entry into the national phase

Ref document number: 112017018008

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170823