WO2016076507A1 - 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법 - Google Patents

렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법 Download PDF

Info

Publication number
WO2016076507A1
WO2016076507A1 PCT/KR2015/007355 KR2015007355W WO2016076507A1 WO 2016076507 A1 WO2016076507 A1 WO 2016076507A1 KR 2015007355 W KR2015007355 W KR 2015007355W WO 2016076507 A1 WO2016076507 A1 WO 2016076507A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
pluripotent stem
induced pluripotent
stem cells
leptin
Prior art date
Application number
PCT/KR2015/007355
Other languages
English (en)
French (fr)
Inventor
김재호
도은경
Original Assignee
부산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부산대학교 산학협력단 filed Critical 부산대학교 산학협력단
Publication of WO2016076507A1 publication Critical patent/WO2016076507A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/2264—Obesity-gene products, e.g. leptin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Definitions

  • the present invention relates to a composition for inducing dedifferentiation from somatic cells to induced pluripotent stem cells comprising a leptin protein or a gene encoding the same, and a method for inducing dedifferentiation from somatic cells to induced pluripotent stem cells using the composition. .
  • Stem cells have the characteristics of pluripotent cells capable of self-renewal and differentiation into the various cells that make up our bodies. Accordingly, the regeneration of damaged tissues using stem cells and the possibility of treating various intractable diseases are expanding.
  • Embryonic stem cells are pluripotent stem cells derived from the blastocyst and inner cell mass of frozen embryos. Embryonic stem cells are attracting much attention for the purpose of therapeutic development and cell therapy of regenerative medicine because their self-renewal is superior to adult stem cells and there is no limit to differentiation capacity.
  • adult stem cells are present in the body tissues of adults, and can be easily separated from various tissues such as fat, bone marrow, and liver, but have difficulty in securing many cells due to their poor proliferation, and compared with embryonic stem cells. There is a problem of poor differentiation capacity (Murry, CE, and Keller, G. 2008. Cell 132, 661-680).
  • iPS cells induced pluripotent stem cells
  • iPS cells induced pluripotent stem cells
  • Transcription factors that may be introduced for reverse differentiation typically include Oct4, Sox2, Klf4 and c-Myc.
  • Oct4 is an octamer transcription factor and is a member of the POU family, which is known to play an important role in maintaining undifferentiated cells.
  • Such dedifferentiation technology can eliminate the problem of bioethics, which is a controversial issue of embryonic stem cells, and can be produced as cells isolated from their adult cells, so that the problem of immune rejection does not occur. It is increasing the potential for new cell therapies with cell similarity (Zaehres, H., and Scholer, HR 2007. Cell 131, 834-835).
  • induced pluripotent stem cells have been spotlighted as a breakthrough technology that can be used for patient-specific disease treatment, but there are still various problems to be overcome in order to be used for clinical application for cell therapy.
  • induced pluripotent stem cells produced through overexpression of genes that can induce tumors such as c-Myc are acting as a threat to safety. Accordingly, recent studies have focused on the discovery of new dedifferentiation transcription factors that can increase the efficiency of dedifferentiation, provide excellent stability and replace c-myc.
  • Reptin a member of RVBs, is an ATP-dependent DNA helicase and plays an important role in processes such as transcriptional regulation, histone modification, and DNA damage. It is known.
  • the binding partner of leptin which is mostly known, is pontin, and the two proteins are combined as complexes and play an important role in transcription regulation. To date, the role of leptin in the differentiation of somatic cells into induced pluripotent stem cells has not been elucidated.
  • the inventors of the present invention while studying the novel differentiation factor into induced pluripotent stem cells that can replace the c-myc gene that can cause tumors, the result of overexpressing the leptin protein by introducing the leptin gene into somatic cells, By staging stably and efficiently into induced pluripotent stem cells, the induced pluripotent stem cells produced by confirming that they have pluripotency or differentiation, the present invention was completed.
  • Another object of the present invention is to provide a method for inducing differentiation of somatic cells into induced pluripotent stem cells using the composition.
  • the present invention provides a composition for inducing differentiation into induced pluripotent stem cells from somatic cells comprising a leptin protein or a gene encoding the same.
  • the present invention also provides a method for inducing dedifferentiation from somatic cells to induced pluripotent stem cells, comprising the step of introducing a leptin gene into somatic cells.
  • Overexpression of leptin according to the present invention can induce efficient reverse differentiation from somatic cells to induced pluripotent stem cells without the use of c-myc genes known to be tumor-prone.
  • the induced pluripotent stem cells prepared using the leptin are excellent in pluripotency or differentiation ability, and thus can be differentiated into various cells such as cardiomyocytes, insulin producing cells and neurons, and cells for the treatment of various diseases. It may be used as a therapeutic agent for stem cell transplantation.
  • 1 is a diagram showing the result confirmed by Western blot decreases the protein expression of leptin in somatic cells by shRNA against leptin.
  • Figure 2 is a diagram showing the results confirmed by alkaline phosphatase staining the degree of reverse differentiation into induced pluripotent stem cells after inhibiting the expression of leptin simultaneously with overexpression of Oct4, Sox2, Klf4 and c-Myc in mouse somatic cells.
  • FIG. 3 is a diagram showing the results of confirming the RNA expression of pluripotent specific markers in induced pluripotent stem cells in which the expression of leptin is suppressed by shRNA against leptin.
  • Figure 4 is a diagram showing the result confirmed by Western blot increase in leptin protein expression by the lenti virus in mouse somatic cells.
  • FIG. 5 is a diagram showing the results obtained by alkaline phosphatase staining after the overexpression of Oct4, Sox2, Klf4, c-Myc and Reptin at the same time in mouse somatic cells to induced pluripotent stem cells.
  • FIG. 6 is a diagram showing the results of quantifying reprogramming efficiency after overexpressing Oct4, Sox2, Klf4, c-Myc and Reptin in mouse somatic cells simultaneously.
  • FIG. 7 is a diagram showing the results of confirming the RNA expression of pluripotent specific markers after simultaneously overexpressing Oct4, Sox2, Klf4, c-Myc and Reptin in mouse somatic cells.
  • FIG. 8 is a diagram showing the results of confirming the pluripotency of the induced pluripotent stem cells differentiated using leptin through immunostaining using Oct4, Sox2, Nanog and SSEA-1.
  • FIG. 9 is a diagram showing the results of the differentiation capacity of the induced pluripotent stem cells differentiated using leptin through teratoma formation and H & E staining.
  • Figure 10 is a diagram showing the results confirmed by alkaline phosphatase staining the degree of reverse differentiation into induced pluripotent stem cells when overexpression of Oct4, Sox2 and Klf4 in the mouse somatic cells, except at the same time with overexpression of Oct4, Sox2 and Klf4.
  • FIG. 11 is a diagram showing the results obtained by alkaline phosphatase staining the degree of reverse differentiation into induced pluripotent stem cells when overexpressing Oct4, Sox2, Klf4 and leptin at the same time except c-Myc in mouse somatic cells.
  • the present invention provides a composition for inducing differentiation from somatic cells comprising leptin protein or gene encoding the same into induced pluripotent stem cells.
  • induced pluripotent stem cell means a cell having pluripotency
  • induced pluripotent stem cells are proliferation without transformation, infinite proliferation, self-reproduction and three kinds Means that there are characteristics of embryonic stem cells, including, but not limited to, the ability to develop into any cell derived from all embryonic layers of.
  • Induced pluripotent stem cells in the present invention may also be described as embryonic stem cell-like cells, or induced pluripotent stem cells.
  • Dedifferentiation in the present invention refers to an epigenetic retrograde process that allows partial or final differentiated cells to return to an undifferentiated state, such as pluripotency or pluripotency, to allow formation of new differentiated tissue.
  • This reverse differentiation is possible because epigenetic changes in the cell genome are not fixed but are reversible processes that can be erased and re-formed.
  • Reverse differentiation also referred to as "reprogramming,” relates to the process of changing the genetic and expressive profile of partially or finally differentiated cells to be similar to that of embryonic stem cells. For example, such changes include changes in methylation patterns, changes in expression rates of stem cell genes, and the like.
  • the laptin protein preferably consists of the amino acid sequence represented by SEQ ID NO: 1 and includes functional equivalents thereof.
  • the term "functional equivalent” means at least 70%, preferably 80%, more preferably 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 1 as a result of the addition, substitution, or deletion of the amino acid.
  • it refers to a protein having a sequence homology of 95% or more, and exhibits substantially homogeneous physiological activity with the leptin protein consisting of the amino acid sequence represented by SEQ ID NO: 1.
  • Leptin proteins of the invention include not only proteins having their natural amino acid sequence, but also amino acid sequence variants thereof are also within the scope of the present invention.
  • a variant of a laptin protein means a protein in which the leptin natural amino acid sequence and one or more amino acid residues have different sequences by deletion, insertion, non-conservative or conservative substitution, or a combination thereof.
  • Amino acid exchanges in proteins and peptides that do not alter the activity of the molecule as a whole are known in the art.
  • the leptin protein or variant thereof can be extracted from nature or synthesized (Merrifleld, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or by genetic recombination methods based on DNA sequences (Sambrook et al. al, Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989).
  • the leptin protein of the present invention may be encoded by the nucleotide sequence of SEQ ID NO: 2, and a variant capable of functioning identically to the nucleotide sequence is included within the scope of the present invention.
  • the leptin gene is artificially synthesized using a nucleic acid synthesizer or the like with reference to the base sequence of the gene, or a primer of an oligonucleotide having a sequence complementary to both ends of a leptin gene of interest as a template of leptin genomic DNA. It can be prepared by performing PCR using.
  • the leptin gene of the present invention may exist in various base sequences, all of which fall within the scope of the present invention.
  • variants of the nucleotide sequence represented by SEQ ID NO: 2 are included in the scope of the present invention.
  • the leptin gene has a base sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 2, respectively. It may include.
  • the "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
  • the gene encoding the leptin protein may be delivered intracellularly by methods known in the art, for example, naked DNA in the form of a vector (Wolff et al. Science, 1990: Wolffet al. J Cell Sci. 103: 1249-59, 1992), liposomes, cationic polymers (Cationic polymer) and the like can be delivered into the cell.
  • the gene encoding the leptin protein may be preferably included in an expression vector.
  • vector refers to a gene construct, which is an expression vector capable of expressing a protein of interest in a suitable host cell, and which contains essential regulatory elements operably linked to express a gene insert.
  • Vectors of the present invention include signal or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals, enhancers, and can be prepared in various ways depending on the purpose.
  • the promoter of the vector may be constitutive or inducible.
  • the expression vector includes a selectable marker for selecting a host cell containing the vector and, in the case of a replicable expression vector, a replication origin. Vectors can self replicate or integrate into host DNA.
  • Such vectors include plasmid vectors, cosmid vectors, viral vectors and the like. Preferably, it is a viral vector.
  • Viral vectors are retroviruses such as Human immunodeficiency virus (HIV), Murineleukemia virus (MLV), Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), Rus sarcoma virus (RSV), and Mouse mammary (MMTV).
  • tumor viruses including adenoviruses (Adenovirus), adeno-associated virus (Adeno associated virus), herpes simplex virus (herpes simplex virus), and the like, and in one embodiment of the present invention, pLOVE lentiviral vector was used, It is not limited.
  • composition for inducing differentiation from somatic cells into induced pluripotent stem cells may include at least one protein selected from the group consisting of Oct4, Sox2 and Klf4 in addition to leptin; Or it may further comprise one or more genes encoding the protein.
  • the somatic cell may be derived from primates, mice, mice, dogs, cats, horses or cattle, but is not limited thereto.
  • the kind of the somatic cell is not particularly limited, and any somatic cell can be used.
  • Induced pluripotent stem cells de-differentiated from somatic cells by the above method does not use the c-myc gene, so it is less likely to induce tumors, and thus has pluripotency or differentiation ability. It is available.
  • the present invention also provides a method for inducing dedifferentiation from somatic cells to induced pluripotent stem cells, comprising the step of introducing a leptin gene into somatic cells.
  • one or more genes selected from the group consisting of Oct4, Sox2 and Klf4 may be further introduced into the somatic cells in addition to the leptin gene.
  • culture refers to the growth of microorganisms under suitable artificial conditions.
  • the somatic cells can be grown in a conventional medium, for example, can be cultured in Nutrient broth medium.
  • the medium may contain a nutritional substance required by the microorganism to be cultured, that is, the culture medium in order to cultivate a specific microorganism, and may be mixed with an additional substance for a special purpose.
  • the medium may also be referred to as an incubator or a culture medium, and is a concept that includes all natural, synthetic, or selective media. Somatic cells of the present invention can be cultured according to a conventional culture method.
  • shRNA synthesized based on the nucleotide sequence of the leptin gene (CCGGCCGAGAACAGATCAATGCAAACTCGAGTTTGCATTGATCTGTTCTCGGTTTTTG, TRCN0000047035, sigma, USA) was inserted into the pLOVE lentiviral vector.
  • PLKO-puro lentiviral vector was used as a control. Lentiviruses were made using each vector and then transfected into mouse somatic cells.
  • the shRNA and lentiviral packaging mix (pLP1, pLP2, pLP-VSV-G, Invitrogen Life Technologies) for the leptin were transfected into HEK293 cells, and the virus was recovered after 48 hours.
  • Lipofectamine-Plus (Invitrogen Life Technologies) was used according to the manufacturer's instructions. After incubating the mouse somatic cells for 18 hours in a medium containing the transfection mixture and 10ug / ml polybrene (polybrene, sigma, USA), the medium was replaced. The transfected cells were collected after 72 hours of culture, and protein expression was confirmed by western blotting.
  • Antibodies were used as primary antibodies against Reptin (ab36569, abcam, Cambridge) and GAPDH (MAB374, EMD Millipore Corp, Billerica, Mass.). The results are shown in FIG.
  • Alkaline phosphatase is widely used as a marker for the identification of undifferentiated characteristics of induced pluripotent stem cells.Staining is carried out using Vector Red Alkaline Phosphatase Substrate Kit I (Alkaline Phosphatase Kit (86R, sigma, USA)) according to the manufacturer's instructions. Was carried out. The results are shown in FIG.
  • Example 2-1 the induced pluripotent stem cells formed in Example 2-1 were collected after 28 days of culture and RNA was separated therefrom to determine the expression level of leptin, Oct4, Sox2 and Nanog by qRT-PCR (quantitative-real time PCR). ) was confirmed.
  • qRT-PCR quantitative-real time PCR
  • first strand-cDNA was extracted from RNA using 2 ⁇ g total RNA sample, 0.5 ⁇ g oligo (dT) 15 primer and molomo murine leukemia virus reverse transcriptase (invitrogen) according to the manufacturer's instructions. Synthesized.
  • leptin gene inhibited the induction of dedifferentiation from somatic cells to induced pluripotent stem cells.
  • leptin was transfected into HEK293 cells using a pLOVE lentiviral vector containing a leptin gene, and the virus was isolated. After the virus was infected with mouse somatic cells, the amount of protein expression of leptin was confirmed by western blotting. The control group used an empty vector. The results are shown in FIG.
  • pLOVE-Reptin was transduced simultaneously with pMXs-Oct4, pMXs-Sox2, pMXs-Klf4 and pMXs-c-Myc in the same manner as in Example 2-1 to induce the formation of induced pluripotent stem cells.
  • colonies stained with alkaline phosphatase were quantified and analyzed, and the cells were recovered to confirm RNA expression changes of pluripotent specific markers. The results are shown in FIGS. 5 to 7.
  • RNA expression of Oct4, Sox2, Zfp42 and Nanog which are specific markers for induced pluripotent stem cells, was highly expressed by overexpression of leptin.
  • Example 3-2 Obtained in Example 3-2 In order to confirm the characteristics of induced pluripotent stem cells, the following experiment was performed.
  • Example 3-2 After 28 days of formation of the obtained induced pluripotent stem cells, the pluripotency and the degree of differentiation were evaluated by immunostaining and teratoma formation. First, a cover glass was attached to a 24-well culture dish for immunostaining and coated with 1% gelatin (sigma, USA), followed by culturing induced pluripotent stem cells. Cells were then collected, placed in 4% paraformaldehyde solution for 10 minutes, washed twice with phosphate buffer (PBS), and blocked for 1 hour with 2% BSA (Bovine serum albumin, sigma, USA). It was.
  • PBS phosphate buffer
  • the marker markers of embryonic stem cell pluripotency were SSEA-1 (Santa Cruz, CA), Oct4 (Santa Cruz, CA), Sox2 (Abcam, Cambridge), and Nanog (Cell signaling, Danvers) primary antibodies
  • fluorescent labeling was performed by reacting alexa-fluor488 with alexa-luor568 (Invitrogen) secondary antibody.
  • mounting was performed using Vectashield medium (Vector laboratories) containing DAPI (4 ', 6-diamidino-2-phenylindole). Random regions were photographed at a magnification of 800 times with a confocal laser scanning microscope (Olympus fluoview FV1000) to confirm the expression level of immunofluorescent stained cells.
  • teratoma formation method was performed according to the regulations of the Institutional Animal Care and Use Committee.
  • anesthesia was injected by injecting 2,2,2-tribromoethanol (Avertin, sigma) at a concentration of 400 mg / kg into balb / c nude mice (Orient Bio).
  • 1x10 6 induced pluripotent stem cell cells of Example 3-2 diluted in DMEM were mixed with Matrigel (matrigel, BD, CA) and then administered to the subcutaneous tissue by 100 ⁇ l.
  • teratoma-forming mice were sacrificed by CO 2 inhalation and the teratoma site was isolated and placed in 4% paraformaldehyde solution. The tissues were washed with phosphate buffer solution, and H & E (Hematoxylin and Eosin) staining was performed according to the manufacturer's instructions.
  • the experimental results are shown in FIGS. 8 and 9.
  • Example 3-2 As shown in Fig. 8, in Example 3-2, it was confirmed that SSEA-1, Oct4, Sox2 and Nanog, which are pluripotent marker markers of embryonic stem cells, were expressed in the obtained cells. Through this, it was confirmed that the induction of reverse differentiation from somatic cells to pluripotent induced pluripotent stem cells through overexpression of leptin.
  • Example 3-2 It was confirmed that teratomas were formed in the endoderm, mesoderm and ectoderm of the mice to which the obtained cells were administered. Through this, induced pluripotent stem cells obtained by using the overexpression of leptin was confirmed to have a differentiation capacity characteristic of embryonic stem cells.
  • leptin can induce the differentiation of somatic cells into induced pluripotent stem cells having pluripotency and differentiation ability.
  • Example 2 while overexpressing Oct4, Sox2 and Klf4 in a state in which c-Myc expression is excluded from mouse somatic cells, the expression of leptin is suppressed to reverse differentiation into induced pluripotent stem cells. Induced.
  • Example 3 while overexpressing Oct4, Sox2, and Klf4 in the state in which c-Myc expression was excluded from mouse somatic cells, leptin was overexpressed and induced differentiation into induced pluripotent stem cells. Two days as described above, 42 days after the induction of reverse differentiation from somatic cells into induced pluripotent stem cells, colonies stained by alkaline phosphatase staining were quantified and analyzed. The results are shown in FIGS. 10 to 11.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Obesity (AREA)
  • Endocrinology (AREA)

Abstract

본 발명은 렙틴(Reptin) 단백질 또는 이를 코딩하는 유전자를 포함하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물; 및 상기 조성물을 이용한 체세포로부터 유도만능줄기세포로의 역분화 유도방법에 관한 것이다. 본 발명에 따른 렙틴의 과발현을 통해 종양 유발 가능성이 있다고 알려진 c-myc 유전자 등의 이용 없이 체세포로부터 유도만능줄기세포로의 효율적인 역분화를 유도할 수 있다. 또한, 상기 렙틴을 이용하여 제조된 유도만능줄기세포는 만능성 또는 분화능력이 우수하여, 심근세포, 인슐린 생산세포 및 신경세포 등의 다양한 세포로 분화가 가능한 바, 다양한 질환의 치료를 위한 대한 세포치료제로서 줄기세포 이식요법 등에 활용될 수 있다.

Description

렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법
본 발명은 렙틴(Reptin) 단백질 또는 이를 코딩하는 유전자를 포함하는 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물, 및 상기 조성물을 이용한 체세포로부터 유도만능줄기세포로의 역분화 유도방법에 관한 것이다.
줄기세포(stem cells)는 자가 재생(self-renewal)이 가능하고, 우리 몸을 구성하는 다양한 세포로의 분화가 가능한 만능세포의 특성을 가지고 있다. 이에 따라, 줄기세포를 이용한 손상된 조직의 재생(regeneration) 및 다양한 난치성 질환들의 치료 가능성이 확대되고 있다.
줄기세포에는 크게 배아줄기세포와 성체줄기세포, 그리고 최근 보고된 유도만능줄기세포가 포함된다(Watt, F.M., and Hogan, B.L. 2000. Science 287, 1427-1430). 배아줄기세포(embryonic stem cells)는 냉동 배아의 배반포(blastocyst) 및 내부세포괴(inner cell mass)로부터 유래한 만능줄기세포(pluripotent stem cells)이다. 배아줄기세포는 자가 재생이 성체줄기세포 보다 뛰어나고 분화능력에 제한이 없어 재생의학의 치료개발과 세포치료의 목적으로 큰 주목을 받고 있다. 반면 성체줄기세포는 성인의 각 신체 조직에 존재하며, 지방, 골수, 간 등 다양한 조직으로부터 쉽게 분리가 가능하지만, 증식이 원활지 않아 많은 세포를 확보하는데 어려움이 있고, 배아줄기세포와 비교하였을 때 분화능력이 떨어지는 문제점이 있다(Murry, C.E., and Keller, G. 2008. Cell 132, 661-680).
한편, 유도만능줄기세포(iPS cells; induced pluripotent stem cells)는 성인의 체세포(somatic cell)에 특정 역분화 전사인자를 도입해 만능세포의 상태로 변환시킨 것으로, 2006년 일본의 신야 야마나카(Shinya Yamanaka) 박사 팀에 의해 개발되었다(Takahashi, K., and Yamanaka, S. 2006. Cell 126, 663-676). 역분화를 위해 도입될 수 있는 전사인자에는 대표적으로 Oct4, Sox2, Klf4 및 c-Myc이 포함된다. 이 중 Oct4는 옥타머 전사인자(octamer transcription factor)이며 POU 계열의 구성원으로 세포가 미분화 상태를 유지하는데 중요한 작용을 하는 것으로 알려져 있다. 이러한 역분화 기술은 배아줄기세포의 논쟁대상이 되는 생명윤리에 대한 문제를 배제할 수 있고, 자신의 성체세포에서 분리된 세포로 제작이 가능하여 면역거부반응에 대한 문제가 발생하지 않으므로, 배아줄기세포와 유사성을 가진 새로운 세포치료제로서의 가능성을 높여주고 있다(Zaehres, H., and Scholer, H.R. 2007. Cell 131, 834-835).
상기와 같이 유도만능줄기세포는 환자 맞춤형 질병치료에 활용될 수 있는 획기적인 기술로 각광받고 있으나, 세포치료를 위한 임상적용에 활용되기 위해서는 아직 극복해야 할 여러 가지 문제점들이 있다. 특히, c-Myc 등 종양을 유발할 수 있는 유전자의 과발현을 통하여 제작된 유도만능줄기세포는 안전성을 위협하는 한계점으로 작용하고 있다. 이에 따라, 최근 연구들은 역분화의 효율을 높이고, 안정성이 우수하며 c-myc을 대체할 수 있는 새로운 역분화 전사인자의 발굴에 초점을 맞추고 있다.
한편, 렙틴(Reptin)은 RVBs 구성원으로, ATP-의존 DNA 헬리카제(ATP-dependent DNA helicase)이며, 전사 조절, 히스톤 변형(histone modification) 및 DNA 손상(DNA damage) 등의 과정에 중요한 역할을 하고 있는 것으로 알려져 있다. 주로 많이 알려져 있는 렙틴의 결합 파트너는 폰틴(Pontin)이며 두 단백질은 복합체로서 결합된 형태로 전사 조절에 중요한 작용을 한다. 현재까지 체세포에서 유도만능줄기세포로의 역분화 과정에서 렙틴의 역할에 대해서는 밝혀진 바가 없다.
본 발명자들은 종양을 유발할 수 있는 c-myc 유전자를 대체할 수 있는 신규한 유도만능줄기세포로의 역분화 인자에 대해 연구하던 중, 렙틴 유전자를 체세포에 도입하여 렙틴 단백질을 과발현시킨 결과, 체세포에서 유도만능줄기세포로 안정적이고 효율적으로 역분화가 이루어지고, 생산된 유도만능줄기세포는 만능성 또는 분화능력을 가지고 있음을 확인함으로써, 본 발명을 완성하였다.
본 발명의 목적은 렙틴 단백질 또는 이를 코딩하는 유전자를 포함하는 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 조성물을 이용한 체세포로부터 유도만능줄기세포로의 역분화 유도방법을 제공하는 것이다.
상기와 같은 과제를 해결하기 위해, 본 발명은 렙틴 단백질 또는 이를 코딩하는 유전자를 포함하는 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물을 제공한다.
또한 본 발명은, 렙틴 유전자를 체세포에 도입하는 단계;를 포함하는, 체세포로부터 유도만능줄기세포로의 역분화 유도방법을 제공한다.
본 발명에 따른 렙틴의 과발현을 통해 종양 유발 가능성이 있다고 알려진 c-myc 유전자 등의 이용 없이 체세포로부터 유도만능줄기세포로의 효율적인 역분화를 유도할 수 있다. 또한, 상기 렙틴을 이용하여 제조된 유도만능줄기세포는 만능성 또는 분화능력이 우수하여, 심근세포, 인슐린 생산세포 및 신경세포 등의 다양한 세포로 분화가 가능한 바, 다양한 질환의 치료를 위한 대한 세포치료제로서 줄기세포 이식요법 등에 활용될 수 있다.
도 1은 렙틴에 대한 shRNA에 의해 체세포에서 렙틴의 단백질 발현이 감소하는 것을 웨스턴 블랏을 통해 확인한 결과를 나타낸 도이다.
도 2는 마우스 체세포에 Oct4, Sox2, Klf4 및 c-Myc의 과발현과 동시에 렙틴의 발현을 억제한 후, 유도만능줄기세포로의 역분화 정도를 알칼리 포스파타제 염색을 통해 확인한 결과를 나타낸 도이다.
도 3은 렙틴에 대한 shRNA에 의해 렙틴의 발현이 억제된 유도만능줄기세포에서 만능성 특이 마커들의 RNA 발현 정도를 확인한 결과를 나타낸 도이다.
도 4는 마우스 체세포에서 렌티 바이러스에 의한 렙틴 단백질 발현의 증가를 웨스턴 블랏을 통해 확인한 결과를 나타낸 도이다.
도 5는 마우스 체세포에 Oct4, Sox2, Klf4, c-Myc 및 Reptin을 동시에 과발현한 후, 유도만능줄기세포로의 역분화 정도를 알칼리 포스파타제 염색을 통해 확인한 결과를 나타낸 도이다.
도 6은 마우스 체세포에 Oct4, Sox2, Klf4, c-Myc 및 Reptin을 동시에 과발현한 후, 리프로그래밍(reprogramming) 효율을 수치화한 결과를 나타낸 도이다
도 7은 마우스 체세포에 Oct4, Sox2, Klf4, c-Myc 및 Reptin을 동시에 과발현한 후, 만능성 특이 마커들의 RNA 발현 정도를 확인한 결과를 나타낸 도이다.
도 8은 렙틴을 이용하여 역분화된 유도만능줄기세포의 만능성을 Oct4, Sox2, Nanog 및 SSEA-1을 이용한 면역염색법을 통해 확인한 결과를 나타낸 도이다.
도 9는 렙틴을 이용하여 역분화된 유도만능줄기세포의 분화능력을 기형종 형성(teratoma formation) 및 H&E 염색법을 통해 확인한 결과를 나타낸 도이다.
도 10은 마우스 체세포에 c-Myc을 제외하고 Oct4, Sox2 및 Klf4의 과발현과 동시에 렙틴의 발현을 억제 시, 유도만능줄기세포로의 역분화 정도를 알칼리 포스파타제 염색을 통해 확인한 결과를 나타낸 도이다.
도 11은 마우스 체세포에 c-Myc을 제외하고 Oct4, Sox2, Klf4 및 렙틴을 동시에 과발현 시, 유도만능줄기세포로의 역분화 정도를 알칼리 포스파타제 염색을 통해 확인한 결과를 나타낸 도이다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 렙틴 단백질 또는 이를 코딩하는 유전자를 포함하는 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물을 제공한다.
본 발명에서, "유도만능줄기세포(induced pluripotent stem cell, iPS cell, iPSC)" 는 전분화성을 가지는 세포를 의미하며, 유도만능줄기세포는 형질전환 없는 증식, 무한증식, 자가-재생산 및 3종류의 모든 배아 층으로부터 유래된 어떠한 세포로 발달할 수 있는 능력을 포함하는 배아줄기세포의 특성이 있음을 의미하나, 이에 제한되지는 않는다. 본 발명에서 유도만능줄기세포는 배아줄기세포 유사세포, 또는 유도된 전분화성 줄기세포로도 기술되기도 한다.
본 발명에서 "역분화 (dedifferentiation)"는 부분 또는 최종 분화된 세포를 만능 또는 다능과 같은 미분화 상태로 되돌려서, 새로운 분화 조직의 형성이 가능하도록 하는 후성학적인 역행 과정을 의미한다. 이러한 역분화 현상은 세포 유전체의 후성학적인 변형(epigenetic changes)들이 고정되어 있는 것이 아니라 지워지고 다시 형성될 수 있는 가역적인 과정이기 때문에 가능하다. 역분화는 "재프로그램화(reprogramming)"라고도 불리며, 부분 또는 최종 분화된 세포의 유전적 및 표현적 프로필을 배아줄기세포의 그것과 비슷하도록 변화시키는 과정에 관한 것이다. 예를 들면, 상기 변화는 메틸화 패턴의 변화, 줄기세포성 유전자의 발현률 변화 등을 포함한다.
본 발명에서, 랩틴 단백질은 바람직하게는 서열번호 1로 표시되는 아미노산 서열로 이루어지며, 이의 기능적 동등물을 포함한다.
상기 "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 1로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 1로 표시되는 아미노산 서열로 이루어진 렙틴 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다.
본 발명의 렙틴 단백질에는 이의 천연형 아미노산 서열을 갖는 단백질뿐만 아니라 이의 아미노산 서열 변이체가 또한 본 발명의 범위에 포함된다. 랩틴 단백질의 변이체란 렙틴 천연 아미노산 서열과 하나 이상의 아미노산 잔기가 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합에 의하여 상이한 서열을 가지는 단백질을 의미한다. 분자의 활성을 전체적으로 변경시키지 않는 단백질 및 펩티드에서의 아미노산 교환은 당해 분야에 공지되어 있다. 상기 렙틴 단백질 또는 이의 변이체는 천연에서 추출하거나 합성(Merrifleld, J. Amer. chem. Soc. 85:2149-2156, 1963) 또는 DNA 서열을 기본으로 하는 유전자 재조합 방법에 의해 제조될 수 있다 (Sambrook et al, Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2판, 1989).
본 발명의 렙틴 단백질은 서열번호 2의 염기서열로 코딩될 수 있으며, 상기 염기서열과 기능적으로 동일한 작용을 할 수 있는 변이체가 본 발명의 범위 내에 포함된다.
본 발명에 있어서, 렙틴 유전자는 당해 유전자의 염기 서열을 참조하여 핵산 합성기 등을 이용하여 인공적으로 합성하거나, 렙틴 게놈 DNA를 주형으로 목적한 렙틴 유전자의 양 말단에 상보적인 서열을 가지는 올리고 뉴클레오타이드를 프라이머로 이용하여 PCR을 실시함으로써 제조할 수 있다. 한편, 코돈의 축퇴성으로 인하여 본 발명의 렙틴 유전자는 다양한 염기 서열로 존재할 수 있으며, 이들은 모두 본 발명의 범주에 포함된다. 또한, 상기 서열번호 2로 표시되는 염기서열의 변이체가 본 발명의 범주에 포함된다. 구체적으로, 상기 렙틴 유전자는 서열번호 2의 염기서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 보다 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
상기 렙틴 단백질을 코딩하는 유전자는 당 분야의 공지 방법, 예를 들어 벡터 형태의 네이키드 DNA로 세포내로 전달하거나(Wolff et al. Science,1990: Wolffet al. J Cell Sci. 103:1249-59, 1992), 리포좀(Liposome), 양이온성 고분자(Cationic polymer)등을 이용하여 세포 내로 전달할 수 있다.
상기 렙틴 단백질을 코딩하는 유전자는, 바람직하게는 발현벡터에 포함될 수 있다.
본 발명에서 용어, "벡터"란 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 발현 벡터로서, 유전자 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 작제물을 말한다.
본 발명의 벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널, 인핸서 같은 발현 조절 요소 외에도 막 표적화 또는 분비를 위한 신호 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 벡터의 프로모터는 구성적 또는 유도성일 수 있다. 또한, 발현벡터는 벡터를 함유하는 숙주 세포를 선택하기 위한 선택성 마커를 포함하고, 복제 가능한 발현벡터인 경우 복제 기원을 포함한다. 벡터는 자가 복제하거나 숙주 DNA에 통합될 수 있다.
상기 벡터는 플라스미드 벡터, 코즈미드 벡터, 바이러스 벡터 등을 포함한다. 바람직하게는, 바이러스 벡터이다. 바이러스 벡터는 레트로바이러스(Retrovirus), 예를 들어 HIV(Human immunodeficiency virus), MLV(Murineleukemia virus) ASLV(Avian sarcoma/leukosis), SNV(Spleen necrosis virus), RSV(Rous sarcoma virus), MMTV(Mouse mammary tumor virus) 등, 아데노바이러스(Adenovirus), 아데노 관련 바이러스(Adenoassociatedvirus), 헤르페스 심플렉스 바이러스(Herpes simplex virus) 등에서 유래한 벡터를 포함하며, 본 발명의 일실시예에서는 pLOVE lentiviral 벡터를 이용하였으며, 이에 제한되지 않는다.
상기 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물은 렙틴 이외에 Oct4, Sox2 및 Klf4으로 이루어진 군으로부터 선택되는 1종 이상의 단백질; 또는 상기 단백질을 코딩하는 1종 이상의 유전자를 더 포함할 수 있다.
본 발명에 있어서, 상기 체세포(somatic cell)는 영장류, 생쥐, 쥐, 개, 고양이, 말 또는 소로부터 유래될 수 있으며, 이에 제한되지 않는다. 상기 체세포의 종류는 특별히 한정되지 않으며, 임의의 체세포를 이용할 수 있다.
본 발명의 일실시예에서는, 렙틴 단백질을 코딩하고 서열번호 2로 표시되는 염기 서열로 이루어진 유전자; 및 Oct4, Sox2 또는 Klf4 유전자 각각을 발현 벡터에 삽입하고, 이를 패키징 세포주에 형질감염한 후, 상기 형질 감염된 세포에서 생성된 렌티 바이러스 및 레트로 바이러스를 수득하고, 상기 바이러스 용액을 체세포에 처리하여 배양하였다. 상기 방법에 의하여 체세포로부터 역분화된 유도만능줄기세포는 c-myc 유전자를 이용하지 않아, 종양 유발 가능성이 낮아 이에 대한 안정성이 있고, 만능성 또는 분화능력이 있어 다양한 질환에 대한 줄기세포 이식요법에 이용할 수 있다.
또한 본 발명은, 렙틴 유전자를 체세포에 도입하는 단계;를 포함하는, 체세포로부터 유도만능줄기세포로의 역분화 유도방법을 제공한다.
상기 체세포로부터 유도만능줄기세포로의 역분화 유도를 위해, 렙틴 유전자 이외에 Oct4, Sox2 및 Klf4으로 이루어진 군으로부터 선택되는 1종 이상의 유전자를 더 체세포에 도입할 수 있다.
본 발명의 일 실시예에서는, 렙틴 단백질을 코딩하고 서열번호 2로 표시되는 염기 서열로 이루어진 유전자; Oct4, Sox2 또는 Klf4 유전자 각각을 삽입한 발현 벡터를 패키징 세포주에 형질감염(transfection)하여 렌티 바이러스 또는 레트로 바이러스를 생성하고, 상기 바이러스 용액을 체세포에 처리하여 배양함으로써, 체세포로부터 유도만능줄기세포로의 역분화를 유도하였다.
본 발명에 있어서, "배양" 용어는 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다.
상기 체세포는 통상의 배지에서 생육 가능하며, 일 예로 뉴트리엔트 브로스(Nutrient broth) 배지에서 배양할 수 있다. 상기 배지는 특정 미생물을 배양하기 위하여 배양대상 즉 배양체가 되는 미생물이 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 하며, 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이다. 본 발명의 체세포는 통상의 배양방법에 따라 배양할 수 있다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. 렙틴(Reptin) shRNA 및 이를 이용한 형질감염 세포의 제조
렙틴 유전자의 발현 저해를 위하여 렙틴에 대한 shRNA를 이용하여 마우스 체세포를 형질감염시키기 위해, 하기와 같은 실험을 수행하였다.
먼저, 마우스 체세포 내에서 렙틴의 전사를 억제하기 위하여, 렙틴 유전자의 염기서열을 바탕으로 합성한 shRNA(CCGGCCGAGAACAGATCAATGCAAACTCGAGTTTGCATTGATCTGTTCTCGGTTTTTG,TRCN0000047035, sigma, 미국)를 pLOVE lentiviral 벡터에 삽입하여 사용하였다. 대조군으로 pLKO-puro lentiviral 벡터를 사용하였다. 각 벡터를 이용하여 렌티바이러스를 만든 후, 이를 마우스 체세포에 형질감염하였다. 보다 구체적으로, 렌티바이러스를 만들기 위해서 상기 렙틴에 대한 shRNA와 lentiviral packaging mix(pLP1, pLP2, pLP-VSV-G, Invitrogen Life Technologies)를 HEK293 세포에 형질주입 시킨 후, 48시간 후에 바이러스를 회수하였다. 형질주입 시, 제조사의 지시에 따라 Lipofectamine-Plus(Invitrogen Life Technologies)를 사용하였다. 상기 형질주입 혼합물과 10ug/ml 폴리브레인(polybrene, sigma, 미국)이 포함된 배지에서 마우스 체세포를 18시간동안 배양한 후, 배지를 교체하였다. 배양 72시간 후 상기 형질감염 세포를 수집하고, 웨스턴블롯팅(western blotting)을 통해 단백질 발현을 확인하였다. 항체는 Reptin(ab36569, abcam, Cambridge) 및 GAPDH(MAB374, EMD Millipore Corp, Billerica, MA)에 대한 1차 항체를 사용하였다. 그 결과를 도 1에 나타내었다.
도 1에 나타낸 바와 같이, 렙틴에 대한 shRNA가 형질주입된 마우스 체세포(sh-Reptin)에서 대조군에 비해 렙틴의 단백질 발현이 현저하게 억제되는 것을 확인하였다.
실시예 2. 렙틴의 발현 저해에 따른 유도만능줄기세포로의 역분화 유도 효율 및 유도만능줄기세포 특이적 마커들의 발현 변화 분석
2-1. 렙틴 유전자 발현 억제가 유도만능줄기세포로의 역분화 유도 효율에 미치는 영향 분석
렙틴의 유전자 발현 억제가 체세포의 유도만능줄기세포로의 역분화 유도에 미치는 영향을 분석하기 위하여, 하기와 같은 실험을 수행하였다.
먼저, 마우스 체세포에 레트로바이러스를 사용하여 4가지 역분화 전사인자(Oct4, Sox2, Klf4, c-Myc)들을 도입하였다. 보다 구체적으로, Plat-GP 세포에 entroviral packaging mix(VSV, gag-pol)와 함께 pMXs-Oct4, pMXs-Sox2, pMXs-Klf4 또는 pMXs-c-Myc을 각각 처리한 후, 레트로바이러스를 수집하였다. 수집된 4가지 바이러스 용액을 1:1:1:1의 비율로 섞어준 후 10mg/ml 폴리브레인을 처리하여 섬유 모세포에 18시간 동안 반응 시킨 후 배지(DMEM+10%FBS)를 교체하였다. 2일 후, 마이토마이신 C가 처리된 섬유 모세포 위에 상기 역분화 전사인자들이 도입된 세포 5x104개를 처리한 후 배양하였다. 상기와 같은 조건에서 실시예 1의 렙틴 shRNA를 사용하여 렌티바이러스를 만든 후, 이를 다른 4가지 역분화 전사인자들과 동일한 비율로 동시에 섬유 모세포에 형질주입한 후, 동일한 방법으로 배양하였다. 대조군(sh-control)과 렙틴의 발현을 억제한 조건(sh-Reptin)에서 유도되는 유도만능줄기세포의 형성은 알칼리 포스파타제(alkaline phosphatase, AP) 염색법을 이용하여 관찰하였으며, 이를 위해 배양 28일 경과 후 알칼리 포스파타제에 의해 염색되는 콜로니들을 수치화하여 분석하였다. 알칼리 포스파타제는 유도만능줄기세포의 미분화 특성을 규명하기 위한 표지인자로서 널리 사용되고 있는 방법이며, 염색은 제조사의 지시에 따라 Vector Red Alkaline Phosphatase Substrate Kit I(Alkaline Phosphatase Kit(86R, sigma, 미국))을 사용하여 수행하였다. 그 결과를 도 2에 나타내었다.
도 2에 나타낸 바와 같이, 마우스 체세포에 Oct4, Sox2, Klf4 및 c-Myc의 과발현과 동시에 shRNA를 이용하여 렙틴의 발현을 억제시킬 경우, 유도만능줄기세포로의 역분화가 저해됨을 확인하였다.
2-2. 렙틴 유전자 발현 억제가 유도만능줄기세포 특이적 마커들의 발현에 미치는 영향 분석
렙틴 유전자 발현 억제가 유도만능줄기세포 특이적 마커들의 발현에 미치는 영향을 분석하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 실시예 2-1에서 형성된 유도만능줄기세포를 배양 28일 경과 후 수집하고 이로부터 RNA를 분리하여 렙틴, Oct4, Sox2 및 Nanog의 발현 정도를 qRT-PCR(quantitative-real time PCR)로 확인하였다. qRT-PCR을 수행하기 위해, 먼저 2μg의 총 RNA 시료, 0.5μg의 oligo(dT) 15 프라이머 및 molomo murine leukemia virus 역전사 효소(invitrogen)를 이용하여 제조사의 지시에 따라 RNA로부터 제1가닥-cDNA를 합성하였다. 이후 2x SYBR Green PCR master mix(Applied Biosystems) 및 하기 표 1에 개시된 프라이머가 각각 10 pM의 농도로 함유된 20μl의 반응용액을 이용하여 동량의 cDNA를 증폭시킨 후, 각 마커 유전자의 발현량을 분석하였다. 이때 하우스킵핑 유전자인 β-actin의 발현량을 기준으로 상대적인 발현 정도를 구하였다. 그 결과를 도 3에 나타내었다.
표 1
유전자 프라이머 서열 (5'-3') 서열번호
Reptin Forward: TCCTAGCCGATTTCCGTTTC 3
Reverse: GGATCTCAGGGACTTTGGTG 4
Oct4 Forward: GGAAAGCAACTCAGAGGGAA 5
Reverse: TTCTAGCTCCTTCTGCAGGG 6
Sox2 Forward: GCGGAGTGGAAACTTTTGTC 7
Reverse: TATTTATAATCCGGGTGCTCCTT 8
Nanog Forward: CACCCACCCATGCTAGTCTT 9
Reverse: ACCCTCAAACTCCTGGTCCT 10
β-actin Forward: GTGGGCCGCTCTAGACACCA 11
Reverse: CGGTTGGCCTTAGGGTTCAGGGGGGG 12
도 3에 나타낸 바와 같이, shRNA에 의해 렙틴의 발현이 억제된 유도만능줄기세포(sh-Reptin)에서 유도만능줄기세포 특이적 마커인 Oct4, Sox2 및 Nanog의 RNA 발현이 대조군에 비해 감소됨을 확인하였다.
따라서 상기 결과를 통하여 렙틴 유전자의 발현에 의해 체세포에서 유도만능줄기세포로의 역분화 유도가 억제됨을 확인하였다.
실시예 3. 렙틴의 과발현에 따른 유도만능줄기세포로의 역분화 유도 효율 분석
3-1. 렙틴의 과발현을 위한 체세포의 형질감염
렙틴의 과발현을 위한 체세포 형질감염을 수행하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 실시예 1과 동일한 방법으로, 렙틴 유전자를 포함하는 pLOVE lentiviral 벡터를 이용하여 렙틴을 HEK293 세포에 형질주입한 후 바이러스를 분리하였다. 상기 바이러스를 마우스 체세포에 감염시킨 후, 웨스턴 블롯팅을 통해 렙틴의 단백질 발현양을 확인하였다. 대조군은 공벡터를 사용하였다. 그 결과를 도 4에 나타내었다.
도 4에 나타낸 바와 같이, 렌티바이러스에 의해 렙틴이 과발현된 마우스 체세포(Reptin) 내에서 대조군에 비해 렙틴의 단백질 발현이 현저하게 증가되는 것을 확인하였다.
3-2. 과발현된 렙틴이 유도만능줄기세포로의 역분화 유도 효율에 미치는 영향 분석
과발현된 렙틴이 유도만능줄기세포로의 역분화 유도 효율에 미치는 영향을 분석하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 실시예 2-1와 동일한 방법으로 pMXs-Oct4, pMXs-Sox2, pMXs-Klf4 및 pMXs-c-Myc과 동시에 pLOVE-Reptin을 형질 주입하여 유도만능줄기세포의 형성을 유도하였다. 역분화 유도 과정 21일 경과 후, 알칼린 포스파타제에 의해 염색되는 콜로니들을 수치화 하여 분석하였고, 상기 세포를 회수 하여 만능성 특이 마커들의 RNA 발현 변화를 확인하였다. 그 결과를 도 5 내지 도 7에 나타내었다.
도 5 및 도 6에 나타낸 바와 같이, 마우스 체세포에 Oct4, Sox2, Klf4, c-Myc 및 Reptin을 동시에 과발현 시, 유도만능줄기세포로 유도되는 수가 증가함을 확인하였다.
도 7에 나타낸 바와 같이, 렙틴의 과발현에 의해 유도만능줄기세포에 대한 특이 마커인 Oct4, Sox2, Zfp42 및 Nanog의 RNA 발현이 높게 발현됨을 확인하였다.
따라서, 마우스 체세포에 Oct4, Sox2, Klf4, c-Myc 및 렙틴을 동시에 과발현하면 체세포에서 유도만능줄기세포로의 역분화 유도 효율이 증가함을 확인하였다.
실시예 4. 배아줄기세포와 유사한 유도만능줄기세포의 특성(characterization) 확인
상기 실시예 3-2에서 수득한 유도만능줄기세포의 특성을 확인하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 실시예 3-2에서 수득한 유도만능줄기세포의 형성 28일 경과 후, 만능성과 분화능력의 정도를 면역염색법과 기형종 형성 방법으로 평가하였다. 먼저, 면역염색법(immunostaining)을 위해 24웰 배양 디쉬(dish)에 커버글라스(cover glass)를 부착시키고 1% 젤라틴(sigma, 미국)으로 코팅한 뒤, 유도만능줄기세포를 배양하였다. 이후 세포를 수집하고 4% 파라포름알데하이드(paraformaldehyde) 용액에 10분간 넣어 둔 후, 인산완충용액(PBS)으로 2회 세척하고, 2% BSA(Bovine serum albumin, sigma, 미국)로 1시간 동안 블로킹하였다. 블로킹 후, 배아줄기세포 만능성의 표지 마커인 SSEA-1(Santa Cruz, CA), Oct4(Santa Cruz, CA), Sox2(Abcam, Cambridge) 및 Nanog(Cell signaling, Danvers) 1차 항체와 1시간동안 반응시킨 후, alexa-fluor488과 alexa-luor568(Invitrogen) 이차 항체와 반응시켜 형광표지를 수행하였다. 이 후 세포 핵의 형광 표지를 위하여 DAPI(4',6-diamidino-2-phenylindole)가 포함된 Vectashield medium(Vector laboratories)을 사용하여 마운팅 하였다. 무작위 영역을 공초점 레이저 스캐닝 현미경(Olympus fluoview FV1000)으로 800배의 배율로 촬영하여 면역형광 염색된 세포의 발현 정도를 확인하였다.
다음으로, 기형종 형성 방법은 동물실험 윤리위원회(Institutional Animal Care and Use Committee)의 규정에 의거하여 수행하였다. 기형종 형성(teratoma formation)을 위하여, 먼저 balb/c nude 마우스(오리엔트 바이오)에 2,2,2-트리브로모에탄올(Avertin, sigma)을 400mg/kg의 농도로 복강에 주사하여 마취시켰다. DMEM에 희석된 상기 실시예 3-2의 유도만능줄기세포 세포 1x106개를 마트리겔(matrigel, BD, CA)과 섞은 후, 100μl씩 피하조직에 투여하였다. 투여 4주 경과 후, 기형종이 형성된 마우스를 CO2 흡입으로 희생시키고 기형종 부위를 분리하여 4% 파라포름알데하이드 용액에 넣어두었다. 상기 조직을 인산완충용액으로 세척하고, 제조사의 지시에 따라 H&E(Hematoxylin and Eosin) 염색을 수행하였다. 이상의 실험 결과를 도 8 및 도 9에 나타내었다.
도 8에 나타낸 바와 같이, 상기 실시예 3-2에서 수득한 세포에서 배아줄기세포의 만능성 표지 마커인 SSEA-1, Oct4, Sox2 및 Nanog가 발현됨을 확인하였다. 이를 통해, 렙틴의 과발현을 통해 체세포로부터 만능성을 가진 유도만능줄기세포로의 역분화 유도가 가능함을 확인하였다.
또한, 도 9에서 나타낸 바와 같이, 상기 실시예 3-2에서 수득한 세포가 투여된 마우스의 내배엽(endoderm), 중배엽(mesoderm) 및 외배엽(ectoderm)에서 기형종이 형성됨을 확인하였다. 이를 통해, 렙틴의 과발현을 이용하여 수득한 유도만능줄기세포는 배아줄기세포의 특징인 분화 능력을 갖고 있음을 확인하였다.
따라서 렙틴의 과발현을 통해 체세포로부터 만능성 및 분화능력을 가지고 있는 유도만능줄기세포로의 역분화를 유도할 수 있음을 확인하였다.
실시예 5. c-Myc의 사용을 배재하고 유도만능줄기세포로의 역분화 유도 시, 렙틴의 영향 분석
c-Myc의 사용을 배재하고 유도만능줄기세포로의 역분화 유도 시, 렙틴의 영향을 분석하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 실시예 2와 같은 방법으로, 마우스 체세포에 c-Myc의 발현을 배재한 상태에서 Oct4, Sox2 및 Klf4의 과발현과 동시에 렙틴의 발현을 억제하여 유도만능줄기세포로의 역분화를 유도하였다. 또한, 상기 실시예 3과 같은 방법으로, 마우스 체세포에 c-Myc의 발현을 배재한 상태에서 Oct4, Sox2 및 Klf4의 과발현과 동시에 렙틴을 과발현하여 유도만능줄기세포로의 역분화를 유도하였다. 상기와 같은 2가지 방법으로 체세포에서 유도만능줄기세포로의 역분화 유도 42일 경과 후, 알칼리 포스파타제 염색에 의해 염색되는 콜로니를 수치화하여 분석하였다. 그 결과를 도 10 내지 도 11에 나타내었다.
도 10에 나타낸 바와 같이, 마우스 체세포에 c-Myc을 제외하고 Oct4, Sox2 및 Klf4의 과발현과 동시에 렙틴의 발현을 억제시키면 유도만능줄기세포로의 역분화 유도가 제대로 이루어지지 않음을 확인하였다.
또한, 도 11에 나타낸 바와 같이, 마우스 체세포에 c-Myc을 제외하고 Oct4, Sox2, Klf4 및 렙틴을 동시에 과발현하면 체세포에서 유도만능줄기세포로의 역분화 유도 효율이 증가되는 것을 확인하였다.
따라서, c-Myc의 발현을 배재하여도 렙틴의 과발현을 통해 효율적으로 유도만능줄기세포로의 역분화 유도가 가능함을 확인하였다.

Claims (7)

  1. 렙틴(Reptin) 단백질 또는 이를 코딩하는 유전자를 포함하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물.
  2. 제1항에 있어서, 상기 렙틴 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 것을 특징으로 하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물.
  3. 제1항에 있어서,상기 렙틴 단백질을 코딩하는 유전자는 서열번호 2로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물.
  4. 제1항에 있어서, 상기 렙틴 단백질을 코딩하는 유전자는 발현벡터에 포함되어 있는 것을 특징으로 하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물.
  5. 제1항에 있어서, 상기 조성물은 Oct4, Sox2 및 Klf4으로 이루어진 군으로부터 선택되는 1종 이상의 단백질; 또는 상기 단백질을 코딩하는 1종 이상의 유전자를 포함하는 것을 특징으로 하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물.
  6. 제1항에 있어서, 상기 유도만능줄기세포는 만능성 또는 분화능력을 갖는 것을 특징으로 하는, 체세포로부터 유도만능줄기세포로의 역분화 유도용 조성물.
  7. 렙틴 유전자를 체세포에 도입하는 단계;를 포함하는, 체세포로부터 유도만능줄기세포로의 역분화 유도방법.
PCT/KR2015/007355 2014-11-10 2015-07-15 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법 WO2016076507A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140155497A KR101698984B1 (ko) 2014-11-10 2014-11-10 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법
KR10-2014-0155497 2014-11-10

Publications (1)

Publication Number Publication Date
WO2016076507A1 true WO2016076507A1 (ko) 2016-05-19

Family

ID=55954561

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/007355 WO2016076507A1 (ko) 2014-11-10 2015-07-15 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법

Country Status (2)

Country Link
KR (1) KR101698984B1 (ko)
WO (1) WO2016076507A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019194549A1 (ko) * 2018-04-02 2019-10-10 고려대학교 산학협력단 체세포에서 유도 만능 줄기세포로의 역분화 유도용 조성물 및 이를 이용한 역분화 유도방법
CN111909897A (zh) * 2020-08-14 2020-11-10 宜兴市人民医院 Ruvbl2在调控人脐带间质干细胞增殖和/或分化中的应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024048820A1 (ko) * 2022-09-01 2024-03-07 서울대학교산학협력단 돼지 줄기세포 만능성 평가 시스템 및 이를 이용한 만능성 평가 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BARTHELERY, M.: "Nuclear Proteomics of Human Embryonic Stem Cell Neural Differentiation", 2008, DOCTORAL THESIS, The Pennsylvania State University, The Graduate School, College of Medicine. *
DATABASE GenBank 15 July 2006 (2006-07-15), "Homo sapiens RuvB-like 2(E. coli), mRNA (cDNA clone MGC:2945 IMAGE:3051517", Database accession no. BC004531.2 *
DO, E. K. ET AL.: "Reptin regulates pluripotency of embryonic stem cells and somatic cell reprogramming through Oct4-dependent mechanism", 26TH INTERNATIONAL CONFERENCE OF THE KOREAN SOCIETY FOR MOLECULAR AND CELLULAR BIOLOGY, 21 October 2014 (2014-10-21), COEX, Seoul, Korea *
JAISHANKAR, A. ET AL.: "Molecular Characterization of Human Stem Cells", DOCTORAL THESIS, 2010, The Pennsylvania State University, The Graduate School, College of Medicine. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019194549A1 (ko) * 2018-04-02 2019-10-10 고려대학교 산학협력단 체세포에서 유도 만능 줄기세포로의 역분화 유도용 조성물 및 이를 이용한 역분화 유도방법
US11987816B2 (en) 2018-04-02 2024-05-21 Korea University Research And Business Foundation Composition for inducing dedifferentiation from somatic cells to induced pluripotent stem cells and method of inducing dedifferentiation using same
CN111909897A (zh) * 2020-08-14 2020-11-10 宜兴市人民医院 Ruvbl2在调控人脐带间质干细胞增殖和/或分化中的应用
CN111909897B (zh) * 2020-08-14 2021-12-21 宜兴市人民医院 Ruvbl2在调控人脐带间质干细胞增殖和/或分化中的应用

Also Published As

Publication number Publication date
KR101698984B1 (ko) 2017-01-24
KR20160056367A (ko) 2016-05-20

Similar Documents

Publication Publication Date Title
KR102134240B1 (ko) 세포의 재프로그램화 방법 및 이의 용도
AU2014250190B2 (en) Method for producing reprogrammed derivative neuronal stem cell from non-neuronal cell by using HMGA2
ES2575605T3 (es) Método de generación de células madre pluripotentes inducidas y células diferenciadas
CN102712903A (zh) 从脐带血产生诱导的多能干细胞
KR20130133703A (ko) 다능성 줄기세포의 제작, 유지, 증식을 증진하는 대사산물 및 이를 포함하는 조성물과 배양방법
WO2016076507A1 (ko) 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법
US10190097B2 (en) Method and composition for inducing human pluripotent stem cells
KR100794362B1 (ko) Ｎａｎｏｇ를 이용한 아스트로사이트의 신경줄기세포로의역분화
WO2019216667A1 (ko) Sox2, c-Myc를 이용하여 비신경 세포로부터 직접 리프로그래밍된 유도신경줄기세포를 제조하는 방법
US20140024119A1 (en) Cell reprogramming composition comprising rex1 and an induced pluripotent stem cell production method using the same
JP2021532736A (ja) 神経幹細胞組成物および神経変性障害を処置するための方法
WO2015133792A1 (ko) 체세포로부터 혈관 전구 세포로의 직접교차분화 유도용 조성물 및 이의 용도
KR101211624B1 (ko) Ｓｈｈ, ＦＧＦＲ 티로신 키나아제 억제제, ＭＥＫ 억제제와 ＧＳＫ 억제제를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
KR101211610B1 (ko) Ｂｍｉ１, ＭＥＫ 억제제와 ＧＳＫ 억제제를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
Angel et al. Nanog overexpression allows human mesenchymal stem cells to differentiate into neural cells——Nanog transdifferentiates mesenchymal stem cells
WO2020209636A1 (ko) 소변세포로부터 신장전구세포로의 직접 역분화를 유도하는 방법 및 이의 방법으로 역분화된 신장전구세포를 포함하는 신장세포 손상 질환 예방 또는 치료용 약학 조성물
KR20120134360A (ko) 세포의 역분화 증진용 조성물 및 이를 이용한 유도 만능 줄기세포의 제조방법
KR102137883B1 (ko) 페닐부틸산나트륨을 포함하는 고효율 세포전환용 배지 첨가제
KR101188878B1 (ko) 퍼모파민 및 Ｏｃｔ４를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
KR101158402B1 (ko) Ｂｍｉ１ 및 Ｏｃｔ４를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
KR20090132236A (ko) 비바이러스성 형질전환방법을 이용한 유도 다능성줄기세포의 확립 방법 및 그 용도
KR102137885B1 (ko) 부틸화하이드록시아니솔을 포함하는 고효율 세포전환용 배지 첨가제
KR101211962B1 (ko) Ｂｍｉ１, Ｇ９ａＨＭＴａｓｅ 억제제와 ＤＭＮＴ 억제제를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
KR101188876B1 (ko) Ｓｈｈ 및 Ｏｃｔ４를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
CN116157511A (zh) 一种用于诱导体细胞直接转分化为运动神经元的组合物以及其使用方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15858585

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15858585

Country of ref document: EP

Kind code of ref document: A1