WO2015065897A1 - Cancer models and associated methods - Google Patents
Cancer models and associated methods Download PDFInfo
- Publication number
- WO2015065897A1 WO2015065897A1 PCT/US2014/062378 US2014062378W WO2015065897A1 WO 2015065897 A1 WO2015065897 A1 WO 2015065897A1 US 2014062378 W US2014062378 W US 2014062378W WO 2015065897 A1 WO2015065897 A1 WO 2015065897A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fgf19
- subject
- tumor
- variant
- indicia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
- A61K38/1825—Fibroblast growth factor [FGF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0331—Animal model for proliferative diseases
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
- G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/70—Mechanisms involved in disease identification
- G01N2800/7023—(Hyper)proliferation
- G01N2800/7028—Cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/70—Mechanisms involved in disease identification
- G01N2800/7057—(Intracellular) signaling and trafficking pathways
- G01N2800/7066—Metabolic pathways
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
Definitions
- the invention relates to, among other things, models useful in determining whether polypeptide variants of a fibroblast growth factor having glucose-lowering activity also exhibit favorable oncology-related profiles, and methods and uses involving the foregoing. Also provided are methods of antagonizing the oncogenic activity of FGF19 in a subject and, in certain
- methods of preventing or treating a disease, disorder or condition such as a FGF19-dependent disease, disorder or condition, or a symptom thereof.
- Diabetes mellitus is a debilitating metabolic disease caused by the absence of insulin production (type 1), or insulin resistance or insufficient insulin production (type 2) from pancreatic ⁇ - cells, endocrine cells that manufacture and store insulin for release following a meal.
- Type 1 insulin production
- type 2 insulin resistance or insufficient insulin production
- High blood glucose levels stimulate the secretion of insulin by pancreatic ⁇ -cells.
- Insulin in turn, stimulates the entry of glucose into muscles and adipose cells, leading to the storage of glycogen and triglycerides and to the synthesis of proteins.
- Activation of insulin receptors on various cell types diminishes circulating glucose levels by increasing glucose uptake and utilization, and by reducing hepatic glucose output. Disruptions within this regulatory network can result in diabetes and associated pathologic conditions.
- An individual having a glucose metabolism disorder can suffer from hyperglycemia, hyperinsulinemia, and/or glucose intolerance, along with a host of related disorders.
- insulin resistance a disorder often associated with aberrant levels of glucose and/or insulin, is characterized by hepatic, fat, and muscle cells losing their ability to respond to normal blood insulin levels.
- glucose metabolism disorders adversely affect a large and growing number of individuals throughout the world.
- Obesity which is most commonly caused by excessive food intake coupled with limited energy expenditure and/or lack of physical exercise, often accompanies various glucose metabolism disorders.
- Obesity increases the likelihood of an individual developing various diseases, such as diabetes mellitus, hypertension, atherosclerosis, coronary artery disease, gout, rheumatism and arthritis.
- mortality risk directly correlates with obesity, such that, for example, a body- mass index in excess of 40 results in an average decreased life expectancy of more than 10 years.
- FGF19 Fibroblast Growth Factor 19
- a use or method of treatment of a subject is intended to or results in reduced glucose levels, increased insulin sensitivity, reduced insulin resistance, reduced glucagon, an improvement in glucose tolerance, or glucose metabolism or homeostasis, improved pancreatic function, or reduced triglyceride, cholesterol, intermediate density lipoproteins (IDL), low density lipoproteins (LDL) or very low density lipoproteins (VLDL) levels, or a decrease in blood pressure, a decrease in intimal thickening of the blood vessel, or a decrease in body mass or weight gain.
- IDL intermediate density lipoproteins
- LDL low density lipoproteins
- VLDL very low density lipoproteins
- the present disclosure contemplates a method for determining whether a test subject having a metabolic disorder is a candidate for treatment with a FGF19 variant, the method comprising a) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject having a metabolic disorder, wherein the amount of the FGF19 or the FGF19 surrogate administered to the test subject is sufficient to induce a cancerous condition in a reference population, and b) determining whether an indicia of a cancerous condition is observed in the test subject; wherein the absence of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant.
- FGF19 surrogate is meant to include any molecule (e.g., a polypeptide) capable of eliciting a same or a comparable effect as FGF19, wherein the effect is generally cancer-related (e.g., the induction of tumor formation or any other indicia of a cancerous condition).
- An FGF19 surrogate is frequently a variant of FGF19, including active fragments, having at least about 75%, at least about 80%, at least about 85%), at least about 90%>, at least about 93%>, at least about 95%, at least about 96%, at least about 97%), at least about 98%>, or at least about 99%, amino acid sequence identity to a contiguous strefch of from about 150 amino acids to about 160 amino acids, from about 160 amino acids to about 170 amino acids, from about 170 amino acids to about 180 amino acids, from about 180 amino acids to about 190 amino acids, or about 194 amino acids or more, of one of the amino acid sequences described herein.
- an indicia of a cancerous condition broadly refers to any indication that a cancerous disease, disorder or condition has formed, is forming or is likely to form. Most cancers are initially recognized either because of the appearance of signs or symptoms or through screening. Definitive diagnoses generally require, among other means, one or more of pathological examination of a tissue sample, blood tests, x-rays, CT scans and endoscopy.
- Cancerous conditions refer to any type or classification of cancer, including carcinomas, sarcomas, lymphomas and leukemias, and blastomas.
- Cancer symptoms are usually caused by the effect of a cancer on the part of the body where it is forming (e.g., unusual lumps on the breasts or changes in moles on the skin), although cancerous diseases, disorders and/or conditions may cause more general symptoms such as weight loss or fatigue.
- an indicia of a cancerous condition (or disorder or disease) is frequently a tumor (e.g., a colon tumor or a hepatic tumor). Observations and measurements of a reduction in tumor number, tumor size, or tumor weight frequently indicate that a treatment modality is having a positive effect.
- the indicia of a cancerous condition is/are associated with hepatocellular carcinoma (HCC, also referred to as malignant hepatoma), the most common type of liver cancer.
- HCC hepatocellular carcinoma
- HCC may present with jaundice, bloating from ascites, easy bruising from blood clotting abnormalities, loss of appetite, weight loss, abdominal pain, nausea, emesis or fatigue. HCC is discussed further hereafter.
- the present disclosure contemplates a method for determining whether a test subject having a metabolic disorder is a candidate for treatment with a FGF19 variant, the method comprising a) providing a test subject having an indicia of a cancerous condition, the subject having a metabolic disorder, b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate administered to the test subject is sufficient to induce a cancerous condition in a reference population, and c) determining whether an indicia of a cancerous condition is enhanced in the test subject; wherein the absence of enhancement of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant.
- the present disclosure contemplates a method for determining whether a test subject having a metabolic disorder is a candidate for treatment with a FGF19 variant, the method comprising a) providing a test subject having an indicia of a cancerous condition, the test subject having a metabolic disorder, b) and co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate is administered to the test subject is sufficient to induce a cancerous condition in a reference population, and c) determining whether an indicia of a cancerous condition is reduced in the test subject; wherein the reduction of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant.
- the present disclosure also contemplates a method for determining whether a FGF19 variant is a candidate for treating a test subject having a metabolic disorder, the method comprising co-administering FGF19 or a FGF19 surrogate, and the FGF19 variant to the test subject having a metabolic disorder, wherein the amount of the FGF19 or the FGF19 surrogate administered to the test subject is sufficient to induce a cancerous condition in a reference population, and determining whether an indicia of a cancerous condition is observed in the test subject; wherein the absence of an indicia of a cancerous condition indicates that the FGF19 variant is a candidate for treatment of the test subject.
- FIG. 1 Other embodiments contemplated herein are drawn to a method for determining whether a FGF19 variant is a candidate for treating a test subject having a metabolic disorder, the method comprising providing a test subject having a metabolic disorder, the test subject having an indicia of a cancerous condition, co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate is administered to the test subject is sufficient to exacerbate a cancerous condition in a reference population, and determining whether an indicia of a cancerous condition is enhanced in the test subject; wherein the absence of exacerbation of an indicia of a cancerous condition indicates that the FGF19 variant is a candidate for treatment of the test subject.
- one or more indicia of a cancerous condition are reduced in the test subject.
- the present disclosure contemplates a method of treating (or preventing, in certain circumstances) a subject having a metabolic disorder, the method comprising providing a subject having a metabolic disorder, wherein the subject exhibits an indicia of a FGF19 - induced cancerous condition, and administering to the subject a therapeutically effective amount of a FGF19 variant identified from a pool of candidate FGF19 variant polypeptides as described herein; wherein there is an improvement in the metabolic disorder in the subject.
- One embodiment is directed to a model for determining whether a FGF19 variant is a candidate for preventing a cancerous disease, disorder or condition in a subject having a metabolic disorder, the model comprising a subject that i) does not exhibit an indicia of a cancerous condition prior to the administration of an effective amount of a FGF19 or FGF19 surrogate, and ii) exhibits an indicia of a cancerous condition after the administration of FGF19 or FGF19 surrogate; and wherein an indicia of a cancerous condition improves upon administration of an effective amount of a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1.
- the polypeptide consists of an amino acid sequence set forth in SEQ ID NO: l .
- the present disclosure also contemplates a model for determining whether a FGF19 variant is a candidate for treating a cancerous disease, disorder or condition in a subject having a metabolic disorder, the model comprising a subject having at least one indicia of cancer resulting from administration of FGF19 or FGF19 surrogate, wherein the indicia of cancer improves upon administration of an effective amount of a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: l .
- the polypeptide consists of an amino acid sequence set forth in SEQ ID NO: 1.
- the FGF19 variant is M70 (SEQ ID NO: 1) in the methods and models of the present disclosure.
- An FGF19 variant can be identified from a pool of candidate FGF19 variant polypeptides, wherein an identified FGF19 variant improves at least one condition of, for example, a hyperglycemic condition (e.g. , diabetes), insulin resistance,
- hyperinsulinemia glucose intolerance
- metabolic syndrome obesity or an undesirable body mass. Additional examples of metabolic disorders, diseases and conditions are described hereafter.
- the subject e.g. , a test subject
- an animal e.g. , a rodent, or monkey
- a mouse e.g. , a db/db mouse
- a subject can also be a human.
- the subject has an increased level of mature FGF19 compared to the level of mature FGF19 in a sample population, wherein the sample population can be any group of members useful as a baseline, reference, etc.
- the increased level of mature FGF19 is due to over-expression.
- the FGF19, a FGF19 surrogate, and/or FGF19 variant is labeled, for example, to facilitate detection, purification and the like.
- the FGF19, a FGF19 surrogate, and/or FGF19 variant is labeled through a covalent bond.
- the skilled artisan is familiar with different types of labels and uses thereof. Labeling is most frequently effected at the N- terminus and/or C-terminus of a polypeptide, but it can also occur within the polypeptide.
- the present disclosure contemplates the use of any direct and indirect labeling techniques, which can be carried out in vivo, in vitro, etc.
- determining an indicia of a cancerous condition, disorder or disease can be performed at any time that can allow the cancerous condition, disorder or disease to manifest itself and thus be detected.
- the determination can occur more than 3 months, more than 20 weeks, more than 6 months, more than 9 months, or more than 12 months after the aforementioned co-administration steps.
- FGF19 is co-administered with the FGF19 variant.
- the present disclosure also contemplates a method of antagonizing the oncogenic activity of FGF19.
- a method of antagonizing the oncogenic activity of FGF 19 in a subject comprising administering to the subject a therapeutically effective amount of a FGF19 variant, thereby antagonizing the oncogenic activity of FGF19 in the subject.
- the subject has a metabolic disorder and/or an indicia of a cancerous condition.
- the present disclosure further contemplates a method of preventing or treating a FGF 19- dependent disease, disorder or condition, or a symptom thereof, in a subject, comprising administering to the subject a therapeutically effective amount of a FGF19 variant, wherein the disease, disorder or condition thereof in the subject, is prevented or treated.
- a therapeutically effective amount of a FGF19 variant wherein the disease, disorder or condition thereof in the subject, is prevented or treated.
- the subject has a metabolic disorder and/or an indicia of a cancerous condition.
- the FGF19-dependent disease, disorder or condition is a cancer or tumor.
- the cancer or tumor is a liver cancer or tumor.
- the cancer or tumor is a colon cancer or tumor.
- the cancer or tumor is a prostate cancer or tumor. In yet other embodiments, the cancer or tumor is a lung cancer or tumor. In certain embodiments, the subject is a subject in need of prevention or treatment thereof.
- the FGF19 variant is a polypeptide comprising or consisting of an amino acid sequence set forth in SEQ ID NO: 1 (M70).
- FIG. 1 depicts the amino acid sequences of mature human FGF19. The amino acid residues corresponding to the flag epitope are underlined.
- FIG. 2 depicts the plasma FGF19 concentrations determined by ELISA in db/db mice five weeks following AAV-mediated gene delivery (GFP as a control; FGF19; and/or M70).
- FIG. 3 depicts gross hepatic tumor nodule formation in db/db mice after continuous exposure to GFP; FGF19-flag; and/or M70 twenty- four weeks following AAV-mediated gene delivery.
- FIG. 4 depicts the effect on body weight, measured prior to injection and 3-, 5- and 23- weeks post-injection, in db/db mice after continuous exposure to GFP; FGF19-flag; and/or M70 following AAV-mediated gene delivery.
- FIG. 5 depicts the effect on glucose concentration, measured prior to injection and 3-, 5- and 23-weeks post-injection, in db/db mice after continuous exposure to GFP; FGF19-flag; and/or M70 following AAV-mediated gene delivery.
- FIGS. 6A-6E depict an AAV-mediated transgene system for studying hepatocellular tumorigenesis.
- A A diagram of experimental protocol. Mice were given a single injection of 3 x 10 11 genome copies of AAV-FGF19 via tail vein when 6-12 week old. Mice were sacrificed 24 or 52 week later for liver tumor analysis. ITR, inverted terminal repeat; EFla, elongation factor la promoter.
- B Representative livers of db/db mice 24 weeks after administration of AAV-FGF19. Multiple, large, raised tumors protruding from the hepatic surface were observed in db/db mice expressing FGF19.
- liver tumor was observed in animals injected with a control virus (AAV-GFP) in this experiment. Scale bars, 10 mm.
- FIGS. 7A-7H depict M70 is a tumor- free FGF19 variant after continuous exposure in db/db mice for 24 weeks.
- A Alignment of protein sequences of M70 and FGF19 in the N-terminal region. Mutations introduced into M70 are underlined.
- B -
- Growth curve (E) and serum levels of transgene expression (F) were also determined.
- G Representative liver sections from db/db mice after 24 weeks of transgene expression.
- liver panel columns are, from top to bottom: hematoxylin and eosin (H & E) staining of liver tissue sections; immunohistochemical detection of Ki-67 and glutamine synthetase.
- Tumors T are outlined by dotted lines. Scale bars, 100 ⁇ .
- FIGS. 8A-8G depict no liver tumor formation in rasH2 mice treated with M70 for 52 weeks.
- F Livers were collected 52 weeks after AAV
- FIGS. 9A-9G depicts M70 binding and activation of FGFR4 in vitro.
- A Biacore SPR assay of the interaction between FGF19 and FGFR4-Fc chimeric proteins immobilized on flow cells. Left column shows binding curves obtained over a range of FGF19 concentrations (15.62-2000 nM at 2 fold dilutions), while right column shows the steady state fits of the data for obtaining K D values.
- B Binding of M70 to FGFR4 by Biacore. Similar procedures to (A) were used.
- C Solid phase binding of M70 or FGF19 to FGFR4-KLB receptor complex.
- the bound ligands were detected using a biotinylated FGF19-specific polyclonal antibody.
- D Relative luciferase activity after stimulation with M70 or FGF19 in L6 cells transiently trans fected with FGFR4 in the presence or absence of KLB.
- E M70 induces ERK phosphorylation in Hep3B cells.
- F M70 repressed Cyp7al expression in primary hepatocytes of mouse, rat, and human origin. Relative expression of Cyp7al mRNA in hepatocytes were determined by qRT-PCR and normalized to 18S RNA (mouse and rat) or actin (human) mRNA levels.
- FIGS. lOA-lOC depict the differential activation of cell signaling pathways by M70 and FGF19 in vivo.
- mice intraperitoneally with saline, 1 mg/kg FGF19 or 1 mg/kg M70 proteins 2 hours post injection. Liver lysates were examined by western blot for expression and phosphorylation of the indicated proteins. Each lane represents an individual mouse. Rabl 1 serves as a loading control. Note that hepatic STAT3 is activated by FGF19, not M70.
- STAT3 phosphorylation status by immunoblotting the liver lysates from the same animals is shown in the lower panel.
- C qPCR showing expression of mRNAs for STAT3 target genes (survivin, BC1-XL, and cyclin Dl) in rasH2 mice 52 weeks following administration of AAV vectors expressing FGF19 or M70 transgenes. All values represent mean + SEM. **p ⁇ 0.01, ***p ⁇ 0.001 denotes significant differences vs. control group by one-way ANOVA followed by Dunnett's post test.
- FIGS. 11 A-l 1 J depicts M70 inhibits FGF 19-induced tumor growth in db/db mice and in xenograft models.
- A 11 week old db/db mice were injected with AAV-FGF19 (3 x 10 10 genome copies) in the absence or presence of M70 (3 x 10 11 genome copies).
- Liver tumor score A
- B liver weight
- C ratio of liver to body weight
- D serum levels of transgene expression
- *p ⁇ 0.05 denotes significant differences vs. control group by one-way ANOVA followed by Dunnett's post test;
- ##p ⁇ 0.01 denotes significant differences by two-tailed t test.
- F FGF 19 is produced and secreted by human cancer cell lines. FGF 19 levels in culture supernatant are determined by ELISA.
- G-J M70 inhibits human cancer xenograft tumor growth in vivo.
- Mice bearing established tumors of equivalent volumes ( ⁇ 100 mm 3 ) were randomized into groups and treated with M70 via AAV-mediated gene delivery.
- a control virus (GFP) was also included in the study. Tumor growth was measured over the course of a 15-day treatment period.
- the image shows HCT-116 solid tumors dissected at end of the 15-day treatment period (I).
- Body weight gain of mice bearing HCT-116 tumor xenografts (J) were also determined.
- ***p ⁇ 0.001 denotes significant differences vs. control group by two-way ANOVA followed by Bonferroni's post test. All values represent mean + SEM.
- FIGS. 12A-12B depict a model of developing a FGF 19 variant for treating FGF 19- dependent tumors.
- A Chronic liver injury (cholestasis, cirrhosis, etc) leads to FGF19 accumulation in the liver. While important for regulating bile acid synthesis, FGF 19 also activates STAT3, a key transcription factor in promoting hepatocarcinogenesis. This contributes to tumor initiation, promotion, and progression into HCC.
- M70 is an engineered variant of FGF 19. As a selective modulator, M70 exhibits bias toward certain FGFR4 signaling pathways (i.e. pERK and Cyp7al) to the relative exclusion of others (i.e., tumor). Moreover, M70 can inhibit the growth of tumors that are dependent on FGF 19.
- FIGS. 13A-13B depicts M70 delays tumor growth in a CT26 colon cancer syngenic mouse model.
- A M70 delays CT26 tumor growth following administration of 10 mg/kg doses.
- B M70 delays CT26 tumor growth following administration of 3 mg/kg doses.
- the p-values were determined by two-way ANOVA vs. vehicle-treated mice. *** p ⁇ 0.001 ; ** p ⁇ 0.01.
- FIGS. 14A-14B depicts M70 reduces body weight in a CT26 colon cancer syngenic mouse model.
- A M70 reduces body weight following administration of 10 mg/kg doses.
- B M70 reduces body weight following administration of 3 mg/kg doses.
- the p-values were determined by two-way ANOVA vs. vehicle-treated mice. *** p ⁇ 0.001 ; ** p ⁇ 0.01.
- the present disclosure contemplates the identification of agents, and compositions thereof, using the models and methods described herein.
- the models and associated methods provide an accurate, efficient methodology for the identification of agents that do not induce cancerous conditions (e.g., hepatocellular carcinoma).
- the models and methods provided herein are useful in identifying agents that antagonize the oncogenic activity of FGF19.
- such agents have therapeutic utility in the treatment and/or prevention of various diseases, disorders and conditions, and/or the symptoms thereof, pertaining to, for example, glucose metabolism disorders and/or body weight disorders.
- the agents, and compositions thereof can be used for the treatment and/or prevention of type 2 diabetes, insulin resistance and diseases, disorders and conditions characterized by insulin resistance, decreased insulin production, hyperglycemia, metabolic syndrome, or obesity.
- Such agents are also useful in the prevention or treatment a FGF19-dependent disease, disorder or condition, or a symptom thereof.
- the models and associated methods described herein are useful in identifying agents (e.g., polypeptides and antibodies) that neither induce nor exacerbate the cancer-related effects of FGF19 (e.g., HCC). As described in detail hereafter, particular embodiments contemplate the use of the models and methods to determine whether a FGF19 variant polypeptide having favorable metabolic characteristics will also possess a desirable "cancer-related" profile. Also provided are methods of antagonizing the oncogenic activity of FGF19 in a subject and, in certain embodiments, methods of preventing or treating a FGF19-dependent disease, disorder or condition, or a symptom thereof.
- the FGF19 dependent disease, disorder or condition is a cancer or tumor, such as a liver, colon, prostate or lung cancer or tumor.
- patient or “subject” are used interchangeably to refer to a human or a non- human animal (e.g. , a mammal).
- treatment refers to a course of action (such as administering a polypeptide or a pharmaceutical composition comprising a polypeptide) initiated after a disease, disorder or condition, or a symptom thereof, has been diagnosed, observed, and the like so as to eliminate, reduce, suppress, mitigate, or ameliorate, either temporarily or permanently, at least one of the underlying causes of a disease, disorder, or condition afflicting a subject, or at least one of the symptoms associated with a disease, disorder, condition afflicting a subject.
- treatment includes inhibiting (i.e. , arresting the development or further development of the disease, disorder or condition or clinical symptoms association therewith) an active disease (e.g. , so as to decrease the level of insulin and/or glucose in the bloodstream, to increase glucose tolerance so as to minimize fluctuation of glucose levels, and/or so as to protect against diseases caused by disruption of glucose homeostasis).
- in need of treatment refers to a judgment made by a physician or other medical professional that a subject requires or will benefit from treatment.
- prevent refers to a course of action (such as administering a polypeptide or a pharmaceutical composition comprising a polypeptide) initiated in a manner (e.g. , prior to the onset of a disease, disorder, condition or symptom thereof) so as to prevent, suppress, inhibit or reduce, either temporarily or permanently, a subject's risk of developing a disease, disorder, condition or the like (as determined by, for example, the absence of clinical symptoms) or delaying the onset thereof, generally in the context of a subject predisposed to having a particular disease, disorder or condition. In certain instances, the terms also refer to slowing the progression of the disease, disorder or condition or inhibiting progression thereof to a harmful or otherwise undesired state.
- the term "in need of prevention” as used herein refers to a judgment made by a physician or other medical professional that a subject requires or will benefit from preventative care.
- the phrase "therapeutically effective amount” refers to the administration of an agent to a subject, either alone or as a part of a pharmaceutical composition and either in a single dose or as part of a series of doses, in an amount that is capable of having any detectable, positive effect on any symptom, aspect, or characteristics of a disease, disorder or condition when administered to a patient.
- the therapeutically effective amount can be ascertained by measuring relevant physiological effects. In the case of a hyperglycemic condition, a lowering or reduction of blood glucose or an
- a therapeutically effective amount is an amount sufficient to reduce or decrease any level (e.g. , a baseline level) of fasting plasma glucose (FPG), wherein, for example, the amount is sufficient to reduce a FPG level greater than 200 mg/dl to less than 200 mg/dl, wherein the amount is sufficient to reduce a FPG level between 175 mg/dl and 200 mg/dl to less than the starting level, wherein the amount is sufficient to reduce a FPG level between 150 mg/dl and 175 mg/dl to less than the starting level, wherein the amount is sufficient to reduce a FPG level between 125 mg/dl and 150 mg/dl to less than the starting level, and so on (e.g.
- FPG fasting plasma glucose
- the effective amount is an amount sufficient to reduce or decrease levels by more than about 10% to 9%, by more than about 9% to 8%, by more than about 8% to 7%, by more than about 7% to 6%, by more than about 6% to 5%, and so on.
- HbAIc levels by about 0.1%, 0.25%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 33%, 35%, 40%, 45%, 50%, or more is contemplated by the present disclosure.
- the therapeutically effective amount can be adjusted in connection with the dosing regimen and diagnostic analysis of the subject's condition and the like.
- the phrase "in a sufficient amount to effect a change” means that there is a detectable difference between a level of an indicator measured before (e.g. , a baseline level) and after administration of a particular therapy.
- Indicators include any objective parameter (e.g. , level of glucose or insulin) or subjective parameter (e.g. , a subject's feeling of well-being).
- glucose tolerance refers to the ability of a subject to control the level of plasma glucose and/or plasma insulin when glucose intake fluctuates.
- glucose tolerance encompasses the subject's ability to reduce, within about 120 minutes, the level of plasma glucose back to a level determined before the intake of glucose.
- the terms “diabetes” and “diabetic” refer to a progressive disease of carbohydrate metabolism involving inadequate production or utilization of insulin, frequently characterized by hyperglycemia and glycosuria.
- pre-diabetes and pre-diabetic refer to a state wherein a subject does not have the characteristics, symptoms and the like typically observed in diabetes, but does have characteristics, symptoms and the like that, if left untreated, can progress to diabetes. The presence of these conditions can be determined using, for example, either the fasting plasma glucose (FPG) test or the oral glucose tolerance test (OGTT). Both usually require a subject to fast for at least 8 hours prior to initiating the test.
- FPG fasting plasma glucose
- OGTT oral glucose tolerance test
- a subject's blood glucose is measured after the conclusion of the fasting; generally, the subject fasts overnight and the blood glucose is measured in the morning before the subject eats.
- a healthy subject would generally have a FPG concentration between about 90 and about 100 mg/dl
- a subject with "pre-diabetes” would generally have a FPG concentration between about 100 and about 125 mg/dl
- a subject with "diabetes” would generally have a FPG level above about 126 mg/dl.
- OGTT a subject's blood glucose is measured after fasting and again two hours after drinking a glucose-rich beverage.
- a healthy subject Two hours after consumption of the glucose-rich beverage, a healthy subject generally has a blood glucose concentration below about 140 mg/dl, a pre-diabetic subject generally has a blood glucose concentration about 140 to about 199 mg/dl, and a diabetic subject generally has a blood glucose concentration about 200 mg/dl or above. While the aforementioned glycemic values pertain to human subjects, normoglycemia, moderate hyperglycemia and overt hyperglycemia are scaled differently in murine subjects.
- a healthy murine subject after a four-hour fast would generally have a FPG concentration between about 100 and about 150 mg/dl
- a murine subject with "pre-diabetes” would generally have a FPG concentration between about 175 and about 250 mg/dl
- a murine subject with "diabetes” would generally have a FPG concentration above about 250 mg/dl.
- insulin resistance refers to a condition where a normal amount of insulin is unable to produce a normal physiological or molecular response.
- a hyper- physiological amount of insulin either endogenously produced or exogenously administered, is able to overcome the insulin resistance, in whole or in part, and produce a biologic response.
- metabolic syndrome refers to an associated cluster of traits that includes, but is not limited to, hyperinsulinemia, abnormal glucose tolerance, obesity, redistribution of fat to the abdominal or upper body compartment, hypertension, dysfibrinolysis, and dyslipidemia characterized by high triglycerides, low high density lipoprotein (HDL)-cholesterol, and high small dense low density lipoprotein (LDL) particles.
- Subjects having metabolic syndrome are at risk for development of type 2 diabetes and/or other disorders (e.g., atherosclerosis).
- glucose metabolism disorder encompasses any disorder characterized by a clinical symptom or a combination of clinical symptoms that is associated with an elevated level of glucose and/or an elevated level of insulin in a subject relative to a healthy individual. Elevated levels of glucose and/or insulin can be manifested in the following diseases, disorders and conditions: hyperglycemia, type II diabetes, gestational diabetes, type I diabetes, insulin resistance, impaired glucose tolerance, hyperinsulinemia, impaired glucose metabolism, pre-diabetes, other metabolic disorders (such as metabolic syndrome, which is also referred to as syndrome X), and obesity, among others.
- diseases, disorders and conditions hyperglycemia, type II diabetes, gestational diabetes, type I diabetes, insulin resistance, impaired glucose tolerance, hyperinsulinemia, impaired glucose metabolism, pre-diabetes, other metabolic disorders (such as metabolic syndrome, which is also referred to as syndrome X), and obesity, among others.
- polypeptides of the present disclosure can be used, for example, to achieve and/or maintain glucose homeostasis, e.g. , to reduce glucose level in the bloodstream and/or to reduce insulin level to a range found in a healthy subject.
- hypoglycemia refers to a condition in which an elevated amount of glucose circulates in the blood plasma of a subject relative to a healthy individual.
- Hyperglycemia can be diagnosed using methods known in the art, including measurement of fasting blood glucose levels as described herein.
- hyperinsulinemia refers to a condition in which there are elevated levels of circulating insulin when, concomitantly, blood glucose levels are either elevated or normal.
- Hyperinsulinemia can be caused by insulin resistance which is associated with dyslipidemia, such as high triglycerides, high cholesterol, high low-density lipoprotein (LDL) and low high-density lipoprotein (HDL); high uric acids levels; polycystic ovary syndrome; type II diabetes and obesity.
- hyperinsulinemia can be diagnosed as having a plasma insulin level higher than about 2 ⁇ /mL.
- body weight disorder refers to conditions associated with excessive body weight and/or enhanced appetite.
- Various parameters are used to determine whether a subject is overweight compared to a reference healthy individual, including the subject's age, height, sex and health status.
- a subject can be considered overweight or obese by assessment of the subject's Body Mass Index (BMI), which is calculated by dividing a subject's weight in kilograms by the subject's height in meters squared.
- BMI Body Mass Index
- An adult having a BMI in the range of -18.5 to -24.9 kg/m 2 is considered to have a normal weight; an adult having a BMI between -25 and -29.9 kg/m 2 can be considered overweight (pre-obese); and an adult having a BMI of -30 kg/m 2 or higher can be considered obese.
- Enhanced appetite frequently contributes to excessive body weight.
- night eating syndrome which is characterized by morning anorexia and evening polyphagia often associated with insomnia, but which can be related to injury to the hypothalamus.
- polypeptide refers to a polymeric form of amino acids of any length, which can include genetically coded and non- genetically coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified polypeptide backbones.
- the terms include fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusion proteins with heterologous and homologous leader sequences, with or without N-terminus methionine residues; immunologically tagged proteins; and the like. It will be appreciated that throughout this disclosure reference is made to amino acids according to the single letter or three letter codes.
- variants encompasses naturally-occurring variants (e.g. , homologs and allelic variants) and non-naturally-occurring variants (e.g., muteins).
- Naturally- occurring variants include homologs, i.e., nucleic acids and polypeptides that differ in nucleotide or amino acid sequence, respectively, from one species to another.
- Naturally-occurring variants include allelic variants, i.e. , nucleic acids and polypeptides that differ in nucleotide or amino acid sequence, respectively, from one individual to another within a species.
- Non-naturally-occurring variants include nucleic acids and polypeptides that comprise a change in nucleotide or amino acid sequence, respectively, where the change in sequence is artificially introduced, e.g., the change is generated in the laboratory or other facility by human intervention ("hand of man").
- the term “native”, in reference to FGF19, refers to biologically active, naturally- occurring FGF19, including biologically active, naturally-occurring FGF19 variants.
- the term includes the 194 amino acid human FGF19 mature sequence.
- label when use in the context of a polypeptide or nucleic acid (or antibody, as appropriate) of the present disclosure are meant to refer broadly to any means useful in, for example, polypeptide purification, identification, isolation and synthesis. Labels are generally covalently bound to the polypeptide of interest and can be introduced in any manner known in the art, including attachment to a mature polypeptide (generally at the N- or C-terminus), incorporation during solid-phase peptide synthesis, or through recombinant means. Examples include, but are not limited to, fluorescence, biotinylation, and radioactive isotopes.
- Polypeptide and nucleic acid molecules can be labeled by both in vitro and in vivo methods. Labeling reagents and kits can be obtained from a number of commercial sources (e.g., Thermo Fischer Scientific, Rockford, IL; and Molecular Probes/Life Technologies; Grand Island, NY).
- FLAG-tag FLAG octapeptide
- FLAG octapeptide refers to an eight amino acid (DYKDDDDK) (SEQ ID NO:2) peptide tag (label) that can be added to a polypeptide using recombinant DNA techniques.
- Antibodies to the FLAG component of the polypeptide can be used for, for example, affinity chromatography and cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.
- a FLAG-tag can be used in conjunction with other affinity tags (e.g. , a polyhistidine tag (His-tag) or myc-tag), and it can be fused to the C-terminus or the N-terminus of a polypeptide.
- affinity tags e.g. , a polyhistidine tag (His-tag) or myc-tag
- muteins refers broadly to mutated recombinant proteins, i.e. , a polypeptide comprising an artificially introduced change in amino acid sequence, e.g. , a change in amino acid sequence generated in the laboratory or other facility by human intervention ("hand of man"). These proteins usually carry single or multiple amino acid substitutions and are frequently derived from cloned genes that have been subjected to site-directed or random mutagenesis, or from completely synthetic genes.
- the terms "modified”, “modification” and the like refer to one or more changes that enhance a desired property of human FGF19, a naturally-occurring FGF19 variant, or a FGF19 mutein, wherein the change(s) does not alter the primary amino acid sequence of the FGF19.
- desired properties include, for example, enhancing solubility, prolonging the circulation half-life, increasing the stability, reducing the clearance, altering the immunogenicity or allergenicity, improving aspects of manufacturability (e.g. , cost and efficiency), and enabling the raising of particular antibodies (e.g., by introduction of unique epitopes) for use in detection assays.
- Changes to human FGF19, a naturally-occurring FGF19 variant, or a FGF19 mutein that can be carried out include, but are not limited to, pegylation
- PEG polyethylene glycol
- glycosylation e.g. , N-glycosylation
- polysialylation and hesylation e.g. , N-glycosylation
- albumin fusion e.g. , albumin binding through, for example, a conjugated fatty acid chain (acylation); Fc-fusion; and fusion with a PEG mimetic.
- Some particular embodiments entail modifications involving polyethylene glycol, other particular embodiments entail modifications involving albumin, and still other particular modifications entail modifications involving glycosylation.
- DNA DNA
- nucleic acid nucleic acid molecule
- polynucleotide polynucleotide
- polynucleotides include linear and circular nucleic acids, messenger RNA (mRNA), complementary
- DNA recombinant polynucleotides
- vectors vectors, probes, primers and the like.
- probe refers to a fragment of DNA or RNA corresponding to a gene or sequence of interest, wherein the fragment has been labeled radioactively (e.g. , by incorporating 32 P or 35 S) or with some other detectable molecule, such as biotin, digoxygen or fluorescein.
- a probe can be used, for example, to label viral plaques, bacterial colonies or bands on a gel that contain the gene of interest.
- a probe can be cloned DNA or it can be a synthetic DNA strand; the latter can be used to obtain a cDNA or genomic clone from an isolated protein by, for example, microsequencing a portion of the protein, deducing the nucleic acid sequence encoding the protein, synthesizing an oligonucleotide carrying that sequence, radiolabeling the sequence and using it as a probe to screen a cDNA library or a genomic library.
- heterologous refers to two components that are defined by structures derived from different sources.
- a “heterologous” polypeptide can include operably linked amino acid sequences that are derived from different polypeptides.
- a “heterologous" polynucleotide can include operably linked nucleic acid sequences that can be derived from different genes.
- heterologous nucleic acids include expression constructs in which a nucleic acid comprising a coding sequence is operably linked to a regulatory element (e.g., a promoter) that is from a genetic origin different from that of the coding sequence (e.g., to provide for expression in a host cell of interest, which can be of different genetic origin than the promoter, the coding sequence or both).
- a regulatory element e.g., a promoter
- heterologous can refer to the presence of a nucleic acid (or gene product, such as a polypeptide) that is of a different genetic origin than the host cell in which it is present.
- operably linked refers to linkage between molecules to provide a desired function.
- “operably linked” in the context of nucleic acids refers to a functional linkage between nucleic acid sequences.
- a nucleic acid expression control sequence such as a promoter, signal sequence, or array of transcription factor binding sites
- the expression control sequence affects transcription and/or translation of the second polynucleotide.
- “operably linked” refers to a functional linkage between amino acid sequences (e.g., different domains) to provide for a described activity of the polypeptide.
- N-terminus or “amino terminus” and “C-terminus” (or “carboxyl terminus”) refer to the extreme amino and carboxyl ends of the polypeptide, respectively, while the terms “N-terminal” and “C-terminal” refer to relative positions in the amino acid sequence of the polypeptide toward the N-terminus and the C-terminus, respectively, and can include the residues at the N-terminus and C-terminus, respectively.
- Immediately N-terminal or “immediately C-terminal” refers to a position of a first amino acid residue relative to a second amino acid residue where the first and second amino acid residues are covalently bound to provide a contiguous amino acid sequence.
- “Derived from”, in the context of an amino acid sequence or polynucleotide sequence is meant to indicate that the polypeptide or nucleic acid has a sequence that is based on that of a reference polypeptide or nucleic acid (e.g., a naturally occurring FGF19 polypeptide or a FGF19-encoding nucleic acid), and is not meant to be limiting as to the source or method in which the protein or nucleic acid is made.
- the term “derived from” includes homologues or variants of reference amino acid or DNA sequences.
- isolated refers to a polypeptide of interest that, if naturally occurring, is in an environment different from that in which it can naturally occur.
- isolated is meant to include polypeptides that are within samples that are substantially enriched for the polypeptide of interest and/or in which the polypeptide of interest is partially or substantially purified. Where the polypeptide is not naturally occurring, “isolated” indicates the polypeptide has been separated from an environment in which it was made by either synthetic or recombinant means.
- Enriched means that a sample is non-naturally manipulated (e.g., by a scientist or a clinician) so that a polypeptide of interest is present in a) a greater concentration (e.g., at least 3-fold greater, at least 4-fold greater, at least 8-fold greater, at least 64-fold greater, or more) than the concentration of the polypeptide in the starting sample, such as a biological sample (e.g., a sample in which the polypeptide naturally occurs or in which it is present after administration), or b) a concentration greater than the environment in which the polypeptide was made (e.g., as in a bacterial cell).
- a biological sample e.g., a sample in which the polypeptide naturally occurs or in which it is present after administration
- a concentration greater than the environment in which the polypeptide was made e.g., as in a bacterial cell.
- substantially pure indicates that a component (e.g. , a polypeptide) makes up greater than about 50% of the total content of the composition, and typically greater than about 60% of the total polypeptide content. More typically, “substantially pure” refers to compositions in which at least 75%), at least 85%, at least 90%> or more of the total composition is the component of interest. In some cases, the polypeptide will make up greater than about 90%, or greater than about 95% of the total content of the composition.
- a component e.g. , a polypeptide
- test and “measuring” and grammatical variations thereof are used interchangeably herein and refer to either qualitative or quantitative determinations, or both qualitative and quantitative determinations.
- any means of assessing the relative amount is contemplated, including the various methods set forth herein and known in the art. For example, gene expression can be assayed or measured by a
- antibodies refer to glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity.
- the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, that is, the individual antibodies comprising the population are identical except for possible naturally occurring mutations that can be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. In contrast to polyclonal antibody preparations, which can include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.
- isolated refers to an antibody that has been separated and/or recovered from contaminant components of its natural environment; such contaminant components include materials which might interfere with diagnostic or therapeutic uses for the antibody, and can include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- the expression of FGF19 is amplified as compared to a control.
- the expression of FGF19 is amplified 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more, or any numerical range thereof.
- the amplified expression of FGF19 directly results in the disease, disorder or condition, or a symptom thereof.
- the amplified expression of FGF19 indirectly results in the disease disorder or condition, or a symptom thereof.
- Fibroblast Growth Factor 19 FGF19
- Fibroblast growth factors are a family of growth factors that play key roles in cellular proliferation and differentiation. Twenty-two members of the FGF family have been identified in humans, all of which are structurally-related signaling molecules.
- the FGF 19 subfamily of FGFs consists of human FGF21, FGF23 and FGF 19 and mouse FGF15.
- FGF family members are the result of heparin-dependent binding to one or more members of the FGF receptor tyrosine kinase (FGFR) family, which includes four members (FGFR1, FGFR2, FGFR3 and FGFR4), each having a tyrosine kinase domain.
- FGFR1 , FGFR2 and FGFR3 also has two splice variants designated as "b" and "c" variants (i.e. , FGFRlb, FGFR2b, FGFR3b, FGFRlc, FGFR2c and FGFR3c).
- FGF19 targets and has effects on both adipocytes and hepatocytes. Mice treated with recombinant human FGF19, despite being on a high- fat diet, show increased metabolic rates, increased lipid oxidation, a lower respiratory quotient, and weight loss. The metabolic effects of FGF19 occur via its binding to the FGFRlc, FGFR2c and FGFR3c receptors, of which the binding to FGFRlc and FGFR2c are the most significant. FGF19 binding to these receptors requires the co- receptor Klotho- ⁇ (KLB).
- KLB co- receptor Klotho- ⁇
- FGF19 has also been shown to regulate bile production by the liver.
- FGF19-like agents can play an important role in bile acid homeostasis.
- Results suggest that FGF19-regulated liver bile acid metabolism could be independent of its glucose-lowering effect.
- FGF19 is expressed as a 216 amino acid polypeptide comprising a 22 residue signal peptide (GenBank: AAQ88669.1).
- Mature human FGF19 (wild-type) is a 194 amino acid polypeptide comprising the following amino acid sequence:
- FGF 19 is associated with the induction of cancer, particularly HCC, the most common type of liver cancer.
- HCC the most common type of liver cancer.
- methods and models of identifying a polypeptide, or a subsequence, variant or modified form thereof, as set forth herein, having a desired metabolic activity (e.g. , glucose lowering activity) but lacking or without substantial HCC activity e.g. , glucose lowering activity
- a desired metabolic activity e.g. , glucose lowering activity
- Various metabolic disorders and associated methods e.g. , methods of measuring glucose levels
- detecting cancers are described elsewhere herein and are known in the art.
- Indicators for HCC include, but are not limited to, detection of a tumor maker, such as elevated alpha- fetoprotein (AFP) or des-gamma carboxyprothrombin (DCP) levels.
- AFP alpha- fetoprotein
- DCP des-gamma carboxyprothrombin
- a number of different scanning and imaging techniques are also available, including ultrasound, CT scans and MRI.
- evaluation of whether a polypeptide e.g., a candidate polypeptide exhibits evidence of inducing HCC is determined in vivo by, for example, quantifying HCC nodule formation in an animal model (e.g., a db/db mouse model) administered a polypeptide, compared to HCC nodule formation induced by wild-type FGF19.
- an animal model e.g., a db/db mouse model
- HCC nodules which are frequently round-to-oval, grey or green, well circumscribed but not encapsulated
- HCC can be present as an infiltrative tumor which is diffuse and poorly circumscribed and frequently infiltrates the portal veins.
- Risk factors for HCC include type 2 diabetes (often exacerbated by obesity).
- the risk of HCC in type 2 diabetics is greater (from -2.5 to ⁇ 7 times the non-diabetic risk) depending on the duration of diabetes and treatment protocol.
- Pathological assessment of hepatic tissue samples is generally performed after the results of one or more of the aforementioned methodologies indicate the likely presence of HCC.
- certain embodiments of the methods provided herein further include assessing a hepatic tissue sample from an in vivo animal model useful in HCC studies in order to determine whether a polypeptide sequence exhibits evidence of inducing HCC.
- the in vivo animal model is a db/db mouse model.
- a pathologist can determine whether one of the four general architectural and cytological types (patterns) of HCC are present (i.e., fibrolamellar, pseudoglandular (adenoid), pleomorphic (giant cell) and clear cell).
- FGF19 variant polypeptides and other agents that mimic, at least in some respects, the activity of FGF19 are described in both the scientific and patent literature. See, e.g., Wu et ah, PLos One, 6:e 17868 (March 11, 2001); US Pat. No. 8,324,160; and US Publ. Nos. 2011/0195895;
- candidate FGF19 variant sequences include polypeptides having a WGDPI (SEQ ID NO:4) sequence motif corresponding to the WGDPI sequence of amino acids 16-20 of FGF19 (SEQ ID NO:3).
- WGDPI SEQ ID NO:4
- a particular polypeptide contemplated herein has the following amino acid sequence:
- a FGF19 variant comprises or consists of an amino acid sequence set forth as:
- the N-terminal R residue is deleted.
- one aspect of the present disclosure contemplates a method for determining whether a test subject having a metabolic disorder is a candidate for treatment with a FGF19 variant, the method comprising: (a) providing a test subject having an indicia of a cancerous condition, the subject having a metabolic disorder, (b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate administered to the test subject is sufficient to induce a cancerous condition in a reference population, and (c) determining whether an indicia of a cancerous condition is enhanced in the test subject; wherein the absence of enhancement of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant.
- Another aspect of the present disclosure contemplates a method for determining whether a test subject having a metabolic disorder is a candidate for treatment with a FGF19 variant, the method comprising: (a) providing a test subject having an indicia of a cancerous condition, the test subject having a metabolic disorder, (b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate is administered to the test subject is sufficient to induce a cancerous condition in a reference population, and (c) determining whether an indicia of a cancerous condition is reduced in the test subject; wherein the reduction of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant.
- the present disclosure also contemplates a method for determining whether a FGF19 variant is a candidate for treating a test subject having a metabolic disorder, the method comprising: (a) co-administering FGF19 or a FGF19 surrogate, and the FGF19 variant to the test subject having a metabolic disorder, wherein the amount of the FGF19 or the FGF19 surrogate administered to the test subject is sufficient to induce a cancerous condition in a reference population, and (b) determining whether an indicia of a cancerous condition is observed in the test subject; wherein the absence of an indicia of a cancerous condition indicates that the FGF19 variant is a candidate for treatment of the test subject.
- a further embodiment contemplated herein is drawn to a method for determining whether a FGF19 variant is a candidate for treating a test subject having a metabolic disorder, the method comprising: (a) providing a test subject having a metabolic disorder, the test subject having an indicia of a cancerous condition, (b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate is administered to the test subject is sufficient to exacerbate a cancerous condition in a reference population, and (c) determining whether an indicia of a cancerous condition is enhanced in the test subject; wherein the absence of exacerbation of an indicia of a cancerous condition indicates that the FGF19 variant is a candidate for treatment of the test subject.
- one or more indicia of a cancerous condition are reduced in the test subject.
- the FGF19 variant is selected from the group consisting of M5, M6, M7, M14, M15, M32, M36, M43, M52, M53, M67, M68,
- the FGF19 variant is M5. In another embodiment, the FGF19 variant is M6. In some embodiments, the FGF19 variant is M7. In one embodiment, the FGF19 variant is Ml 4. In another embodiment, the FGF19 variant is M15. In other embodiments, the FGF19 variant is M32. In one embodiment, the FGF19 variant is M36. In another embodiment, the FGF19 variant is M43. In other embodiments, the FGF19 variant is M52. In yet other embodiment, the FGF19 variant is M53.
- the FGF19 variant is M67. In one embodiment, the FGF19 variant is M68.
- the FGF19 variant is M69. In some embodiments, the FGF19 variant is
- the FGF19 variant is M70. In one embodiment, the FGF19 variant is M75. In another embodiment, the FGF19 variant is
- the FGF19 variant is M77. In yet other embodiments, the FGF19 variant is M83. In one embodiment, the FGF19 variant is M84. In another embodiment, the FGF19 variant is M140. In other embodiments, the FGF19 variant is M144. In yet other embodiments, the FGF19 variant is M145. In one embodiment, the FGF19 variant is M146. In some embodiments, the FGF19 variant is M160. In other embodiments, any combination of two or more of the foregoing FGF19 variants is also contemplated.
- the FGF19 variant comprises an amino acid sequence set forth in any one of SEQ ID NOS:5-29; or a subsequence or fragment thereof.
- the N-terminal R residue is deleted.
- the FGF19 variant comprises SEQ ID NO:5.
- the FGF19 variant comprises SEQ ID NO:6.
- the FGF19 variant comprises SEQ ID NO:7.
- the FGF19 variant comprises SEQ ID NO: 8.
- the FGF19 variant comprises SEQ ID NO:9.
- the FGF19 variant comprises SEQ ID NO: 10.
- the FGF19 variant comprises SEQ ID NO: l 1.
- the FGF19 variant comprises SEQ ID NO: 12. In some embodiments, the FGF19 variant comprises SEQ ID NO: 13. In other embodiments, the FGF19 variant comprises SEQ ID NO: 14. In one embodiment, the FGF19 variant comprises SEQ ID NO: 15. In another embodiment, the FGF19 variant comprises SEQ ID NO: 16. In some embodiments, the FGF19 variant comprises SEQ ID NO: 17. In other embodiments, the FGF19 variant comprises SEQ ID NO: 18. In yet other embodiments, the FGF19 variant comprises SEQ ID NO: 19. In some embodiments, the FGF19 variant comprises SEQ ID NO:20. In one embodiment, the FGF19 variant comprises SEQ ID NO:21. In some embodiments, the FGF19 variant comprises SEQ ID NO:22.
- the FGF19 variant comprises SEQ ID NO:23. In another embodiment, the FGF19 variant comprises SEQ ID NO:24. In some embodiments, the FGF19 variant comprises SEQ ID NO:25. In other embodiments, the FGF19 variant comprises SEQ ID NO:26. In yet other embodiments, the FGF19 variant comprises SEQ ID NO:27. In some embodiments, the FGF19 variant comprises SEQ ID NO:28. In other embodiments, the FGF19 variant comprises SEQ ID NO:29. In certain embodiments, the FGF19 variant comprises any one of the foregoing sequences, wherein the N-terminal R residue is deleted. In some embodiments, the FGF19 variant comprises a subsequence of any of the foregoing sequences. In other embodiments, any combination of two or more of the foregoing FGF19 variants is also contemplated.
- the FGF19 variant consists of an amino acid sequence set forth in any one of SEQ ID NOS: 5-29; or a subsequence or fragment thereof. In certain embodiments, the N-terminal R residue is deleted. In some embodiments, the FGF19 variant consists of SEQ ID NO: 5. In other embodiments, the FGF19 variant consists of SEQ ID NO:6. In one embodiment, the FGF19 variant consists of SEQ ID NO:7. In other embodiments, the FGF19 variant consists of SEQ ID NO: 8. In another embodiment, the FGF19 variant consists of SEQ ID NO:9. In some embodiments, the FGF19 variant consists of SEQ ID NO: 10.
- the FGF19 variant consists of SEQ ID NO: l 1. In another embodiment, the FGF19 variant consists of SEQ ID NO: 12. In some embodiments, the FGF19 variant consists of SEQ ID NO: 13. In other embodiments, the FGF19 variant consists of SEQ ID NO: 14. In one embodiment, the FGF19 variant consists of SEQ ID NO: 15. In another embodiment, the FGF19 variant consists of SEQ ID NO: 16. In some embodiments, the FGF19 variant consists of SEQ ID NO: 17. In other embodiments, the FGF19 variant consists of SEQ ID NO: 18. In yet other embodiments, the FGF19 variant consists of SEQ ID NO: 19. In some embodiments, the FGF19 variant consists of SEQ ID NO:20.
- the FGF19 variant consists of SEQ ID NO:21. In some embodiments, the FGF19 variant consists of SEQ ID NO:22. In other embodiments, the FGF19 variant consists of SEQ ID NO:23. In another embodiment, the FGF19 variant consists of SEQ ID NO:24. In some embodiments, the FGF19 variant consists of SEQ ID NO:25. In other embodiments, the FGF19 variant consists of SEQ ID NO:26. In yet other embodiments, the FGF19 variant consists of SEQ ID NO:27. In some embodiments, the FGF19 variant consists of SEQ ID NO:28. In other embodiments, the FGF19 variant consists of SEQ ID NO:29.
- the FGF19 variant consists of any one of the foregoing sequences, wherein the N-terminal R residue is deleted. In some embodiments, the FGF19 variant consists of a subsequence of any of the foregoing sequences. In other embodiments, any combination of two or more of the foregoing FGF19 variants is also contemplated.
- the present disclosure also contemplates various models. Any model can be used that provides reliable, reproducible results. The skilled artisan is familiar with models that can be used in conjunction with the subject matter of the present disclosure.
- rodent models are used, particularly mouse models.
- db/db, db/ob and DIO models can find use in practicing aspects of the present disclosure.
- One such embodiment is directed to a model for determining whether a FGF19 variant is a candidate for preventing a cancerous disease, disorder or condition in a subject having a metabolic disorder, the model comprising a subject that (i) does not exhibit an indicia of a cancerous condition prior to the administration of an effective amount of FGF19 or FGF19 surrogate, and (ii) exhibits an indicia of a cancerous condition after the administration of the FGF19 or the FGF19 surrogate; and wherein an indicia of a cancerous condition improves upon administration of an effective amount of a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1.
- the polypeptide consists of an amino acid sequence set forth in SEQ ID NO: l .
- the present disclosure also contemplates a model for determining whether a FGF19 variant is a candidate for treating a cancerous disease, disorder or condition in a subject having a metabolic disorder, the model comprising a subject having at least one indicia of cancer resulting from administration of FGF19 or FGF19 surrogate, wherein the indicia of cancer improves upon administration of an effective amount of a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: l .
- the polypeptide consists of an amino acid sequence set forth in SEQ ID NO: 1.
- a model for determining whether a FGF19 variant is a candidate for preventing a cancerous disease, disorder or condition in a subject having a metabolic disorder comprising a subject that i) does not exhibit an indicia of a cancerous condition prior to the administration of an effective amount of FGF19 or FGF19 surrogate, and ii) exhibits an indicia of a cancerous condition after the administration of the FGF19 or FGF19 surrogate; and wherein an indicia of a cancerous condition improves upon administration of an effective amount of a FGF19 variant.
- a model for determining whether a FGF19 variant is a candidate for treating a cancerous disease, disorder or condition in a subject having a metabolic disorder comprising a subject having at least one indicia of cancer resulting from administration of FGF19 or FGF19 surrogate, wherein the indicia of cancer improves upon administration of an effective amount of a FGF19 variant.
- the FGF19 variant comprises an amino acid sequence set forth in any one of SEQ ID NOS:5-29; or a subsequence or fragment thereof. In other embodiments of the models provided herein, the FGF19 variant consists of an amino acid sequence set forth in any one of SEQ ID NOS: 5-29; or a subsequence or fragment thereof. In certain embodiments, the N-terminal R residue is deleted. In some embodiments, the
- FGF19 variant comprises or consists of SEQ ID NO:5. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:6. In one embodiment, the FGF19 variant comprises or consists of SEQ ID NO:7. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:8.
- the FGF19 variant comprises or consists of SEQ ID NO:9. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 10. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 11. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO: 12. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 13. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 14. In one embodiment, the FGF19 variant comprises or consists of SEQ ID NO: 15. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO: 16. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 17.
- the FGF19 variant comprises or consists of SEQ ID NO: 18. In yet other embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 19. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:20. In one embodiment, the FGF19 variant comprises or consists of SEQ ID NO:21. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:22. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:23. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO:24. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:25.
- the FGF19 variant comprises or consists of SEQ ID NO:26. In yet other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:27. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:28. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:29. In certain embodiments, the FGF19 variant comprises or consists of any one of the foregoing sequences, wherein the N-terminal R residue is deleted. In some embodiments, the FGF19 variant comprises or consists of a subsequence of any of the foregoing sequences. In other embodiments, any combination of two or more of the foregoing FGF19 variants is also contemplated.
- Adeno-associated virus was used as the vehicle to deliver and express exogenous genes of interest in the mice and to enable continuous, persistent and systemic exposure to proteins encoded by the transgenes.
- FIG. 2 depicts plasma FGF19 concentrations determined by ELISA in db/db mice five weeks after AAV-mediated gene delivery of GFP (control); FGF19 (two separates doses); and FGF19 and FGF19 variant M70 (two separate doses of each).
- the high FGF19 concentrations observed following co-administration of the FGF19 and M70 transgenes reflect contributions from the expression of both FGF19 variant M70 and FGF19.
- FGF19-flag was used in the examples to facilitate quantification of the experimental results; as set forth in the Experimental section, the c- Flag component did not impact FGF19's tumorogenic effects, though it can have an impact FGF19's antidiabetic effects.
- FGF19-mediated tumorigenesis is completely suppressed when the FGF19 and M70 trans genes are co-expressed.
- Example 4 sets forth the effect on mouse body weight initially measured prior to injection and subsequently determined 3-, 5- and 23-weeks post-injection of the indicated transgenes.
- transgenic db/db mice co-expressing the FGF19 variant M70 and FGF19 showed significant reductions in body weight compared to animals dosed with control, while less dramatic effects on body weight were observed in mice only expressing the FGF19 transgene.
- the changes in body weight observed in mice co-expressing the FGF19 and M70 transgenes were also reflected in reduced liver weights compared with weights of livers harvested from animals in the control group.
- Example 7 sets forth an AAV-mediated transgene system for evaluation of hepatocellular tumorigenesis in vivo.
- FGF19 transgene expression was introduced using an AAV-mediated gene delivery approach (Zhang et ah, 2009, Hum. Gene Ther. 20, 922-929).
- a panel of FGF19 variants was evaluated in vivo and identified tumor-free variants including M70.
- M70 was shown to retain the beneficial activity of regulating bile acid homeostasis; and M70 was also shown to bind to and activate FGFR4, which is assumed to mediate FGF19-associated tumorigenicity (French et al, 2012, PloS one 7, e36713; Wu et al, 2010, J. Biol. Chem. 285, 5165-5170).
- FGF19 was shown mechanistically to stimulate tumor progression by activating the STAT3 pathway, an activity eliminated in M70.
- M70 was shown to inhibit FGF19-dependent tumor growth in multiple tumor models.
- M70 was shown to inhibit colon tumor growth in a syngenic mouse model.
- natural hormones are engineered to selectively eliminate potential deleterious activity (i.e., tumorigenicity), while leaving beneficial function (i.e., bile acid metabolism) intact.
- beneficial function i.e., bile acid metabolism
- M70 was identified as a tumor- free FGF19 variant that binds and selective activates FGFR4 receptor complex to maintain bile acid homeostasis.
- Mice with prolonged exposure to supra-physiological levels of M70 24 weeks in db/db mice, 52 weeks in rasH2 mice) were free of liver tumors (Example 8; FIGS. 7 and 8).
- M70 was also demonstrated to block FGF19-associated tumorigenicity in mice and in human cancer xenografts (Example 11, FIG. 11). Although tumor-free FGF19 variants were identified previously (Wu et al, 2011, PloS one 6, el7868; Wu et al, 2010a, PNAS, 107, 14158-14163), these variants were specifically designed to eliminate FGFR4 binding, and by extension, were impaired in regulating bile acid metabolism. In contrast, M70 exhibits similar potency and efficacy in binding FGFR4 and regulating Cyp7al and pERK pathways downstream of FGFR4 (Examples 9 and 10; FIGS. 9 and 10). These results provide in vivo evidence of selective activation of FGFR4/KLB receptor complex, which does not lead to hepatocellular tumorigenesis.
- M70 exhibits pharmacologic characteristics of a "biased ligand" or a selective modulator.
- M70 binds to the extracellular domain of FGFR4 with similar potency and efficacy as wild type FGF19.
- M70 activates ERK phosphorylation in cells transfected with FGFR4-KLB or FGFR4 or cells expressing FGFR4-KLB endogenously.
- M70 potently represses Cyp7al in primary hepatocytes and in mice.
- M70 does not promote liver tumor formation.
- the lack of tumorigenicity by M70 could be explained by its lack of activation of pSTAT3, a key signaling molecule in hepatocellular carcinogenic pathways.
- STAT3 is a major player in hepatocellular oncogenesis (He and Karin, 201 1 , Cell Res. 21 , 159-168). Phosphorylated (i.e. activated) STAT3 is found in approximate 60% of HCC in human (He et ah, 2010, Cancer Cell 17, 286-297). STAT3 activation also correlates with poor prognosis in HCC patients (Calvisi et ah, 2006, Gastroenterol. 130, 1 1 17-1 128).
- STAT3 acts as an oncogene in cellular transformation (Bromberg et ah, 1999, Cell 98, 295- 303). Hepatocyte-specific ablation of STAT3 prevented HCC development in mice (He et ah, 2010, Cancer cell 17, 286-297). Inhibitors of STAT3 activation block the growth of human cancer cells and are being tested in the clinic for treating various cancers including HCC (Chen et ah, 2010, Clin. Cancer Res,16, 5189-5199; Karras et ah, 2000, Cellular immunol. 202, 124-135; Lin et ah, 2009, Oncogene 28, 961-972).
- IL-6 is postulated to be the major STAT3 activator in the liver (He et ah, 2010, (He et ah, 2010, Cancer cell 17, 286-297). IL-6 signaling has been shown to stimulate malignant progression of liver cancer progenitors (He et ah, 2013, Cell 155, 384-396). Increased IL-6 production was observed in patients with primary biliary cirrhosis, a cholestatic condition associated with increased HCC risk (Kakumu et ah, 1993,
- FGF19 is also shown in Example 10 and FIG. 10 to activate STAT3 signaling in vivo. This effect could be directly mediated by FGFR4 receptor complex, or indirectly through induction of cytokines or growth factors. Indeed, the expression of IL-6 is elevated in the livers of FGF19-treated animals in our studies (Example 10; FIG. 10).
- M70 may bind to an orthosteric site on FGFR4, since M70 is able to displace or interfere with FGF19 binding and inhibits FGF19-associated tumorigenicity. Yet M70 does not block all pathways nondiscriminatively to the same extent. M70 exhibits bias toward certain FGFR4 signaling pathways (i.e. Cyp7al , pERK) to the relative exclusion of others (i.e. , tumor), as observed for certain allosteric modulators (FIG. 12).
- FGFR4 signaling pathways i.e. Cyp7al , pERK
- M70 can be useful as an anticancer agent for the treatment of FGF19-dependent tumors (see, e.g., Examples, 8 and 1 1 ; FIGS. 7, 8 and 1 1). This is particularly true given that FGF19 is amplified in -15% human HCCs and is upregulated in cirrhosis and cholestatic conditions that often lead to tumor development.
- M70 retains FGF19's activity on bile acid regulation, while eliminating tumorigenicity (see, e.g., Examples 8, 9 and 1 1; FIGS. 8, 9 and 1 1). This ensures preservation of bile acid homeostasis when used as an anti-cancer agent.
- the experimental data provided herein shows that, not only does M70 lack the tumorigenic potential, but it can also effectively interfere with the tumorigenic effects associated with wild type FGF19.
- M70 inhibits the growth of colon cancer xenograft tumors, in addition to FGF19-mediated HCC.
- M70 also inhibits the growth of colon cancer in a syngenic mouse model (see, e.g., Example 12 and FIG. 13). These results confirm that, as a selective FGFR4 modulator, M70 antagonizes the oncogenic activity of FGF19.
- FGF19 demonstrates an array of biological effects.
- the therapeutic potential for FGF19 includes the treatment of chronic liver diseases, as well as obesity and diabetes, but its promotion of hepatocyte proliferation and carcinogenic potential challenges the development of FGF19 for chronic use.
- M70 as an engineered FGF19 variant devoid of
- the present disclosure also contemplates active fragments (e.g., subsequences) of the polypeptides containing contiguous amino acid residues derived from the polypeptide sequences described herein.
- active fragments e.g., subsequences
- the length of contiguous amino acid residues of a peptide or a polypeptide subsequence varies depending on the specific naturally-occurring amino acid sequence from which the subsequence is derived.
- peptides and polypeptides are from about 5 amino acids to about 10 amino acids, from about 10 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 40 amino acids, from about 40 amino acids to about 50 amino acids, from about 50 amino acids to about 75 amino acids, from about 75 amino acids to about 100 amino acids, or from about 100 amino acids up to the full-length polypeptide.
- the total number of amino acid residues is less than about 250.
- the number of amino acid residues ranges from about 190 to about 230, from about 200 to about 225, or from about 210 to about 220 residues.
- the number of amino acid residues is greater than 180, greater than 185, greater than 190, greater than 195, greater than 200, greater than 205, greater than 210, greater than 215, greater than 220 or greater than 225 residues.
- the polypeptides have a defined sequence identity compared to a reference sequence over a defined length of contiguous amino acids (e.g., a
- Comparison window Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
- a suitable polypeptide comprises an amino acid sequence having at least about 75%, at least about 80%, at least about 85%), at least about 90%>, at least about 95%, at least about 98%), or at least about 99%, amino acid sequence identity to a contiguous strefch of from about 5 amino acids to about 10 amino acids, from about 10 amino acids to about 12 amino acids, from about 12 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 35 amino acids, from about 35 amino acids to about 40 amino acids, from about 40 amino acids to about 45 amino acids, from about 45 amino acids to about 50 amino acids, from about 50 amino acids to about 60 amino acids, from about 60 amino acids to about 70 amino acids, from about 70 amino acids to about 80 amino acids, from about 80 amino acids to about 90 amino acids, from about 90 amino acids to about 100 amino acids, from about 100 amino acids
- the polypeptides are isolated from a natural source ⁇ e.g., an environment other than its naturally-occurring environment) and also can be recombinantly made ⁇ e.g., in a genetically modified host cell such as bacteria; yeast; Pichia; insect cells; and the like), where the genetically modified host cell is modified with a nucleic acid comprising a nucleotide sequence encoding the polypeptide.
- a genetically modified host cell such as bacteria; yeast; Pichia; insect cells; and the like
- the polypeptides can also be synthetically produced ⁇ e.g., by cell-free chemical synthesis). Methods of productions are described in more detail below.
- a polypeptide is generated using recombinant techniques to manipulate different FGF19-related nucleic acids known in the art to provide constructs capable of encoding the polypeptide. It will be appreciated that, when provided a particular amino acid sequence, the ordinary skilled artisan will recognize a variety of different nucleic acid molecules encoding such amino acid sequence in view of her background and experience in, for example, molecular biology.
- the present disclosure also provides polypeptides that have one or more alterations in the amino acid residues (e.g., at locations that are not conserved across variants or species) compared to a reference sequence (e.g., the corresponding wild-type sequence).
- Such polypeptides frequently retain domains that are conserved among species and have the same biological activity as the naturally-occurring polypeptides.
- Such polypeptides frequently also have one or more conservative amino acid substitutions.
- substitution generally refers to substitution of amino acid residues within the following groups: 1) L, I, M, V, F; 2) R, K; 3) F, Y, H, W, R; 4) G, A, T, S; 5) Q, N; and 6) D, E.
- Conservative amino acid substitutions preserve the activity of the protein by replacing an amino acid(s) in the protein with an amino acid with a side chain of similar acidity, basicity, charge, polarity, or size of the side chain.
- Guidance for substitutions, insertions, or deletions can be based on alignments of amino acid sequences of different variant proteins or proteins from different species.
- FGF19 residues 127-129 are defined as constituting the Loop-8 region, although in the literature the Loop-8 region is sometimes defined as including or consisting of other residues (e.g., residues 125-129).
- Certain combinations of R127L and P128E substitutions to the FGF19 framework had an unexpectedly positive effect on HCC formation.
- a combination of R127L and P128E substitutions and a substitution of Gin (Q) for Leu (L) in the FGF19 core region also had significant effects on preventing HCC formation.
- variants of the FGF19 Loop-8 region are included since they can reduce or eliminate substantial, measurable or detectable HCC formation. Furthermore, the effect of reducing HCC formation may be enhanced by modifications to amino acid residues outside of the Loop-8 region (e.g., substitutions of amino acid residues in the core region, such as the region corresponding to amino acids 21-29 of SEQ ID NO:3).
- the Loop-8 modified variant is M70:
- the Loop-8 modified M70 variant comprises a substitution in the FGF19 Loop-
- the Loop-8 modified M70 variant further comprises or further comprises a substitution in the FGF19 core region. In some embodiments, the Loop-8 modified M70 variant comprises a L18Q substitution.
- the Loop-8 modified variant is M5 (SEQ ID NO: 5), M6 (SEQ ID NO:6), M7 (SEQ ID N07), M14 (SEQ ID NO:8), M15 (SEQ ID NO:9), M32 (SEQ ID NO: 10), M36 (SEQ ID NO: 11), M43 (SEQ ID NO: 12), M50 (SEQ ID NO: 13), M52 (SEQ ID N014), M53 (SEQ ID NO: 15), M67 (SEQ ID NO: 16), M68 (SEQ ID NO: 17), M69 (SEQ ID NO: 18), M70 (SEQ ID NO: l or 19), M75 (SEQ ID NO:20), M76 (SEQ ID NO:21), M77 (SEQ ID N022), M83 (SEQ ID NO:23), M84 (SEQ ID NO:24), M140 (SEQ ID NO:25), M5-R (SEQ ID NO:26), M6-R (SEQ ID NO:27), M50-R
- the Loop-8 modified variant comprises a substitution in the FGF19 Loop-8 region corresponding to amino acids 127-129 of SEQ ID NO: 3. In certain embodiments, the Loop-8 modified variant comprises a substitution in the FGF19 Loop-8 region corresponding to (i) a R127L substitution, (ii) a P128E substitution, or (iii) a R127L substitution and a P128E substitution. In some embodiments, the FGF19 variant comprises or further comprises a substitution in the core region corresponding to amino acids 21-29 of SEQ ID NO: 3. In certain embodiments, the FGF19 variant comprises or further comprises a substitution in the core region corresponding to a L22Q substitution.
- Nucleic acid molecules encoding the polypeptides described herein are contemplated by the present disclosure, including their naturally-occurring and non-naturally occurring isoforms, allelic variants and splice variants.
- the present disclosure also encompasses nucleic acid sequences that vary in one or more bases from a naturally-occurring DNA sequence but still translate into an amino acid sequence that corresponds to a polypeptide due to degeneracy of the genetic code.
- a polypeptide includes one or more linkages other than peptide bonds, e.g., at least two adjacent amino acids are joined via a linkage other than an amide bond.
- linkages other than peptide bonds e.g., at least two adjacent amino acids are joined via a linkage other than an amide bond.
- one or more amide bonds within the backbone of a polypeptide can be substituted.
- one or more amide linkages (-CO-NH-) in a polypeptide can be replaced with a linkage which is an isostere of an amide linkage, such as -CFLNH-, CH 2 S-, -
- amide linkages in a polypeptide can also be replaced by, for example, a reduced isostere pseudopeptide bond. See Couder et al. (1993) Int. J. Peptide Protein Res. 41 : 181-184. Such replacements and how to effect are known to those of ordinary skill in the art.
- one or more amino acid substitutions are made in a polypeptide.
- alkyl-substituted hydrophobic amino acids including alanine, leucine, isoleucine, valine, norleucine, (S)-2-aminobutyric acid, (S)-cyclohexylalanine or other simple alpha-amino acids substituted by an aliphatic side chain from Ci-Cio carbons including branched, cyclic and straight chain alkyl, alkenyl or alkynyl substitutions;
- aromatic-substituted hydrophobic amino acids including phenylalanine, tryptophan, tyrosine, sulfotyrosine, biphenylalanine, 1-naphthylalanine, 2- naphthylalanine, 2-benzothienylalanine, 3-benzothienylalanine, histidine, including amino, alkylamino, dialkylamino, aza, halogenated (fluoro, chloro, bromo, or iodo) or alkoxy (from C1-C4)- substituted forms of the above-listed aromatic amino acids, illustrative examples of which are: 2-, 3- or 4-aminophenylalanine, 2-, 3- or 4-chlorophenylalanine, 2-, 3- or 4-methylphenylalanine, 2-, 3- or 4-methoxyphenylalanine, 5-amino-, 5-chloro-, 5-methyl- or 5-methoxytryptophan, 2
- a substitution of amino acids containing basic side chains including arginine, lysine, histidine, ornithine, 2,3-diaminopropionic acid, homoarginine, including alkyl, alkenyl, or aryl- substituted (from C1-C1 0 branched, linear, or cyclic) derivatives of the previous amino acids, whether the substituent is on the heteroatoms (such as the alpha nitrogen, or the distal nitrogen or nitrogens, or on the alpha carbon, in the pro-R position for example.
- N-epsilon-isopropyl-lysine 3-(4-tetrahydropyridyl)-glycine, 3-(4- tetrahydropyridyl)-alanine, ⁇ , ⁇ -gamma, gamma'-diethyl-homoarginine.
- compounds such as alpha-methyl-arginine, alpha-methyl-2,3-diaminopropionic acid, alpha-methyl- histidine, alpha-methyl-ornithine where the alkyl group occupies the pro-R position of the alpha- carbon.
- amides formed from alkyl, aromatic, heteroaromatic where the heteroaromatic group has one or more nitrogen, oxygen or sulfur atoms singly or in combination
- carboxylic acids or any of the many well-known activated derivatives such as acid chlorides, active esters, active azolides and related derivatives
- lysine, ornithine, or 2,3-diaminopropionic acid d) substitution of acidic amino acids, including aspartic acid, glutamic acid, homoglutamic acid, tyrosine, alkyl, aryl, arylalkyl, and heteroaryl sulfonamides of 2,4- diaminopriopionic acid, ornithine or lysine and tetrazole-substituted alkyl amino acids;
- hydroxyl containing amino acids including serine, threonine, homoserine, 2,3-diaminopropionic acid, and alkyl or aromatic substituted derivatives of serine or threonine.
- a polypeptide comprises one or more naturally occurring non- genetically encoded L-amino acids, synthetic L-amino acids or D-enantiomers of an amino acid.
- a polypeptide can comprise only D-amino acids.
- a polypeptide comprises one or more of the following residues: hydroxyproline, ⁇ -alanine, o- aminobenzoic acid, m-aminobenzoic acid, p-aminobenzoic acid, m-aminomethylbenzoic acid, 2,3- diaminopropionic acid, a-aminoisobutyric acid, N-methylglycine (sarcosine), ornithine, citrulline, t- butylalanine, t-butylglycine, N-methylisoleucine, phenylglycine, cyclohexylalanine, norleucine, naphthylalanine, pyridylalanine 3-benzothienyl alanine, 4-chlorophenylalanine, 2- fluorophenylalanine, 3-fluorophenylalanine, 4-fiuorophenylalanine, penicillamine, 1,2,3,4-
- a cysteine residue or a cysteine analog is introduced into a polypeptide to provide for linkage to another peptide via a disulfide linkage or to provide for cyclization of the polypeptide.
- Methods of introducing a cysteine or cysteine analog are known in the art; see, e.g., U.S. Patent No. 8,067,532.
- a polypeptide is cyclized.
- one or more cysteine or cysteine analogs can be introduced into a polypeptide, where the introduced cysteine or cysteine analog can form a disulfide bond with a second introduced cysteine or cysteine analog.
- Other means of cyclization include introduction of an oxime linker or a lanthionine linker; see, e.g., U.S. Patent
- Any combination of amino acids (or non-amino acid moieties) that can form a cyclizing bond can be used and/or introduced.
- a cyclizing bond can be generated with any combination of amino acids (or with amino acid and -(CH2) n -CO- or -(CH2) n -C 6 H 4 -CO-) with functional groups which allow for the introduction of a bridge.
- Some examples are disulfides, disulfide mimetics such as the -(CH2) n - carba bridge, thioacetal, thioether bridges (cystathionine or lanthionine) and bridges containing esters and ethers.
- n can be any integer, but is frequently less than ten.
- modulator compounds of the present disclosure include C-terminal hydroxymethyl derivatives, O-modified derivatives (e.g. , C-terminal hydroxymethyl benzyl ether), N-terminally modified derivatives including substituted amides such as alkylamides and hydrazides.
- one or more L-amino acids in a polypeptide are replaced with a D-amino acid.
- a polypeptide is a retro-inverso analog (Sela and Zisman (1997) FASEB J. 1 1 :449).
- Retro-inverso peptide analogs are isomers of linear polypeptides in which the direction of the amino acid sequence is reversed (retro) and the chirality, D- or L-, of one or more amino acids therein is inverted (inverso) e.g. , using D-amino acids rather than L-amino acids. See, e.g. , Jameson et al. (1994) Nature 368:744; and Brady et al. (1994) Nature 368:692.
- a polypeptide can include a "Protein Transduction Domain” (PTD), which refers to a polypeptide, polynucleotide, carbohydrate, or organic or inorganic compound that facilitates traversing a lipid bilayer, micelle, cell membrane, organelle membrane, or vesicle membrane.
- PTD Protein Transduction Domain
- PTD attached to another molecule facilitates the molecule traversing a membrane, for example going from extracellular space to intracellular space, or cytosol to within an organelle.
- a PTD is covalently linked to the amino terminus of a polypeptide, while in other embodiments, a PTD is covalently linked to the carboxyl terminus of a polypeptide.
- Exemplary protein transduction domains include, but are not limited to, a minimal undecapeptide protein transduction domain (corresponding to residues 47-57 of HIV- 1 TAT comprising YGRKKRRQRRR;
- SEQ ID NO:30 a polyarginine sequence comprising a number of arginines sufficient to direct entry into a cell (e.g. , 3, 4, 5, 6, 7, 8, 9, 10, or 10-50 arginines); a VP22 domain (Zender et al. (2002)
- Exemplary PTDs include, but are not limited to, YGRKKRRQRRR (SEQ ID NO:30), RKKRRQRRR (SEQ ID NO:35); an arginine homopolymer of from 3 arginine residues to 50 arginine residues.
- Exemplary PTD domain amino acid sequences include, but are not limited to, any of the following: YGRKKRRQRRR (SEQ ID NO:30);
- RKKRRQRR SEQ ID NO:36
- YARAAARQARA SEQ ID NO:37
- THRLPRRRRRR SEQ ID NO:38
- GGRRARRRRRR SEQ ID NO:39
- the carboxyl group can also be esterified with primary, secondary or tertiary alcohols such as, e.g. , methanol, branched or unbranched Ci-C6-alkyl alcohols, e.g. , ethyl alcohol or tert-butanol.
- the carboxyl group can also be amidated with primary or secondary amines such as ammonia, branched or unbranched Ci-C - alkylamines or C1-C6 di-alkylamines, e.g. , methylamine or dimethylamine.
- primary or secondary amines such as ammonia, branched or unbranched Ci-C - alkylamines or C1-C6 di-alkylamines, e.g. , methylamine or dimethylamine.
- the amino group can be present in a form protected by amino-protecting groups conventionally used in peptide chemistry such as, e.g. , Fmoc, Benzyloxy- carbonyl (Z), Boc, or Alloc.
- Alkyl residues can be straight-chained, branched or cyclic (e.g. , ethyl, isopropyl and cyclohexyl, respectively).
- a polypeptide of the present disclosure can be produced by any suitable method, including recombinant and non-recombinant methods (e.g. , chemical synthesis).
- SPPS Solid-phase peptide synthesis
- Fmoc and Boc are available for synthesizing polypeptides of the present disclosure. Details of the chemical synthesis are known in the art (e.g., Ganesan A. 2006 Mini Rev. Med. Chem. 6:3-10; and Camarero J.A. et al, 2005 Protein Pept Lett. 12:723-8).
- Solid phase peptide synthesis can be performed as described hereafter.
- the a functions (Na) and any reactive side chains are protected with acid-labile or base-labile groups.
- the protective groups are stable under the conditions for linking amide bonds but can be readily cleaved without impairing the peptide chain that has formed.
- Suitable protective groups for the a-amino function include, but are not limited to, the following: t-butyloxycarbonyl (Boc), benzyloxycarbonyl (Z), o- chlorbenzyloxycarbonyl, bi-phenylisopropyloxycarbonyl, tert-amyloxycarbonyl (Amoc), a, a- dimethyl-3,5-dimethoxy-benzyloxycarbonyl, o-nitrosulfenyl, 2-cyano-t-butoxy-carbonyl, 9- fluorenylmethoxycarbonyl (Fmoc), l-(4,4-dimethyl-2,6-dioxocylohex-l-ylidene)ethyl (Dde) and the like.
- Suitable side chain protective groups include, but are not limited to: acetyl, allyl (All), allyloxycarbonyl (Alloc), benzyl (Bzl), benzyloxycarbonyl (Z), t-butyloxycarbonyl (Boc), benzyloxymethyl (Bom), o-bromobenzyloxycarbonyl, t-butyl (tBu), t-butyldimethylsilyl, 2- chlorobenzyl, 2-chlorobenzyloxycarbonyl (2-CIZ), 2,6-dichlorobenzyl, cyclohexyl, cyclopentyl, 1- (4,4-dimethyl-2,6-dioxocyclohex-l-ylidene)ethyl (Dde), isopropyl, 4-methoxy-2,3-6- trimethylbenzylsulfonyl (Mtr), 2,3,5,7, 8-pentamethylchroman-6
- the C-terminal amino acid is coupled to a suitable support material.
- suitable support materials are those which are inert towards the reagents and reaction conditions for the step-wise condensation and cleavage reactions of the synthesis process and which do not dissolve in the reaction media being used.
- Examples of commercially-available support materials include styrene/divinylbenzene copolymers which have been modified with reactive groups and/or polyethylene glycol; chloromethylated styrene/divinylbenzene copolymers;
- Polystyrene (l%)-divinylbenzene or TentaGel® derivatized with 4-benzyloxybenzyl-alcohol (Wang-anchor) or 2- chlorotrityl chloride can be used if it is intended to prepare the peptidic acid.
- polystyrene (1%) divinylbenzene or TentaGel® derivatized with 5-(4'-aminomethyl)- 3',5'-dimethoxyphenoxy)valeric acid (PAL-anchor) or p-(2,4-dimethoxyphenyl-amino methyl)- phenoxy group (Rink amide anchor) can be used.
- the linkage to the polymeric support can be achieved by reacting the C-terminal Fmoc- protected amino acid with the support material with the addition of an activation reagent in ethanol, acetonitrile, ⁇ , ⁇ -dimethylformamide (DMF), dichloromethane, tetrahydrofuran, N- methylpyrrolidone or similar solvents at room temperature or elevated temperatures (e.g., between 40°C and 60°C) and with reaction times of, e.g., 2 to 72 hours.
- an activation reagent in ethanol, acetonitrile, ⁇ , ⁇ -dimethylformamide (DMF), dichloromethane, tetrahydrofuran, N- methylpyrrolidone or similar solvents at room temperature or elevated temperatures (e.g., between 40°C and 60°C) and with reaction times of, e.g., 2 to 72 hours.
- the coupling of the Na-protected amino acid (e.g., the Fmoc amino acid) to the PAL, Wang or Rink anchor can, for example, be carried out with the aid of coupling reagents such as ⁇ , ⁇ '-dicyclohexylcarbodiimide (DCC), ⁇ , ⁇ '-diisopropylcarbodiimide (DIC) or other carbodiimides, 2-(lH-benzotriazol-l-yl)-l ,l ,3,3-tetramethyluronium tetrafluoroborate (TBTU) or other uronium salts, o-acyl-ureas, benzotriazol- 1 -yl-tris-pyrrolidino-phosphonium hexafluorophosphate (PyBOP) or other phosphonium salts, N-hydroxysuccinimides, other N-hydroxyimides or oximes in the presence or also in the absence of 1 -hydroxy
- the Na-protected amino acid e.g., the Fmoc amino acid
- the Na-protected amino acid can be coupled to the 2- chlorotrityl resin in dichloromethane with the addition of DIEA with reaction times of 10 to 120 minutes, e.g., 20 minutes, but is not limited to the use of this solvent and this base.
- the successive coupling of the protected amino acids can be carried out according to conventional methods in peptide synthesis, typically in an automated peptide synthesizer.
- the next protected amino acid in a 3 to 10-fold excess is coupled to the previous amino acid in an inert, non-aqueous, polar solvent such as dichloromethane, DMF or mixtures of the two and at temperatures between about 10°C and 50°C, e.g., at 25°C.
- Cleavage can be carried out with trifluoroacetic acid or other strongly acidic media with addition of 5%-20% V/V of scavengers such as dimethylsulfide, ethylmethylsulfide, thioanisole, thiocresol, m-cresol, anisole ethanedithiol, phenol or water, e.g., 15% v/v dimethylsulfide/ethanedithiol/m-cresol 1 : 1 : 1 , within 0.5 to 3 hours, e.g., 2 hours.
- scavengers such as dimethylsulfide, ethylmethylsulfide, thioanisole, thiocresol, m-cresol, anisole ethanedithiol, phenol or water, e.g., 15% v/v dimethylsulfide/ethanedithiol/m-cresol 1 : 1 : 1 , within 0.5 to 3
- Peptides with fully protected side chains are obtained by cleaving the 2-chlorotrityl anchor with glacial acetic acid/trifluoroethanol/dichloromethane 2:2:6.
- the protected peptide can be purified by chromatography on silica gel. If the peptide is linked to the solid phase via the Wang anchor and if it is intended to obtain a peptide with a C-terminal alkylamidation, the cleavage can be carried out by aminolysis with an alkylamine or fiuoroalkylamine. The aminolysis is carried out at temperatures between about -10°C and 50°C (e.g., about 25°C), and reaction times between about 12 and 24 hours (e.g., about 18 hours). In addition the peptide can be cleaved from the support by re- esterification, e.g. , with methanol.
- the acidic solution that is obtained can be admixed with a 3 to 20-fold amount of cold ether or n-hexane, e.g., a 10-fold excess of diethyl ether, in order to precipitate the peptide and hence to separate the scavengers and cleaved protective groups that remain in the ether.
- a further purification can be carried out by re -precipitating the peptide several times from glacial acetic acid.
- the precipitate that is obtained can be taken up in water or tert- butanol or mixtures of the two solvents, e.g., a 1 : 1 mixture of tert-butanol/water, and freeze-dried.
- the peptide obtained can be purified by various chromatographic methods, including ion exchange over a weakly basic resin in the acetate form; hydrophobic adsorption chromatography on non-derivatized polystyrene/divinylbenzene copolymers (e.g., Amberlite® XAD); adsorption chromatography on silica gel; ion exchange chromatography, e.g., on carboxymethyl cellulose; distribution chromatography, e.g., on Sephadex® G-25; countercurrent distribution chromatography; or high pressure liquid chromatography (HPLC) e.g., reversed-phase HPLC on octyl or
- HPLC high pressure liquid chromatography
- ODS octadecylsilylsilica
- the polypeptide can be produced as an intracellular protein or as a secreted protein, using any suitable construct and any suitable host cell, which can be a prokaryotic or eukaryotic cell, such as a bacterial (e.g., E. coli) or a yeast host cell, respectively.
- eukaryotic cells that can be used as host cells include insect cells, mammalian cells, and/or plant cells. Where mammalian host cells are used, they can include human cells (e.g. , HeLa, 293, H9 and Jurkat cells); mouse cells (e.g. , NIH3T3, L cells, and C127 cells); primate cells (e.g. , Cos 1 , Cos 7 and CV1) and hamster cells (e.g. , Chinese hamster ovary (CHO) cells).
- human cells e.g. , HeLa, 293, H9 and Jurkat cells
- mouse cells e.g. , NIH3T3, L cells, and C127 cells
- a variety of host-vector systems suitable for the expression of a polypeptide can be employed according to standard procedures known in the art. See, e.g. , Sambrook et ah , 1989 Current Protocols in Molecular Biology Cold Spring Harbor Press, New York; and Ausubel et al. 1995 Current Protocols in Molecular Biology, Eds. Wiley and Sons. Methods for introduction of genetic material into host cells include, for example, transformation, electroporation, conjugation, calcium phosphate methods and the like. The method for transfer can be selected so as to provide for stable expression of the introduced polypeptide-encoding nucleic acid.
- the polypepti de-encoding nucleic acid can be provided as an inheritable episomal element (e.g. , a plasmid) or can be genomically integrated.
- a variety of appropriate vectors for use in production of a polypeptide of interest are commercially available.
- Vectors can provide for extrachromosomal maintenance in a host cell or can provide for integration into the host cell genome.
- the expression vector provides transcriptional and translational regulatory sequences, and can provide for inducible or constitutive expression where the coding region is operably-linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region.
- the transcriptional and translational regulatory sequences can include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. Promoters can be either constitutive or inducible, and can be a strong
- constitutive promoter e.g., T7
- Expression constructs generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding proteins of interest.
- a selectable marker operative in the expression host can be present to facilitate selection of cells containing the vector.
- the expression construct can include additional elements.
- the expression vector can have one or two replication systems, thus allowing it to be maintained in organisms, for example, in mammalian or insect cells for expression and in a prokaryotic host for cloning and amplification.
- the expression construct can contain a selectable marker gene to allow the selection of transformed host cells. Selectable genes are well known in the art and will vary with the host cell used.
- Isolation and purification of a protein can be accomplished according to methods known in the art.
- a protein can be isolated from a lysate of cells genetically modified to express the protein constitutively and/or upon induction, or from a synthetic reaction mixture by immunoaffinity purification, which generally involves contacting the sample with an anti- protein antibody, washing to remove non-specifically bound material, and eluting the specifically bound protein.
- the isolated protein can be further purified by dialysis and other methods normally employed in protein purification methods.
- the protein can be isolated using metal chelate chromatography methods. Proteins can contain modifications to facilitate isolation.
- the polypeptides can be prepared in substantially pure or isolated form (e.g. , free from other polypeptides).
- the polypeptides can be present in a composition that is enriched for the polypeptide relative to other components that can be present (e.g., other polypeptides or other host cell components).
- purified polypeptide can be provided such that the polypeptide is present in a composition that is substantially free of other expressed proteins, e.g., less than 90%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1%, of the composition is made up of other expressed proteins.
- the present disclosure provides methods for treating or preventing a host of other diseases, disorders and conditions. Such methods can also have an advantageous effect on one or more symptoms associated with a disease, disorder or condition by, for example, decreasing the severity or the frequency of a symptom.
- the method is a method for treating a disease or disorder. In other embodiments, the method is a method for preventing a disease or disorder.
- the present disclosure contemplates methods of treating (or preventing, in certain circumstances) a subject having a metabolic disorder, the method comprising providing a subject having a metabolic disorder, wherein the subject exhibits an indicia of a FGF19- induced cancerous condition, and administering to the subject a therapeutically effective amount of a FGF19 variant identified from a pool of candidate FGF19 variant polypeptides as described herein; wherein there is an improvement in the metabolic disorder in the subject.
- Non-limiting examples of diseases, disorders and conditions include: 1) glucose utilization disorders and the sequelae associated therewith, including diabetes mellitus (type I and type-2), gestational diabetes, hyperglycemia, insulin resistance, abnormal glucose metabolism, "prediabetes” (Impaired Fasting Glucose (IFG) or Impaired Glucose Tolerance (IGT)), and other physiological disorders associated with, or that result from, the hyperglycemic condition, including, for example, histopathological changes such as pancreatic ⁇ -cell destruction.
- diabetes mellitus type I and type-2
- gestational diabetes hyperglycemia
- insulin resistance abnormal glucose metabolism
- abnormal glucose metabolism abnormal glucose metabolism
- prediabetes Impaired Fasting Glucose (IFG) or Impaired Glucose Tolerance (IGT)
- IGF Impaired Fasting Glucose
- ITT Impaired Glucose Tolerance
- hyperglycemic-related disorders include kidney damage (e.g., tubule damage or nephropathy), liver degeneration, eye damage (e.g., diabetic retinopathy or cataracts), and diabetic foot disorders; 2) dyslipidemias and their sequelae such as, for example, atherosclerosis, coronary artery disease, cerebrovascular disorders and the like; 3) other conditions which can be associated with the metabolic syndrome, such as obesity and elevated body mass (including the co-morbid conditions thereof such as, but not limited to, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), and polycystic ovarian syndrome (PCOS)), and also include thromboses, hypercoagulable and prothrombotic states (arterial and venous), hypertension, cardiovascular disease, stroke and heart failure; 4) disorders or conditions in which inflammatory reactions are involved, including atherosclerosis, chronic inflammatory bowel diseases (e.g., Crohn's disease and ulcerative colitis), asthma, lupus
- a subject in order to determine whether a subject can be a candidate for the treatment or prevention of hyperglycemia, hyperinsulinemia, glucose intolerance, and/or glucose disorders by the methods provided herein, various diagnostic methods known in the art can be utilized (e.g., fasting plasma glucose (FPG) evaluation and the oral glucose tolerance test (oGTT)).
- FPG fasting plasma glucose
- oGTT oral glucose tolerance test
- a subject in order to determine whether a subject can be a candidate for the treatment or prevention of a body weight disorder (e.g., obesity) by the methods provided herein, parameters such as, but not limited to, the etiology and the extent of the subject's condition (e.g., how overweight the subject is compared to reference healthy individual) should be evaluated. For example, an adult having a BMI between ⁇ 25 and -29.9 kg/m 2 can be considered overweight (pre-obese), while an adult having a BMI of ⁇ 30 kg/m 2 or higher can be considered obese.
- a body weight disorder e.g., obesity
- Also provided herein is a method of treating a subject (e.g. , an animal, such as a human) having a metabolic or metabolic-associated disease, disorder or condition, said method comprising:
- the method comprising: (a) providing a test subject having an indicia of a cancerous condition, the subject having a metabolic disorder, (b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate administered to the test subject is sufficient to induce a cancerous condition in a reference population, and (c) determining whether an indicia of a cancerous condition is enhanced in the test subject; wherein the absence of enhancement of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant; and wherein if there is an absence of enhancement of the indicia of a cancerous condition in the test subject, then the method further comprises (ii) subsequently administering the FGF19 variant to the subject (e.g., an animal, such as a human). In certain embodiments, the subsequent administration of the FGF19 variant is a therapeutically
- a subject e.g. , an animal, such as a human
- a metabolic or metabolic-associated disease, disorder or condition comprising:
- the method comprising: (a) providing a test subject having an indicia of a cancerous condition, the test subject having a metabolic disorder, and (b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate is administered to the test subject is sufficient to induce a cancerous condition in a reference population, and (c) determining whether an indicia of a cancerous condition is reduced in the test subject; wherein the reduction of an indicia of a cancerous condition indicates that the test subject is a candidate for treatment with a FGF19 variant; and wherein if there is a reduction of the indicia of a cancerous condition in the test subject, then the method further comprises (ii) subsequently administering the FGF19 variant to the subject (e.g., an animal, such as a human). In certain embodiments, the subsequent administration of the FGF19 variant is a therapeutically
- a method of treating a subject comprising: (i) determining whether a FGF19 variant is a candidate for treating a test subject having a metabolic disorder, the method comprising: (a) providing a test subject having a metabolic disorder, the test subject having an indicia of a cancerous condition, (b) co-administering FGF19 or a FGF19 surrogate, and a FGF19 variant to the test subject, wherein the amount of the FGF19 or the FGF19 surrogate is administered to the test subject is sufficient to exacerbate a cancerous condition in a reference population, and (c) determining whether an indicia of a cancerous condition is enhanced in the test subject; wherein the absence of exacerbation of an indicia of a cancerous condition indicates that the FGF19 variant is a candidate for treatment of the test subject; and where
- one or more indicia of a cancerous condition are reduced in the test subject.
- a method of treating a subject having a metabolic or metabolic- associated disease, disorder or condition comprising: (a) providing a subject having a metabolic disorder, wherein the subject exhibits an indicia of a FGF19-induced cancerous condition, and (b) administering to the subject a therapeutically effective amount of a FGF19 variant identified in any one of methods or models provided herein; wherein there is an improvement in the metabolic or metabolic-associated disease, disorder or condition in the subject.
- the subject is an animal. In other embodiments, the subject is a human. In some embodiments, the cancerous condition is a tumor. In certain embodiments, the tumor is a colon tumor or a hepatic tumor. In some embodiments, the metabolic or metabolic-associated disease, disorder or condition is a metabolic disorder. In some embodiments, the metabolic disorder is selected from the group consisting of a hyperglycemic condition, insulin resistance, hyperinsulinemia, glucose intolerance, obesity and metabolic syndrome. In one embodiment, the hyperglycemic condition is diabetes. In another embodiment, the treatment results in an improvement in the metabolic disorder. In certain embodiments, the improvement of the metabolic disorder is a decrease in blood glucose. In other embodiments, the improvement in the metabolic disorder in the subject is a decrease in body weight. In certain embodiments, the improvement in the metabolic disorder in the subject is a decrease in insulin.
- provided herein is a method of antagonizing the oncogenic activity of FGF19, for example, using a FGF19 variant provided herein.
- a cell expressing FGF19 is contacted with a FGF19 variant provided herein.
- the FGF19 variant is M70.
- a method of antagonizing the oncogenic activity of FGF19 in a subject comprising administering to the subject a therapeutically effective amount of a FGF19 variant, thereby antagonizing the oncogenic activity of FGF19 in the subject.
- a method of treating a FGF19-dependent disease, disorder or condition, or a symptom thereof, in a subject comprising administering to the subject a therapeutically effective amount of a FGF19 variant, wherein the disease, disorder, condition, or symptom thereof is treated in the subject.
- the subject has a metabolic disorder and/or an indicia of a cancerous condition.
- the FGF19-dependent disease, disorder or condition is a cancer or tumor.
- the cancer or tumor is a liver, colon, prostate or lung cancer or tumor.
- the cancer or tumor is benign. In other embodiments, the cancer or tumor is malignant.
- the subject has or is at risk of developing a FGF19-dependent disease, disorder or condition.
- the FGF19-dependent disease, disorder or condition is a liver (hepatocellular) disease, disorder or condition, such as cirrhosis or cholestasis.
- the liver disease or disorder is a chronic liver disease or disorder.
- the FGF19-dependent disease, disorder or condition is cancer or tumor, such as HCC.
- the FGF19-dependent disease, disorder or condition is not a liver disease, disorder or condition, such as cirrhosis or cholestasis.
- the FGF19-dependent disease, disorder or condition is not a cancer or tumor, such as HCC.
- the FGF19-dependent disease, disorder or condition is a colon cancer or tumor.
- the colon cancer or tumor is a colon adenocarcinoma.
- the FGF19-dependent disease, disorder or condition is a prostate cancer or tumor.
- the FGF19- dependnent disease, disorder or condition is a lung cancer or tumor.
- the lung cancer or tumor is a lung squamous cell carcinoma.
- FGF19 is expressed in a primary or metastatic cancer or tumor cell.
- the FGF19-dependent disease, disorder or condition is pre-cancerous.
- cirrhosis and cholestasis sometimes to lead to liver cancers, such as HCC, and methods of treating or preventing such liver diseases and disorders are contemplated.
- the subject is a subject in need of prevention or treatment thereof.
- administration of the FGF19 variant maintains bile acid homeostasis in the subject.
- Also provided herein is a method of treating a cancer or tumor, such as a FGF19-dependent cancer or tumor, or a symptom thereof, in a subject, comprising administering to the subject a therapeutically effective amount of a FGF19 variant.
- the administration results in an improvement in the cancer, tumor or symptom thereof in the subject.
- the method results in a reduction in tumor number, tumor size, or tumor weight.
- Also provided herein is a method of preventing a cancer or tumor, such as a FGF19-dependent cancer or tumor, or a symptom thereof, in a subject, comprising administering to the subject a cancer or tumor, such as a FGF19-dependent cancer or tumor, or a symptom thereof, in a subject, comprising administering to the subject a cancer or tumor, such as a FGF19-dependent cancer or tumor, or a symptom thereof, in a subject, comprising administering to the subject a
- the administration results in prevention of the cancer, tumor, or symptom thereof in the subject.
- the method results in a reduction in tumor number, tumor size, or tumor weight.
- the cancer or tumor is a FGF19-dependent cancer or tumor.
- the cancer or tumor is hepatocellular carcinoma.
- the cancer or tumor is not hepatocellular carcinoma.
- the cancer or tumor is a colon cancer or tumor.
- the cancer or tumor is a prostate cancer or tumor.
- the cancer or tumor is a lung cancer or tumor.
- the FGF19 variant is a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: l . In some embodiments, the FGF 19 variant is a polypeptide consisting of an amino acid sequence set forth in SEQ ID NO: 1. In certain embodiments, the subject is a subject in need thereof.
- the FGF19 variant is selected from the group consisting of M5, M6, M7, M14, M15, M32, M36, M43, M52, M53, M67, M68, M69, M70, M75, M76, M77, M83, M84, M140, M144, M145, M146 and M160.
- the FGF 19 variant is M5. In another embodiment, the FGF 19 variant is M6. In some embodiments, the FGF 19 variant is M7. In one embodiment, the FGF 19 variant is Ml 4. In another embodiment, the FGF19 variant is M15. In other embodiments, the FGF19 variant is M32. In one embodiment, the FGF 19 variant is M36. In another embodiment, the FGF 19 variant is M43. In other embodiments, the FGF19 variant is M52. In yet other embodiment, the FGF19 variant is M53. In some embodiments, the FGF19 variant is M67. In one embodiment, the FGF19 variant is M68. In another embodiment, the FGF 19 variant is M69. In some embodiments, the FGF 19 variant is M70.
- the FGF 19 variant is M75. In another embodiment, the FGF 19 variant is M76. In other embodiments, the FGF19 variant is M77. In yet other embodiments, the FGF19 variant is M83. In one embodiment, the FGF19 variant is M84. In another embodiment, the FGF19 variant is M140. In other embodiments, the FGF19 variant is M144. In yet other embodiments, the FGF19 variant is M145. In one embodiment, the FGF19 variant is M146. In some embodiments, the FGF19 variant is M160. In other embodiments, any combination of two or more of the foregoing FGF 19 variants is also contemplated.
- the FGF19 variant comprises an amino acid sequence set forth in any one of SEQ ID NOS:5-29; or a subsequence or fragment thereof. In other embodiments of the methods provided herein, the FGF 19 variant consists of an amino acid sequence set forth in any one of SEQ ID NOS: 5-29; or a subsequence or fragment thereof. In certain embodiments, the N-terminal R residue is deleted. In some embodiments, the
- FGF19 variant comprises or consists of SEQ ID NO:5. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:6. In one embodiment, the FGF19 variant comprises or consists of SEQ ID NO:7. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:8. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO:9. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 10. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 11. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO: 12. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 13.
- the FGF19 variant comprises or consists of SEQ ID NO: 14. In one embodiment, the FGF19 variant comprises or consists of SEQ ID NO: 15. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO: 16. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 17. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 18. In yet other embodiments, the FGF19 variant comprises or consists of SEQ ID NO: 19. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:20. In one embodiment, the FGF19 variant comprises or consists of SEQ ID NO:21. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:22.
- the FGF19 variant comprises or consists of SEQ ID NO:23. In another embodiment, the FGF19 variant comprises or consists of SEQ ID NO:24. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:25. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:26. In yet other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:27. In some embodiments, the FGF19 variant comprises or consists of SEQ ID NO:28. In other embodiments, the FGF19 variant comprises or consists of SEQ ID NO:29. In certain embodiments, the FGF19 variant comprises or consists of any one of the foregoing sequences, wherein the N-terminal R residue is deleted. In some embodiments, the FGF19 variant comprises or consists of a subsequence of any of the foregoing sequences. In other embodiments, any combination of two or more of the foregoing FGF19 variants is also contemplated.
- compositions suitable for administration to a subject can be in the form of compositions suitable for administration to a subject.
- compositions are "pharmaceutical compositions" comprising one or more polypeptides and one or more pharmaceutically acceptable or
- the polypeptides are present in a therapeutically acceptable amount.
- the pharmaceutical compositions can be used in the methods of the present disclosure; thus, for example, the pharmaceutical compositions can be administered ex vivo or in vivo to a subject in order to practice the therapeutic and prophylactic methods and uses described herein. [0185]
- the pharmaceutical compositions of the present disclosure can be formulated to be compatible with the intended method or route of administration; exemplary routes of administration are set forth herein.
- the pharmaceutical compositions can be used in combination with other therapeutically active agents or compounds (e.g. , glucose lowering agents) as described herein in order to treat or prevent the diseases, disorders and conditions as contemplated by the present disclosure.
- compositions typically comprise a therapeutically effective amount of at least one of the polypeptides contemplated by the present disclosure and one or more pharmaceutically and physiologically acceptable formulation agents.
- suitable pharmaceutically acceptable or physiologically acceptable diluents, carriers or excipients include, but are not limited to, antioxidants (e.g., ascorbic acid and sodium bisulfate), preservatives (e.g., benzyl alcohol, methyl parabens, ethyl or n-propyl, p-hydroxybenzoate), emulsifying agents, suspending agents, dispersing agents, solvents, fillers, bulking agents, detergents, buffers, vehicles, diluents, and/or adjuvants.
- antioxidants e.g., ascorbic acid and sodium bisulfate
- preservatives e.g., benzyl alcohol, methyl parabens, ethyl or n-propyl, p-hydroxybenzoate
- a suitable vehicle can be physiological saline solution or citrate buffered saline, possibly supplemented with other materials common in pharmaceutical compositions for parenteral administration.
- Neutral buffered saline or saline mixed with serum albumin are further exemplary vehicles.
- Typical buffers include, but are not limited to, pharmaceutically acceptable weak acids, weak bases, or mixtures thereof.
- the buffer components can be water soluble materials such as phosphoric acid, tartaric acids, lactic acid, succinic acid, citric acid, acetic acid, ascorbic acid, aspartic acid, glutamic acid, and salts thereof.
- Acceptable buffering agents include, for example, a Tris buffer, N-(2-Hydroxyethyl)piperazine-N'-
- HPES 2-ethanesulfonic acid
- MES 2-(N-Morpholino)ethanesulfonic acid
- Morpholino)ethanesulfonic acid sodium salt MES
- MOPS metal-tris[Hydroxymethyl]methyl-3-aminopropanesulfonic acid
- TAPS N-tris[Hydroxymethyl]methyl-3-aminopropanesulfonic acid
- a pharmaceutical composition After a pharmaceutical composition has been formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations can be stored either in a ready-to-use form, a lyophilized form requiring reconstitution prior to use, a liquid form requiring dilution prior to use, or other acceptable form.
- the pharmaceutical composition is provided in a single-use container (e.g. , a single-use vial, ampoule, syringe, or autoinjector (similar to, e.g., an EpiPen®)), whereas a multi-use container
- any drug delivery apparatus can be used to deliver the polypeptides, including implants (e.g., implantable pumps) and catheter systems, both of which are well known to the skilled artisan.
- Depot injections which are generally administered subcutaneously or intramuscularly, can also be utilized to release the polypeptides disclosed herein over a defined period of time. Depot injections are usually either solid- or oil-based and generally comprise at least one of the formulation components set forth herein.
- One of ordinary skill in the art is familiar with possible formulations and uses of depot injections.
- the use of Nano Precision Medical's depot delivery technology (Nano Precision Medical; Emeryville, CA) is contemplated.
- the technology utilizes a titania nanotube membrane that produces zero-order release rates of macromolecules, such as protein and peptide therapeutics.
- the biocompatible membrane is housed in a small, subcutaneous implant that provides long-term (e.g., up to one year), constant-rate delivery of therapeutic macromolecules.
- the technology is currently being evaluated, e.g., for the delivery of GLP-1 agonists for the treatment of Type II diabetes.
- the pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension.
- This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents mentioned herein.
- the sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol.
- Acceptable diluents, solvents and dispersion media that can be employed include water, Ringer's solution, isotonic sodium chloride solution, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline
- PBS polyol
- polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol
- suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil can be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid find use in the preparation of injectables. Prolonged absorption of particular injectable formulations can be achieved by including an agent that delays absorption (e.g., aluminum monostearate or gelatin).
- compositions containing the active ingredient can be in a form suitable for oral use, for example, as tablets, capsules, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups, solutions, microbeads or elixirs.
- Pharmaceutical compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions, and such compositions can contain one or more agents such as, for example, sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
- Tablets, capsules and the like contain the active ingredient in admixture with non-toxic
- excipients which are suitable for the manufacture of tablets.
- excipients can be, for example, diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example magnesium stearate, stearic acid or talc.
- the tablets, capsules and the like suitable for oral administration can be uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action.
- a time-delay material such as glyceryl
- monostearate or glyceryl distearate can be employed. They can also be coated by techniques known in the art to form osmotic therapeutic tablets for controlled release.
- Additional agents include biodegradable or biocompatible particles or a polymeric substance such as polyesters, polyamine acids, hydrogel, polyvinyl pyrrolidone, polyanhydrides, polyglycolic acid, ethylene-vinylacetate, methylcellulose, carboxymethylcellulose, protamine sulfate, or lactide/glycolide copolymers, polylactide/glycolide copolymers, or ethylenevinylacetate copolymers in order to control delivery of an administered composition.
- the oral agent can be entrapped in microcapsules prepared by coacervation techniques or by interfacial polymerization, by the use of
- colloidal dispersion systems include
- liposomes macromolecule complexes, nano-capsules, microspheres, microbeads, and lipid-based systems, including oil-in- water emulsions, micelles, mixed micelles, and liposomes.
- Methods of preparing liposomes are described in, for example, U.S. Patent Nos. 4,235,871 , 4,501 ,728, and 4,837,028. Methods for the preparation of the above-mentioned formulations will be apparent to those skilled in the art.
- Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate, kaolin or microcrystalline cellulose, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
- an inert solid diluent for example, calcium carbonate, calcium phosphate, kaolin or microcrystalline cellulose
- water or an oil medium for example peanut oil, liquid paraffin, or olive oil.
- Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture thereof.
- excipients can be suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxy-propylmethylcellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents, for example a naturally-occurring phosphatide (e.g., lecithin), or condensation products of an alkylene oxide with fatty acids (e.g., polyoxy-ethylene stearate), or condensation products of ethylene oxide with long chain aliphatic alcohols (e.g., for heptadecaethyleneoxycetanol), or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol (e.g., polyoxyethylene sorbitol monooleate), or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol an
- Oily suspensions can be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
- the oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents can be added to provide a palatable oral preparation.
- Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
- a dispersing or wetting agent e.g., kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, ka
- the pharmaceutical compositions of the present disclosure can also be in the form of oil- in-water emulsions.
- the oily phase can be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example, liquid paraffin, or mixtures of these.
- Suitable emulsifying agents can be naturally-occurring gums, for example, gum acacia or gum tragacanth; naturally-occurring phosphatides, for example, soy bean, lecithin, and esters or partial esters derived from fatty acids; hexitol anhydrides, for example, sorbitan monooleate; and condensation products of partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate.
- Formulations can also include carriers to protect the composition against rapid degradation or elimination from the body, such as a controlled release formulation, including implants, liposomes, hydrogels, prodrugs and microencapsulated delivery systems.
- a time delay material such as glyceryl monostearate or glyceryl stearate alone, or in combination with a wax, can be employed.
- the present disclosure contemplates the administration of the polypeptides in the form of suppositories for rectal administration of the drug.
- the suppositories can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
- suitable non-irritating excipient include, but are not limited to, cocoa butter and polyethylene glycols.
- polypeptides contemplated by the present disclosure can be in the form of any other suitable pharmaceutical composition (e.g., sprays for nasal or inhalation use) currently known or developed in the future.
- concentration of a polypeptide or fragment thereof in a formulation can vary widely (e.g., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight) and will usually be selected primarily based on fluid volumes, viscosities, and subject- based factors in accordance with, for example, the particular mode of administration selected.
- Suitable routes of administration include parenteral (e.g., intramuscular, intravenous, subcutaneous (e.g., injection or implant), intraperitoneal, intracisternal, intraarticular, intraperitoneal, intracerebral (intraparenchymal) and
- intracerebro ventricular oral, nasal, vaginal, sublingual, intraocular, rectal, topical (e.g.,
- Depot injections which are generally administered subcutaneously or intramuscularly, can also be utilized to release the polypeptides disclosed herein over a defined period of time.
- Depot injections are usually either solid- or oil-based and generally comprise at least one of the formulation components set forth herein.
- One of ordinary skill in the art is familiar with possible formulations and uses of depot injections.
- an antibody or antibody fragment of the present disclosure is stored at 10 mg/ml in sterile isotonic aqueous saline solution for injection at 4°C and is diluted in either 100 ml or 200 ml 0.9% sodium chloride for injection prior to
- the antibody is administered by intravenous infusion over the course of 1 hour at a dose of between 0.2 and 10 mg/kg. In other embodiments, the antibody is administered by intravenous infusion over a period of between 15 minutes and 2 hours. In still other embodiments, the administration procedure is via subcutaneous bolus injection.
- the present disclosure contemplates the use of the FGF19 variant polypeptides identified herein in combination with one or more active therapeutic agents or other prophylactic or therapeutic modalities.
- the various active agents frequently have different mechanisms of action.
- Such combination therapy can be especially advantageous by allowing a dose reduction of one or more of the agents, thereby reducing or eliminating the adverse effects associated with one or more of the agents; furthermore, such combination therapy can have a synergistic therapeutic or prophylactic effect on the underlying disease, disorder, or condition.
- “combination” is meant to include therapies that can be administered separately, for example, formulated separately for separate administration (e.g.
- kits that can be provided in a kit
- therapies that can be administered together in a single formulation (i.e. , a "co- formulation").
- Combinations of the polypeptides identified using the methods and models described herein with one or more active therapeutic agents or other prophylactic or therapeutic modalities can be administered or applied sequentially (e.g. , where one agent is administered prior to one or more other agents) or simultaneously (e.g. , where two or more agents are administered at or about the same time). Regardless of whether the two or more agents are administered sequentially or
- kits for treating diseases and uses of the polypeptides identified through use of the methods and models described herein can be practiced prior to, substantially contemporaneously with or following another treatment, and can be supplemented with other forms of therapy.
- Supplementary therapies include other glucose lowering and/or weigh loss treatments, such as insulin, an insulin sensitivity enhancer and other drug treatments, a change in diet (low sugar, fats, etc.), weight loss surgery- (reducing stomach volume by gastric bypass, gastrectomy), gastric banding, gastric balloon, gastric sleeve, etc.
- the present disclosure contemplates combination therapy with numerous agents (and classes thereof), including 1) insulin, insulin mimetics and agents that entail stimulation of insulin secretion, including sulfonylureas (e.g. , chlorpropamide, tolazamide, acetohexamide, tolbutamide, glyburide, glimepiride, glipizide) and meglitinides (e.g. , repaglinide (PRANDIN) and nateglinide (STARLIX)); 2) biguanides (e.g.
- sulfonylureas e.g. , chlorpropamide, tolazamide, acetohexamide, tolbutamide, glyburide, glimepiride, glipizide
- meglitinides e.g. , repaglinide (PRANDIN) and nateglinide (STARLIX)
- biguanides e.g.
- metformin GLUCOPHAGE
- alpha-glucosidase inhibitors e.g. , acarbose and miglitol
- thiazolidinediones e.g.
- rosiglitazone AVANDIA
- troglitazone REZULIN
- pioglitazone ACTOS
- glipizide balaglitazone
- rivoglitazone netoglitazone
- troglitazone englitazone
- ciglitazone adaglitazone
- darglitazone that enhance insulin action (e.g. , by insulin sensitization), thus promoting glucose utilization in peripheral tissues;
- glucagon-like -peptides including DPP-IV inhibitors (e.g. , vildagliptin (GALVUS) and sitagliptin (JANUVIA)) and
- GLP-1 Glucagon-Like Peptide- 1
- GLP-1 agonists and analogs e.g. , exenatide (BYETTA and ITCA 650 (an osmotic pump inserted subcutaneously that delivers an exenatide analog over a 12- month period; Intarcia, Boston, MA)); 6) and DPP-IV-resistant analogues (incretin mimetics), PPAR gamma agonists, dual-acting PPAR agonists, pan-acting PPAR agonists, PTP1B inhibitors, SGLT inhibitors, insulin secretagogues, RXR agonists, glycogen synthase kinase-3 inhibitors, immune modulators, beta-3 adrenergic receptor agonists, 1 lbeta-HSDl inhibitors, and amylin analogues.
- exenatide BYETTA and ITCA 650 (an osmotic pump inserted subcutaneously that delivers an exenatide
- the present disclosure contemplates combination therapy with agents and methods for promoting weight loss, such as agents that stimulate metabolism or decrease appetite, and modified diets and/or exercise regimens to promote weight loss.
- agents and methods for promoting weight loss such as agents that stimulate metabolism or decrease appetite, and modified diets and/or exercise regimens to promote weight loss.
- Appetite suppression drugs are well known and can be used in combination with the methods provided herein.
- FGF19 variant polypeptides of the present disclosure can be used in combination with one or more other agent in any manner appropriate under the circumstances.
- one or more other agent in any manner appropriate under the circumstances.
- treatment with the at least one active agent and at least one polypeptide of the present disclosure is maintained over a period of time.
- treatment with the at least one active agent is reduced or discontinued (e.g., when the subject is stable), while treatment with the polypeptide of the present disclosure is maintained at a constant dosing regimen.
- treatment with the at least one active agent is reduced or discontinued (e.g., when the subject is stable), while treatment with the polypeptide of the present disclosure is reduced (e.g., lower dose, less frequent dosing or shorter treatment regimen).
- treatment with the at least one active agent is reduced or discontinued (e.g., when the subject is stable), and treatment with the polypeptide of the present disclosure is increased (e.g., higher dose, more frequent dosing or longer treatment regimen).
- treatment with the at least one active agent is maintained and treatment with the polypeptide of the present disclosure is reduced or discontinued (e.g., lower dose, less frequent dosing or shorter treatment regimen).
- treatment with the at least one active agent and treatment with the polypeptide of the present disclosure are reduced or discontinued (e.g., lower dose, less frequent dosing or shorter treatment regimen).
- the polypeptides of the present disclosure can be administered to a subject in an amount that is dependent upon, for example, the goal of the administration (e.g., the degree of resolution desired); the age, weight, sex, and health and physical condition of the subject to be treated; the nature of the polypeptide, and/or formulation being administered; the route of administration; and the nature of the disease, disorder, condition or symptom thereof (e.g. , the severity of the dysregulation of glucose/insulin and the stage of the disorder).
- the dosing regimen can also take into consideration the existence, nature, and extent of any adverse effects associated with the agent(s) being administered. Effective dosage amounts and dosage regimens can readily be determined from, for example, safety and dose-escalation trials, in vivo studies (e.g. , animal models), and other methods known to the skilled artisan.
- dosing parameters dictate that the dosage amount be less than an amount that could be irreversibly toxic to the subject (i.e. , the maximum tolerated dose, "MTD”) and not less than an amount required to produce a measurable effect on the subject.
- MTD maximum tolerated dose
- Such amounts are determined by, for example, the pharmacokinetic and pharmacodynamic parameters associated with absorption, distribution, metabolism, and excretion (“ADME”), taking into consideration the route of administration and other factors.
- An effective dose is the dose or amount of an agent that produces a therapeutic response or desired effect in some fraction of the subjects taking it.
- the "median effective dose” or ED50 of an agent is the dose or amount of an agent that produces a therapeutic response or desired effect in 50% of the population to which it is administered.
- the ED50 is commonly used as a measure of reasonable expectance of an agent's effect, it is not necessarily the dose that a clinician might deem appropriate taking into consideration all relevant factors.
- the effective amount is more than the calculated ED50, in other situations the effective amount is less than the calculated ED50, and in still other situations the effective amount is the same as the calculated ED50.
- an effective dose of the polypeptides of the present disclosure can be an amount that, when administered in one or more doses to a subject, produces a desired result relative to a healthy subject.
- an effective dose can be one that, when administered to a subject having elevated plasma glucose and/or plasma insulin, achieves a desired reduction relative to that of a healthy subject by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 10%, at least about 80%), or more than 80%).
- An appropriate dosage level will generally be about 0.001 to 100 mg/kg of patient body weight per day, which can be administered in single or multiple doses. In some embodiments, the dosage level will be about 0.01 to about 25 mg/kg per day, and in other embodiments about 0.05 to about 10 mg/kg per day. A suitable dosage level can be about 0.01 to 25 mg/kg per day, about 0.05 to 10 mg/kg per day, or about 0.1 to 5 mg/kg per day. Within this range, the dosage can be 0.005 to 0.05, 0.05 to 0.5 or 0.5 to 5.0 mg/kg per day.
- compositions can be provided in the form of tablets, capsules and the like containing from 1.0 to 1000 milligrams of the active ingredient, particularly 1.0, 3.0, 5.0, 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, 100.0, 150.0, 200.0, 250.0, 300.0, 400.0, 500.0, 600.0, 750.0, 800.0, 900.0, and 1000.0 milligrams of the active ingredient.
- the polypeptides can be administered on a regimen of, for example, 1 to 4 times per day, and often once or twice per day.
- the dosage of the polypeptides of the present disclosure can be repeated at an appropriate frequency, which can be in the range of once per day to once every three months, depending on the pharmacokinetics of the polypeptides (e.g. half- life) and the pharmacodynamic response (e.g. the duration of the therapeutic effect of the polypeptide).
- the polypeptide is an antibody or a fragment thereof, or a polypeptide or variants thereof
- dosing is frequently repeated between once per week and once every 3 months.
- such polypeptides are administered approximately once per month.
- the dosage of the disclosed polypeptides is contained in a "unit dosage form.”
- unit dosage form refers to physically discrete units, each unit containing a predetermined amount of a polypeptide of the present disclosure, either alone or in combination with one or more additional agents, sufficient to produce the desired effect. It will be appreciated that the parameters of a unit dosage form will depend on the particular agent and the effect to be achieved.
- Exemplary unit doses can range from about 25-250; 250-500; 500-1,000; 1 ,000-2,500; 2,500-5,000; 5,000-25,000; or 25,000-50,000 ng; or from about 25-250; 250-500; 500-1 ,000; 1 ,000- 2,500; 2,500-5,000; 5,000-25,000; 25,000-50,000 ⁇ g; or from about 25-250; 250-500; 500-1 ,000; 1000-2,500; 2,500-5,000; 5,000-25,000; or 25,000-50,000 mg.
- Single or multiple doses can be administered, for example, multiple times per day, on consecutive days, alternating days, weekly or intermittently (e.g., twice per week, once every 1 , 2, 3, 4, 5, 6, 7 or 8 weeks, or once every 2, 3, 4, 5 or 6 months).
- kits comprising the disclosed polypeptides, and pharmaceutical compositions thereof.
- the kits are generally in the form of a physical structure housing various components, as described below, and can be utilized, for example, in practicing the methods described above (e.g., administration of a polypeptide to a subject in need of restoring glucose homeostasis).
- a kit can include one or more of the polypeptides disclosed herein (provided in, e.g., a sterile container), which can be in the form of a pharmaceutical composition suitable for administration to a subject.
- the polypeptides can be provided in a form that is ready for use or in a form requiring, for example, reconstitution or dilution prior to administration.
- the kit can also include buffers, pharmaceutically acceptable excipients, and the like, packaged with or separately from the polypeptides.
- the kit can contain the several agents separately or they can already be combined in the kit.
- Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package.
- a kit of the present disclosure can be designed for conditions necessary to properly maintain the components housed therein (e.g. , refrigeration or freezing).
- a kit can contain a label or packaging insert including identifying information for the components therein and instructions for their use (e.g. , dosing parameters, clinical pharmacology of the active ingredient(s), including mechanism of action, pharmacokinetics and pharmacodynamics, adverse effects, contraindications, etc.). Labels or inserts can include manufacturer information such as lot numbers and expiration dates.
- the label or packaging insert can be, e.g. , integrated into the physical structure housing the components, contained separately within the physical structure, or affixed to a component of the kit (e.g. , an ampoule, tube or vial).
- Exemplary instructions include those for reducing or lowering blood glucose, treatment of hyperglycemia, treatment of diabetes, etc. with the disclosed polypeptides, and pharmaceutical compositions thereof
- Labels or inserts can additionally include, or be incorporated into, a computer readable medium, such as a disk (e.g. , hard disk, card, memory disk), optical disk such as CD- or DVD-ROM/RAM, DVD, MP3, magnetic tape, or an electrical storage media such as RAM and ROM or hybrids of these such as magnetic/optical storage media, FLASH media or memory-type cards.
- a computer readable medium such as a disk (e.g. , hard disk, card, memory disk), optical disk such as CD- or DVD-ROM/RAM, DVD, MP3, magnetic tape, or an electrical storage media such as RAM and ROM or hybrids of these such as magnetic/optical storage media, FLASH media or memory-type cards.
- the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. , via the internet, are provided.
- reference to a range of 90-100% includes 91-99%, 92-98%, 93-95%, 91-98%, 91-97%, 91-96%, 91-95%, 91-94%, 91-93%, and so forth.
- Reference to a range of 90-100% also includes 91%, 92%, 93%, 94%, 95%, 96%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc. , 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc. , and so forth.
- reference to a range of 1-3, 3-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-1 10, 1 10-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, 190-200, 200-225, 225-250 includes 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.
- reference to a range of 25-250, 250-500, 500-1000, 1000-2500, 2500-5000, 5000-25,000, or 5000-50,000 includes any numerical value or range within or encompassing such values, e.g.
- ranges such as 5-10, 10-20, 20-30, 30-40, 40-50, 50-75, 75-100, 100-150, includes ranges such as 5-20, 5-30, 5-40, 5-50, 5-75, 5-100, 5-150, and 10-30, 10-40, 10-50, 10-75, 10-100, 10-150, and 20-40, 20-50, 20-75, 20-100, 20-150, and so forth.
- PG fasting plasma glucose
- FPI fasting plasma insulin
- ITT insulin tolerance test
- PTT pyruvate tolerance test
- oGTT oral glucose tolerance test
- GSIS glucose-stimulated insulin secretion
- AAV adneno- associated virus
- PBS phosphate-buffered saline
- PCR polymerase chain reaction
- NHS N- Hydroxysuccinimide
- DMEM Dulbeco's Modification of Eagle's Medium
- GC genome copy
- EDTA ethylenediaminetetraacetic acid
- FGF19CF FGF19 with FLAG-tag at the C-terminus
- GFP green fluorescent protein
- ELISA enzyme-linked immunosorbance assay
- ANOVA analysis
- mice (The Jackson Laboratory; Bar Harbor, ME), approximately 15 weeks old mice and weighing approximately 36-48 g at initiation of treatment, were kept in accordance with welfare guidelines under controlled light (12-hour light and 12-hour dark cycle, dark 6:30 p.m. - 6:30 a.m.), temperature (22 ⁇ 4° C) and humidity (50% ⁇ 20%) conditions.
- Mice had free access to autoclaved distilled water and were fed ad libitum a commercial diet (Harlan Laboratories, Indianapolis, IN, Irradiated 2018 Teklad Global 18% Protein Rodent Diet) containing 18 kcal% fat, 24 kcal% protein and 58 kcal% carbohydrate. All animal studies were approved by the NGM Institutional Animal Care and Use Committee.
- FGF 19 ORF cDNA of ORF encoding hFGF19 (GenBank Accession No. NM_005117.2) and protein sequence encoded thereby (GenBank Accession No. NP_005108.1) was amplified via PCR using recombinant DNA (cDNA) prepared from human small intestinal tissue.
- PCR reagent kits with Phusion® high-fidelity DNA polymerase (F-530L; New England BioLabs; Ipswich, MA) were used with the following primers: forward PCR primer: 5' CCGACTAGTCACCatgcggagcgggtgtgtgg (SEQ ID NO:40), and reverse PCR primer: 5' ATAAGAATGCGGCCGCTTACTTCTCAAAGCTGGGACTCCTC (SEQ ID NO:41).
- Amplified DNA fragment was digested with Spe I and Not I (the restriction sites were included in the 5' or 3' PCR primers, respectively) and was then ligated with AAV transgene vectors that had been digested with the same restriction enzymes.
- the vector used for expression contained a selectable marker and an expression cassette composed of a strong eukaryotic promoter 5 ' of a site for insertion of the cloned coding sequence, followed by a 3' untranslated region and bovine growth hormone polyadenylation tail.
- the expression construct was also flanked by internal terminal repeats at the 5' and 3' ends.
- AAV293 cells (Agilent Technologies, Santa Clara, CA) were cultured in Dulbeco's Modification of Eagle's
- DMEM fetal bovine serum
- the cells were scraped off the plates, pelleted by centrifugation at 3000 ⁇ g and re-suspended in buffer containing 20 mM Tris pH 8.5, 100 mM NaCl and 1 mM MgCl 2 .
- the suspension was frozen in an alcohol dry ice bath and was then thawed in 37°C water bath; the freeze -thaw cycle was repeated three times.
- Benzonase® Sigma-Aldrich; St. Louis, MO
- deoxycholate was added to a final concentration of 0.25%. After incubation at 37°C for 30 minutes, cell debris was pelleted by centrifugation at 5000 x g for
- Viral particles in the supernatant were purified using a discontinued iodixanal
- Vivaspin® 20 molecular weight (MW) cutoff 100,000 Da, Sartorius Stedim Biotech; Aubagne, France
- PBS phosphate -buffered saline
- GC viral genome copy
- 2 iL of viral stock was incubated in 6 iL of solution containing 50 units/mL Benzonase, 50 mM Tris-HCl pH 7.5, 10 mM MgCl 2 , and 10 mM CaCi 2 at 37°C for 30 minutes. Afterwards, 15 iL of the solution containing 2 mg/mL of Proteinase K, 0.5%) SDS, and 25 mM EDTA were added and the mixture was incubated for an additional 20 minutes at 55°C to release viral DNA. Viral DNA was cleaned with mini DNeasy® Kit (Qiagen; Valencia, CA) and eluted with 40 iL of water. Viral GC was determined using quantitative PCR. Viral stock was diluted with saline to the desirable GC/mL and the working solution (200 ⁇ ) was injected into mice via a tail vein.
- Blood Glucose Assay Blood samples were collected from individual non-fasted animals by tail snip, and plasma glucose levels were measured using a glucometer (Accu-Chek® instruments; Roche Diagnostics, Indianapolis, IN) following manufacturer's instruction.
- Serum FGF19 and FGF19 Variant Exposure Level Assay Whole blood ( ⁇ 50 ⁇ /mouse) from mouse tail snips was collected into plain capillary tubes (BD Clay Adams SurePrepTM, Becton Dickenson; Sparks, MD). Serum and blood cells were separated by centrifugation for 10 mins at 10,000 rpm, 4°C in an AutocritTM Ultra 3 centrifuge (Becton Dickinson) and immediately frozen at - 80°C. Levels of FGF19 and FGF19 variants were measured in serum using a commercially available ELISA (Biovendor; Asheville, NC) following the manufacturer's instructions. Human FGF19 was used as the standard and relative concentrations of M70 were determined. Relative concentrations of other FGF19 variants can be determined accordingly.
- Fat Mass and Lean Mass Measurements Un-anesthetized animals were placed individually in a plastic holder and body composition determined using NMR-MRI (whole body composition analyzer, EchoMRITM, Houston, TX). Fat mass, lean mass, and water content (data not presented) were recorded. The entire procedure did not exceed 2 minutes for each animal.
- Gross Liver Nodule Assessment Twenty-four weeks after AAV injection, animals were euthanized and individual livers were examined for gross nodule formation. The number of visible liver nodules (>2 mm in diameter) were counted and recorded.
- AAV was used in this example (and examples 2-4 that follow) as the vehicle to deliver and express exogenous genes of interest in mice and enable continuous, persistent and systemic exposure to proteins encoded by those trans genes.
- mice Prior to gene delivery, mice were sorted into six groups (5 male mice/group) as set forth in Table 1, and blood glucose and body weight measurements were recorded for each mouse.
- mice were injected either with 0.2 mL saline or 0.2 mL of one of the AAV constructs from Groups 2-6.
- mice were injected either with 0.2 mL saline or 0.2 mL of one of the AAV constructs from Groups 2-6.
- blood glucose and body weight measurements were again recorded for each mouse in Groups 1-6.
- FGF19 concentrations were measured in sera isolated from mice injected either with saline (Group 1) or AAV constructs (Groups 2-6). Since the ELISA used to measure drug concentrations was unable to accurately distinguish between FGF19 and M70, plasma levels determined for Groups 5 and 6 represent the total plasma concentrations of both proteins.
- FGF19 was undetectable in samples isolated from db/db mice injected with either saline or AAV-GFP.
- Transgenic db/db mice co-expressing M70 and FGF19-flag (Groups 5 and 6) showed significant reductions in body weight as compared with animals dosed with saline (Group 1). Less dramatic effects on body weight were observed in mice expressing the FGF19-flag transgene, although the reductions appeared to be dose-dependent and were significant at weeks 3 and 5 in animals injected with the higher dose (Groups 3 and 4).
- mice in both control groups dosed either with saline (Group 1) or AAV-GFP (Group 2)
- saline Group 1
- AAV-GFP Group 2
- mice in both control groups tended to show significant loss of mass by the end of the study, compared with their maximum body weights in weeks 3 and 5 following gene delivery.
- the body weight loss in these animals is commonly associated with the severe hyperglycemia observed in db/db mice and the progression of type 2 diabetes during the course of the 24-week study.
- mice co-expressing the FGF19-flag and M70 transgenes were reflected in reduced liver weights compared with those harvested from animals in the saline group (data not shown); notably, the reduced organ size was directly proportional to the lower body weight in these mice. In contrast, the relative liver weight was increased in mice expressing FGF19-flag, although these changes were similarly not significant when normalized to body weight (data not shown)
- Transgenic db/db mice co-expressing M70 and FGF19-flag (Groups 5 and 6) showed significant reductions in blood glucose concentrations as compared with control animals (Groups 1 and 2).
- Glucose levels were reduced rapidly in mice co-expressing the FGF19-flag and M70 transgenes, reaching plateau levels by approximately 3 weeks after gene delivery (160 and
- mice expressing FGF19-flag were significantly lower than in control groups, and maintained at initial baseline levels (approximately 400-450 mg/dL) during the course of the 24-week study.
- the c- Flag component did not impact FGF19's tumorogenic effects, it can impact FGF19's antidiabetic effects.
- the low systemic levels of FGF19-flag detected in these mice appear to provide some protection against the deteriorating glycemia observed in mice treated with saline or AAV-GFP, but fail to lower glucose levels below the baseline values.
- AAV293 cells (Agilent Technologies, Santa Clara, CA) were cultured in Dulbeco's Modification of Eagle's Medium (DMEM, Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum and 1 antibiotic-antimycotic solution (Mediatech).
- DMEM Dulbeco's Modification of Eagle's Medium
- Mediatech Mediatech
- the cells were plated at 50% density on Day 1 in 150-mm cell culture plates and transfected on Day 2, using calcium phosphate precipitation method, with the following three plasmids (20 ⁇ g/plate of each): i) AAV transgene plasmid, ii) pHelper plasmids (Agilent Technologies), and iii) AAV2/9 plasmid (Rabinowitz et al. 2002).
- the cells were scraped off the plates, pelleted by centrifugation at 3000 x g and re-suspended in buffer containing 20 mM Tris pH 8.5, 100 mM NaCl and 1 mM MgCl 2 .
- the suspension was frozen in an alcohol dry ice bath and was then thawed in 37°C water bath; the freeze -thaw cycle was repeated three times.
- Benzonase® Sigma-Aldrich; St. Louis, MO
- deoxycholate was added to a final concentration of 0.25%. After incubation at 37°C for 30 minutes, cell debris was pelleted by centrifugation at 5000 x g for
- Viral particles in the supernatant were purified using a discontinued iodixanal
- Vivaspin® 20 molecular weight (MW) cutoff 100,000 Da, Sartorius Stedim Biotech; Aubagne, France
- PBS phosphate -buffered saline
- GC viral genome copy
- 2 ⁇ of viral stock was incubated in 6 iL of solution containing 50 units/mL Benzonase, 50 mM Tris-HCl pH 7.5, 10 mM MgCl 2 , and 10 mM CaCi 2 at 37°C for 30 minutes. Afterwards, 15 iL of the solution containing 2 mg/mL of Proteinase K, 0.5%) SDS, and 25 mM EDTA were added and the mixture was incubated for an additional 20 minutes at 55°C to release viral DNA. Viral DNA was cleaned with mini DNeasy® Kit (Qiagen; Valencia, CA) and eluted with 40 iL of water. Viral GC was determined using quantitative PCPv. Viral stock was diluted with saline to the desirable GC/mL and the working solution (200 ⁇ ) was injected into mice via a tail vein.
- mice were housed in a pathogen-free animal facility at 22°C under controlled 12 hour light/ 12 hour dark cycle. All mice were kept on standard chow diet (Harlan
- mice Male mice were used unless otherwise specified.
- cohorts of 10-12 week old ob/ob or db/db mice, or 6-8 week old C57BL/6J, FVB/NJ, BDF, or rasH2 mice were randomized into treatment groups based on body weight. All animals received a single 200 ⁇ ⁇ intravenous injection of 3 x 10 11 genome copies of AAV via tail vein on Day 1. Body weights were recorded and blood was collected via tail snip for measurement of serum FGF19 levels. Animals were euthanized and livers were collected 24 or 52 weeks after dosing with AAV.
- liver sections were stained with hematoxylin and eosin (H & E) for histological assessment of hepatocytic hyperplasia, hypertrophy, or neoplasia.
- H & E hematoxylin and eosin
- liver sections were treated for antigen retrieval using citrate buffer (Vector Laboratories) and then incubated with 10 ⁇ g/mL anti-PCNA (Dako), anti-Ki67 (Dako), anti-glutamine synthetase (Thermofisher), or anti- ⁇ - catenin antibodies (Cell Signaling).
- Biotinylated secondary antibody, ABC-HRP reagent, and DAB colorimetric peroxidase substrate were used for detection.
- livers were embedded in OCT and sectioned on Cryostat. Tissue sections were fixed in PBS containing 4% paraformaldehyde and 2% glutaraldehyde for 10 minutes and incubated with 1 mg/mL X-gal (Promega) in 5 mM potassium ferrocyanide and 5 mM potassium ferri cyanide at 37°C for 2 hours.
- Rat L6 myoblasts were obtained from American Type Culture Collection (ATCC) and cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% C02. Cells in 96-well plates were transiently transfected with expression vectors encoding mouse KLB, mouse FGFR4, GAL4-Elk-1
- Cyp7al expression in cell lysates was determined by qRT-PCR analysis using QuantiTect multiplex qRT-PCR master mix (Qiagen) and premade primers and probes (Life Technologies; mouse Cyp7al : Mm00484150_ml; rat Cyp7al : Rn00564065_ml; human Cyp7al : Hs00167982_ml).
- Reactions were performed in triplicates on Applied Biosystems 7900HT Sequence Detection System. Relative mRNA levels were calculated by the comparative threshold cycle method using 18S RNA (mouse and rat) or actin (human) as the internal standard.
- Frozen liver samples were homogenized in RIPA lysis buffer (50 mM Tris pH7.5, 150 mM NaCl, 1% NP40 and 0.5% sodium deoxycholic acid, 1 mM dithiothereitol ,1 mM PMSF, 2 mM sodium fluoride, and 2 mM sodium orthovanadate) containing protease inhibitors (Roche) and phosphatase inhibitors (Sigma). Equal amounts of protein (15 ⁇ g), as determined by BCA assay (Thermo Fisher), were separated on 4-20% polyacrylamide gels (Bio-Rad) and transferred to nitrocellulose membranes (Bio-Rad).
- RIPA lysis buffer 50 mM Tris pH7.5, 150 mM NaCl, 1% NP40 and 0.5% sodium deoxycholic acid, 1 mM dithiothereitol ,1 mM PMSF, 2 mM sodium fluoride, and 2 mM sodium orthovanadate
- protease inhibitors
- Membranes were blocked in 5% non-fat dry milk in PBS/0.05%) Tween 20 and incubated with antibodies to pSTAT3 (Cell Signaling), STAT3 (Cell Signaling), or antibody cocktail I (Cell Signaling). Bound antibodies were detected with horse radish peroxidase (HRP)-conjugated secondary reagents and visualized using Odyssey® scanner (Li-Cor Biotechnology).
- HRP horse radish peroxidase
- AAV-mediated gene delivery provides a means to achieve continuous transgene expression without inflammatory responses that are commonly associated with other viral vectors (Zaiss et al., 2002, J. Virol. 76, 4580-4590). Sustained expression of up to 1 year has been observed with the AAV gene delivery method when introduced into adult mice (Rivera et al., 1999, PNAS 96, 8657-8662). The first AAV vector was recently approved as a treatment for a genetic disorder in human (Wirth et al, 2013, Gene 525, 162-169).
- FGF19 was ectopically expressed in the skeletal muscle, a non-physiological site of FGF19 expression (Inagaki et ah, 2005, Cell Metabol. 2, 217-225; Nicholes et al., 2002, Amer. J. Pathol. 160, 2295-2307). Under pathological conditions such as cirrhosis or cholestasis, FGF19 expression is induced in the liver (Desnoyers et al., 2008, Oncogene 27, 85-97; Hasegawa Y, 2013, Hepatol. 58, 802A; Schaap et al., 2009, Hepatol. 49, 1228- 1235).
- FGF19 was introduced via AAV in 6-12 week old mice (FIG. 6A).
- the primary tissue of transgene expression is liver using this approach, with only marginal expression in heart and muscle (data not shown).
- 90- 100% transduction of hepatocytes and long-term gene expression without toxicity following a single administration of AAV were observed as previously reported (Zincarelli et al., 2008, Mol. Ther. 16, 1073-1080)(data not shown).
- FGF19 Promotes Hepatocarcinogenesis in Multiple Mouse Models.
- Various strains of mice (6-12 week old) were injected with 3 x 10 11 genome copies of AAV vectors encoding FGF19 or a control gene (GFP, green fluorescent protein). Tumor incidence was determined at 24 or 52 weeks after AAV administration, n.d., not determined.
- GFP green fluorescent protein
- mice injected with AAV-GFP exhibited similar phenotype as saline-injected animals (data not shown). For simplicity, only results from AAV-GFP-injected animals were shown as controls in the following studies.
- db/db mice exhibited the shortest latency and high tumor penetrance, with the appearance of multiple, large, raised tumor nodules protruding from the liver surface 24 weeks following AAV-FGF19 delivery (FIG. 6B).
- Serum FGF19 levels reached ⁇ 1 ⁇ , 1 week after single tail vein injection of 3 x 10 11 genome copies of AAV-FGF19 in db/db mice (FIG. 6C). No FGF19 was detected in mice injected with control virus. The high circulating levels of FGF19 persisted throughout the 24-week study period (FIG. 6C). Visible tumor nodules on the entire surface of the liver were counted (FIG. 6D). The maximum diameter of the liver tumor nodules was recorded (FIG. 6D). Occasionally a few liver tumor nodules were observed in db/db mice injected with control virus or saline, probably reflecting increased background in tumorigenesis in this genetic model (FIG. 6D and data not shown). A tumor score system was established based on the multiplicity of liver tumor nodules as described in the materials and methods (Example 6) (FIG. 6D).
- Liver tumors from AAV-FGF19 mice also showed increased nuclear staining for ⁇ -catenin (FIG. 6E).
- the AAV-mediated transgene expression provides a robust system to evaluate FGF19-induced hepatocarcinogenesis in vivo.
- M70 is an engineered, tumor-free FGF19 variant
- FGF19 and FGF21 belong to the same FGF subfamily, sharing 34% amino acid identity. Interestingly, unlike FGF 19, FGF21 does not induce liver tumor formation in our AAV-mediated transgene models (data not shown).
- a number of chimeric constructs between FGF 19 and FGF21 were generated by systematically swapping predicted secondary structural elements including a-strands and ⁇ -helices (Table 3). Table 3 shows chimeric constructs with amino acid sequences derived from FGF 19 or FGF21. Liver tumor formation was assessed 24 weeks after AAV-mediated transgene expression. Secondary structural components ( ⁇ -sheets and loops between ⁇ -sheets) of FGF 19 are replaced systematically. Constructs were individually introduced into db/db mice by AAV to assess their tumorigenic potential after 24 weeks of continuous exposure. The N-terminal 10-20 amino acids of FGF19 were identified as being critical for tumorigenicity (Table 3).
- Table 4 shows the structure activity relationship analysis of FGF19 variants in the N-terminal region. Amino acid changes from wild type FGF19 are underlined. Liver tumor formation was assessed 24 weeks after transgene expression.
- a FGF19 variant carrying 3 amino acid substitutions (A30S, G31S, H33L) and a 5- amino acid deletion, referred as M70 (SEQ ID NO: 1), was selected for further studies (FIG. 7A).
- M70-expressing mice did not show any increased liver weight (1.56 + 0.09 g vs.
- FIG. 7G Liver histological analysis revealed that M70-expressing mice did not develop any discernable preneoplastic and neoplastic lesions associated with FGF19 overexpression in mice. Specifically, no altered hepatic foci, hepatocellular dysplasia, hepatocellular adenomas, or hepatocellular carcinomas was observed (FIG. 7G).
- H & E stained liver sections from these mice were evaluated for the presence of tumors and preneoplastic lesions (FIG. 8F).
- anti-glutamine synthetase staining was carried out as a marker of FGF19-induced liver tumor (FIG. 8F).
- the sections stained for glutamine synthetase were taken from paired section stained with H & E and the photographs showed the same portal (p) and central (c) veins.
- rasH2 mice expressing FGF19 displayed hepatocellular adenoma as well as hepatocellular carcinomas.
- Preneoplastic hepatocellular lesions were also noted in FGF19- expressing rasH2 mice.
- M70 binds and activates FGFR4 in vitro and in vivo
- L6 cells transfected with a FGF-responsive GAL-Elkl luciferase reporter gene (Wu et ah, 2011, PloS one 6, el7868; Wu et al, 2010a, PNAS, 107, 14158-14163).
- a FGF-responsive GAL-Elkl luciferase reporter gene Wang et ah, 2011, PloS one 6, el7868; Wu et al, 2010a, PNAS, 107, 14158-14163.
- effective binding of a ligand to FGFR results in activation of an endogenous ERK kinase pathway, leading to subsequent activation of a chimeric transcriptional activator comprising of an Elk- 1 activation domain and a GAL4 DNA-binding domain.
- L6 cells lack functional FGFR or KLB and are only responsive to FGF19 when co-transfected with cognate receptors (data not shown).
- signaling in cells transfected with FGFR4 alone was much less responsive to either ligand, showing a > 500-fold reduction in potency upon addition of either FGF19 or M70 (FIG. 9D).
- Hep3B cells predominantly express FGFR4, among isoforms of FGFRs, and KLB.
- FGF19/FGF15 have been implicated in the regulation of hepatic bile acid metabolism in humans and in rodents, respectively (Holt et ah, 2003, Genes Dev. 17, 1581-1591) (Inagaki et ah, 2005, Cell Metabol. 2, 217-225). FGF19/FGF15 potently represses hepatic expression of cholesterol- 7a-hydroxylase 1 (Cyp7al), in a process that requires FGFR4 (Inagaki et ah, 2005, Cell Metabol. 2, 217-225; Wu et ah, 2011, PloS one 6, el7868).
- M70 The ability of M70 to regulate Cyp7al in primary hepatocytes was evaluated. Upon addition to the culture media, M70 effectively repressed Cyp7al expression in primary hepatocytes derived from mouse, rat, or human liver (FIG. 9F). The activity of M70 was comparable to that of wild-type FGF19 (half maximum inhibitory concentration IC50 0.64 pM for M70 vs. 0.65 pM for FGF19 in primary mouse hepatocytes; IC50 0.49 pM for M70 vs. 3.96 pM for FGF19 in primary rat hepatocytes; IC50 6.80 pM for M70 vs. 1.73 pM for FGF19 in primary human hepatocytes; FIG. 9F). In primary human hepatocytes, the addition of FGF19 resulted in a maximum suppression of Cyp7al mRNA by 97%. Similarly, M70 was able to reduce Cyp7al expression by 98% (FIG. 9F).
- mice were injected intraperitoneally (i.p.) with recombinant M70 or FGF19 protein at doses ranging from 0.001 to 10 mg/kg (FIG. 9G).
- i.p. intraperitoneally
- FGF19 protein FGF19 protein
- M70 and wild type FGF19 exhibit a comparable profile of biological activities, leading to activation of ERK signaling and Cyp7al regulation.
- M70 binds FGFR4 receptor complex and activates the intracellular signaling pathway leading to Cyp7al repression, but does not promote liver tumor formation in either db/db or rasH2 mouse models.
- the activation of key signaling proteins involved in tumorigenesis including ERK, PI3K/AKT, STATs, and WNT/p-catenin pathways, was analyzed.
- M70 and FGF19 proteins (1 mg/kg) were injected intraperitoneally into db/db mice.
- M70 retains activity on FGFR4-KLB receptor complex. Neither M70 nor FGF19 had any effect on hepatic levels of phosphorylated AKT. No activation of GSK3P and ⁇ -catenin was observed at all three time points tested.
- FIG. 10A This effect lasted to 4 hours post dosing (data not shown).
- M70 did not increase STAT3 phosphorylation (FIG. 10A).
- IL-6 a known STAT3 activator, was shown to be upregulated in FGF19- but not M70-treated livers (FIG. 10B).
- the pSTAT3 activation by FGF19 is likely due to non-cell autonomous mechanisms on the liver, since no induction of pSTAT3 was observed 15 minutes after protein injection or in primary mouse hepatocyte culture (data not shown).
- M70 only activates a subset of signaling pathways downstream of its receptors, a hallmark of selective modulators (Kenakin and Christopoulos, 2013, Nat. Rev. Drug Discov. 12, 205- 21).
- the identification and characterization of M70 allow us to define two distinct biological processes regulated by FGF19-FGFR4 pathway, bile acid homeostasis and tumorigenesis.
- M70 behaves as a selective modulator or a "biased ligand" to activate the metabolic signaling but not the tumorigenic signals from FGFR4.
- the biased agonism of M70 can be utilized to inhibit FGF19-associated tumor formation via an orthosteric or allosteric mechanism.
- db/db mice were injected with 3 x 10 10 genome copies of AAV-FGF19, with or without 10-fold molar excess of AAV-M70 (3 x 10 11 genome copies). Mice were necropsied 24 weeks after transgene expression and the livers were exercised for analysis. While ectopic expression of FGF19 in db/db mice promoted the formation of tumor nodules on hepatic surface (7.8 + 2.3 tumor nodules per liver), livers from mice expressing both FGF19 and M70 were completely free of tumor nodules (FIG. 11A).
- the ratios of liver to body weight in M70 and FGF19 co-treated mice were not significantly different from those of control mice (FIG. 11C).
- the serum levels of FGF19 were 94 + 12 ng/ml when dosed alone, and the combined serum level of FGF19 and M70 was 453 + 169 ng/ml (FIG. 1 ID).
- mice co-expressing M70 and FGF19 did not exhibit any histological evidence of liver tumors (FIG. 1 IE). These data demonstrate that M70 effectively competes with FGF19 to prevent tumor formation in FGF19-expressing mice.
- FGF19 is reported to be amplified and/or overexpressed in HCC and colon cancer
- HCC cell line Huh-7 harbors the 1 lql3.3 amplicon and overexpresses both FGF19 and
- M70 acts as a biased ligand that is capable of antagonizing wild type FGF19 in tumorigenic signaling, and demonstrate the potential of using a selective modulator such as M70 to suppress FGF19-dependent tumor growth.
- CT26 is a mouse colon cancer cell line, which grafts and grows well in syngenic Balb/c mice. CT26 was widely used for characterizing compounds/agents on tumor growth, especially for evaluating cancer immunotherapies.
- PD-1 Programmed Death- 1
- PD-1 and its ligands PD-L1/PD-L2 represent an immune checkpoint axis.
- the PD-1 pathway down- regulates tumor-specific immunity by impairing T-cell responses and promoting the induction of Foxp3+ Tregs in the periphery.
- mice were purchased from the Jackson Laboratory. Animals were maintained in a pathogen- free facility. All animal protocols were approved by Institutional Animal Care and Use Committee at NGM Biopharmaceuticals.
- CT26 mouse colon cancer cell line was purchased from ATCC. Cells were cultured in DMEM with 10% FBS and penicillin/streptomycin cocktail. Exponentially grown cells were harvested for implantation in mice. Cells were resuspended in saline for injection.
- M70 delays tumor growth in a CT26 colon cancer syngenic mouse model following administration of 10 mg/kg doses (FIG. 13 A) or 3 mg/kg doses (FIG. 13B) as compared to vehicle alone. M70 was also shown to reduce body weight following administration of 10 mg/kg doses (FIG. 14A) or 3 mg/kg doses (FIG. 14B).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Diabetes (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Endocrinology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Obesity (AREA)
- Environmental Sciences (AREA)
- Emergency Medicine (AREA)
- Wood Science & Technology (AREA)
- Pulmonology (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020167013366A KR102178945B1 (ko) | 2013-10-28 | 2014-10-27 | 암 모델 및 관련 방법 |
| BR112016009099A BR112016009099A2 (pt) | 2013-10-28 | 2014-10-27 | Método para determinar se um indivíduo de teste tendo um distúrbio metabólico é um candidato para o tratamento com uma variante de fgf19, método para determinar se uma variante de fgf19 é um candidato para tratar um indivíduo de teste, uso de uma variante fgf19, modelo para determinar se uma variante de fgf19 é um candidato para prevenir uma doença |
| JP2016525550A JP6560202B2 (ja) | 2013-10-28 | 2014-10-27 | 癌モデル及び関連方法 |
| US15/032,605 US10369199B2 (en) | 2013-10-28 | 2014-10-27 | Methods of using variants of FGF19 polypeptides for the treatment of cancer |
| CA2927592A CA2927592C (en) | 2013-10-28 | 2014-10-27 | Fgf-19 variants for treating a fgf-19 dependent cancer or tumor |
| AU2014342630A AU2014342630B2 (en) | 2013-10-28 | 2014-10-27 | Cancer models and associated methods |
| SG11201602870YA SG11201602870YA (en) | 2013-10-28 | 2014-10-27 | Cancer models and associated methods |
| EP14857066.6A EP3062881B1 (en) | 2013-10-28 | 2014-10-27 | Cancer models and associated methods |
| RU2016119745A RU2707531C2 (ru) | 2013-10-28 | 2014-10-27 | Модели рака и соответствующие способы |
| NZ718962A NZ718962A (en) | 2013-10-28 | 2014-10-27 | Cancer models and associated methods |
| CN201480070292.4A CN105828878A (zh) | 2013-10-28 | 2014-10-27 | 癌症模型及相关方法 |
| MX2016004822A MX377380B (es) | 2013-10-28 | 2014-10-27 | Modelos de cáncer y métodos asociados. |
| ES14857066T ES2753264T3 (es) | 2013-10-28 | 2014-10-27 | Modelos de cáncer y métodos asociados |
| ZA2016/02665A ZA201602665B (en) | 2013-10-28 | 2016-04-19 | Cancer models and associated methods |
| IL245297A IL245297B (en) | 2013-10-28 | 2016-04-24 | Variants of fgf19 polypeptides for cancer therapy |
| US16/453,164 US20200164035A1 (en) | 2013-10-28 | 2019-06-26 | Methods of using variants of fgf19 polypeptides for the treatment of cancer |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361896473P | 2013-10-28 | 2013-10-28 | |
| US61/896,473 | 2013-10-28 | ||
| US201361922586P | 2013-12-31 | 2013-12-31 | |
| US61/922,586 | 2013-12-31 | ||
| US201462067273P | 2014-10-22 | 2014-10-22 | |
| US62/067,273 | 2014-10-22 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/032,605 A-371-Of-International US10369199B2 (en) | 2013-10-28 | 2014-10-27 | Methods of using variants of FGF19 polypeptides for the treatment of cancer |
| US16/453,164 Continuation US20200164035A1 (en) | 2013-10-28 | 2019-06-26 | Methods of using variants of fgf19 polypeptides for the treatment of cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015065897A1 true WO2015065897A1 (en) | 2015-05-07 |
Family
ID=53004989
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/062378 Ceased WO2015065897A1 (en) | 2013-10-28 | 2014-10-27 | Cancer models and associated methods |
Country Status (16)
| Country | Link |
|---|---|
| US (2) | US10369199B2 (https=) |
| EP (1) | EP3062881B1 (https=) |
| JP (3) | JP6560202B2 (https=) |
| KR (1) | KR102178945B1 (https=) |
| CN (2) | CN105828878A (https=) |
| AU (1) | AU2014342630B2 (https=) |
| BR (1) | BR112016009099A2 (https=) |
| CA (1) | CA2927592C (https=) |
| ES (1) | ES2753264T3 (https=) |
| IL (1) | IL245297B (https=) |
| MX (1) | MX377380B (https=) |
| NZ (1) | NZ718962A (https=) |
| RU (1) | RU2707531C2 (https=) |
| SG (1) | SG11201602870YA (https=) |
| WO (1) | WO2015065897A1 (https=) |
| ZA (1) | ZA201602665B (https=) |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9089525B1 (en) | 2011-07-01 | 2015-07-28 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject |
| US9273107B2 (en) | 2012-12-27 | 2016-03-01 | Ngm Biopharmaceuticals, Inc. | Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US9290557B2 (en) | 2012-11-28 | 2016-03-22 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| WO2018026713A1 (en) * | 2016-08-01 | 2018-02-08 | Salk Institute For Biological Studies | Fibroblast growth factor (fgf) 1 proteins with glucose lowering ability and reduced mitogenicity |
| US9925242B2 (en) | 2012-12-27 | 2018-03-27 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of nonalcoholic steatohepatitis |
| US9925241B2 (en) | 2013-10-21 | 2018-03-27 | Salk Institute For Biological Studies | Mutated fibroblast growth factor (FGF) 1 and methods of use |
| US9925243B2 (en) | 2013-10-21 | 2018-03-27 | Salk Institute For Biological Studies | Chimeric fibroblast growth factor (FGF) 2/FGF1 peptides and methods of use |
| US9963494B2 (en) | 2012-11-28 | 2018-05-08 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject |
| US10093735B2 (en) | 2014-01-24 | 2018-10-09 | Ngm Biopharmaceuticals, Inc. | Beta-klotho binding proteins |
| US10159711B2 (en) | 2010-04-16 | 2018-12-25 | Salk Institute For Biological Studies | Methods for treating metabolic disorders using FGF |
| US10369199B2 (en) | 2013-10-28 | 2019-08-06 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of cancer |
| US10398758B2 (en) | 2014-05-28 | 2019-09-03 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions |
| US10434144B2 (en) | 2014-11-07 | 2019-10-08 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US10456449B2 (en) | 2014-06-16 | 2019-10-29 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US10517929B2 (en) | 2014-10-23 | 2019-12-31 | Ngm Biopharmaceuticals, Inc. | Pharmaceutical compositions comprising FGF19 variants |
| US10695404B2 (en) | 2015-10-30 | 2020-06-30 | Salk Institute For Biological Studies | Treatment of steroid-induced hyperglycemia with fibroblast growth factor (FGF) 1 analogs |
| US10744185B2 (en) | 2015-11-09 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of pruritus |
| US10800843B2 (en) | 2015-07-29 | 2020-10-13 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins |
| US11370841B2 (en) | 2016-08-26 | 2022-06-28 | Ngm Biopharmaceuticals, Inc. | Methods of treating fibroblast growth factor 19-mediated cancers and tumors |
| US11542309B2 (en) | 2019-07-31 | 2023-01-03 | Salk Institute For Biological Studies | Fibroblast growth factor 1 (FGF1) mutant proteins that selectively activate FGFR1B to reduce blood glucose |
| JP2023520285A (ja) * | 2021-03-12 | 2023-05-17 | 江南大学 | 代謝障害に対する新規なfgf19タンパク質類似物質及びその使用 |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109722480B (zh) * | 2018-05-17 | 2022-04-26 | 上海交通大学 | 一种非小细胞肺癌检测试剂盒及其应用 |
| JP2023509195A (ja) | 2020-01-08 | 2023-03-07 | アルジェニクス ビーブイ | 天疱瘡症を治療する方法 |
| CN114731985B (zh) * | 2022-03-29 | 2023-09-26 | 华南理工大学 | 一种代谢相关脂肪性肝病非人灵长类动物模型的构建方法 |
| CN119698429A (zh) | 2022-06-15 | 2025-03-25 | 阿根思有限公司 | Fcrn结合分子及使用方法 |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US20090226459A1 (en) * | 2008-01-29 | 2009-09-10 | Cold Spring Harbor Laboratory | Role of fgf-19 in cancer diagnosis and treatment |
| US8044175B2 (en) | 2003-03-03 | 2011-10-25 | Dyax Corp. | Peptides that specifically bind HGF receptor (CMET) and uses thereof |
| US8067532B2 (en) | 2007-01-19 | 2011-11-29 | Kai Pharmaceuticals, Inc. | Modifications of peptide compositions to increase stability and delivery efficiency |
| US20130023474A1 (en) | 2011-07-01 | 2013-01-24 | Ngm Biopharmaceuticals, Inc. | Compositions, uses and methods for treatment of metabolic disorders and diseases |
| US20130183294A1 (en) * | 2012-01-18 | 2013-07-18 | Genentech, Inc. | Methods of using fgf19 modulators |
Family Cites Families (158)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002008284A2 (en) | 2000-07-20 | 2002-01-31 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| US20020042367A1 (en) | 1997-11-25 | 2002-04-11 | Genentech, Inc. | Fibroblast growth factor-19 (FGF-19) nucleic acids and polypeptides and methods of use for the treatment of obesity and related disorders |
| US20060246540A1 (en) | 1997-08-26 | 2006-11-02 | Ashkenazi Avi J | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US20020012961A1 (en) | 1999-04-15 | 2002-01-31 | Genentech, Inc. | Fibroblast growth factor- 19 |
| US20030092002A1 (en) | 1997-09-17 | 2003-05-15 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US6806352B2 (en) | 1997-09-17 | 2004-10-19 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US20030113718A1 (en) | 1997-09-17 | 2003-06-19 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| NZ503343A (en) | 1997-09-17 | 2002-09-27 | Genentech Inc | Secreted and transmembrane polypeptides and use to induce apoptosis of tumour cells |
| US20050026832A1 (en) * | 1997-11-25 | 2005-02-03 | Genentech, Inc. | Fibroblast growth factor-19 (FGF-19) nucleic acids and polypeptides and methods of use for the treatment of obesity and related disorders |
| US20020155543A1 (en) | 1997-11-25 | 2002-10-24 | Genentech, Inc. | Fibroblast growth factor-19 (FGF-19) nucleic acids and polypeptides and methods of use for the treatment of obesity and related disorders |
| US20040126852A1 (en) | 1997-11-25 | 2004-07-01 | Genentech, Inc. | Fibroblast growth factor-19 (FGF-19) nucleic acids and polypeptides and methods of use for the treatment of obesity |
| AU3924300A (en) | 1999-04-02 | 2000-10-23 | Millennium Pharmaceuticals, Inc. | Fibroblast growth factor-20 |
| US7390879B2 (en) | 1999-06-15 | 2008-06-24 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US7129072B1 (en) | 1999-08-30 | 2006-10-31 | New York University | Crystal of fibroblast growth factor receptor 1 in complex with fibroblast growth factor |
| US7459540B1 (en) | 1999-09-07 | 2008-12-02 | Amgen Inc. | Fibroblast growth factor-like polypeptides |
| AU7368100A (en) | 1999-09-10 | 2001-04-10 | Curagen Corporation | Fibroblast growth factor polypeptide and nucleic acids encoding same |
| US6797695B1 (en) | 1999-10-22 | 2004-09-28 | Kyoto University | Human FGF-20 gene and gene expression products |
| EP2163626A1 (en) | 1999-11-18 | 2010-03-17 | Novartis Vaccines and Diagnostics, Inc. | Human FGF-21 gene and gene expression products |
| US6716626B1 (en) | 1999-11-18 | 2004-04-06 | Chiron Corporation | Human FGF-21 nucleic acids |
| DE10160151A1 (de) | 2001-01-09 | 2003-06-26 | Ribopharma Ag | Verfahren zur Hemmung der Expression eines vorgegebenen Zielgens |
| US20010044525A1 (en) | 2000-01-05 | 2001-11-22 | Conklin Darrell C. | Novel FGF Homolog zFGF12 |
| EP1246843A1 (en) | 2000-01-05 | 2002-10-09 | ZymoGenetics, Inc. | Novel fgf homolog zfgf12 |
| AU2631001A (en) | 2000-01-05 | 2001-07-16 | Zymogenetics Inc. | Novel fgf homolog zfgf11 |
| US20020081663A1 (en) | 2000-01-05 | 2002-06-27 | Conklin Darrell C. | Novel FGF homolog ZFGF11 |
| AU3976701A (en) | 2000-02-15 | 2001-08-27 | Amgen, Inc. | Fibroblast growth factor-23 molecules and uses thereof |
| US20060160181A1 (en) | 2000-02-15 | 2006-07-20 | Amgen Inc. | Fibroblast Growth Factor-23 molecules and uses thereof |
| US20030180312A1 (en) | 2000-02-22 | 2003-09-25 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| AU2001245535A1 (en) | 2000-03-08 | 2001-09-17 | Chiron Corporation | Human fgf-23 gene and gene expression products |
| WO2001066595A2 (en) | 2000-03-08 | 2001-09-13 | Chiron Corporation | Human fgf-23 gene and gene expression products |
| US20020001825A1 (en) | 2000-03-31 | 2002-01-03 | Nobuyuki Itoh | Fibroblast growth factor-like molecules and uses thereof |
| US20030065140A1 (en) | 2000-04-03 | 2003-04-03 | Vernet Corine A.M. | Novel proteins and nucleic acids encoding same |
| JP2002112772A (ja) | 2000-07-10 | 2002-04-16 | Takeda Chem Ind Ltd | 新規ポリペプチドおよびそのdna |
| ATE461213T1 (de) | 2000-07-19 | 2010-04-15 | Advanced Res & Tech Inst | Neuer fibroblastwachstumsfaktor (fgf23) und methoden zur verwendung |
| US20070037165A1 (en) | 2000-09-08 | 2007-02-15 | Applera Corporation | Polymorphisms in known genes associated with human disease, methods of detection and uses thereof |
| US6812339B1 (en) | 2000-09-08 | 2004-11-02 | Applera Corporation | Polymorphisms in known genes associated with human disease, methods of detection and uses thereof |
| US7265210B2 (en) | 2000-09-15 | 2007-09-04 | Genentech, Inc. | Anti-PRO9821 antibodies |
| IL139380A0 (en) | 2000-10-31 | 2001-11-25 | Prochon Biotech Ltd | Active variants of fibroblast growth factor |
| US20030045489A1 (en) | 2000-11-22 | 2003-03-06 | Murphy John E. | Methods for modulating angiogenesis |
| US20020151496A1 (en) | 2000-12-08 | 2002-10-17 | Bringmann Peter W. | Novel fibroblast growth factors |
| DE10100587C1 (de) | 2001-01-09 | 2002-11-21 | Ribopharma Ag | Verfahren zur Hemmung der Expression eines Zielgens |
| DE10100588A1 (de) | 2001-01-09 | 2002-07-18 | Ribopharma Ag | Verfahren zur Hemmung der Expression eines Zielgens |
| US7164007B2 (en) | 2001-06-20 | 2007-01-16 | Genentech, Inc. | Anti-PR020044 antibodies |
| WO2003080803A2 (en) | 2002-03-21 | 2003-10-02 | Smithkline Beecham Corporation | Methods of using farnesoid x receptor (fxr) agonists |
| US6987121B2 (en) | 2002-04-25 | 2006-01-17 | Smithkline Beecham Corporation | Compositions and methods for hepatoprotection and treatment of cholestasis |
| EP1553912A4 (en) | 2002-06-07 | 2007-08-08 | Genentech Inc | COMPOSITIONS AND METHODS FOR TUMOR DIAGNOSIS AND TREATMENT |
| AU2003268116A1 (en) | 2002-09-18 | 2004-04-08 | Eli Lilly And Company | Method for reducing morbidity and mortality in critically ill patients |
| WO2004063355A2 (en) | 2003-01-10 | 2004-07-29 | Protein Design Labs, Inc. | Novel methods of diagnosis of metastatic cancer, compositions and methods of screening for modulators of matastatic cancer |
| ATE385806T1 (de) | 2003-06-12 | 2008-03-15 | Lilly Co Eli | Fusionsproteine |
| EP2270163A1 (en) | 2003-12-10 | 2011-01-05 | Eli Lilly and Company | Muteins of fibroblast growth factor 21 |
| EP2194064A1 (en) | 2004-05-13 | 2010-06-09 | Eli Lilly & Company | FGF-21 fusion proteins |
| JP2006016323A (ja) | 2004-06-30 | 2006-01-19 | Hiroshima Industrial Promotion Organization | 生理活性バイオマテリアル |
| KR100854198B1 (ko) | 2004-09-02 | 2008-08-26 | 일라이 릴리 앤드 캄파니 | 섬유아세포 성장 인자 21의 뮤테인 |
| US7622445B2 (en) | 2004-09-02 | 2009-11-24 | Eli Lilly And Company | Muteins of fibroblast growth factor 21 |
| WO2006049854A2 (en) | 2004-10-29 | 2006-05-11 | Genentech, Inc. | Disruptions of genes encoding secreted proteins, compositions and methods relating thereto |
| EP1815021A2 (en) | 2004-11-03 | 2007-08-08 | Almac Diagnostics Limited | Transcriptome microarray technology and methods of using the same |
| US7655627B2 (en) | 2004-12-14 | 2010-02-02 | Eli Lilly And Company | Muteins of fibroblast growth factor 21 |
| US20060275794A1 (en) | 2005-03-07 | 2006-12-07 | Invitrogen Corporation | Collections of matched biological reagents and methods for identifying matched reagents |
| EP2083081A1 (en) | 2005-07-22 | 2009-07-29 | Five Prime Therapeutics, Inc. | Compositions and methods of treating disease with FGFR fusion proteins |
| CA2620082A1 (en) | 2005-08-24 | 2007-03-01 | Genizon Biosciences Inc. | Genemap of the human genes associated with crohn's disease |
| EP1987055A1 (en) | 2006-02-10 | 2008-11-05 | Dermagen AB | Novel antimicrobial peptides and use thereof |
| US8168169B2 (en) | 2006-08-09 | 2012-05-01 | Mclean Hospital Corporation | Methods and compositions for the treatment of medical disorders |
| CA2661332A1 (en) | 2006-09-01 | 2008-03-13 | American Type Culture Collection | Compositions and methods for diagnosis and treatment of type 2 diabetes |
| EP2094733A1 (en) | 2006-11-03 | 2009-09-02 | U3 Pharma GmbH | Fgfr4 antibodies |
| CA2901105C (en) | 2007-01-03 | 2018-02-13 | California Stem Cell, Inc. | Stem cell growth media and methods of making and using same |
| CN107501407B (zh) | 2007-03-30 | 2022-03-18 | Ambrx公司 | 经修饰fgf-21多肽和其用途 |
| CL2008000947A1 (es) | 2007-04-02 | 2008-10-10 | Genentech Inc | Uso de un antagonista de la proteina beta-klotho (klb) para tratar trastornos asociados a la expresion o actividad de klb. |
| EP2036539A1 (en) | 2007-09-11 | 2009-03-18 | Novo Nordisk A/S | Stable formulations of amylin and its analogues |
| US20120142546A1 (en) | 2007-12-10 | 2012-06-07 | The Johns Hopkins University | Hypomethylated genes in cancer |
| EP2080812A1 (en) | 2008-01-18 | 2009-07-22 | Transmedi SA | Compositions and methods of detecting post-stop peptides |
| US8420088B2 (en) | 2008-01-28 | 2013-04-16 | Novartis Ag | Methods and compositions using FGF23 fusion polypeptides |
| TW200936156A (en) | 2008-01-28 | 2009-09-01 | Novartis Ag | Methods and compositions using Klotho-FGF fusion polypeptides |
| US20110015345A1 (en) | 2008-03-19 | 2011-01-20 | Ambrx, Inc. | Modified FGF-23 Polypeptides and Their Uses |
| NZ602702A (en) | 2008-03-19 | 2014-03-28 | Ambrx Inc | Modified fgf-21 polypeptides and their uses |
| CA2719001A1 (en) | 2008-03-21 | 2009-09-24 | Podiceps B.V. | Diagnostic of pre-symptomatic metabolic syndrome |
| CN101591653B (zh) | 2008-05-27 | 2013-07-31 | 中国人民解放军军事医学科学院野战输血研究所 | 低表达cyp7a1的肝细胞及其构建方法 |
| US8034770B2 (en) | 2008-06-04 | 2011-10-11 | Amgen Inc. | FGF21 polypeptides comprising two or more mutations |
| US8363365B2 (en) | 2008-06-17 | 2013-01-29 | Semiconductor Energy Laboratory Co., Ltd. | Semiconductor device |
| FR2933702A1 (fr) | 2008-07-08 | 2010-01-15 | Sanofi Aventis | Antagonistes specifiques du recepteur fgf-r4 |
| WO2010006214A1 (en) | 2008-07-09 | 2010-01-14 | Ambrx, Inc. | Fgf-21 neutralizing antibodies and their uses |
| EP2318529B1 (en) | 2008-08-04 | 2017-10-18 | Five Prime Therapeutics, Inc. | Fgfr extracellular domain acidic region muteins |
| CA2739615C (en) | 2008-10-10 | 2017-12-05 | Amgen Inc. | Fgf21 mutants comprising polyethylene glycol and uses thereof |
| WO2010065439A1 (en) | 2008-12-05 | 2010-06-10 | Eli Lilly And Company | Variants of fibroblast growth factor 21 |
| US20120035105A1 (en) | 2009-01-09 | 2012-02-09 | Sdg, Inc. | Insulin Therapies for the Treatment of Diabetes, Diabetes Related Ailments, and/or Diseases or Conditions Other Than Diabetes or Diabetes Related Ailments |
| US20110268794A1 (en) | 2009-01-09 | 2011-11-03 | Camilleri Michael L | Methods and materials for delivering bile acids |
| WO2010083051A2 (en) | 2009-01-15 | 2010-07-22 | ProChon Biotech, Ltd. | Cartilage particle tissue mixtures optionally combined with a cancellous construct |
| ES2610356T3 (es) | 2009-02-03 | 2017-04-27 | Amunix Operating Inc. | Polipéptidos recombinantes extendidos y composiciones que comprenden los mismos |
| WO2010129600A2 (en) | 2009-05-05 | 2010-11-11 | Amgen Inc. | Fgf21 mutants and uses thereof |
| WO2010129503A1 (en) | 2009-05-05 | 2010-11-11 | Amgen Inc. | Fgf21 mutants and uses thereof |
| US8461111B2 (en) | 2009-05-20 | 2013-06-11 | Florida State University Research Foundation | Fibroblast growth factor mutants having improved functional half-life and methods of their use |
| US10241093B2 (en) | 2009-05-28 | 2019-03-26 | The Cleveland Clinic Foundation | Trimethylamine-containing compounds for diagnosis and prediction of disease |
| WO2010139741A1 (en) | 2009-06-04 | 2010-12-09 | Novartis Ag | Fgf-21 for treating cancers |
| JP2012529463A (ja) | 2009-06-11 | 2012-11-22 | ノヴォ ノルディスク アー/エス | 2型糖尿病を治療するための、glp−1とfgf21との組合せ |
| WO2011154349A2 (en) | 2010-06-08 | 2011-12-15 | Novo Nordisk A/S | Fgf21 analogues and derivatives |
| MX2011013903A (es) | 2009-06-17 | 2012-05-08 | Amgen Inc | Polipeptidos quimericos y usos de los mismos. |
| CN101993485B (zh) | 2009-08-20 | 2013-04-17 | 重庆富进生物医药有限公司 | 促胰岛素分泌肽类似物同源二聚体及其用途 |
| KR101952453B1 (ko) | 2009-10-15 | 2019-02-26 | 제넨테크, 인크. | 수용체 특이성이 변경된 키메라 섬유모세포 성장 인자 |
| US8889621B2 (en) | 2009-10-30 | 2014-11-18 | New York University | Inhibiting binding of FGF23 to the binary FGFR-Klotho complex for the treatment of hypophosphatemia |
| UA109888C2 (uk) | 2009-12-07 | 2015-10-26 | ІЗОЛЬОВАНЕ АНТИТІЛО АБО ЙОГО ФРАГМЕНТ, ЩО ЗВ'ЯЗУЄТЬСЯ З β-КЛОТО, РЕЦЕПТОРАМИ FGF І ЇХНІМИ КОМПЛЕКСАМИ | |
| WO2011084808A2 (en) | 2009-12-21 | 2011-07-14 | Amunix Operating Inc. | Bifunctional polypeptide compositions and methods for treatment of metabolic and cardiovascular diseases |
| EP2460527A1 (en) | 2010-01-21 | 2012-06-06 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| US20110195077A1 (en) | 2010-01-29 | 2011-08-11 | Novartis Ag | Methods and compositions using fgf23 fusion ppolypeptides |
| CA2796055A1 (en) | 2010-04-15 | 2011-10-20 | Amgen Inc. | Human fgf receptor and .beta.-klotho binding proteins |
| WO2011130729A2 (en) | 2010-04-16 | 2011-10-20 | Salk Institute For Biological Studies | Methods for treating metabolic disorders using fgf |
| CN103415300B (zh) | 2010-07-20 | 2018-02-23 | 诺沃—诺迪斯克有限公司 | N‑末端修饰的fgf21化合物 |
| JP2013537172A (ja) | 2010-09-09 | 2013-09-30 | トリフォイリウム エーピーエス | 血管新生阻害剤の気道投与 |
| MX360946B (es) | 2010-09-22 | 2018-10-29 | Amgen Inc Star | Inmunoglobulinas portadoras y usos de las mismas. |
| CN102464712A (zh) | 2010-11-11 | 2012-05-23 | 重庆富进生物医药有限公司 | 缺失型人成纤维细胞生长因子21变异体及其偶联物 |
| US9023791B2 (en) | 2010-11-19 | 2015-05-05 | Novartis Ag | Fibroblast growth factor 21 mutations |
| JP5613547B2 (ja) | 2010-12-14 | 2014-10-22 | 株式会社スクウェア・エニックス | タスクベースの並列プログラミング言語 |
| WO2012088379A2 (en) | 2010-12-22 | 2012-06-28 | Marcadia Biotech, Inc. | Methods for treating metabolic disorders and obesity with gip and glp-1 receptor-active glucagon-based peptides |
| JP5850435B2 (ja) | 2010-12-24 | 2016-02-03 | 国立研究開発法人産業技術総合研究所 | ヒトfgf19活性の正確で高感度な測定方法ならびにヒトfgf19活性の制御剤 |
| AU2012229107A1 (en) | 2011-03-17 | 2013-09-19 | Novartis Ag | FGFR and ligands thereof as biomarkers for breast cancer in HR positive subjects |
| EP2694092B1 (en) | 2011-04-08 | 2017-01-04 | Amgen Inc. | Method of treating or ameliorating metabolic disorders using growth differentiation factor 15 (gdf-15) |
| WO2012140650A2 (en) | 2011-04-12 | 2012-10-18 | Hepacore Ltd. | Conjugates of carboxy polysaccharides with fibroblast growth factors and variants thereof |
| AU2012254160A1 (en) | 2011-05-10 | 2013-11-21 | Amgen Inc. | Method of identifying compounds that specifically modulate the interaction of FGFR1 and beta-Klotho |
| EA030462B1 (ru) | 2011-05-16 | 2018-08-31 | Дженентек, Инк. | Агонисты fgfr1 и способы их применения |
| US9574002B2 (en) | 2011-06-06 | 2017-02-21 | Amgen Inc. | Human antigen binding proteins that bind to a complex comprising β-Klotho and an FGF receptor |
| CA2838207A1 (en) | 2011-06-08 | 2012-12-13 | Denovo Biopharma (Hangzhou) Ltd. Co. | Methods and compositions of predicting activity of retinoid x receptor modulator |
| US20140294820A1 (en) | 2011-06-24 | 2014-10-02 | University Of Miami | Fibroblast growth factor receptor inhibition for the treatment of disease |
| EP2548570A1 (en) | 2011-07-19 | 2013-01-23 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| WO2013027191A1 (en) | 2011-08-25 | 2013-02-28 | Novartis Ag | Methods and compositions using fgf23 fusion polypeptides |
| MX2014002260A (es) | 2011-08-31 | 2014-08-18 | Amgen Inc | Factor de crecimiento de fibroblasto 21 para usar en el tratamiento de diabetes tipo 1. |
| UY34347A (es) | 2011-09-26 | 2013-04-30 | Novartis Ag | Proteínas de función dual para tratar trastornos metabólicos |
| TWI593708B (zh) | 2011-09-26 | 2017-08-01 | 諾華公司 | 治療代謝病症之融合蛋白質 |
| AR087973A1 (es) | 2011-10-04 | 2014-04-30 | Lilly Co Eli | Variantes del factor 21 del crecimiento de fibroblastos |
| CN103127503B (zh) | 2011-11-23 | 2017-11-10 | 上海医学生命科学研究中心有限公司 | 拮抗和/或阻断IL‑6/IL‑6R/gp130信号通路在抗肝癌治疗中的用途 |
| WO2013131091A1 (en) | 2012-03-02 | 2013-09-06 | New York University | Chimeric fgf21 proteins with enhanced binding affinity for beta-klotho for the treatment of type ii diabetes, obesity and related metabolic disorders |
| JP2013194049A (ja) | 2012-03-23 | 2013-09-30 | Kazuo Todokoro | ヒト造血幹細胞を増幅させるための組成物及び方法 |
| WO2013151665A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| US9771567B2 (en) | 2012-04-16 | 2017-09-26 | Tel Hashomer Medical Research Infrastructure And Services Ltd. | Klotho variant polypeptides |
| MA37506B1 (fr) | 2012-05-15 | 2017-03-31 | Lilly Co Eli | Utilisations thérapeutiques de protéines de facteur de croissance des fibroblastes 21 |
| US9657075B2 (en) | 2012-06-07 | 2017-05-23 | New York University | Chimeric fibroblast growth factor 23 proteins and methods of use |
| US9464126B2 (en) | 2012-06-07 | 2016-10-11 | New York University | Chimeric fibroblast growth factor 21 proteins and methods of use |
| US9474785B2 (en) | 2012-06-07 | 2016-10-25 | New York University | Chimeric fibroblast growth factor 19 proteins and methods of use |
| TWI513705B (zh) | 2012-06-11 | 2015-12-21 | Lilly Co Eli | 纖維母細胞生長因子21蛋白質 |
| CA2871656A1 (en) | 2012-06-11 | 2013-12-19 | Eli Lilly And Company | Fibroblast growth factor 21 variants |
| SG11201500125QA (en) | 2012-07-11 | 2015-02-27 | Blueprint Medicines Corp | Inhibitors of the fibroblast growth factor receptor |
| TW201420606A (zh) | 2012-08-22 | 2014-06-01 | Lilly Co Eli | 同源二聚體蛋白 |
| JP2015533483A (ja) | 2012-09-07 | 2015-11-26 | サノフイ | メタボリックシンドロームを治療するための融合タンパク質 |
| US9290557B2 (en) | 2012-11-28 | 2016-03-22 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| HK1214832A1 (zh) | 2012-11-28 | 2016-08-05 | 恩格姆生物制药公司 | 用於代謝病症和疾病治療的組合物和方法 |
| US9273107B2 (en) | 2012-12-27 | 2016-03-01 | Ngm Biopharmaceuticals, Inc. | Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| ES2915851T3 (es) | 2012-12-27 | 2022-06-27 | Ngm Biopharmaceuticals Inc | Péptidos quiméricos de FGF19 para usar en el tratamiento de trastornos de ácidos biliares |
| US9550820B2 (en) | 2013-02-22 | 2017-01-24 | New York University | Chimeric fibroblast growth factor 23/fibroblast growth factor 19 proteins and methods of use |
| WO2014152090A1 (en) | 2013-03-14 | 2014-09-25 | Georgetown University | Compositions and treatments of metabolic disorders using fgf binding protein 3 and fgf 19 |
| WO2014152089A1 (en) | 2013-03-14 | 2014-09-25 | Georgetown University | Compositions and treatments of metabolic disorders using fgf binding protein 3 |
| WO2014149699A1 (en) | 2013-03-15 | 2014-09-25 | Eli Lilly And Company | Bifunctional protein |
| AU2014340241B2 (en) | 2013-10-21 | 2018-11-01 | Salk Institute For Biological Studies | Mutated fibroblast growth factor (FGF) 1 and methods of use |
| CA2927592C (en) | 2013-10-28 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Fgf-19 variants for treating a fgf-19 dependent cancer or tumor |
| PE20170256A1 (es) | 2014-01-24 | 2017-04-22 | Ngm Biopharmaceuticals Inc | Proteinas de union y sus metodos de uso |
| WO2015183890A2 (en) | 2014-05-28 | 2015-12-03 | Ngm Biopharmaceuticals, Inc. | Methods and compositions for the treatment of metabolic disorders and diseases |
| AU2015277438B2 (en) | 2014-06-16 | 2020-02-27 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| WO2016048995A2 (en) | 2014-09-23 | 2016-03-31 | Salk Institute For Biological Studies | Fgf19 truncations and mutants and uses thereof |
| RU2729161C2 (ru) | 2014-10-23 | 2020-08-04 | ЭнДжиЭм БАЙОФАРМАСЬЮТИКАЛЗ, ИНК. | Фармацевтические композиции, содержащие варианты пептидов, и способы их применения |
| US10434144B2 (en) | 2014-11-07 | 2019-10-08 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| JP6728352B2 (ja) | 2015-11-09 | 2020-07-22 | エヌジーエム バイオファーマシューティカルス,インコーポレーテッド | 胆汁酸に関係した障害の治療方法 |
| CA3034399A1 (en) | 2016-08-26 | 2018-03-01 | Ngm Biopharmaceuticals, Inc. | Methods of treating fibroblast growth factor 19-mediated cancers and tumors |
| CA3034435A1 (en) | 2016-08-29 | 2018-03-08 | Lei Ling | Methods for treatment of bile acid-related disorders |
-
2014
- 2014-10-27 CA CA2927592A patent/CA2927592C/en active Active
- 2014-10-27 SG SG11201602870YA patent/SG11201602870YA/en unknown
- 2014-10-27 CN CN201480070292.4A patent/CN105828878A/zh active Pending
- 2014-10-27 JP JP2016525550A patent/JP6560202B2/ja not_active Expired - Fee Related
- 2014-10-27 WO PCT/US2014/062378 patent/WO2015065897A1/en not_active Ceased
- 2014-10-27 RU RU2016119745A patent/RU2707531C2/ru active
- 2014-10-27 KR KR1020167013366A patent/KR102178945B1/ko not_active Expired - Fee Related
- 2014-10-27 US US15/032,605 patent/US10369199B2/en active Active
- 2014-10-27 CN CN202111064301.7A patent/CN113769114A/zh active Pending
- 2014-10-27 MX MX2016004822A patent/MX377380B/es active IP Right Grant
- 2014-10-27 AU AU2014342630A patent/AU2014342630B2/en not_active Ceased
- 2014-10-27 BR BR112016009099A patent/BR112016009099A2/pt not_active Application Discontinuation
- 2014-10-27 NZ NZ718962A patent/NZ718962A/en not_active IP Right Cessation
- 2014-10-27 EP EP14857066.6A patent/EP3062881B1/en active Active
- 2014-10-27 ES ES14857066T patent/ES2753264T3/es active Active
-
2016
- 2016-04-19 ZA ZA2016/02665A patent/ZA201602665B/en unknown
- 2016-04-24 IL IL245297A patent/IL245297B/en active IP Right Grant
-
2019
- 2019-01-24 JP JP2019009836A patent/JP6776380B2/ja not_active Expired - Fee Related
- 2019-06-26 US US16/453,164 patent/US20200164035A1/en not_active Abandoned
-
2020
- 2020-10-07 JP JP2020169989A patent/JP2021008499A/ja active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US8044175B2 (en) | 2003-03-03 | 2011-10-25 | Dyax Corp. | Peptides that specifically bind HGF receptor (CMET) and uses thereof |
| US8067532B2 (en) | 2007-01-19 | 2011-11-29 | Kai Pharmaceuticals, Inc. | Modifications of peptide compositions to increase stability and delivery efficiency |
| US20090226459A1 (en) * | 2008-01-29 | 2009-09-10 | Cold Spring Harbor Laboratory | Role of fgf-19 in cancer diagnosis and treatment |
| US20130023474A1 (en) | 2011-07-01 | 2013-01-24 | Ngm Biopharmaceuticals, Inc. | Compositions, uses and methods for treatment of metabolic disorders and diseases |
| US20130183294A1 (en) * | 2012-01-18 | 2013-07-18 | Genentech, Inc. | Methods of using fgf19 modulators |
Non-Patent Citations (52)
| Title |
|---|
| "GenBank", Database accession no. NP 005108.1 |
| BEENKENMOHAMMADI, NAT. REV. DRUG DISCOV, vol. 8, 2009, pages 235 - 253 |
| BEENKENMOHAMMADI, NAT. REV. DRUG. DISCOV., vol. 8, 2009, pages 235 - 253 |
| BROMBERG ET AL., CELL, vol. 98, 1999, pages 295 - 303 |
| CALVISI ET AL., GASTROENTEROL, vol. 130, 2006, pages 1117 - 1128 |
| CAMARERO J.A. ET AL., PROTEIN PEPT LETT, vol. 12, 2005, pages 723 - 8 |
| CANCER GENE THER, vol. 9, no. 6, pages 489 - 96 |
| CHEN ET AL., CLIN. CANCER RES, vol. 16, 2010, pages 5189 - 5199 |
| CHEN ET AL.: "Soluble FGFR4 extracellular domain inhibits FGF19-induced activation of FGFR4 signaling and prevents nonalcoholic fatty liver disease", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 409, 17 May 2011 (2011-05-17), pages 651 - 656, XP055184310 * |
| COUDER ET AL., INT. J. PEPTIDE PROTEIN RES., vol. 41, 1993, pages 181 - 184 |
| DESNOYERS ET AL., ONCOGENE, vol. 27, 2008, pages 85 - 97 |
| FRENCH ET AL., PLOS ONE, vol. 7, 2012, pages e36713 |
| GANESAN A, MINI REV. MED. CHEM., vol. 6, 2006, pages 3 - 10 |
| HASEGAWA Y, HEPATOL, vol. 58, 2013, pages 802A |
| HE ET AL., CANCER CELL, vol. 17, 2010, pages 286 - 297 |
| HE ET AL., CELL, vol. 155, 2013, pages 384 - 396 |
| HEKARIN, CELL RES, vol. 21, 2011, pages 159 - 168 |
| HOLT ET AL., GENES DEV, vol. 17, 2003, pages 1581 - 1591 |
| IKEDA ET AL., GASTROENTEROL., vol. 146, 2014, pages 222 - 232 |
| INAGAKI ET AL., CELL METABOL, vol. 2, 2005, pages 217 - 225 |
| JAMESON ET AL., NATURE, vol. 368, 1994, pages 692 |
| KAKUMU ET AL., GASTROENTEROLOGIA JAPONICA, vol. 28, 1993, pages 18 - 24 |
| KARRAS ET AL., CELLULAR IMMUNOL, vol. 202, 2000, pages 124 - 135 |
| KENAKINCHRISTOPOULOS, NAT. REV. DRUG DISCOV., vol. 12, 2013, pages 205 - 21 |
| KIR ET AL., SCIENCE, vol. 331, 2011, pages 1621 - 1624 |
| LIN ET AL., ONCOGENE, vol. 28, 2009, pages 961 - 972 |
| M. ZHOU ET AL.: "Separating Tumorigenicity from Bile Acid Regulatory Activity for Endocrine Hormone FGF19", CANCER RESEARCH, US, vol. 74, no. 12, 15 June 2014 (2014-06-15), pages 3306 - 3316, XP055441260, DOI: doi:10.1158/0008-5472.CAN-14-0208 |
| MARRERO AND EL-SERAG, HEPATOL, vol. 53, 2011, pages 1060 - 1062 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NICHOLES ET AL., AMER. J. PATHOL., vol. 160, 2002, pages 2295 - 2307 |
| NOGUCHI ET AL., DIABETES, vol. 52, no. 7, 2003, pages 1732 - 1737 |
| PAI2012 ET AL., TOXICOLOGICAL SCIENCES, vol. 126, pages 446 - 456 |
| PEARSONLIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| RIVERA ET AL., PNAS, vol. 96, 1999, pages 8657 - 8662 |
| SAWEY ET AL., ONCOGENE, vol. 27, 2011, pages 85 - 97 |
| SCHAAP ET AL., HEPATOL, vol. 49, 2009, pages 1228 - 1235 |
| See also references of EP3062881A4 |
| SELAZISMAN, FASEB J., vol. 11, 1997, pages 449 |
| STORER ET AL., TOXICOLOGIC PATHOL, vol. 38, 2010, pages 51 - 61 |
| TARTAGLIA ET AL., CELL, vol. 83, 1995, pages 1263 - 1271 |
| TREHIN ET AL., PHARM. RESEARCH, vol. 21, 2004, pages 1248 - 1256 |
| WANG ET AL., WORLD J. GASTROENTEROL, vol. 16, 2010, pages 5801 - 5809 |
| WENDER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 13003 - 13008 |
| WIRTH ET AL., GENE, vol. 525, 2013, pages 162 - 169 |
| WU ET AL., J. BIOL. CHEM., vol. 285, 2010, pages 5165 - 5170 |
| WU ET AL., PLOS ONE, vol. 6, 2011, pages el7868 |
| WU ET AL., PNAS, vol. 107, 2010, pages 14158 - 14163 |
| WU ET AL.: "FGF19 Regulates Cell Proliferation, Glucose and Bile Acid Metabolism via FGFR4-Dependent and Independent Pathways", PLOS ONE, vol. 6, no. 3, 18 March 2011 (2011-03-18), pages E17868, PGS. 1 - 11, XP055059113 * |
| ZAISS ET AL., J. VIROL., vol. 76, 2002, pages 4580 - 4590 |
| ZHANG ET AL., HUM. GENE THER., vol. 20, 2009, pages 922 - 929 |
| ZINCARELLI ET AL., MOL. THER., vol. 16, 2008, pages 1073 - 1080 |
| ZOLOTUKHIN ET AL., ENDOCRINOLOGY, vol. 143, no. 5, 2002, pages 1741 - 47 |
Cited By (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10159711B2 (en) | 2010-04-16 | 2018-12-25 | Salk Institute For Biological Studies | Methods for treating metabolic disorders using FGF |
| US10398759B2 (en) | 2010-04-16 | 2019-09-03 | Salk Institute For Biological Studies | Methods for treating metabolic disorders using FGF |
| US10293027B2 (en) | 2010-04-16 | 2019-05-21 | Salk Institute For Biological Studies | Methods for treating metabolic disorders using FGF |
| US9089525B1 (en) | 2011-07-01 | 2015-07-28 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject |
| US11065302B2 (en) | 2011-07-01 | 2021-07-20 | Ngm Biopharmaceuticals, Inc. | Compositions comprising fusion variants of FGF19 polypeptides |
| US9580483B2 (en) | 2011-07-01 | 2017-02-28 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of diabetes |
| US9670260B2 (en) | 2011-07-01 | 2017-06-06 | Ngm Biopharmaceuticals, Inc. | Compositions comprising fusion variants of FGF19 polypeptides |
| US9751924B2 (en) | 2011-07-01 | 2017-09-05 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising fusion variants of FGF19 polypeptides for reducing glucose levels in a subject |
| US10413590B2 (en) | 2011-07-01 | 2019-09-17 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants of FGF19 polypeptides for reducing body mass in a subject |
| US11066454B2 (en) | 2012-11-28 | 2021-07-20 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| US9963494B2 (en) | 2012-11-28 | 2018-05-08 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject |
| US9290557B2 (en) | 2012-11-28 | 2016-03-22 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| US10758590B2 (en) | 2012-11-28 | 2020-09-01 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF 19 polypeptides for treating diabetes |
| US9878008B2 (en) | 2012-12-27 | 2018-01-30 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having bile acid diarrhea or bile acid malabsorption |
| US11564972B2 (en) | 2012-12-27 | 2023-01-31 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants of FGF19 polypeptides for treating primary biliary cirrhosis in a subject |
| US9974833B2 (en) | 2012-12-27 | 2018-05-22 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having pregnancy intrahepatic cholestasis |
| US9273107B2 (en) | 2012-12-27 | 2016-03-01 | Ngm Biopharmaceuticals, Inc. | Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US9889178B2 (en) | 2012-12-27 | 2018-02-13 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having nonalcoholic steatohepatitis |
| US9889177B2 (en) | 2012-12-27 | 2018-02-13 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having primary sclerosing cholangitis |
| US9895416B2 (en) | 2012-12-27 | 2018-02-20 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having cholestasis |
| US11103554B2 (en) | 2012-12-27 | 2021-08-31 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants of FGF19 polypeptides for reducing bile acid synthesis in a subject having cirrhosis |
| US9878009B2 (en) | 2012-12-27 | 2018-01-30 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having error of bile acid synthesis |
| US9925242B2 (en) | 2012-12-27 | 2018-03-27 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of nonalcoholic steatohepatitis |
| US9925241B2 (en) | 2013-10-21 | 2018-03-27 | Salk Institute For Biological Studies | Mutated fibroblast growth factor (FGF) 1 and methods of use |
| US9925243B2 (en) | 2013-10-21 | 2018-03-27 | Salk Institute For Biological Studies | Chimeric fibroblast growth factor (FGF) 2/FGF1 peptides and methods of use |
| US10369199B2 (en) | 2013-10-28 | 2019-08-06 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of cancer |
| US11596676B2 (en) | 2014-01-24 | 2023-03-07 | Ngm Biopharmaceuticals, Inc. | Methods of treating nonalcoholic steatohepatitis comprising administering an anti-human beta klotho antibody or binding fragment thereof |
| US10744191B2 (en) | 2014-01-24 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins and methods of use thereof |
| US12378312B2 (en) | 2014-01-24 | 2025-08-05 | Ngm Biopharmaceuticals, Inc. | Polynucleotides encoding human beta klotho antibodies or binding fragments thereof and methods of use thereof |
| US10093735B2 (en) | 2014-01-24 | 2018-10-09 | Ngm Biopharmaceuticals, Inc. | Beta-klotho binding proteins |
| US10398758B2 (en) | 2014-05-28 | 2019-09-03 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions |
| US10456449B2 (en) | 2014-06-16 | 2019-10-29 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US11241481B2 (en) | 2014-06-16 | 2022-02-08 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US10517929B2 (en) | 2014-10-23 | 2019-12-31 | Ngm Biopharmaceuticals, Inc. | Pharmaceutical compositions comprising FGF19 variants |
| US10434144B2 (en) | 2014-11-07 | 2019-10-08 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US11141460B2 (en) | 2014-11-07 | 2021-10-12 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US10800843B2 (en) | 2015-07-29 | 2020-10-13 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins |
| US11667708B2 (en) | 2015-07-29 | 2023-06-06 | Ngm Biopharmaceuticals, Inc. | Anti-human beta klotho antibody or binding fragment thereof and methods of their use |
| US10695404B2 (en) | 2015-10-30 | 2020-06-30 | Salk Institute For Biological Studies | Treatment of steroid-induced hyperglycemia with fibroblast growth factor (FGF) 1 analogs |
| US10744185B2 (en) | 2015-11-09 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of pruritus |
| WO2018026713A1 (en) * | 2016-08-01 | 2018-02-08 | Salk Institute For Biological Studies | Fibroblast growth factor (fgf) 1 proteins with glucose lowering ability and reduced mitogenicity |
| US11370841B2 (en) | 2016-08-26 | 2022-06-28 | Ngm Biopharmaceuticals, Inc. | Methods of treating fibroblast growth factor 19-mediated cancers and tumors |
| US11542309B2 (en) | 2019-07-31 | 2023-01-03 | Salk Institute For Biological Studies | Fibroblast growth factor 1 (FGF1) mutant proteins that selectively activate FGFR1B to reduce blood glucose |
| JP2023520285A (ja) * | 2021-03-12 | 2023-05-17 | 江南大学 | 代謝障害に対する新規なfgf19タンパク質類似物質及びその使用 |
| EP4089106A4 (en) * | 2021-03-12 | 2023-08-09 | Jiangnan University | NOVEL FGF ANALOGUE AGAINST METABOLIC DISORDERS AND ITS USE |
| JP7457413B2 (ja) | 2021-03-12 | 2024-03-28 | 江南大学 | 代謝障害に対する新規なfgf19タンパク質類似物質及びその使用 |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2014342630A1 (en) | 2016-05-05 |
| EP3062881A1 (en) | 2016-09-07 |
| EP3062881B1 (en) | 2019-10-02 |
| JP6776380B2 (ja) | 2020-10-28 |
| KR102178945B1 (ko) | 2020-11-13 |
| US20200164035A1 (en) | 2020-05-28 |
| ES2753264T3 (es) | 2020-04-07 |
| EP3062881A4 (en) | 2017-03-29 |
| JP2017501381A (ja) | 2017-01-12 |
| JP2021008499A (ja) | 2021-01-28 |
| IL245297B (en) | 2021-02-28 |
| NZ718962A (en) | 2019-12-20 |
| MX2016004822A (es) | 2016-08-17 |
| MX377380B (es) | 2025-03-10 |
| CN113769114A (zh) | 2021-12-10 |
| AU2014342630B2 (en) | 2020-11-05 |
| JP2019112404A (ja) | 2019-07-11 |
| KR20160074000A (ko) | 2016-06-27 |
| CA2927592C (en) | 2020-08-18 |
| US10369199B2 (en) | 2019-08-06 |
| RU2707531C2 (ru) | 2019-11-27 |
| ZA201602665B (en) | 2020-07-29 |
| IL245297A0 (en) | 2016-06-30 |
| RU2016119745A3 (https=) | 2018-05-30 |
| RU2016119745A (ru) | 2017-12-05 |
| SG11201602870YA (en) | 2016-05-30 |
| JP6560202B2 (ja) | 2019-08-21 |
| CN105828878A (zh) | 2016-08-03 |
| BR112016009099A2 (pt) | 2017-09-19 |
| US20160252497A1 (en) | 2016-09-01 |
| CA2927592A1 (en) | 2015-05-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200164035A1 (en) | Methods of using variants of fgf19 polypeptides for the treatment of cancer | |
| US10869909B2 (en) | Compositions and methods of use for treating metabolic disorders | |
| US20200054714A1 (en) | Methods and Compositions for the Treatment of Metabolic Disorders and Diseases | |
| EP2925775B1 (en) | Compositions and methods for treatment of metabolic disorders and diseases | |
| US20140194352A1 (en) | Compositions and Methods for Treatment of Metabolic Disorders and Diseases | |
| EP3597666A2 (en) | Compositions, uses and methods for treatment of metabolic disorders and diseases | |
| HK1227790A1 (en) | Cancer models and associated methods | |
| HK1227790B (en) | Cancer models and associated methods | |
| WO2014014819A2 (en) | Methods of treating glucose metabolism disorders | |
| HK40015656A (en) | Compositions, uses and methods for treatment of metabolic disorders and diseases | |
| WO2013151627A1 (en) | Methods of treating glucose metabolism disorders | |
| HK1206260B (en) | Compositions and methods of use for treating metabolic disorders | |
| WO2014014816A2 (en) | Methods of treating glucose metabolism disorders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14857066 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2927592 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2016/004822 Country of ref document: MX |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014857066 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014857066 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2016525550 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 122020009322 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 245297 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15032605 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112016009099 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2014342630 Country of ref document: AU Date of ref document: 20141027 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20167013366 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2016119745 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112016009099 Country of ref document: BR Kind code of ref document: A2 Effective date: 20160422 |