WO2015054676A2 - Compositions for modulating c9orf72 expression - Google Patents

Compositions for modulating c9orf72 expression Download PDF

Info

Publication number
WO2015054676A2
WO2015054676A2 PCT/US2014/060194 US2014060194W WO2015054676A2 WO 2015054676 A2 WO2015054676 A2 WO 2015054676A2 US 2014060194 W US2014060194 W US 2014060194W WO 2015054676 A2 WO2015054676 A2 WO 2015054676A2
Authority
WO
WIPO (PCT)
Prior art keywords
soooossssssssssooss
certain embodiments
compound
nucleobases
c90rf72
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/060194
Other languages
English (en)
French (fr)
Other versions
WO2015054676A3 (en
Inventor
Susan M. Freier
Frank Rigo
Priyam SINGH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP22197003.1A priority Critical patent/EP4166667A3/en
Priority to CN201480054676.7A priority patent/CN105637090B/zh
Priority to KR1020167010455A priority patent/KR20160062069A/ko
Priority to JP2016521622A priority patent/JP6679476B2/ja
Priority to MX2016004651A priority patent/MX2016004651A/es
Priority to CA2926408A priority patent/CA2926408A1/en
Priority to SG11201602597YA priority patent/SG11201602597YA/en
Priority to MYPI2016701280A priority patent/MY192689A/en
Priority to RU2016116849A priority patent/RU2748426C2/ru
Priority to EP14852924.1A priority patent/EP3055414A4/en
Priority to US15/028,626 priority patent/US10221414B2/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to AU2014331652A priority patent/AU2014331652B2/en
Priority to BR112016007751A priority patent/BR112016007751A2/pt
Publication of WO2015054676A2 publication Critical patent/WO2015054676A2/en
Publication of WO2015054676A3 publication Critical patent/WO2015054676A3/en
Priority to IL244759A priority patent/IL244759A0/en
Priority to PH12016500603A priority patent/PH12016500603A1/en
Anticipated expiration legal-status Critical
Priority to US16/248,612 priority patent/US11339393B2/en
Priority to AU2020220099A priority patent/AU2020220099A1/en
Priority to US17/721,765 priority patent/US20230112920A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896Neurological disorders, e.g. Alzheimer's disease
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/343Spatial arrangement of the modifications having patterns, e.g. ==--==--==--

Definitions

  • compositions and methods for reducing expression of C90RF72 mRNA and protein in an animal are useful to treat, prevent, or ameliorate neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and
  • olivopontocerellar degeneration OPCD
  • ALS Amyotrophic lateral sclerosis
  • ALS is a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death from respiratory failure, typically within two to three years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700).
  • ALS is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al, Neurology, 2008, 70, 533-537).
  • ALS and frontotemporal dementia represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133).
  • the ALS-FTD causing mutation is a large hexanucleotide (GGGGCC) repeat expansion in the first intron of the C90RF72 gene (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hernandez et al., Neuron, 2011, 72, 245-256).
  • GGGGCC hexanucleotide repeat expansion in the first intron of the C90RF72 gene
  • C90RF72 gene is present in the majority of cases linked to this region (Renton et al., Neuron, 2011, 72, 257-268). This locus on chromosome 9p21 accounts for nearly half of familial ALS and nearly one-quarter of all ALS cases in a cohort of 405 Finnish patients (Laaksovirta et al, Lancet Neurol, 2010, 9, 978-985).
  • compositions and methods for modulating levels of C90RF72 mRNA and protein in cells, tissues, and animals are provided herein.
  • C90RF72 specific inhibitors modulate expression of C90RF72 mRNA and protein.
  • C90RF72 specific inhibitors are nucleic acids, proteins, or small molecules.
  • modulation can occur in a cell or tissue.
  • the cell or tissue is in an animal.
  • the animal is a human.
  • C90RF72 mRNA levels are reduced.
  • C90RF72 protein levels are reduced.
  • C90RF72 associated Repeat Associated Non-ATG Translation (RAN translation) products are reduced.
  • the C90RF72 associated RAN translation products are poly-(glycine-proline), poly-(glycine-alanine), and poly- (glycine-arginine).
  • certain C90RF72 mRNA variants are preferentially reduced.
  • the C90RF72 mRNA variants preferentially reduced are variants processed from a pre-mRNA containing intron 1.
  • intron 1 contains a hexanucleotide repeat expansion.
  • the C90RF72 mRNA variant preferentially reduced is a C90RF72 pathogenic associated mRNA variant.
  • the C90RF72 pathogenic associated mRNA variant is NM 001256054.1 (SEQ ID NO: 1).
  • the hexanucleotide repeat expansion is associated with a
  • the hexanucleotide repeat expansion is associated with a C90RF72 hexanucleotide repeat expansion associated disease.
  • the hexanucleotide repeat expansion comprises at least 24 GGGGCC repeats.
  • the hexanucleotide repeat expansion is associated with nuclear foci.
  • C90RF72 associated RAN translation products are associated with nuclear foci.
  • the C90RF72 associated RAN translation products are are poly-(glycine- proline), poly-(glycine-alanine), and poly-(glycine-arginine).
  • compositions and methods described herein are useful for reducing C90RF72 mRNA levels, C90RF72 protein levels, C90RF72 RAN translation products, and nuclear foci. In certain embodiments, the compositions and methods described herein are useful for selectively reducing C90RF72 pathogenic associated mRNA variants. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticalbasal degeneration syndrome
  • OPCD olivopontocerellar degeneration
  • Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common.
  • Certain risk factors and causes for development of a neurodegenerative disease, and, in particular, ALS and FTD, include genetic predisposition and older age.
  • methods of treatment include administering a C90RF72 specific inhibitor to an individual in need thereof.
  • the C90RF72 specific inhibitor is a nucleic acid.
  • the nucleic acid is an antisense compound.
  • the antisense compound is a single-stranded antisense oligonucleotide.
  • the single-stranded antisense oligonucleotide is complementary to a C90RF72 nucleic acid.
  • element or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
  • 2'-0-methoxyethyl refers to an O- methoxy-ethyl modification of the 2' position of a furanose ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2'-MOE nucleoside (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a MOE modified sugar moiety.
  • 2 '-substituted nucleoside means a nucleoside comprising a substituent at the 2'-position of the furanose ring other than H or OH.
  • 2 '-substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5-methylcytosine is a modified nucleobase.
  • administering refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.
  • “Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • antisense compounds include single- stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
  • Antisense inhibition means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.
  • Antisense mechanisms are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.
  • Base complementarity refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
  • Bicyclic sugar means a furanose ring modified by the bridging of two atoms.
  • a bicyclic sugar is a modified sugar.
  • BNA Bicyclic nucleoside
  • C90RF72 associated disease means any disease associated with any C90RF72 nucleic acid or expression product thereof. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD.
  • C90RF72 associated RAN translation products means aberrant peptide or di-peptide polymers translated through RAN translation (i.e., repeat-associated, and non-ATG-dependent translation).
  • the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).
  • C90RF72 hexanucleotide repeat expansion associated disease means any disease associated with a C90RF72 nucleic acid containing a hexanucleotide repeat expansion.
  • the hexanucleotide repeat expansion may comprise GGGGCC, GGGGGG,
  • C90RF72 nucleic acid means any nucleic acid encoding C90RF72.
  • a C90RF72 nucleic acid includes a DNA sequence encoding C90RF72, an RNA sequence transcribed from DNA encoding C90RF72 including genomic DNA comprising introns and exons (i.e., pre-mRNA), and an mRNA sequence encoding C90RF72.
  • C90RF72 mRNA means an mRNA encoding a C90RF72 protein.
  • C90RF72 pathogenic associated mRNA variant means the C90RF72 mRNA variant processed from a C90RF72 pre-mRNA variant containing the hexanucleotide repeat.
  • a C90RF72 pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1 A to the start site of exon IB, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No.
  • the level of a C90RF72 pathogenic associated mRNA variant is measured to determine the level of a C90RF72 pre-mRNA containting the hexanucleotide repeat in a sample.
  • C90RF72 specific inhibitor refers to any agent capable of specifically inhibiting the expression of C90RF72 mRNA and/or C90RF72 protein at the molecular level.
  • C90RF72 specific inhibitors include nucleic acids (including antisense compounds), siRNAs, aptamers, antibodies, peptides, small molecules, and other agents capable of inhibiting the expression of C90RF72 mRNA and/or C90RF72 protein.
  • C90RF72 specific inhibitors may affect other molecular processes in an animal.
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • cEt or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'- CH(CH 3 )-0-2'.
  • Consstrained ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-0-2' bridge.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-0-methoxyethyl modifications.
  • Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.
  • Co-administration means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • Designing or”designed to refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent may be a liquid, e.g. saline solution.
  • Dose means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period.
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
  • Effective amount in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • Effectiveacy means the ability to produce a desired effect.
  • “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
  • “Foci” means a nuclear foci comprising a C90RF72 transcript.
  • a foci comprises at least one C90RF72 transcript.
  • C90RF72 foci comprise transcripts comprising any of the following hexanucleotide repeats: GGGGCC, GGGGGG,
  • GGGGGC GGGGCG
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as a "gap” and the external regions may be referred to as the "wings.”
  • Gap-narrowed means a chimeric antisense compound having a gap segment of 9 or fewer contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.
  • Gap-widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.
  • “Hexanucleotide repeat expansion” means a series of six bases (for example, GGGGCC,
  • hexanucleotide repeat expansion may be located in intron 1 of a C90RF72 nucleic acid.
  • a pathogenic hexanucleotide repeat expansion includes at least 24 repeats of
  • GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C90RF72 nucleic acid and is associated with disease.
  • the repeats are consecutive.
  • the repeats are interrupted by 1 or more nucleobases.
  • a wild-type hexanucleotide repeat expansion includes 23 or fewer repeats of GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C90RF72 nucleic acid.
  • the repeats are consecutive.
  • the repeats are interrupted by 1 or more nucleobases. "Hybridization" means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
  • Identifying an animal having a C90RF72 associated disease means identifying an animal having been diagnosed with a C90RF72 associated disease or predisposed to develop a C90RF72 associated disease. Individuals predisposed to develop a C90RF72 associated disease include those having one or more risk factors for developing a C90RF72 associated disease, including, having a personal or family history or genetic predisposition of one or more C90RF72 associated diseases. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • “Inhibiting C90RF72” means reducing the level or expression of a C90RF72 mR A and/or protein.
  • C90RF72 mRNA and/or protein levels are inhibited in the presence of an antisense compound targeting C90RF72, including an antisense oligonucleotide targeting C90RF72, as compared to expression of C90RF72 mRNA and/or protein levels in the absence of a C90RF72 antisense compound, such as an antisense oligonucleotide.
  • “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Linked nucleosides means adjacent nucleosides linked together by an internucleoside linkage.
  • LNA Locked nucleic acid
  • LNA Low-power nucleic acid
  • LNA nucleosides means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar.
  • bicyclic sugar examples include, but are not limited to A) a-L-Methyleneoxy (4'-CH 2 -0-2') LNA , (B) ⁇ -D-Methyleneoxy (4'-CH 2 -0-2') LNA , (C) Ethyleneoxy (4'-(CH 2 ) 2 -0-2') LNA , (D) Aminooxy (4'-CH 2 -0-N(R)-2') LNA and (E) Oxyamino (4'-CH 2 -N(R)-0-2') LNA, as depicted below.
  • Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(Ri)(R 2 )] n -, -[C(Ri)(R 2 )] n -0-, -C(RiR 2 )-N(Ri)-0- or - C(RiR2)-0-N(Ri)-.
  • bridging groups encompassed with the definition of LNA are 4'-CH 2 -2', 4'-(CH 2 )2-2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(Ri)-2' and 4'-CH 2 - N(Ri)-0-2'- bridges, wherein each Ri and R2 is, independently, H, a protecting group or C1-C12 alkyl.
  • LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-0-2') bridge to form the bicyclic sugar moiety.
  • the bridge can also be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-0-2') LNA is used.
  • ethyleneoxy (4'- CH2CH2-O-2') LNA is used, a -L- methyleneoxy (4'- ⁇ 3 ⁇ 4-0-2'), an isomer of methyleneoxy (4'- CH2-0-2') LNA is also encompassed within the definition of LNA, as used herein.
  • mis or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. , a phosphodiester internucleoside bond).
  • Modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.
  • Modified sugar means substitution and/or any change from a natural sugar moiety.
  • “Monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
  • “Motif means the pattern of unmodified and modified nucleoside in an antisense compound. "Natural sugar moiety” means a sugar moiety found in DNA (2'-H) or R A (2'-OH).
  • Naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
  • Non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds withone another or otherwise support hybridization.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single- stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • U uracil
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units.
  • Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit
  • tetrahydropyranyl rings are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
  • mimetic refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Off-target effect refers to an unwanted or deleterious biological effect assocaited with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.
  • Oligomer means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous
  • intramuscular administration intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebro ventricular
  • peptide means a molecule formed by linking at least two amino acids by amide bonds.
  • peptide refers to polypeptides and proteins.
  • “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual.
  • an antisense oligonucleotide targeted to C90RF72 is a pharmaceutical agent.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to as subject.
  • a pharmaceutical composition may comprise an antisense oliognucleotide and a sterile aqueous solution.
  • “Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • Portion means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent or “preventing” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • “Prophylactically effective amount” refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
  • Random is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • “Ribonucleotide” means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
  • Salts mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
  • Side effects means physiological responses attributable to a treatment other than desired effects.
  • side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.
  • Sites are defined as unique nucleobase positions within a target nucleic acid.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Stringent hybridization conditions or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
  • Subject means a human or non-human animal selected for treatment or therapy.
  • Target refers to a protein, the modulation of which is desired.
  • Target gene refers to a gene encoding a target.
  • Targeting or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid means a nucleic acid capable of being targeted by antisense compounds.
  • Target region means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3 ' target site refers to the 3 '-most nucleotide of a target segment.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • Treat” or “treating” or “treatment” means administering a composition to effect an alteration or improvement of a disease or condition.
  • Unmodified nucleobases means the purine bases adenine (A) and guanine (G), and the pyrimidine bases (T), cytosine (C), and uracil (U).
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • Wild segment means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • compositions and methods for decreasing total C90RF72 mRNA and protein expression are provided.
  • compositions and methods for decreasing C90RF72 pathogenic associated mRNA variants are provided.
  • Certain embodiments provide methods for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with C90RF72 in an individual in need thereof. Also contemplated are methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with C90RF72.
  • C90RF72 associated diseases, disorders, and conditions include neurodegenerative diseases.
  • the neurodegenerative disease may be ALS or FTD.
  • the neurodegenerative disease may be familial or sporadic.
  • compositions and methods for the treatment, prevention, or amelioration of a C90RF72 hexanucleotide repeat expansion associated disease may comprise GGGGCC, GGGGGG,
  • GGGGGC GGGGCG
  • compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: SEQ ID NOs: 20-401 and 441-1545.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1107-1520 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1111-1200 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1211-1318 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1326-1540 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1331-1375 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1368-1391 of SEQ ID NO: 2
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1398-1424 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1411-1440 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1429-1481 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1502-1539 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 1508-1539 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7860-7906 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7907-9744 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 7989-8038 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8020-8135 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8136-8161 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8174-8211 of SEQ ID NO: 2.
  • nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 8213-8325 of SEQ ID NO: 2.
  • the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.
  • the modified oligonucleotide is a single- stranded modified oligonucleotide.
  • At least one internucleoside linkage of the m odified oligonucleotide is a modified internucleoside linkage.
  • At least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • At least one internucleoside linkage is a phosphodiester internucleoside linkage.
  • At least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.
  • At least one nucleoside comprises a modified nucleobase.
  • the modified nucleobase is a 5-methylcytosine.
  • At least one nucleoside of the modified oligonucleotide comprises a modified sugar.
  • the at least one modified sugar is a bicyclic sugar.
  • the bicyclic sugar comprises a chemical link between the 2' and 4' position of the sugar 4'-CH2-N(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.
  • the bicyclic sugar comprises a 4'-CH2-N(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.
  • At least one modified sugar comprises a 2'-0-methoxyethyl group. In certain embodiments, the modified sugar comprises a 2'-0(CH 2 )2-OCH 3 group.
  • the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides
  • a 3' wing segment consisting of 5 linked nucleosides
  • each nucleoside of each wing segment comprises a modified sugar
  • the modified oligonucleotide comprises:
  • a 3' wing segment consisting of 5 linked nucleosides
  • each nucleoside of each wing segment comprises a modified sugar
  • the modified oligonucleotide comprises sugar modifications in any of the following patterns: eeekkddddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekedddddddekeke, and ekekdddddddkekee; wherein,
  • e a 2'-0-methoxyethyl modified nucleoside
  • k a cEt nucleoside.
  • the modified oligonucleotide comprises intemucleoside linkages in any of the following patterns: soooossssssssssooss, sooossssssssooss, soosssssssooss, and sosssssssssoooss; wherein,
  • o a phosphodiester linkage
  • the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides.
  • compositions comprising the compound of any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • the animal is a human.
  • administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 associated disease, disorder or condition.
  • administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 hexanucleotide repeat expansion associated disease, disorder or condition.
  • the disease, disorder or condition is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerellar degeneration (OPCD).
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticalbasal degeneration syndrome
  • OPCD olivopontocerellar degeneration
  • the administering reduces nuclear foci.
  • the administering reduces expression of C90RF72 associated
  • the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).
  • kits for selectively inhibiting a C90RF72 pathogenic associated mRNA variant by administering an antisense compound targeting the region beginning at the start site of exon 1 A to the start site of exon IB of a C90RF72 pre-mRNA.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense
  • oligonucleotides and siRNAs.
  • An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound targeted to a C90RF72 nucleic acid is 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. In certain embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits.
  • the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense
  • oligonucleotide, and the linked subunits are nucleosides.
  • antisense oligonucleotides targeted to a C90RF72 nucleic acid may be shortened or truncated.
  • a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3 ' end (3 ' truncation).
  • a shortened or truncated antisense compound targeted to a C90RF72 nucleic acid may have two subunits deleted from the 5 ' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.
  • the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
  • the additional subunit may be located at the 5' or 3' end of the antisense compound.
  • the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound.
  • the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
  • antisense compounds targeted to a C90RF72 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • each distinct region comprises uniform sugar moieties.
  • wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment.
  • Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other embodiments they are different.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides.
  • gapmers described herein include, but are not limited to, for example 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7- 5, 4-7-5, 5-7-4, or 4-7-4.
  • the antisense compound has a "wingmer" motif, having a wing- gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration.
  • wingmer configurations described herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
  • antisense compounds targeted to a C90RF72 nucleic acid possess a 5-10-5 gapmer motif.
  • antisense compounds targeted to a C90RF72 nucleic acid possess a 5-8-5 gapmer motif. In certain embodiments, antisense compounds targeted to a C90RF72 nucleic acid possess sugar modifications in any of the following patterns: eeekkddddddddkkeee, eekkddddddddkkeee, ekddddddddekekeee, kekeddddddddekeke, and ekekddddddddkekee; wherein,
  • e a 2'-0-methoxyethyl modified nucleoside
  • k a cEt nucleoside.
  • an antisense compound targeted to a C90RF72 nucleic acid has a gap-narrowed motif.
  • a gap-narrowed antisense oligonucleotide targeted to a C90RF72 nucleic acid has a gap segment of 9, 8, 7, or 6 2'-deoxynucleotides positioned immediately adjacent to and between wing segments of 5, 4, 3, 2, or 1 chemically modified nucleosides.
  • the chemical modification comprises a bicyclic sugar.
  • the bicyclic sugar comprises a 4' to bridge selected from among: 4'-(CH 2 ) n - 0-2' bridge, wherein n is 1 or 2; and 4'-CH 2 -0-CH 2 -2'.
  • the bicyclic sugar is comprises a 4'-CH(C]3 ⁇ 4)-0-2' bridge.
  • the chemical modification comprises a non-bicyclic 2'-modified sugar moiety.
  • the non-bicyclic 2'- modified sugar moiety comprises a 2'-0-methylethyl group or a 2'-0-methyl group.
  • Nucleotide sequences that encode C90RF72 include, without limitation, the following: the complement of GENBANK Accession No. NM OO 1256054.1 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 008413.18 truncated from nucleobase 27535000 to 27565000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. BQ068108.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. NM_018325.3 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DN993522.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No.
  • NMJ45005.5 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 7), GENBANK Accession No. BU194591.1 (incorporated herein as SEQ ID NO: 8), Sequence Identifier 4141_014_A
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region may encompass a 3' UT , a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for C90RF72 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region may encompass the sequence from a 5 ' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
  • Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • C90RF72 mRNA levels are indicative of inhibition of C90RF72 expression.
  • Reductions in levels of a C90RF72 protein are also indicative of inhibition of target mRNA expression.
  • Reduction in the presence of expanded C90RF72 RNA foci are indicative of inhibition of C90RF72 epxression.
  • phenotypic changes are indicative of inhibition of C90RF72 expression. For example, improved motor function and respiration may be indicative of inhibition of C90RF72 expression.
  • hybridization occurs between an antisense compound disclosed herein and a C90RF72 nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a C90RF72 nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a C90RF72 nucleic acid).
  • a desired effect e.g., antisense inhibition of a target nucleic acid, such as a C90RF72 nucleic acid.
  • Non-complementary nucleobases between an antisense compound and a C90RF72 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a C90RF72 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a C90RF72 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and
  • complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof.
  • an antisense compound may be fully complementary to a C90RF72 nucleic acid, or a target region, or a target segment or target sequence thereof.
  • each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous.
  • a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C90RF72 nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as a C90RF72 nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5'
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to a C90RF72 nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are interspersed throughout the antisense compound.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • the antisense compounds targeted to a C90RF72 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage.
  • antisense compounds targeted to a C90RF72 nucleic acid possess internucleoside linkages in any of the following patterns: soooossssssssssooss, sooossssssssooss, soosssssssooss, and sosssssssssoooss; wherein,
  • o a phosphodiester linkage
  • Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA)
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group
  • Examples of chemically modified sugars include 2 -F-5 '-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a BNA (see PCT International
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5 * -vinyl, 5 * -methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'- OCH 2 CH 2 F and 2'-0(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to one of the formulae: 4'- (CH 2 )-0-2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )-0-2' and 4'-CH(CH 2 OCH 3 )- 0-2' (and analogs thereof see U.S.
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentoiuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ra)(Rb)] justify-,
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • the bridge of a bicyclic sugar moiety is -[C(Ra)(Rb)]n- , -[C(R a )(Rb)] n -0-, -C(RaR b )-N(R)-0- or -C(RaRb)-0-N(R)-.
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 )2-2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 )2-0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 - N(R)-0-2'- wherein each R is, independently, H, a protecting group or C 1 -C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4'-2' methylene-oxy bridge may be in the a-L
  • bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA , (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0- 2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA, (G) methylene-thio (4'-CH 2 -S- 2') BNA, (H) methylene-amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )- 2') BNA
  • Bx is the base moiety and R is independently H, a protecting group or Ci-Ci 2 alkyl.
  • bicyclic nucleosides are provided having Formula I:
  • Bx is a heterocyclic base moiety
  • -Qa-Qb-Q c - is -CH 2 -N(Rc)-CH 2 -, -CH 2 -0-N(Rc)-, -CH 2 -N(IQ-0- or - N(R c )-0-CH 2 ;
  • Rc is C1 -C12 alkyl or an amino protecting group;
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides are provided having Formula II:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • bicyclic nucleosides are provided having Formula III:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides are provided having Formula IV:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Rd is C1-C6 alkyl, substituted Ci-C 6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
  • each q a , qb, q c and qa is, independently, H, halogen, Q-C6 alkyl, substituted C1-C6 alkyl, C2- Ce alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;
  • bicyclic nucleosides are provided having Formula V:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q g and q h are each, independently, H, halogen, C 1 -C 12 alkyl or substituted C 1 -C 12 alkyl.
  • the synthesis and preparation of the methyleneoxy (4'-CH 2 -0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • bicyclic nucleosides are provided having Formula VI:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each q;, c , q k and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2'- substituent groups can also be selected from: Ci-Ci 2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'- MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2 * -MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486- 504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
  • a "modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted in for the pento furanosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoro HNA F-HNA) or those compounds having Formula VII:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently, an internucleoside linking group linking the
  • internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T a and Tb is H, a hydro xyl protecting group, a linked conjugate group or a 5 ' or 3 '-terminal group;
  • qi , q 2 , q3, q4, qs, q6 and q 7 are each independently, H, Q-C6 alkyl, substituted C1-C6 alkyl,
  • the modified THP nucleosides of Formula VII are provided wherein qi, q2, q 3 , q 4 , qs, qe and q 7 are each H. In certain embodiments, at least one of qi , q2, q 3 , q 4 , qs, qe and q 7 is other than H. In certain embodiments, at least one of qi , q2, q 3 , q 4 , qs, q6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of i and R2 is fluoro. In certain embodiments, Ri is fluoro and R2 is H; Ri is methoxy and R2 is H, and Ri is H and R2 is methoxyethoxy.
  • 2'-modified nucleosides refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position.
  • 2'-OMe or “2'-OCH 3 " or “2'-0-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (R A) and/or deoxyribonucleosides (DNA).
  • Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleotides having modified sugar moieties are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'-CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to a C90RF72 nucleic acid can be utilized in
  • compositions by combining the antisense compound with a suitable pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a C90RF72 nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any one of
  • compositions are also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini.
  • Cap structures are well known in the art and include, for example, inverted deoxy abasic caps.
  • 3' and 5'- stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.
  • C90RF72 nucleic acids can be tested in vitro in a variety of cell types.
  • Cell types used for such analyses are available from commerical vendors ⁇ e.g. American Type Culture Collection, Manassus, VA; Zen- Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA).
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN
  • concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes
  • LIPOFECT AMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line.
  • Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Quantitative Real-Time PCR Analysis of Target RNA Levels
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cD A) that is then used as the substrate for the real-time PCR amplification.
  • RT reverse transcriptase
  • cD A complementary DNA
  • the RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
  • Probes and primers are designed to hybridize to a C90RF72 nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
  • Antisense inhibition of C90RF72 nucleic acids can be assessed by measuring C90RF72 protein levels. Protein levels of C90RF72 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme- linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immuno cytochemistry or fluorescence- activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human C90RF72 are commercially available.
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of C90RF72 and produce phenotypic changes, such as, improved motor function and respiration.
  • motor function is measured by rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal.
  • respiration is measured by whole body plethysmo graph, invasive resistance, and compliance measurements in the animal. Testing may be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).
  • a pharmaceutically acceptable diluent such as phosphate- buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).
  • Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous, as well as central routes of administration such as intracerebro ventricular or intrathecal. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight.
  • RNA is isolated from CNS tissue or CSF and changes in C90RF72 nucleic acid expression are measured.
  • Antisense oligonucleotides described herein may hybridize to a C90RF72 nucleic acid in any stage of RNA processing.
  • described herein are antisense oligonucleotides that are complementary to a pre-mRNA or a mature mRNA.
  • antisense oligonucleotides described herein may hybridize to any element of a C90RF72 nucleic acid.
  • antisense oligonucleotides that are complementary to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon la, exon lb, exon lc, exon Id, exon le, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exonl 1, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10 of a C90RF72 nucleic acid.
  • antisense oligonucleotides described herein hybridize to all variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to certain variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to variants of C90RF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oliognucleotides described herein selectively hybridize to pre-mRNA variants containing the hexanucleotide repeat.
  • pre-mRNA variants of C90RF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10.
  • such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.
  • the antisense oligonucleotides described herein inhibit expression of all variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C90RF72 equally. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of one or more variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of variants of C90RF72 containing a hexanucleotide repeat expansion.
  • the antisense oliognucleotides described herein selectively inhibit expression of pre- mRNA variants containing the hexanucleotide repeat. In certain embodiments, the antisense oliognucleotides described herein selectively inhibit expression of C90RF72 pathogenic associated mRNA variants.
  • pre-mRNA variants of C90RF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.
  • the hexanucleotide repeat expansion forms nuclear foci.
  • antisense oligonucleotides described herein are useful for reducing nuclear foci. Nuclear foci may be reduced in terms of percent of cells with foci as well as number of foci per cell.
  • primer probe set RTS3905 detects an mRNA variant (e.g. NM_001256054.1) processed from a pre-mRNA variant containing the hexanucleotide repeat.
  • the mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat i.e., the "C90RF72 pathogenic associated mRNA variant").
  • a pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon IB, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No.
  • NT_008413.18 truncated from nucleosides 27535000 to 27565000.
  • Oligonucleotides were designed in this region to selectively target the pre-mRNA variant containing the hexanucleotide repeat.
  • RTS3905 measures an mRNA product (i.e. the C90RF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat.
  • Antisense oligonucleotides described herein may hybridize to any C90RF72 variant at any state of processing within any element of the C90RF72 gene. For example, antisense
  • oligonucleotides described herein may hybridize to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon la, exon lb, exon lc, exon Id, exon le, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10.
  • ESS exonic splicing silencer
  • ESE exonic splicing enhancer
  • antisense oligonucleotides may target any of the exons characterized below in Tables 1-5 for the various C90RF72 variants described below.
  • Antisense oligonucleotides described herein may also target variants not characterized below and such variants are characterized in GENBANK.
  • antisense oligonucleotides described herein may also target elements other than exons and such elements are characterized in GENBANK.
  • provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions described herein.
  • the individual has a neurodegenerative disease.
  • the individual is at risk for developing a neurodegenerative disease, including, but not limited to, ALS or FTD.
  • the individual has been identified as having a C90RF72 associated disease.
  • the individual has been identified as having a C90RF72 hexanucleotide repeat expansion associated disease.
  • provided herein are methods for
  • Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a C90RF72 nucleic acid.
  • administration of a therapeutically effective amount of an antisense compound targeted to a C90RF72 nucleic acid is accompanied by monitoring of C90RF72 levels in an individual, to determine an individual's response to administration of the antisense compound.
  • An individual's response to administration of the antisense compound may be used by a physician to determine the amount and duration of therapeutic intervention.
  • administration of an antisense compound targeted to a C90RF72 nucleic acid results in reduction of C90RF72 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • administering results in improved motor function and respiration in an animal.
  • administration of a C90RF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to C90RF72 are used for the preparation of a medicament for treating a patient suffering or susceptible to a neurodegenerative disease including ALS and FTD.
  • one or more pharmaceutical compositions described herein are co- administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein.
  • one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions described herein are co-administered with another
  • compositions described herein are co-administered with another pharmaceutical agent to produce a synergistic effect.
  • one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include Riluzole (Rilutek), Lioresal (Lioresal), and Dexpramipexole.
  • pharmaceutical agents that may be co-administered with a C90RF72 specific inhibitor described herein include, but are not limited to, an additional C90RF72 inhibitor.
  • the co-adminstered pharmaceutical agent is administered prior to administration of a pharmaceutical composition described herein.
  • the co- administered pharmaceutical agent is administered following administration of a pharmaceutical composition described herein.
  • the co-administered pharmaceutical agent is administered at the same time as a pharmaceutical composition described herein.
  • the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
  • the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
  • the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone.
  • the coadministration results in effects that are additive of the effects of the compounds when administered alone.
  • the co-administration results in effects that are supra-additive of the effects of the compounds when administered alone.
  • the first compound is an antisense compound.
  • the second compound is an antisense compound.
  • Certain antisense oligonucleotides described herein may target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these compounds.
  • the human C90RF72 antisense oligonucleotides described herein are being evaluated as possible human therapeutics.
  • Various parameters of potency, efficacy, and/or tolerability are being examined. Such parameters include in vitro inhibition of total C90RF72 R A expression, in vitro inhibition of C90RF72 pathogenic associated RNA variant expression, in vitro dose response (IC50), in vivo inhibition of total or pathogenic RNA and/or protein in a transgenic animal containing a human C90RF72 transgene in relevant tissues (e.g., brain and/or spinal cord), tolerability in mouse, tolerability in rat, and/or tolerability in a primate.
  • relevant tissues e.g., brain and/or spinal cord
  • Tolerability markers that may be measured in elude blood and serum chemistry parameters, CSF chemistry parameters, body and organ weights, general observations and/or behavioral tests, and/or biochemical markers such as GFAP and/or AIF1. Acute or long term tolerability may be measured.
  • antisense oligonucletoides are designed to target nucleobases 1107-1520 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1107- 1 20 are a hotspot region.
  • nucleobases 1107-1520 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 17, 18, or 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers or 5-8-5 MOE gapmers.
  • the antisense oligonucleotides are 17-mer Deoxy, MOE and cEt oligonucleotides.
  • the nucleosides of the antisense olignonucleotides are linked by
  • nucleosides of the antisense oligonucleotides are linked by phosphodiester intemucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 1107-1520 are targeted by the following ISIS numbers: 619042-619333, 672581-672714, 672735-672865, 672885-673015, 673035-673165, 673185-673315, and 673335-673465.
  • nucleobases 1107-1520 are targeted by the following SEQ ID NO:
  • nucleobases 1 107-1520 are targeted by the following ISIS numbers: 619042-619333.
  • nucleobases 1 107-1520 are targeted by the following SEQ ID NOs: 21-31 , 33-50, 52, 54-134, 138-248, 251-319, and 325.
  • antisense oligonucleotides targeting nucleobases 1107-1520 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%), at least 47%, at least 47%,
  • antisense oligonucleotides targeting nucleobases 1107-1520 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases 1111-1200 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1111- 1200 are a hotspot region.
  • nucleobases 1111-1200 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 1111-1200 are targeted by the following ISIS numbers: 619042-619095.
  • nucleobases 1111-1200 are targeted by the following SEQ ID NOs: 21, 26-31, 33-50, 52, 54-60, 75, 81, and 87-96.
  • antisense oligonucleotides targeting nucleobases 1111-1200 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucleotides targeting nucleobases 1111-1200 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases
  • nucleobases 1211-1318 of SEQ ID NO: 2 are a hotspot region.
  • nucleobases 1211-1318 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 1211-1318 are targeted by the following ISIS numbers: 619096-619172.
  • nucleobases 1211-1318 are targeted by the following SEQ ID NOs: 22-25, 70-74, 76-80, 82-86, 99-134, and 138-159.
  • antisense oligonucleotides targeting nucleobases 1211-1318 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucleotides targeting nucleobases 1211-1318 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases 1326-1540 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1326- 1540 are a hotspot region.
  • nucleobases 1326-1540 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 17, 18, or 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers or 5-8-5 MOE gapmers.
  • the antisense oligonucleotides are 17-mer Deoxy, MOE and cEt oligonucleotides.
  • the nucleosides of the antisense olignonucleotides are linked by
  • nucleosides of the antisense oligonucleotides are linked by phosphodiester intemucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 1326-1540 are targeted by the following ISIS numbers: 619173-619354, and 672581-673484.
  • nucleobases 1326-1540 are targeted by the following SEQ ID NOs: 97, 98, 160-248, 2 1-322, 325-343, and 744-1047.
  • nucleobases 1326-1540 are targeted by the following ISIS numbers: 619173-619354.
  • nucleobases 1326-1540 are targeted by the following SEQ ID NO:
  • antisense oligonucleotides targeting nucleobases 1326-1540 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%>, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 4
  • antisense oligonucleotides targeting nucleobases 1326-1540 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%), at least 47%, at least 47%,
  • antisense oligonucletoides are designed to target nucleobases 1331-1375 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1331- 1375 are a hotspot region.
  • nucleobases 1331-1375 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssssooss.
  • nucleobases 1331-1375 are targeted by the following ISIS numbers: 619178-619203.
  • nucleobases 1331-1375 are targeted by the following SEQ ID NOs: 165-190.
  • antisense oligonucleotides targeting nucleobases 1331-1375 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases 1368-1391 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1368- 1391 are a hotspot region.
  • nucleobases 1368-1391 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssssooss.
  • nucleobases 1368-1391 are targeted by the following ISIS numbers: 619215-619219.
  • nucleobases 1368-1391 are targeted by the following SEQ ID NOs: 202-206.
  • antisense oligonucleotides targeting nucleobases 1368-1391 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases 1398-1424 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1398- 1424 are a hotspot region.
  • nucleobases 1398-1424 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssssooss.
  • nucleobases 1398-1424 are targeted by the following ISIS numbers: 619245-619252.
  • nucleobases 1398-1424 are targeted by the following SEQ ID NOs: 232-239.
  • antisense oligonucleotides targeting nucleobases 1398-1424 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases 1411-1440 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobasesl411- 1440 are a hotspot region.
  • nucleobases 1411-1440 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssssooss.
  • nucleobases 1411-1440 are targeted by the following ISIS numbers: 619258-619268.
  • nucleobases 1411-1440 are targeted by the following SEQ ID Nos: 244-248, 251-255, and 325.
  • antisense oligonucleotides targeting nucleobases 1411-1440 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucletoides are designed to target nucleobases
  • nucleobases 1429- 1481 are a hotspot region.
  • nucleobases 1429-1481 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssssooss.
  • nucleobases 1429-1481 are targeted by the following ISIS numbers: 619276-619303.
  • nucleobases 1429-1481 are targeted by the following SEQ ID NO:
  • antisense oligonucleotides targeting nucleobases 1429-1481 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%>, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%,
  • antisense oligonucletoides are designed to target nucleobases 1502-1539 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1502- 1539 are a hotspot region.
  • nucleobases 1502-1539 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssooss.
  • nucleobases 1502-1539 are targeted by the following ISIS numbers: 619335-619353.
  • nucleobases 1502-1539 are targeted by the following SEQ ID Nos: 321, 322, and 326-342.
  • antisense oligonucleotides targeting nucleobases 1502-1539 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%o, at least 47%,
  • antisense oligonucletoides are designed to target nucleobases 1508-1539 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 1508- 1539 are a hotspot region.
  • nucleobases 1508-1539 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense olignonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleotide linkages (e.g., the antisense oligonucleotides have "mixed backbones"). In certain embodiments, the antisense oligonucleotides comprise the following sugar modification pattern: soooosssssssssssooss.
  • nucleobases 1508-1539 are targeted by the following ISIS numbers: 619341-619353.
  • nucleobases 1508-1539 are targeted by the following SEQ ID NOs: 330-342.
  • antisense oligonucleotides targeting nucleobases 1508-1539 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 40%, at
  • antisense oligonucleotides are designed to target nucleobases 7860-7906 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 7860- 7906 are a hotspot region.
  • nucleobases 7860-7906 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 7860-7906 are targeted by the following ISIS numbers: 655135-655144.
  • nucleobases 7860-7906 are targeted by the following SEQ ID NOs: 445-454.
  • antisense oligonucleotides targeting nucleobases 7860-7906 achieve at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%o, at least 67%, at least 68%>, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%), or at least 89% reduction of total C90RF72 mR A and/or protein levels in vitro and/or in vivo.
  • antisense oligonucleotides are designed to target nucleobases 7907-7944 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 7907- 7944 are a hotspot region.
  • nucleobases 7907-7944 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 7907-7944 are targeted by the following ISIS numbers: 655150-655156. In certain embodiments, nucleobases 7907-7944 are targeted by the following SEQ ID NOs: 460-467.
  • antisense oligonucleotides targeting nucleobases 7907-7944 achieve at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, or at least 91% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.
  • antisense oligonucleotides are designed to target nucleobases 7989-8038 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 7989- 8038 are a hotspot region.
  • nucleobases 7989-8038 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester Internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 7989-8038 are targeted by the following ISIS numbers: 619411, 619412, 619420, 625183, 627833, and 655173-655180.
  • nucleobases 7989-8038 are targeted by the following SEQ ID NOs: 20, 51, 53, and 484-493.
  • antisense oligonucleotides targeting nucleobases 7989-8038 achieve at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at
  • antisense oligonucleotides targeting nucleobases 7989-8038 achieve at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
  • antisense oligonucleotides are designed to target nucleobases 8020-8135 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 8020- 8135 are a hotspot region.
  • nucleobases 8020-8135 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 8020-8135 are targeted by the following ISIS numbers: 619413, 619414, 625255, 627834, 655181-655208.
  • nucleobases 8020-8135 are targeted by the following SEQ ID NOs: 135, 136, 494-511, and 517-528.
  • antisense oligonucleotides targeting nucleobases 8020-8135 achieve at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%
  • antisense oligonucleotides targeting nucleobases 8020-8135 achieve at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
  • antisense oligonucleotides are designed to target nucleobases 8136-8161 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 8136- 8161 are a hotspot region.
  • nucleobases 8136-8161 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 8136-8161 are targeted by the following ISIS numbers: 655215-655217.
  • nucleobases 8136-8161 are targeted by the following SEQ ID NO:
  • antisense oligonucleotides targeting nucleobases 8136-8161 achieve at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, or at least 41% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.
  • antisense oligonucleotides targeting nucleobases 8136-8161 achieve at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
  • antisense oligonucleotides are designed to target nucleobases
  • nucleobases 8174-8211 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 8174- 8211 are a hotspot region.
  • nucleobases 8174-8211 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length.
  • the antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
  • nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 8174-8211 are targeted by the following ISIS numbers: 655228-655234.
  • nucleobases 8174-8211 are targeted by the following SEQ ID NOs: 548-554.
  • antisense oligonucleotides targeting nucleobases 8174-8211 achieve at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, or at least 63% reduction of total C90RF72 mRNA and/or protein levels in vitro and/or in vivo.
  • antisense oligonucleotides targeting nucleobases 8174-8211 achieve at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% reduction of C90RF72 pathogenic associated mRNA variant levels in vitro and/or in vivo.
  • antisense oligonucleotides are designed to target nucleobases 8213-8325 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT 008413.18 truncated from nucleosides 27535000 to 27565000).
  • nucleobases 8213- 8325 are a hotspot region.
  • nucleobases 8213-8325 are targeted by antisense oligonucleotides.
  • the antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers.
  • the nucleosides of the antisense oligonucleotides are linked by phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphodiester internucleoside linkages. In certain embodiments, the nucleosides of the antisense oligonucleotides are linked by phosphorothioate and phosphodiester internucleoside linkages (e.g., the antisense oligonucleotides have "mixed backbones").
  • nucleobases 8213-8325 are targeted by the following ISIS numbers: 655235-655270.
  • nucleobases 8213-8325 are targeted by the following SEQ ID NOs: 555-590.
  • antisense oligonucleotides targeting nucleobases 8213-8325 achieve at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least
  • antisense oligonucleotides targeting nucleobases 8213-8325 achieve at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least
  • Example 1 Antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells by MOE gapmers
  • Antisense oligonucleotides targeting a C90RF72 nucleic acid were designed and tested for their effects on C90RF72 mRNA in vitro.
  • ISIS 576816 previously tested in US Application No. 61/714,132, filed October 15, 2012, was used as a benchmark oligonucleotide.
  • ISIS 576816 is a 5- 10-5 MOE gapmer with phosphorothioate linkages throughout.
  • Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM antisense
  • Human primer probe set RTS3905 forward primer sequence GGGTCTAGCAAGAGCAGGTG, designated herein as SEQ ID NO: 13; reverse primer sequence GTCTTGGCAACAGCTGGAGAT, designated herein as SEQ ID NO: 14; probe sequence TGATGTCGACTCTTTGCCCACCGC, designated herein as SEQ ID NO: 15 - a TAQ-man primer probe set
  • RTS3905 detects an mRNA variant (e.g.
  • NM_001256054.1 processed from a pre-mRNA variant containing the hexanucleotide repeat.
  • the mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat is herein the "C90RF72 pathogenic associated mRNA variant.”
  • a pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon IB (generally nucleotides 1107 to 1520 of the genomic sequence: SEQ ID NO: 2, the complement of GENBAN Accession No. NT 008413.18 truncated from nucleosides
  • oligonucleotides were designed in this region selectively target the pre-mRNA variant containing the hexanucleotide repeat.
  • RTS3905 measures an mRNA product (i.e. the C90RF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat.
  • the levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells.
  • oligonucleotide marked with an asterisk (*) targets the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides.
  • the chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment comprises a 2' -MOE group. All cytosine residues throughout each
  • oligonucleotide are 5-methylcytosines.
  • the internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages.
  • the internucleoside linkages for each gapmer are presented in the Linkage column, where ⁇ ' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage.
  • Start site indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each antisense oligonucleotide listed in the Table below is targeted to either human C90RF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No.
  • NM_001256054.1 or the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 27565000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence
  • Example 2 Antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells by MOE gapmers
  • Human primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant, which is the product of a pre-mRNA containing a hexanucleotide repeat.
  • the levels of the C90RF72 pathogenic associated mRNA variant were normalized to the total RNA content of the cell, as measured by RIBOGREEN®. Results are presented as percent inhibition of C90RF72, relative to untreated control cells.
  • the oligonucleotides marked with as asterisk (*) targets the region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides, 'n.d.' indicates that there was no signal reading in the assay for that particular oligonucleotide.
  • the chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end comprising five nucleosides each.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment comprises a 2' -MOE group.
  • All cytosine residues throughout each oligonucleotide are 5-methylcytosines.
  • the internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages.
  • the internucleoside linkages for each gapmer are presented in the Linkage column, where 'o' indicates a phosphodiester linkage and's' indicates a phosphorothioate linkage.
  • Start site indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • Stop site indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence.
  • the gapmers of the Tables below also target either human C90RF72 mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001256054.1) or the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No.
  • NT_008413.18 truncated from nucleosides 27535000 to 27565000), or both.
  • Some of the gapmers of Table 10 are targeted to GENBANK Accession No. NM 145005.5 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. BUI 94591.1 (incorporated herein as SEQ ID NO: 5).
  • 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence.
  • Example 3 Dose-dependent antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells
  • Antisense oligonucleotides from the study described above exhibiting significant in vitro inhibition of C90RF72 mRNA were selected and tested at various doses in HepG2 cells.
  • ISIS 576816 and ISIS 577061 are 5-10-5 MOE gapmers with phosphorothioate linkages throughout.
  • the antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • Cells were plated at a density of 20,000 cells per well and transfected using electrop oration with 78.1 nM, 312.5 nM, 1,250.0 nM, or 5,000.0 nM concentrations of antisense oligonucleotide. After a treatment period of approximately 16 hours, RNA was isolated from the cells and C90RF72 mRNA levels were measured by quantitative real-time PCR.
  • Human C90RF72 primer probe set RTS3905 was used to measure the C90RF72 pathogenic associated mRNA variant.
  • the levels of the C90RF72 pathogenic associated mRNA variant were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of variant C90RF72 levels, relative to untreated control cells. 'n.d.' means no data.
  • the half maximal inhibitory concentration (IC 5 o) of each oligonucleotide is also presented in the Tables below. As illustrated, the C90RF72 pathogenic associated mRNA variant levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
PCT/US2014/060194 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression Ceased WO2015054676A2 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
US15/028,626 US10221414B2 (en) 2013-10-11 2014-10-11 Compositions for modulating C9ORF72 expression
KR1020167010455A KR20160062069A (ko) 2013-10-11 2014-10-11 C9orf72 발현을 조절하기 위한 조성물
JP2016521622A JP6679476B2 (ja) 2013-10-11 2014-10-11 C9orf72発現を調節するための組成物
MX2016004651A MX2016004651A (es) 2013-10-11 2014-10-11 Composiciones para modular la expresion de c9orf72.
CA2926408A CA2926408A1 (en) 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression
SG11201602597YA SG11201602597YA (en) 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression
AU2014331652A AU2014331652B2 (en) 2013-10-11 2014-10-11 Compositions for modulating C9ORF72 expression
CN201480054676.7A CN105637090B (zh) 2013-10-11 2014-10-11 用于调节c9orf72表达的组合物
EP14852924.1A EP3055414A4 (en) 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression
EP22197003.1A EP4166667A3 (en) 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression
RU2016116849A RU2748426C2 (ru) 2013-10-11 2014-10-11 Композиции для модуляции экспрессии c90rf72
MYPI2016701280A MY192689A (en) 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression
BR112016007751A BR112016007751A2 (pt) 2013-10-11 2014-10-11 composições para modulação de expressão de c9orf72
IL244759A IL244759A0 (en) 2013-10-11 2016-03-27 Preparations for modulation of c9orf72 expression
PH12016500603A PH12016500603A1 (en) 2013-10-11 2016-04-04 Compositions for modulating c9orf72 expression
US16/248,612 US11339393B2 (en) 2013-10-11 2019-01-15 Compositions for modulating C9ORF72 expression
AU2020220099A AU2020220099A1 (en) 2013-10-11 2020-08-19 Compositions for modulating c9orf72 expression
US17/721,765 US20230112920A1 (en) 2013-10-11 2022-04-15 Compositions for Modulating C9ORF72 Expression

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US201361890108P 2013-10-11 2013-10-11
US61/890,108 2013-10-11
US201361891313P 2013-10-15 2013-10-15
US61/891,313 2013-10-15
US201361919540P 2013-12-20 2013-12-20
US61/919,540 2013-12-20
US201461927903P 2014-01-15 2014-01-15
US61/927,903 2014-01-15
US201461980502P 2014-04-16 2014-04-16
US61/980,502 2014-04-16

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US15/028,626 A-371-Of-International US10221414B2 (en) 2013-10-11 2014-10-11 Compositions for modulating C9ORF72 expression
US16/248,612 Division US11339393B2 (en) 2013-10-11 2019-01-15 Compositions for modulating C9ORF72 expression
US16/248,612 Continuation US11339393B2 (en) 2013-10-11 2019-01-15 Compositions for modulating C9ORF72 expression

Publications (2)

Publication Number Publication Date
WO2015054676A2 true WO2015054676A2 (en) 2015-04-16
WO2015054676A3 WO2015054676A3 (en) 2015-06-04

Family

ID=52813758

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/060194 Ceased WO2015054676A2 (en) 2013-10-11 2014-10-11 Compositions for modulating c9orf72 expression

Country Status (16)

Country Link
US (3) US10221414B2 (https=)
EP (2) EP4166667A3 (https=)
JP (2) JP6679476B2 (https=)
KR (1) KR20160062069A (https=)
CN (2) CN112080502A (https=)
AU (2) AU2014331652B2 (https=)
BR (1) BR112016007751A2 (https=)
CA (1) CA2926408A1 (https=)
CL (3) CL2016000839A1 (https=)
IL (1) IL244759A0 (https=)
MX (2) MX2016004651A (https=)
MY (1) MY192689A (https=)
PH (1) PH12016500603A1 (https=)
RU (1) RU2748426C2 (https=)
SG (2) SG10201808903UA (https=)
WO (1) WO2015054676A2 (https=)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105663129A (zh) * 2015-12-29 2016-06-15 山东大学 用于治疗肌萎缩侧索硬化和额颞叶痴呆的化合物与应用
WO2016168592A3 (en) * 2015-04-16 2016-11-24 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
WO2017180835A1 (en) 2016-04-13 2017-10-19 Ionis Pharmaceuticals, Inc. Methods for reducing c9orf72 expression
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US20190231808A1 (en) * 2017-11-10 2019-08-01 University Of Massachusetts Compositions and methods for the treatment of expanded repeat-associated disorders
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10443052B2 (en) 2012-10-15 2019-10-15 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10577604B2 (en) 2012-10-15 2020-03-03 Ionis Pharmaceuticals, Inc. Methods for monitoring C9ORF72 expression
WO2020117772A1 (en) 2018-12-06 2020-06-11 Biogen Ma Inc. Neurofilament protein for guiding therapeutic intervention in amyotrophic lateral sclerosis
WO2020205605A3 (en) * 2019-03-29 2020-11-12 University Of Massachusetts OLIGONUCLEOTIDE-BASED MODULATION OF C9orf72
JP2020534253A (ja) * 2017-08-08 2020-11-26 ウェーブ ライフ サイエンシーズ リミテッド オリゴヌクレオチド組成物及びその方法
EP3750907A3 (en) * 2014-03-18 2021-04-28 University of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
WO2021205005A3 (en) * 2020-04-09 2021-11-18 Association Institut De Myologie Antisense sequences for treating amyotrophic lateral sclerosis
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
EP3701030A4 (en) * 2017-10-23 2022-04-20 Prevail Therapeutics, Inc. GENE THERAPIES FOR NEURODEGENERATIVE DISEASES
US11312962B2 (en) 2015-07-10 2022-04-26 Ionis Pharmaceuticals, Inc. Modulators of diacyglycerol acyltransferase 2 (DGAT2)
US11359197B2 (en) 2018-01-12 2022-06-14 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11629347B2 (en) 2019-05-06 2023-04-18 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods
US11739330B2 (en) 2017-09-22 2023-08-29 University Of Massachusetts SOD1 dual expression vectors and uses thereof
US11859179B2 (en) 2017-05-09 2024-01-02 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)
EP4110924A4 (en) * 2020-02-28 2024-03-13 Ionis Pharmaceuticals, Inc. COMPOUNDS AND METHODS FOR MODULATING PRE-MRNA SPLICEING
US12241065B2 (en) 2018-01-12 2025-03-04 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
EP4125930A4 (en) * 2020-03-27 2025-06-04 University Of Massachusetts Dual-acting siRNA-based modulation of C9ORF72
US12384814B2 (en) 2020-07-28 2025-08-12 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing app expression

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
JP7511563B2 (ja) * 2018-09-10 2024-07-05 アイオーニス ファーマシューティカルズ, インコーポレーテッド Cln3の発現を調節するための化合物及び方法
CN113227116A (zh) * 2018-10-01 2021-08-06 联脑科学公司 针对源自c9orf72二肽重复蛋白的肽免疫原构建体
UY38562A (es) * 2019-01-29 2020-08-31 Ionis Pharmaceuticals Inc Compuestos y métodos para reducir la expresión de app
EP4073251A1 (en) * 2019-12-13 2022-10-19 Alnylam Pharmaceuticals, Inc. Human chromosome 9 open reading frame 72 (c9orf72) irna agent compositions and methods of use thereof
WO2021159008A2 (en) 2020-02-07 2021-08-12 Maze Therapeutics, Inc. Compositions and methods for treating neurodegenerative diseases
AU2022255175A1 (en) 2021-04-06 2023-11-23 Trace Neuroscience, Inc. Compositions and methods for treating tdp-43 proteinopathy
AU2023356317A1 (en) 2022-10-05 2025-05-15 Trace Neuroscience, Inc. Unc13a antisense oligonucleotides and uses thereof
WO2025107038A1 (en) * 2023-11-23 2025-05-30 Murdoch University Method of treating motor neurone disease

Family Cites Families (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
KR940703846A (ko) * 1991-12-24 1994-12-12 비. 린네 파샬 갭(gap)이 형성된 2′ 변성된 올리고뉴클레오티드(gapped 2′ modifed oligonucleotides)
EP0673559A1 (en) 1992-12-14 1995-09-27 Honeywell Inc. Motor system with individually controlled redundant windings
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5681940A (en) 1994-11-02 1997-10-28 Icn Pharmaceuticals Sugar modified nucleosides and oligonucleotides
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
AU9063398A (en) 1997-09-12 1999-04-05 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
EP1178999B1 (en) 1999-05-04 2007-03-14 Santaris Pharma A/S L-ribo-lna analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
DE19935303A1 (de) * 1999-07-28 2001-02-08 Aventis Pharma Gmbh Oligonukleotide zur Inhibierung der Expression von humanem eg5
USH2191H1 (en) 2000-10-24 2007-06-05 Snp Consortium Identification and mapping of single nucleotide polymorphisms in the human genome
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
JP2005504020A (ja) 2001-07-03 2005-02-10 アイシス・ファーマシューティカルス・インコーポレーテッド ヌクレアーゼ耐性キメラオリゴヌクレオチド
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
CA2504694C (en) 2002-11-05 2013-10-01 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
EP2305812A3 (en) 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
US7790867B2 (en) 2002-12-05 2010-09-07 Rosetta Genomics Inc. Vaccinia virus-related nucleic acids and microRNA
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
WO2005027962A1 (en) 2003-09-18 2005-03-31 Isis Pharmaceuticals, Inc. 4’-thionucleosides and oligomeric compounds
US20050261233A1 (en) 2004-04-21 2005-11-24 Sanjay Bhanot Modulation of glucose-6-phosphatase translocase expression
EP1752536A4 (en) 2004-05-11 2008-04-16 Alphagen Co Ltd POLYNUCLEOTIDE CAUSING RNA INTERFERENCE AND METHOD OF REGULATING GENE EXPRESSION WITH THE USE OF THE SAME
EP1766052A4 (en) 2004-06-03 2009-12-16 Isis Pharmaceuticals Inc OLIGOMERIC CHIMERIC COMPOSITIONS WITH BRECH
US20090291437A1 (en) 2005-11-02 2009-11-26 O'brien Sean Methods for targeting quadruplex sequences
PT2161038E (pt) 2006-01-26 2014-03-10 Isis Pharmaceuticals Inc Composições e suas utilizações dirigidas à huntingtina
JP5342881B2 (ja) 2006-01-27 2013-11-13 アイシス ファーマシューティカルズ, インコーポレーテッド 6−修飾された二環式核酸類似体
EP2023940B1 (en) * 2006-05-05 2011-06-22 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression of sglt2
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
ES2603379T3 (es) * 2006-10-09 2017-02-27 Roche Innovation Center Copenhagen A/S Compuestos antagonistas de ARN para la modulación de PCSK9
AU2007334502B2 (en) 2006-12-14 2011-12-15 Novartis Ag Compositions and methods to treat muscular & cardiovascular disorders
US20100190837A1 (en) 2007-02-15 2010-07-29 Isis Pharmaceuticals, Inc. 5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
ATE462787T1 (de) 2007-06-18 2010-04-15 Commissariat Energie Atomique Reversibles sirna-silencing eines mutierten und endogenen huntington-wildtypgens und dessen anwendung zur behandlung von morbus huntington
CA2692579C (en) 2007-07-05 2016-05-03 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
US20090123928A1 (en) 2007-10-11 2009-05-14 The Johns Hopkins University Genomic Landscapes of Human Breast and Colorectal Cancers
WO2009060124A2 (en) 2007-11-05 2009-05-14 Baltic Technology Development, Ltd. Use of oligonucleotides with modified bases in hybridization of nucleic acids
US8546556B2 (en) 2007-11-21 2013-10-01 Isis Pharmaceuticals, Inc Carbocyclic alpha-L-bicyclic nucleic acid analogs
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
WO2010019270A1 (en) 2008-08-14 2010-02-18 Isis Pharmaceuticals, Inc. Modulation of prion expression
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
WO2010120820A1 (en) 2009-04-13 2010-10-21 Isis Pharmaceuticals, Inc. Compositions and methods for modulation of smn2 splicing
NZ597504A (en) 2009-06-15 2013-10-25 Alnylam Pharmaceuticals Inc Lipid formulated dsrna targeting the pcsk9 gene
EP2451476A4 (en) 2009-07-06 2013-07-03 Alnylam Pharmaceuticals Inc BIOTRAITEMENT BASED ON CELLS
US8927513B2 (en) 2009-07-07 2015-01-06 Alnylam Pharmaceuticals, Inc. 5′ phosphate mimics
EP2462153B1 (en) 2009-08-06 2015-07-29 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
WO2011135396A1 (en) 2010-04-30 2011-11-03 Cellectis Method for modulating double-strand break-induced homologous recombination
WO2011156673A2 (en) * 2010-06-10 2011-12-15 Isis Pharmaceuticals, Inc. Modulation of phosphoenolpyruvate carboxykinase-mitochondrial (pepck-m) expression
WO2012005898A2 (en) 2010-06-15 2012-01-12 Alnylam Pharmaceuticals, Inc. Chinese hamster ovary (cho) cell transcriptome, corresponding sirnas and uses thereof
WO2012012467A2 (en) 2010-07-19 2012-01-26 Isis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
DK2655621T3 (en) 2010-12-20 2018-08-13 Massachusetts Gen Hospital Polycomb-associated non-coding RNAS
US20140050778A1 (en) 2010-12-28 2014-02-20 University Of Rochester Nucleic acid binding compounds, methods of making, and use thereof
JP5943993B2 (ja) 2011-04-01 2016-07-05 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. 転写のシグナル伝達及び活性化因子3(stat3)発現の調節
PH12019502377A1 (en) 2011-04-21 2022-11-14 Isis Pharmaceuticals Inc Modulation of hepatitis b virus (hbv) expression
EP2751284B1 (en) * 2011-08-31 2017-01-11 The University Of Manchester Method for diagnosing a neurodegenerative disease.
WO2013036833A1 (en) 2011-09-09 2013-03-14 Mayo Foundation For Medical Education And Research Detecting frontotemporal dementia and amyotrophic lateral sclerosis
JP2014533508A (ja) * 2011-11-17 2014-12-15 リーアニクス・インコーポレイテッドRheonix, Inc. 選択的分子分析のためのシステムおよび方法
US10066228B2 (en) 2011-11-30 2018-09-04 Sarepta Therapeutics, Inc. Oligonucleotides for treating expanded repeat diseases
US9725716B2 (en) * 2011-12-06 2017-08-08 Ohio State Innovation Foundation and Research Institute at Nationwide Children's Hospital Non-ionic, low osmolar contrast agents for delivery of antisense oligonucleotides and treatment of disease
SMT201700339T1 (it) 2012-04-23 2017-09-07 Biomarin Tech Bv Oligonucleotidi di modulazione dell'rna con caratteristiche migliorate per il trattamento dei disturbi neuromuscolari
AU2013262709A1 (en) 2012-05-16 2015-01-22 Rana Therapeutics, Inc. Compositions and methods for modulating MECP2 expression
ES2762326T5 (es) 2012-10-15 2023-04-27 Ionis Pharmaceuticals Inc Métodos para modular la expresión de C9ORF72
HK1212597A1 (zh) * 2012-10-15 2016-06-17 Isis Pharmaceuticals, Inc. 用於調節c90rf72表達的組合物
WO2014062736A1 (en) 2012-10-15 2014-04-24 Isis Pharmaceuticals, Inc. Methods for monitoring c9orf72 expression
PT2948777T (pt) 2013-01-22 2019-09-26 Deutsches Zentrum Fuer Neurodegenerative Erkrankungen E V Proteínas de repetição por dipeptídeos como alvo terapêutico em doenças neurodegenerativas com expansão de hexanucleotídico repetido
EP4166667A3 (en) * 2013-10-11 2023-08-02 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
WO2016024205A1 (en) 2014-08-15 2016-02-18 Pfizer Inc. Oligomers targeting hexanucleotide repeat expansion in human c9orf72 gene
KR20230104759A (ko) 2014-09-30 2023-07-10 뉴리뮨 홀딩 아게 인간-유래의 항-디펩티드 반복체(dpr) 항체
WO2016060919A1 (en) 2014-10-14 2016-04-21 The Board Of Regents Of The University Of Texas System Allele selective inhibition of mutant c9orf72 foci expression by duplex rnas targeting the expanded hexanucleotide repeat
RS60230B1 (sr) 2015-04-16 2020-06-30 Ionis Pharmaceuticals Inc Kompozicije za moduliranje ekspresije c9orf72
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
SG10201510101XA (en) 2015-12-09 2017-07-28 Au Optronics Corp Evaporation apparatus and evaporation method
AU2017248637A1 (en) 2016-04-13 2018-09-27 Ionis Pharmaceuticals, Inc. Methods for reducing C9ORF72 expression
JP7026678B2 (ja) 2016-09-30 2022-02-28 リジェネロン・ファーマシューティカルズ・インコーポレイテッド C9orf72座位中にヘキサヌクレオチドリピート伸長を有する非ヒト動物

Cited By (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US12600970B2 (en) 2012-10-15 2026-04-14 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10577604B2 (en) 2012-10-15 2020-03-03 Ionis Pharmaceuticals, Inc. Methods for monitoring C9ORF72 expression
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
US10443052B2 (en) 2012-10-15 2019-10-15 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US11339393B2 (en) 2013-10-11 2022-05-24 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
AU2020260765B2 (en) * 2014-03-18 2022-12-01 University Of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
EP3750907A3 (en) * 2014-03-18 2021-04-28 University of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
US11760999B2 (en) 2014-03-18 2023-09-19 University Of Massachusetts RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
AU2016249002B2 (en) * 2015-04-16 2019-07-18 Ionis Pharmaceuticals, Inc. Compositions for modulating C90RF72 expression
US10138482B2 (en) * 2015-04-16 2018-11-27 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
KR20200043513A (ko) * 2015-04-16 2020-04-27 아이오니스 파마수티컬즈, 인코포레이티드 C9orf72 발현을 조절하기 위한 조성물
US9605263B2 (en) * 2015-04-16 2017-03-28 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
EP3722424A1 (en) * 2015-04-16 2020-10-14 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
WO2016168592A3 (en) * 2015-04-16 2016-11-24 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
AU2019250156B2 (en) * 2015-04-16 2021-11-25 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
US12215321B2 (en) 2015-07-10 2025-02-04 Ionis Pharmaceuticals, Inc. Modulators of diacyglycerol acyltransferase 2 (DGAT2)
US11312962B2 (en) 2015-07-10 2022-04-26 Ionis Pharmaceuticals, Inc. Modulators of diacyglycerol acyltransferase 2 (DGAT2)
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
CN105663129A (zh) * 2015-12-29 2016-06-15 山东大学 用于治疗肌萎缩侧索硬化和额颞叶痴呆的化合物与应用
WO2017180835A1 (en) 2016-04-13 2017-10-19 Ionis Pharmaceuticals, Inc. Methods for reducing c9orf72 expression
EP3443094A4 (en) * 2016-04-13 2019-12-11 Ionis Pharmaceuticals, Inc. PROCESS FOR REDUCING C9ORF72 EXPRESSION
US11859179B2 (en) 2017-05-09 2024-01-02 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)
US12529051B2 (en) 2017-05-09 2026-01-20 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)
US11739325B2 (en) 2017-08-08 2023-08-29 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
JP2020534253A (ja) * 2017-08-08 2020-11-26 ウェーブ ライフ サイエンシーズ リミテッド オリゴヌクレオチド組成物及びその方法
EP3664816A4 (en) * 2017-08-08 2021-05-19 Wave Life Sciences Ltd. OLIGONUCLEOTIDE COMPOSITIONS AND RELATED PROCESSES
US11739330B2 (en) 2017-09-22 2023-08-29 University Of Massachusetts SOD1 dual expression vectors and uses thereof
US12312587B2 (en) 2017-09-22 2025-05-27 University Of Massachusetts SOD1 dual expression vectors and uses thereof
EP3701030A4 (en) * 2017-10-23 2022-04-20 Prevail Therapeutics, Inc. GENE THERAPIES FOR NEURODEGENERATIVE DISEASES
US10905707B2 (en) * 2017-11-10 2021-02-02 University Of Massachusetts Compositions and methods for the treatment of expanded repeat-associated disorders
US12161658B2 (en) * 2017-11-10 2024-12-10 University Of Massachusetts Compositions and methods for the treatment of expanded repeat-associated disorders
US20190231808A1 (en) * 2017-11-10 2019-08-01 University Of Massachusetts Compositions and methods for the treatment of expanded repeat-associated disorders
US20210236534A1 (en) * 2017-11-10 2021-08-05 University Of Massachusetts Compositions and methods for the treatment of expanded repeat-associated disorders
US12180478B2 (en) 2018-01-12 2024-12-31 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11447775B2 (en) 2018-01-12 2022-09-20 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11359197B2 (en) 2018-01-12 2022-06-14 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US12241065B2 (en) 2018-01-12 2025-03-04 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
WO2020117772A1 (en) 2018-12-06 2020-06-11 Biogen Ma Inc. Neurofilament protein for guiding therapeutic intervention in amyotrophic lateral sclerosis
WO2020205605A3 (en) * 2019-03-29 2020-11-12 University Of Massachusetts OLIGONUCLEOTIDE-BASED MODULATION OF C9orf72
JP2022528487A (ja) * 2019-03-29 2022-06-13 ユニバーシティ・オブ・マサチューセッツ C9orf72のオリゴヌクレオチドベースの調節
US12378554B2 (en) 2019-05-06 2025-08-05 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods
EP3966328A4 (en) * 2019-05-06 2023-10-18 University Of Massachusetts Anti-c9orf72 oligonucleotides and related methods
US11629347B2 (en) 2019-05-06 2023-04-18 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods
EP4110924A4 (en) * 2020-02-28 2024-03-13 Ionis Pharmaceuticals, Inc. COMPOUNDS AND METHODS FOR MODULATING PRE-MRNA SPLICEING
US12344839B2 (en) 2020-03-27 2025-07-01 University Of Massachusetts Dual-acting siRNA based modulation of C9orf72
EP4125930A4 (en) * 2020-03-27 2025-06-04 University Of Massachusetts Dual-acting siRNA-based modulation of C9ORF72
CN115516093A (zh) * 2020-04-09 2022-12-23 肌肉学研究协会 用于治疗肌萎缩侧索硬化症的反义序列
WO2021205005A3 (en) * 2020-04-09 2021-11-18 Association Institut De Myologie Antisense sequences for treating amyotrophic lateral sclerosis
US12384814B2 (en) 2020-07-28 2025-08-12 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing app expression

Also Published As

Publication number Publication date
AU2020220099A1 (en) 2020-09-03
CL2020003121A1 (es) 2021-06-25
MX2016004651A (es) 2016-08-05
PH12016500603A1 (en) 2016-06-13
BR112016007751A2 (pt) 2017-09-12
CN105637090A (zh) 2016-06-01
JP6679476B2 (ja) 2020-04-15
MX2018010676A (es) 2020-09-02
EP3055414A2 (en) 2016-08-17
MY192689A (en) 2022-09-01
US20160251655A1 (en) 2016-09-01
CL2016000839A1 (es) 2016-12-30
WO2015054676A3 (en) 2015-06-04
JP2020115865A (ja) 2020-08-06
CA2926408A1 (en) 2015-04-16
RU2016116849A (ru) 2017-11-16
US11339393B2 (en) 2022-05-24
US20230112920A1 (en) 2023-04-13
US10221414B2 (en) 2019-03-05
EP3055414A4 (en) 2017-07-19
AU2014331652A1 (en) 2016-04-21
US20190367916A1 (en) 2019-12-05
EP4166667A2 (en) 2023-04-19
RU2748426C2 (ru) 2021-05-25
SG11201602597YA (en) 2016-05-30
AU2014331652B2 (en) 2020-05-21
KR20160062069A (ko) 2016-06-01
CN105637090B (zh) 2020-10-16
CN112080502A (zh) 2020-12-15
SG10201808903UA (en) 2018-11-29
CL2018001753A1 (es) 2018-10-19
EP4166667A3 (en) 2023-08-02
IL244759A0 (en) 2016-04-21
JP2016533717A (ja) 2016-11-04

Similar Documents

Publication Publication Date Title
US12600970B2 (en) Compositions for modulating C9ORF72 expression
US11339393B2 (en) Compositions for modulating C9ORF72 expression
EP2906696B1 (en) Methods for modulating c9orf72 expression
EP3283080B1 (en) Compositions for modulating c9orf72 expression
EP3058068B1 (en) Compositions for modulating expression of c9orf72 antisense transcript
EP3058069B1 (en) Methods for modulating expression of c9orf72 antisense transcript
US11193128B2 (en) Compositions for modulating expression of C9ORF72 antisense transcript
WO2016167780A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
WO2016112132A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
AU2015240761A1 (en) Compositions for modulating SOD-1 expression
WO2016141145A1 (en) Methods for modulating mecp2 expression
HK40039446A (en) Compositions for modulating c9orf72 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14852924

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 244759

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 12016500603

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2926408

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016521622

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15028626

Country of ref document: US

Ref document number: MX/A/2016/004651

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: NC2018/0012057

Country of ref document: CO

Ref document number: 16092933

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016007751

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2014331652

Country of ref document: AU

Date of ref document: 20141011

Kind code of ref document: A

Ref document number: 20167010455

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016116849

Country of ref document: RU

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014852924

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: IDP00201603132

Country of ref document: ID

Ref document number: 2014852924

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14852924

Country of ref document: EP

Kind code of ref document: A2

WWP Wipo information: published in national office

Ref document number: NC2018/0012057

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112016007751

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160407

WWG Wipo information: grant in national office

Ref document number: NC2018/0012057

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 521422062

Country of ref document: SA

Ref document number: 516370914

Country of ref document: SA

WWW Wipo information: withdrawn in national office

Ref document number: NC2018/0012057

Country of ref document: CO