US20090291437A1 - Methods for targeting quadruplex sequences - Google Patents

Methods for targeting quadruplex sequences Download PDF

Info

Publication number
US20090291437A1
US20090291437A1 US12/092,557 US9255706A US2009291437A1 US 20090291437 A1 US20090291437 A1 US 20090291437A1 US 9255706 A US9255706 A US 9255706A US 2009291437 A1 US2009291437 A1 US 2009291437A1
Authority
US
United States
Prior art keywords
nucleic acid
nucleotide sequence
method
molecule
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/092,557
Inventor
Sean O'Brien
Adam Siddiqui-Jain
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cylene Pharmaceuticals
Original Assignee
Cylene Pharmaceuticals
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US73253105P priority Critical
Priority to US73568605P priority
Application filed by Cylene Pharmaceuticals filed Critical Cylene Pharmaceuticals
Priority to PCT/US2006/042906 priority patent/WO2007056113A2/en
Priority to US12/092,557 priority patent/US20090291437A1/en
Assigned to CYLENE PHARMACEUTICALS, INC. reassignment CYLENE PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: O'BRIEN, SEAN, SIDDIQUI-JAIN, ADAM
Publication of US20090291437A1 publication Critical patent/US20090291437A1/en
Application status is Abandoned legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Abstract

Provided are quadruplex nucleotide sequences and methods for identifying interacting molecules.

Description

    FIELD OF THE INVENTION
  • The invention relates to quadruplex nucleotide sequences and methods for identifying interacting molecules.
  • BACKGROUND
  • Developments in molecular biology have led to an understanding of how certain therapeutic compounds interact with molecular targets and lead to a modified physiological condition. Specificity of therapeutic compounds for their targets is derived in part from interactions between complementary structural elements in the target molecule and the therapeutic compound. A greater variety of target structural elements in the target leads to the possibility of unique and specific target/compound interactions. Because polypeptides are structurally diverse, researchers have focused on this class of targets for the design of specific therapeutic molecules.
  • In addition to therapeutic compounds that target polypeptides, researchers also have identified compounds that target DNA. Some of these compounds are effective anticancer agents and have led to significant increases in the survival of cancer patients. Unfortunately, however, these DNA targeting compounds do not act specifically on cancer cells and therefore are extremely toxic. Their unspecific action may be due to the fact that DNA often requires the uniformity of Watson-Crick duplex structures for compactly storing information within the human genome. This uniformity of DNA structure does not offer a structurally diverse population of DNA molecules that can be specifically targeted.
  • Nevertheless, there are some exceptions to this structural uniformity, as certain DNA sequences can form unique secondary structures. For example, intermittent runs of guanines can form G quadruplex structures, and complementary runs of cytosines can form i motif structures. Formation of G quadruplex and i-motif structures occurs when a particular region of duplex DNA transitions from Watson-Crick base pairing to intermolecular and intramolecular single-stranded structures.
  • SUMMARY
  • Provided are isolated nucleic acids containing a nucleotide sequence that can comprise (a) a C-rich or G-rich sequence from human genomic DNA, (b) a complement of (a), (c) an encoded RNA nucleotide sequence of (a), (d) an encoded RNA nucleotide sequence of (b), or substantially identical variant nucleotide sequence of the foregoing. In certain embodiments, the nucleotide sequence comprises (a) one or more nucleotide sequences of Table A, (b) a complementary nucleotide sequence of (a), (c) an RNA nucleotide sequence encoded by (a), (d) an RNA nucleotide sequence encoded by (b), or (e) a substantially identical variant nucleotide sequence of the foregoing. The nucleotide sequence may conform to the motif ((G3+)N1-7)3G3+ or ((C3+)N1-7)3C3+, where “3+” is three or more nucleotides, C is cytosine, G is guanine and N is any nucleotide. The nucleotide sequence in some embodiments is in or near a region of DNA transcribed into RNA in a polymerase II-directed process. In polymerase II-directed processes, DNA generally is transcribed into a nascent RNA (“pre-RNA”), and the nascent RNA is processed into messenger RNA (“mRNA”). In some embodiments, the nucleotide sequence is in or near a region of DNA that is replicated (e.g., telomere DNA). A nucleotide sequence often is capable of adopting a quadruplex structure (described in greater detail hereafter). In certain embodiments, the nucleotide sequence is a G-rich or C-rich sequence in or near one of the following genes or regions: c-myc, MAX, c-myb, Vav, HIF-1a, Hmga2, PDGFA, PDGFB/c-sis, Her2-neu, EGFr, VEGF, TGF-B3, c-abl, c-src, RET, Bcl-2, MCL-1, Cyclin D1/Bcl-1, Cyclin A1, Ha-ras, DHFR & MRP 1, SPARC, Telomere, Insulin promoter, Cystatin B Promoter, FMR1 promoter, K-Ras, c-Kit and MAZ.
  • Also provided herein is a method for identifying a molecule that binds to a nucleic acid, which comprises contacting a nucleic acid described above; and detecting the amount of the compound bound or not bound to the nucleic acid, whereby the test molecule is identified as a molecule that binds to the nucleic acid containing the human nucleotide sequence when less of the compound binds to the nucleic acid in the presence of the test molecule than in the absence of the test molecule. The compound sometimes is in association with a detectable label, and is radiolabled in some embodiments. The compound is a quinolone or a porphyrin in certain embodiments. The nucleic acid sometimes is in association with a solid phase in certain embodiments. The test molecule is a quinolone derivative in certain embodiments, and the quinolone derivative sometimes is a compound of Tables 1A-1C, Table 2, Table 3 or Table 4. The nucleotide sequence sometimes is a DNA nucleotide sequence, at times is a RNA nucleotide sequence, and sometimes the nucleic acid comprises one or more nucleotide analogs or derivatives.
  • Provided also is a method for identifying a molecule that causes displacement of a protein from a nucleic acid, which comprises contacting a nucleic acid described above and a protein with a test molecule; and detecting the amount of the nucleic acid bound or not bound to the protein, whereby the test molecule is identified as a molecule that causes protein displacement when less of the nucleic acid binds to the protein in the presence of the test molecule than in the absence of the test molecule. In certain embodiments the protein is in association with a detectable label or is in association with a solid phase. The nucleic acid sometimes is in association with a detectable label or sometimes is in association with a solid phase in certain embodiments. The test molecule is a quinolone derivative in certain embodiments, and the quinolone derivative sometimes is a compound of Tables 1A-1C, Table 2, Table 3 or Table 4. The nucleotide sequence sometimes is a DNA nucleotide sequence, at times is a RNA nucleotide sequence, and sometimes the nucleic acid comprises one or more nucleotide analogs or derivatives.
  • Also provided is a method of identifying a modulator of nucleic acid synthesis, which comprises contacting a template nucleic acid, a primer oligonucleotide having a nucleotide sequence complementary to a template nucleic acid nucleotide sequence, extension nucleotides, a polymerase and a test molecule under conditions that allow the primer oligonucleotide to hybridize to the template nucleic acid, wherein the template nucleic acid comprises a nucleotide sequence described above; and detecting the presence, absence or amount of an elongated primer product synthesized by extension of the primer nucleic acid, whereby the test molecule is identified as a modulator of nucleic acid synthesis when a different amount of an elongated primer product is synthesized in the presence of the test molecule than in the absence of the test molecule. The template nucleic acid sometimes is DNA and is RNA in certain embodiments. In some embodiments, the polymerase is a DNA polymerase, and sometimes is an RNA polymerase.
  • DETAILED DESCRIPTION
  • Nucleic acids, compounds and related methods described herein are useful in a variety of applications. For example, the nucleotide sequences described herein can serve as targets for screening interacting molecules (e.g., in screening assays). The interacting molecules may be utilized as novel therapeutics or for the discovery of novel therapeutics. Nucleic acid interacting molecules can serve as tools for identifying other target nucleotide sequences (e.g., target screening assays) or other interacting molecules (e.g., competition screening assays). The nucleotide sequences or complementary sequences thereof also can be utilized as aptamers or serve as basis for generating aptamers. The aptamers can be utilized as therapeutics or in assays for identifying novel interacting molecules.
  • Nucleic Acids
  • Provided are isolated nucleic acids containing a nucleotide sequence that can comprise (a) a C-rich or G-rich sequence from human genomic DNA, (b) a complement of (a), (c) an encoded RNA nucleotide sequence of (a), (d) an encoded RNA nucleotide sequence of (b), or substantially identical variant thereof. In certain embodiments, the nucleotide sequence comprises (a) one or more nucleotide sequences of Table A, (b) a complementary nucleotide sequence of (a), (c) an RNA nucleotide sequence encoded by (a), (d) an RNA nucleotide sequence encoded by (b), or (e) a substantially identical variant nucleotide sequence of the foregoing. The nucleotide sequence may conform to the motif ((G3+)N1-7)3G3+ or ((C3+)N1-7)3C3+, where “3+” is three or more nucleotides, C is cytosine, G is guanine and N is any nucleotide. The nucleotide sequence in some embodiments is in or near a region of DNA transcribed into RNA in a polymerase II-directed process. In polymerase II-directed processes, DNA generally is transcribed into a nascent RNA (“pre-RNA”), and the nascent RNA is processed into messenger RNA (“mRNA”). In some embodiments, the nucleotide sequence is in or near a region of DNA that is replicated (e.g., telomere DNA). A nucleotide sequence often is capable of adopting a quadruplex structure (described in greater detail hereafter). In certain embodiments, the nucleotide sequence is a G-rich or C-rich sequence in or near one of the following genes or regions: c-myc, MAX, c-myb, Vav, HIF-1a, Hmga2, PDGFA, PDGFB/c-sis, Her2-neu, EGFr, VEGF, TGF-B3, c-abl, c-src, RET, Bcl-2, MCL-1, Cyclin D1/Bcl-1, Cyclin A1, Ha-ras, DHFR & MRP1, SPARC, Telomere, Insulin promoter, Cystatin B Promoter, FMR1 promoter, K-Ras, c-Kit and MAZ.
  • In Table A, certain sequences are repeated, and the number of repeats for certain sequences are designated by n or m. For certain sequences designated n times, n is three (3) or more, such as 3 to 500, 3 to 100, 3 to 10, 3 to 8, 3 to 7, 3 to 6, 3 to 5 or 3 to 4 times, for example. For certain sequences repeated m times, m is two (2) or more, such as 2 to 500, 2 to 100, 2 to 10, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4 or 2 to 3 times, for example.
  • TABLE A
    c-myc TGGGGAGGGTGGGGAGGGTGGGGAAGG
    c-myc CCTTCCCCACCCTCCCCACCCTCCCCA
    MAX CGGCGGCGGGGAGGGGAAGGGGTGAAGGGGAGGGGGA
    MAX TCCCCCTCCCCTTCACCCCTTCCCCTCCCCGCCGCCG
    c-myb AGAGGAGGAGGAGGACACGGAGGAGGAGGAGAAGGAGGAGGAGGAA
    c-myb TTCCTCCTCCTCCTTCTCCTCCTCCTCCGTGTCCTCCTCCTCCTCT
    Vav TGGAGGAGGAGGAG
    Vav CTCCTCCTCCTCCA
    HIF-1a GCGCGGGGAGGGGAGAGGGGGCGGGAGCGCG
    HIF-1a CGCGCTCCCGCCCCCTCTCCCCTCCCCGCGC
    Hmga2 AGAGAAGAGGGGAGGAGGAGGAGGAGAGGAGGAGGCGC
    Hmga2 GCGCCTCCTCCTCTCCTCCTCCTCCTCCCCTCTTCTCT
    PDGFA GGGGGGGCGGGGGCGGGGGCGGGGGAGGGGC
    PDGFA GCCCCTCCCCCGCCCCCGCCCCCGCCCCCCC
    PDGFB/c-sis GGGGGGGGACGCGGGAGCTGGGGGAGGGCTTGGGGCCAGGGCGGG
    GCGCTTAGGGGG
    PDGFB/c-sis CCCCCTAAGCGCCCCGCCCTGGCCCCAAGCCCTCCCCCAGCTCCC
    GCGTCCCCCCCC
    Her2-neu AGGAGAAGGAGGAGGTGGAGGAGGAGG
    Her2-neu CCTCCTCCTCCACCTCCTCCTTCTCCT
    EGFr AGGAGGAGGAGAATGCGAGGAGGAGGGAGGAGA
    EGFr TCTCCTCCCTCCTCCTCGCATTCTCCTCCTCCT
    VEGF GGGGCGGGCCGGGGGCGGGGTCCCGGCGGGGCGGAG
    VEGF CTCCGCCCCGCCGGGACCCCGCCCCCGGCCCGCCCC
    TGF-B3 GGGGTGGGGGAGGGAGGGA
    TGF-B3 TCCCTCCCTCCCCCACCCC
    c-ab1 AGGAAGGGGAGGGCCGGGGGGAGGTGGC
    c-ab1 GCCACCTCCCCCCGGCCCTCCCCTTCCT
    c-src CGGGAGGAGGAGGAAGGAGGAAGCGCG
    c-src CGCGCTTCCTCCTTCCTCCTCCTCCCG
    RET AGGGGCGGGGCGGGGCGGGGGC
    RET GCCCCCGCCCCGCCCCGCCCCT
    Bcl-2 AGGGGCGGGCGCGGGAGGAAGGGGGCGGGAGCGGGGCTG
    Bcl-2 CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCCCT
    MCL-1 CCGGCCGGGCCGGGGCGGGGCCGGGGCCGGGGCCGGGGC
    MCL-1 GCCCCGGCCCCGGCCCCGGCCCCGCCCCGGCCCGGCCGG
    Cyclin D1/Bcl-1 GGGGGGCGGGGGCGGGCGCAGGGGGAGGGGGC
    Cyclin D1/Bcl-1 GCCCCCTCCCCCTGCGCCCGCCCCCGCCCCCC
    Cyclin A1 TGGGGCGGGGCAGGGCGGGGCAGGGT
    Cyclin A1 ACCCTGCCCCGCCCTGCCCCGCCCCA
    Ha-ras CGGGGCGGGGCGGGGGCGGGGGC
    Ha-ras GCCCCCGCCCCCGCCCCGCCCCG
    DHFR & MRP1 CGGGGCGGGGGGGCGGGGC
    DHFR & MRP1 GCCCCGCCCCCCCGCCCCG
    SPARC GGAGGAGGAGGAGGAGGAGGAGGA
    SPARC TCCTCCTCCTCCTCCTCCTCCTCC
    Telomere (GGGTTA)n
    Telomere (TAACCC)n
    Insulin promoter (ACAGGGGTGTGGGG)m
    Insulin promoter (CCCCACACCCCTGT)m
    Cystatin B Promoter (CGCGGGGCGGGG)m
    Cystatin B Promoter (CCCCGCCCCGCG)m
    FMR1 promoter (GGC)n
    FMR1 promoter (GCC)n
    K-Ras GGGAGGGAGGGAAGGAGGGAGGGAGGGAG
    K-Ras CTCCCTCCCTCCCTCCTTCCCTCCCTCCC
    c-Kit AGGGAGGGCGCTGGGAGGAGGG
    c-Kit CCCTCCTCCCAGCGCCCTCCCT
    MAZ AGGGGGGTGGGGGCGGGGGGAGGGA
    MAZ TCCCTCCCCCCGCCCCCACCCCCCT
  • A nucleic acid may be single-stranded, double-stranded, triplex, linear or circular. The nucleic acid sometimes is a DNA, at times is RNA, and may comprise one or more nucleotide derivatives or analogs of the foregoing (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more analog or derivative nucleotides). In some embodiments, the nucleic acid is entirely comprised of one or more analog or derivative nucleotides, and sometimes the nucleic acid is composed of about 50% or fewer, about 25% or fewer, about 10% or fewer or about 5% or fewer analog or derivative nucleotide bases. One or more nucleotides in an analog or derivative nucleic acid may comprise a nucleobase modification or backbone modification, such as a ribose or phosphate modification (e.g., ribosepeptide nucleic acid (PNA) or phosphothioate linkages), as compared to a RNA or DNA nucleotide. Nucleotide analogs and derivatives are known to the person of ordinary skill in the art, and non-limiting examples of such modifications are set forth in U.S. Pat. No. 6,455,308 (Freier et al.); in U.S. Pat. Nos. 4,469,863; 5,536,821; 5,541,306; 5,637,683; 5,637,684; 5,700,922; 5,717,083; 5,719,262; 5,739,308; 5,773,601; 5,886,165; 5,929,226; 5,977,296; 6,140,482; and in WIPO publications WO 00/56746 and WO 01/14398. Methods for synthesizing nucleic acids comprising such analogs or derivatives are disclosed, for example, in the patent publications cited above, and in U.S. Pat. Nos. 6,455,308; 5,614,622; 5,739,314; 5,955,599; 5,962,674; 6,117,992; and in WO 00/75372.
  • A nucleic acid or nucleotide sequence therein sometimes is about 8 to about 80 nucleotides in length, at times about 8 to about 50 nucleotides in length, and sometimes from about 10 to about 30 nucleotides in length. In some embodiments, the nucleic acid or nucleotide sequence therein sometimes is about 500 or fewer, about 400 or fewer, about 300 or fewer, about 200 or fewer, about 150 or fewer, about 100 or fewer, about 90 or fewer, about 80 or fewer, about 70 or fewer, about 60 or fewer, or about 50 or fewer nucleotides in length, and sometimes is about 40 or fewer, about 35 or fewer, about 30 or fewer, about 25 or fewer, about 20 or fewer, or about 15 or fewer nucleotides in length. A nucleic acid sometimes is larger than the foregoing lengths, such as in embodiments in which it is in plasmid form, and can be about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, or about 1400 base pairs in length or longer in certain embodiments.
  • Nucleic acids described herein often are isolated. The term “isolated” as used herein refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring, or a host cell if expressed exogenously), often is purified from other materials in an original environment, and thus is altered “by the hand of man” from its original environment. The term “purified” as used herein with reference to molecules does not refer to absolute purity. Rather, “purified” refers to a substance in a composition that contains fewer substance species in the same class (e.g., nucleic acid or protein species) other than the substance of interest in comparison to the sample from which it originated. The term “purified” refers to a substance in a composition that contains fewer nucleic acid species other than the nucleic acid of interest in comparison to the sample from which it originated. Sometimes, a nucleic acid is “substantially pure,” indicating that the nucleic acid represents at least 50% of nucleic acid on a mass basis of the composition. Often, a substantially pure nucleic acid is at least 75% pure on a mass basis of the composition, and sometimes at least 95% pure on a mass basis of the composition. The nucleic acid may be purified from a biological source and/or may be manufactured. Nucleic acid manufacture processes (e.g., chemical synthesis and recombinant DNA processes) and purification processes are known to the person of ordinary skill in the art. For example, synthetic oligonucleotides can be synthesized using standard methods and equipment, such as by using an ABI™3900 High Throughput DNA Synthesizer, which is available from Applied Biosystems (Foster City, Calif.).
  • As described above, a nucleic acid may comprise a substantially identical sequence variant of a nucleotide sequence described herein. The term “substantially identical variant” as used herein refers to a nucleotide sequence sharing sequence identity to a nucleotide sequence described. Included are nucleotide sequences 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more sequence identity to a nucleotide sequence described herein. In certain embodiments, the substantially identical variant is 91% or more identical to a nucleotide sequence described herein. One test for determining whether two nucleotide sequences are substantially identical is to determine the percent of identical nucleotide sequences shared.
  • Calculations of sequence identity can be performed as follows. Sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is sometimes 30% or more, 40% or more, 50% or more, often 60% or more, and more often 70% or more, 80% or more, 90% or more, or 100% of the length of the reference sequence. The nucleotides or amino acids at corresponding nucleotide or polypeptide positions, respectively, are then compared among the two sequences. When a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, the nucleotides or amino acids are deemed to be identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, introduced for optimal alignment of the two sequences. Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. Percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers & Miller, CABIOS 4: 11-17 (1989), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. Also, percent identity between two amino acid sequences can be determined using the Needleman & Wunsch, J. Mol. Biol. 48: 444-453 (1970) algorithm which has been incorporated into the GAP program in the GCG software package (available at the http address www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. Percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http address www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A set of parameters often used is a Blossum 62 scoring matrix with a gap open penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • Another manner for determining whether two nucleic acids are substantially identical is to assess whether a polynucleotide homologous to one nucleic acid will hybridize to the other nucleic acid under stringent conditions. As use herein, the term “stringent conditions” refers to conditions for hybridization and washing. Stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., 6.3.1-6.3.6 (1989). Aqueous and non-aqueous methods are described in that reference and either can be used. An example of stringent hybridization conditions is hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 50° C. Another example of stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 55° C. A further example of stringent hybridization conditions is hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 60° C. Often, stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 65° C. More often, stringency conditions are 0.5M sodium phosphate, 7% SDS at 65° C., followed by one or more washes at 0.2×SSC, 1% SDS at 65° C.
  • Specific nucleotide sequences described herein can be used as “query sequences” to perform a search against public databases to identify other family members or related sequences, for example. The query sequences can be utilized to search for substantially identical sequences in organisms other than humans (e.g., apes, rodents (e.g., mice, rats, rabbits, guinea pigs), ungulates (e.g., equines, bovines, caprines, porcines), reptiles, amphibians and avians). Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al., J. Mol. Biol. 215: 403-10 (1990). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleotide sequences described herein. BLAST polypeptide searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to those encoded by SEQ ID NO: 1, 2, 3, 6, 7, 8, 13, 15, 17, 19, 21, 22, 23, 26 or 28. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17): 3389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see the http address www.ncbi.nlm.nih.gov).
  • In some embodiments, an isolated nucleic acid can include a nucleotide sequence that encodes a nucleotide sequence described herein. In other embodiments, the nucleic acid includes a nucleotide sequence that encodes the complement of a nucleotide sequence described herein. For example, a nucleotide sequence described herein, or a sequence complementary to a nucleotide sequence described herein, may be included within a longer nucleotide sequence in the nucleic acid. The encoded nucleotide sequence sometimes is referred to herein as an “aptamer” and can be utilized in screening methods or as a therapeutic. In certain embodiments, the aptamer is complementary to a nucleotide sequence herein and can hybridize to a target nucleotide sequence. The hybridized aptamer may form a duplex or triplex with the target complementary nucleotide sequence, for example. The aptamer can be synthesized by the encoding sequence in an in vitro or in vivo system. When synthesized in vitro, an aptamer sometimes contains analog or derivative nucleotides. When synthesized in vivo, the encoding sequence may integrate into genomic DNA in the system or replicate autonomously from the genome (e.g., within a plasmid nucleic acid). An aptamer sometimes is selected by a measure of binding or hybridization affinity to a particular protein or nucleic acid target. In certain embodiments the aptamer may bind to one or more protein molecules within a cell or in plasma and induce a therapeutic response or be used as a method to detect the presence of the protein(s).
  • The isolated nucleic acid by be provided under conditions that allow formation of a quadruplex structure, and sometimes stabilize the structure. The term “quadruplex structure,” as used herein refers to a structure within a nucleic acid that includes one or more guanine-tetrad (G-tetrad) structures or cytosine-tetrad structures (C-tetrad or “i-motif”). G-tetrads can form in quadruplex structures via Hoogsteen hydrogen bonds. A quadruplex structure may be intermolecular (i.e., formed between two, three, four or more separate nucleic acids) or intramolecular (i.e., formed within a single nucleic acid). In some embodiments, a quadruplex-forming nucleic acid is capable of forming a parallel quadruplex structure having four parallel strands (e.g., propeller structure), antiparallel quadruplex structure having two stands that are antiparallel to the two parallel strands (e.g., chair or basket quadruplex structure) or a partially parallel quadruplex structure having one strand that is antiparallel to three parallel strands (e.g., a chair-eller or basket-eller quadruplex structure). Such structures are described in U.S. Patent Application Publication Nos. 2004/0005601 and PCT Application PCT/US2004/037789, for example. One or more quadruplex structures may form within a nucleic acid, and may form at one or more regions in the nucleic acid. Depending upon the length of the nucleic acid, the entire nucleic acid may form the quadruplex structure, and often a portion of the nucleic forms a particular quadruplex structure.
  • Conditions that allow quadruplex formation and stabilization are known to the person of ordinary skill in the art, and optimal quadruplex-forming conditions can be tested. Ion type, ion concentration, counteranion type and incubation time can be varied, and the artisan of ordinary skill can routinely determine whether a quadruplex conformation forms and is stabilized for a given set of conditions by utilizing the methods described herein. For example, cations (e.g., monovalent cations such as potassium) can stabilize quadruplex structures. The nucleic acid may be contacted in a solution containing ions for a particular time period, such as about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes or about 60 minutes or more, for example. A quadruplex structure is stabilized if it can form a functional quadruplex in solution, or if it can be detected in solution.
  • One nucleic acid sequence can give rise to different quadruplex orientations, where the different conformations depend in part upon the nucleotide sequence of the nucleic acid and conditions under which they form, such as the concentration of potassium ions present in the system and the time within which the quadruplex is allowed to form. Multiple conformations can be in equilibrium with one another, and can be in equilibrium with duplex nucleic acid if a complementary strand exists in the system. The equilibrium may be shifted to favor one conformation over another such that the favored conformation is present in a higher concentration or fraction over the other conformation or other conformations. The term “favor” or “stabilize” as used herein refers to one conformation being at a higher concentration or fraction relative to other conformations. The term “hinder” or “destabilize” as used herein refers to one conformation being at a lower concentration. One conformation may be favored over another conformation if it is present in the system at a fraction of 50% or greater, 75% or greater, or 80% or greater or 90% or greater with respect to another conformation (e.g., another quadruplex conformation, another paranemic conformation, or a duplex conformation). Conversely, one conformation may be hindered if it is present in the system at a fraction of 50% or less, 25% or less, or 20% or less and 10% or less, with respect to another conformation.
  • Equilibrium may be shifted to favor one quadruplex form over another form by methods described herein. A quadruplex forming region in a nucleic acid may be altered in a variety of manners. Alternations may result from an insertion, deletion, or substitution of one or more nucleotides. Substitutions can include a single nucleotide replacement of a nucleotide, such as a guanine that participates in a G-tetrad, where one, two, three, or four of more of such guanines in the quadruplex nucleic acid may be substituted. Also, one or more nucleotides near a guanine that participates in a G-tetrad may be deleted or substituted or one or more nucleotides may be inserted (e.g., within one, two, three or four nucleotides of a guanine that participates in a G-tetrad. A nucleotide may be substituted with a nucleotide analog or with another DNA or RNA nucleotide (e.g., replacement of a guanine with adenine, cytosine or thymine), for example. Ion concentrations and the time with which quadruplex DNA is contacted with certain ions can favor one conformation over another. Ion type, counterion type, ion concentration and incubation times can be varied to select for a particular quadruplex conformation. In addition, compounds that interact with quadruplex DNA may favor one form over the other and thereby stabilize a particular form.
  • Standard procedures for determining whether a quadruplex structure forms in a nucleic acid are known to the person of ordinary skill in the art. Also, different quadruplex conformations can be identified separately from one another using standard known procedures known to the person of ordinary skill in the art. Examples of such methods, such as characterizing quadruplex formation by polymerase arrest and circular dichroism, for example, are described in the Examples section hereafter.
  • Identification of Nucleotide Sequence Interacting Molecules
  • Provided are methods for identifying agents that interact with a nucleic acid described herein. Assay components, such as one or more nucleic acids and one or more test molecules, are contacted and the presence or absence of an interaction is observed. Assay components may be contacted in any convenient format and system by the artisan. As used herein, the term “system” refers to an environment that receives the assay components, including but not limited to microtiter plates (e.g., 96-well or 384-well plates), silicon chips having molecules immobilized thereon and optionally oriented in an array (see, e.g., U.S. Pat. No. 6,261,776 and Fodor, Nature 364: 555-556 (1993)), microfluidic devices (see, e.g., U.S. Pat. Nos. 6,440,722; 6,429,025; 6,379,974; and 6,316,781) and cell culture vessels. The system can include attendant equipment, such as signal detectors, robotic platforms, pipette dispensers and microscopes. A system sometimes is cell free, sometimes includes one or more cells, sometimes includes or is a cell sample from an animal (e.g., a biopsy, organ, appendage), and sometimes is a non-human animal. Cells may be extracted from any appropriate subject, such as a mouse, rat, hamster, rabbit, guinea pig, ungulate (e.g., equine, bovine, porcine), monkey, ape or human subject, for example.
  • The artisan can select test molecules and test conditions based upon the system utilized and the interaction and/or biological activity parameters monitored. Any type of test molecule can be utilized, including any reagent described herein, and can be selected from chemical compounds, antibodies and antibody fragments, binding partners and fragments, and nucleic acid molecules, for example. Specific embodiments of each class of such molecules are described hereafter. One or more test molecules may be added to a system in assays for identifying nucleic acid interacting molecules. Test molecules and other components can be added to the system in any suitable order. A sample exposed to a particular condition or test molecule often is compared to a sample not exposed to the condition or test molecule so that any changes in interactions or biological activities can be observed and/or quantified.
  • Assay systems sometimes are heterogeneous or homogeneous. In heterogeneous assays, one or more reagents and/or assay components are immobilized on a solid phase, and complexes are detected on the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the molecules being tested. For example, test compounds that agonize target molecule/binding partner interactions can be identified by conducting the reaction in the presence of the test molecule in a competition format. Alternatively, test molecules that agonize preformed complexes, e.g., molecules with higher binding constants that displace one of the components from the complex, can be tested by adding a test compound to the reaction mixture after complexes have been formed.
  • In a heterogeneous assay embodiment, one or more assay components are anchored to a solid surface (e.g., a microtiter plate), and a non-anchored component often is labeled, directly or indirectly. One or more assay components may be immobilized to a solid support in heterogeneous assay embodiments. The attachment between a component and the solid support may be covalent or non-covalent (see, e.g., U.S. Pat. No. 6,022,688 for non-covalent attachments). The term “solid support” or “solid phase” as used herein refers to a wide variety of materials including solids, semi-solids, gels, films, membranes, meshes, felts, composites, particles, and the like. Suitable solid phases include those developed and/or used as solid phases in solid phase binding assays (e.g., U.S. Pat. Nos. 6,261,776; 5,900,481; 6,133,436; and 6,022,688; WIPO publication WO 01/18234; chapter 9 of Immunoassay, E. P. Diamandis and T. K. Christopoulos eds., Academic Press: New York, 1996; Leon et al., Bioorg. Med. Chem. Lett. 8: 2997 (1998); Kessler et al., Agnew. Chem. Int. Ed. 40: 165 (2001); Smith et al., J. Comb. Med. 1: 326 (1999); Orain et al., Tetrahedron Lett. 42: 515 (2001); Papanikos et al., J. Am. Chem. Soc. 123: 2176 (2001); Gottschling et al., Bioorg. And Medicinal Chem. Lett. 11: 2997 (2001)). Examples of suitable solid phases include membrane filters, cellulose-based papers, beads (including polymeric, latex and paramagnetic particles), glass (e.g., glass slide), polyvinylidene fluoride (PVDF), nylon, silicon wafers, microchips, microparticles, nanoparticles, chromatography supports, TentaGels, AgroGels, PEGA gels, SPOCC gels, multiple-well plates (e.g., microtiter plate), nanotubes and the like that can be used by those of skill in the art to sequester molecules. The solid phase can be non-porous or porous. Assay components may be oriented on a solid phase in an array. Thus provided are arrays comprising one or more, two or more, three or more, etc., of assay components described herein (e.g., nucleic acids) immobilized at discrete sites on a solid support in an ordered array. Such arrays sometimes are high-density arrays, such as arrays in which each spot comprises at least 100 molecules per square centimeter.
  • A partner of the immobilized species sometimes is exposed to the coated surface with or without a test molecule in certain heterogeneous assay embodiments. After the reaction is complete, unreacted components are removed (e.g., by washing) such that a significant portion of any complexes formed remain immobilized on the solid surface. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surface is indicative of complex formation. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect complexes anchored to the surface (e.g., by using a labeled antibody specific for the initially non-immobilized species). Depending upon the order of addition of reaction components, test compounds that inhibit complex formation or disrupt preformed complexes can be detected.
  • In certain embodiments, a protein or peptide test molecule or assay component is linked to a phage via a phage coat protein. Molecules capable of interacting with the protein or peptide linked to the phage are immobilized to a solid phase, and phages displaying proteins or peptides that interact with the immobilized components adhere to the solid support. Nucleic acids from the adhered phages then are isolated and sequenced to determine the sequence of the protein or peptide that interacted with the components immobilized on the solid phase. Methods for displaying a wide variety of peptides or proteins as fusions with bacteriophage coat proteins are well known (Scott and Smith, Science 249: 386-390 (1990); Devlin, Science 249: 404-406 (1990); Cwirla et al., Proc. Natl. Acad. Sci. 87: 6378-6382 (1990); Felici, J. Mol. Biol. 222: 301-310 (1991)). Methods are also available for linking the test polypeptide to the N-terminus or the C-terminus of the phage coat protein. The original phage display system was disclosed, for example, in U.S. Pat. Nos. 5,096,815 and 5,198,346. This system used the filamentous phage M13, which required that the cloned protein be generated in E. coli and required translocation of the cloned protein across the E. coli inner membrane. Lytic bacteriophage vectors, such as lambda, T4 and T7 are more practical since they are independent of E. coli secretion. T7 is commercially available and described in U.S. Pat. Nos. 5,223,409; 5,403,484; 5,571,698; and 5,766,905.
  • In heterogeneous assay embodiments, the reaction can be conducted in a liquid phase in the presence or absence of test molecule, where the reaction products are separated from unreacted components, and the complexes are detected (e.g., using an immobilized antibody specific for one of the binding components to anchor any complexes formed in solution, and a labeled antibody specific for the other partner to detect anchored complexes). Again, depending upon the order of addition of reactants to the liquid phase, test compounds that inhibit complex or that disrupt preformed complexes can be identified.
  • In some homogeneous assay embodiments, a preformed complex comprising a reagent and/or other component is prepared. One or more components in the complex (e.g., nucleic acid, nucleolin protein, or nucleic acid binding compound) is labeled. In some embodiments, a signal generated by a label is quenched upon complex formation (e.g., U.S. Pat. No. 4,109,496 that utilizes this approach for immunoassays). Addition of a test molecule that competes with and displaces one of the species from the preformed complex can result in the generation of a signal above background or reduction in a signal. In this way, test substances that disrupt nucleic acid/test molecule complexes can be identified.
  • In an embodiment for identifying test molecules that antagonize or agonize formation of a complex comprising a nucleic acid, a reaction mixture containing components of the complex is prepared under conditions and for a time sufficient to allow complex formation. The reaction mixture often is provided in the presence or absence of the test molecule. The test molecule can be included initially in the reaction mixture, or can be added at a time subsequent to the addition of the target molecule and its binding partner. Control reaction mixtures are incubated without the test molecule or with a placebo. Formation of any complex is detected. Decreased formation of a complex in the reaction mixture containing test molecule as compared to in a control reaction mixture indicates that the molecule antagonizes complex formation. Alternatively, increased formation of a complex in the reaction mixture containing test molecule as compared to in a control reaction mixture indicates that the molecule agonizes target molecule/binding partner complex formation. In certain embodiments, complex formation nucleic acid/interacting molecule can be compared to complex formation of a modified nucleic acid/interacting molecule (e.g., nucleotide replacement in the nucleic acid). Such a comparison can be useful in cases where it is desirable to identify test molecules that modulate interactions of modified nucleic acid but not non-modified nucleic acid.
  • In some embodiments, the artisan detects the presence or absence of an interaction between assay components (e.g., a nucleic acid and a test molecule). As used herein, the term “interaction” typically refers to reversible binding of particular system components to one another, and such interactions can be quantified. A molecule may “specifically bind” to a target when it binds to the target with a degree of specificity compared to other molecules in the system (e.g., about 75% to about 95% or more of the molecule is bound to the target in the system). Often, binding affinity is quantified by plotting signal intensity as a function of a range of concentrations or amounts of a reagent, reactant or other system component. Quantified interactions can be expressed in terms of a concentration or amount of a reagent required for emission of a signal that is 50% of the maximum signal (IC50). Also, quantified interactions can be expressed as a dissociation constant (Kd or Ki) using kinetic methods known in the art. Kinetic parameters descriptive of interaction characteristics in the system can be assessed, including for example, assessing Km, kcat, kon, and/or koff parameters.
  • A variety of signals can be detected to identify the presence, absence or amount of an interaction. One or more signals detected sometimes are emitted from one or more detectable labels linked to one or more assay components. In some embodiments, one or more assay components are linked to a detectable label. A detectable label can be covalently linked to an assay component, or may be in association with a component in a non-covalent linkage. Non-covalent linkages can be effected by a binding pair, where one binding pair member is in association with the assay component and the other binding pair member is in association with the detectable label. Any suitable binding pair can be utilized to effect a non-covalent linkage, including, but not limited to, antibody/antigen, antibody/antibody, antibody/antibody fragment, antibody/antibody receptor, antibody/protein A or protein G, hapten/anti-hapten, biotin/avidin, biotin/streptavidin, folic acid/folate binding protein, vitamin B12/intrinsic factor, nucleic acid/complementary nucleic acid (e.g., DNA, RNA, PNA). Covalent linkages also can be effected by a binding pair, such as a chemical reactive group/complementary chemical reactive group (e.g., sulfhydryl/maleimide, sulfhydryl/haloacetyl derivative, amine/isotriocyanate, amine/succinimidyl ester, and amine/sulfonyl halides). Methods for attaching such binding pairs to reagents and effecting binding are known to the artisan.
  • Any detectable label suitable for detection of an interaction can be appropriately selected and utilized by the artisan. Examples of detectable labels are fluorescent labels such as fluorescein, rhodamine, and others (e.g., Anantha, et al., Biochemistry (1998) 37:2709 2714; and Qu & Chaires, Methods Enzymol. (2000) 321:353 369); radioactive isotopes (e.g., 125I, 131I, 35S, 31P, 32P, 14C, 3H, 7Be, 28Mg, 57Co, 65Zn, 67Cu, 68Ge, 82Sr, 83Rb, 95Tc, 96Tc, 103Pd, 109Cd, and 127Xe); light scattering labels (e.g., U.S. Pat. No. 6,214,560, and commercially available from Genicon Sciences Corporation, CA); chemiluminescent labels and enzyme substrates (e.g., dioxetanes and acridinium esters), enzymic or protein labels (e.g., green fluorescence protein (GFP) or color variant thereof, luciferase, peroxidase); other chromogenic labels or dyes (e.g., cyanine), and labels described previously.
  • A fluorescence signal generally is monitored in assays by exciting a fluorophore at a specific excitation wavelength and then detecting fluorescence emitted by the fluorophore at a different emission wavelength. Many nucleic acid interacting fluorophores and their attendant excitation and emission wavelengths are known (e.g., those described above). Standard methods for detecting fluorescent signals also are known, such as by using a fluorescence detector. Background fluorescence may be reduced in the system with the addition of photon reducing agents (see, e.g., U.S. Pat. No. 6,221,612), which can enhance the signal to noise ratio.
  • Another signal that can be detected is a change in refractive index at a solid optical surface, where the change is caused by the binding or release of a refractive index enhancing molecule near or at the optical surface. These methods for determining refractive index changes of an optical surface are based upon surface plasmon resonance (SPR). SPR is observed as a dip in light intensity reflected at a specific angle from the interface between an optically transparent material (e.g., glass) and a thin metal film (e.g., silver or gold). SPR depends upon the refractive index of the medium (e.g., a sample solution) close to the metal surface. A change of refractive index at the metal surface, such as by the adsorption or binding of material near the surface, will cause a corresponding shift in the angle at which SPR occurs. SPR signals and uses thereof are further exemplified in U.S. Pat. Nos. 5,641,640; 5,955,729; 6,127,183; 6,143,574; and 6,207,381, and WIPO publication WO 90/05295 and apparatuses for measuring SPR signals are commercially available (Biacore, Inc., Piscataway, N.J.). In certain embodiments, an assay component can be linked via a linker to a chip having an optically transparent material and a thin metal film, and interactions between and/or with the reagents can be detected by changes in refractive index.
  • Other signals representative of structure may also be detected, such as NMR spectral shifts (see, e.g., Arthanari & Bolton, Anti-Cancer Drug Design 14: 317-326 (1999)), mass spectrometric signals and fluorescence resonance energy transfer (FRET) signals (e.g., Lakowicz et al., U.S. Pat. No. 5,631,169; Stavrianopoulos et al. U.S. Pat. No. 4,868,103). In FRET approaches, a fluorophore label on a first, “donor” molecule is selected such that its emitted fluorescent energy will be absorbed by a fluorescent label on a second, “acceptor” molecule, which in turn is able to fluoresce due to the absorbed energy. Alternately, the “donor” polypeptide molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the “acceptor” molecule label may be differentiated from that of the “donor”. Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the “acceptor” molecule label in the assay should be maximal. A FRET binding event can be conveniently measured using standard fluorometric detection means well known (e.g., using a fluorimeter). Molecules useful for FRET are known (e.g., fluorescein and terbium). FRET can be utilized to detect interactions in vitro or in vivo.
  • Interaction assays sometimes are performed in a heterogeneous format in which interactions are detected by monitoring detectable label in association with or not in association with a target linked to a solid phase. An example of such a format is an immunoprecipitation assay. Multiple separation processes are available, such as gel electrophoresis, chromatography, sedimentation (e.g., gradient sedimentation) and flow cytometry processes, for example. Flow cytometry processes include, for example, flow microfluorimetry (FMF) and fluorescence activated cell sorting (FACS); U.S. Pat. Nos. 6,090,919 (Cormack, et al.); 6,461,813 (Lorens); and 6,455,263 (Payan)). In some embodiments, cells also may be washed of unassociated detectable label, and detectable label associated with cellular components may be visualized (e.g., by microscopy).
  • In particular screening embodiments, provided is a method for identifying a molecule that binds to a nucleic acid containing a human nucleotide sequence, which comprises contacting a nucleic acid and a compound that binds to the nucleic acid with a test molecule, wherein the nucleic acid comprises a nucleotide sequence containing (a) one or more nucleotide sequences of Table A, (b) a complement of (a), (c) an RNA nucleotide sequence encoded by (a), (d) an RNA nucleotide sequence encoded by (b), or (e) a substantially identical variant nucleotide sequence of the foregoing; and detecting the amount of the compound bound or not bound to the nucleic acid, whereby the test molecule is identified as a molecule that binds to the nucleic acid containing the human nucleotide sequence when less of the compound binds to the nucleic acid in the presence of the test molecule than in the absence of the test molecule. The compound sometimes is in association with a detectable label, and at times is radiolabled. In certain embodiments, the compound is a quinolone analog (e.g., a quinolone analog described herein in Tables 1A-1C, Table 2, Table 3 or Table 4). Methods for radiolabeling compounds are known (e.g., U.S. patent application 60/718,021, filed Sep. 16, 2005, entitled METHODS FOR PREPARING RADIOACTIVE QUINOLONE ANALOGS). In some embodiments, the compound is a porphyrin (e.g., TMPyP4 or an expanded porphyrin described in U.S. patent application publication no. 20040110820 (e.g., Se2SAP)). In the latter embodiments, fluorescence of the porphyrin sometimes is detected as the signal. The nucleic acid and/or another assay component sometimes is in association with a solid phase in certain embodiments. The nucleic acid may be DNA, RNA or an analog thereof, and may comprise a nucleotide sequence described above in specific embodiments. The nucleic acid may form a quadruplex, such as an intramolecular quadruplex.
  • In some screening embodiments, provided is a method for identifying a molecule that causes displacement of a protein from a nucleic acid, which comprises contacting a nucleic acid containing a nucleotide sequence and a protein with a test molecule, wherein the nucleic acid is capable of binding to the protein and the nucleotide sequence comprises (a) one or more nucleotide sequences of Table A, (b) a complement of (a), (c) an RNA nucleotide sequence encoded by (a), (d) an RNA nucleotide sequence encoded by (b), or (e) a substantially identical variant nucleotide sequence of the foregoing; and detecting the amount of the nucleic acid bound or not bound to the protein, whereby the test molecule is identified as a molecule that causes protein displacement when less of the nucleic acid binds to the protein in the presence of the test molecule than in the absence of the test molecule. In some embodiments, the protein is in association with a detectable label, and/or the protein may be in association with a solid phase. The nucleic acid sometimes is in association with a detectable label, and/or the nucleic acid may be in association with a solid phase in certain embodiments. Any convenient combination of the foregoing may be utilized. The nucleic acid may be DNA, RNA or an analog thereof, and may comprise a nucleotide sequence described above in specific embodiments. The nucleic acid may comprise G-quadruplex sequences and/or hairpin structures, sometimes composed of a five base pair stem and seven to ten nucleotide loop (e.g., U/GCCCGA motif). A protein that interacts with a quadruplex sequence may be utilized. Examples of such proteins include nucleolin, nucleolin binding protein and NM23 protein, for example. Any nucleolin protein may be utilized, such as a nucleolin having a sequence of accession no. NM005381, or a fragment or substantially identical sequence variant of the foregoing capable of binding a nucleic acid. Examples of nucleolin domains are RRM domains (e.g., amino acids 278-640) and RGG domains (e.g., amino acids 640-709). Any suitable nucleolin binding protein may be utilized, such as c-Myc (sequences under database accession nos. NM012603, AY679730, NP036735) or a fragment thereof (e.g., leucine zipper domain (positions 422-453), amino terminal domain positions 15-359; or helix-turn-helix domain (positions 366-425)); peroxisome proliferative activated receptor gamma coactivator protein (sequences under database accession nos. NM013261, AF106698, NP037393); Pr55 (Gag) of Human immunodeficiency virus 1 (sequences under accession no. NP057850); splicing factor, arginine/serine-rich 12 (sequences under accession nos. NM139168, AF459094, NP631907); and NM23-H2 (sequences under accession nos. NP036735.1, NW047336.1). In some embodiments the test molecule is a quinolone analog (e.g., a quinolone analog described herein in Tables 1A-1C, Table 2, Table 3 or Table 4).
  • In some screening embodiments, provided is a method of identifying a modulator of nucleic acid synthesis, which comprises contacting a template nucleic acid, a primer oligonucleotide having a nucleotide sequence complementary to a template nucleic acid nucleotide sequence, extension nucleotides, a polymerase and a test molecule under conditions that allow the primer oligonucleotide to hybridize to the template nucleic acid, wherein the template nucleic acid comprises (a) one or more nucleotide sequences of Table A, (b) a complement of (a), (c) an RNA nucleotide sequence encoded by (a), (d) an RNA nucleotide sequence encoded by (b), or (e) a substantially identical variant nucleotide sequence of the foregoing; and detecting the presence, absence or amount of an elongated primer product synthesized by extension of the primer nucleic acid, whereby the test molecule is identified as a modulator of nucleic acid synthesis when a different amount of an elongated primer product is synthesized in the presence of the test molecule than in the absence of the test molecule. In certain embodiments, the template nucleic acid is DNA and in other embodiments the template nucleic acid is RNA. The template nucleic acid sometimes comprises one or more nucleic acid analogs. In some embodiments, the polymerase is a DNA polymerase and in other embodiments, the polymerase is an RNA polymerase. Examples of suitable DNA and RNA polymerases are known and can be selected by the person of ordinary skill in the art. Examples of RNA polymerases include but are not limited to RNA polymerase II, SP6 RNA polymerase, T3 RNA polymerase, T7 RNA polymerase, RNA polymerase III and phage derived RNA polymerases. Examples of DNA polymerases include but are not limited to Pol I, II, II, IV or V, Taq polymerase and Klenow fragment.
  • Test molecules identified as having an effect in an assay described herein can be analyzed and compared to one another (e.g., ranked). Molecules identified as having an interaction or effect in a methods described herein are referred to as “candidate molecules.” Provided herein are candidate molecules identified by screening methods described herein, information descriptive of such candidate molecules, and methods of using candidate molecules (e.g., for therapeutic treatment of a condition).
  • Accordingly, provided is structural information descriptive of a candidate molecule identified by a method described herein. In certain embodiments, information descriptive of molecular structure (e.g., chemical formula or sequence information) sometimes is stored and/or renditioned as an image or as three-dimensional coordinates. The information often is stored and/or renditioned in computer readable form and sometimes is stored and organized in a database. In certain embodiments, the information may be transferred from one location to another using a physical medium (e.g., paper) or a computer readable medium (e.g., optical and/or magnetic storage or transmission medium, floppy disk, hard disk, random access memory, computer processing unit, facsimile signal, satellite signal, transmission over an internet or transmission over the world-wide web).
  • Nucleotide Sequence Interacting Molecules
  • Multiple types of nucleotide sequence interacting molecules can be constructed, identified and utilized by the person of ordinary skill in the art. Examples of such interacting molecules are compounds, nucleic acids and antibodies. Any of these types of molecules may be utilized as test molecules in assays described herein.
  • Compounds can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive (see, e.g., Zuckermann et al., J. Med. Chem. 37: 2678-85 (1994)); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; “one-bead one-compound” library methods; and synthetic library methods using affinity chromatography selection. Biological library and peptoid library approaches are typically limited to peptide libraries, while the other approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des. 12: 145, (1997)). Examples of methods for synthesizing molecular libraries are described, for example, in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90: 6909 (1993); Erb et al., Proc. Natl. Acad. Sci. USA 91: 11422 (1994); Zuckermann et al., J. Med. Chem. 37: 2678 (1994); Cho et al., Science 261: 1303 (1993); Carrell et al., Angew. Chem. Int. Ed. Engl. 33: 2059 (1994); Carell et al., Angew. Chem. Int. Ed. Engl. 33: 2061 (1994); and in Gallop et al., J. Med. Chem. 37: 1233 (1994). Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13: 412-421 (1992)), or on beads (Lam, Nature 354: 82-84 (1991)), chips (Fodor, Nature 364: 555-556 (1993)), bacteria or spores (Ladner, U.S. Pat. No. 5,223,409), plasmids (Cull et al., Proc. Natl. Acad. Sci. USA 89: 1865-1869 (1992)) or onphage (Scott and Smith, Science 249: 386-390 (1990); Devlin, Science 249: 404-406 (1990); Cwirla et al., Proc. Natl. Acad. Sci. 87: 6378-6382 (1990); Felici, J. Mol. Biol. 222: 301-310 (1991); Ladner supra.).
  • A compound sometimes is a small molecule. Small molecules include, but are not limited to, peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
  • A nucleotide sequence interacting compound sometimes is a quinolone analog. In certain embodiments, the compound is of formula 1:
  • Figure US20090291437A1-20091126-C00001
  • and pharmaceutically acceptable salts, esters and prodrugs thereof;
  • wherein B, X, A, or V is absent if Z1, Z2, Z3, or Z4, respectively, is N, and independently H, halo, azido, R2, CH2R2, SR2, OR2 or NR1R2 if Z1, Z2, Z3, or Z4, respectively, is C; or
  • A and V, A and X, or X and B may form a carbocyclic ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring;
  • Z is O, S, NR1, CH2, or C═O;
  • Z1, Z2, Z3 and Z4 are C or N, provided any two N are non-adjacent;
  • W together with N and Z forms an optionally substituted 5- or 6-membered ring that is fused to an optionally substituted saturated or unsaturated ring; said saturated or unsaturated ring may contain a heteroatom and is monocyclic or fused with a single or multiple carbocyclic or heterocyclic rings;
  • U is R2, OR2, NR1R2, NR1—(CR1 2)n—NR3R4, or N═CR1R2, wherein in N═CR1R2, R1 and R2 together with C may form a ring;
  • in each NR1R2, R1 and R2 together with N may form an optionally substituted ring;
  • in NR3R4, R3 and R4 together with N may form an optionally substituted ring;
  • R1 and R3 are independently H or C1-6 alkyl;
  • each R2 is H, or a C1-10 alkyl or C2-10 alkenyl each optionally substituted with a halogen, one or more non-adjacent heteroatoms, a carbocyclic ring, a heterocyclic ring, an aryl or heteroaryl, wherein each ring is optionally substituted; or R2 is an optionally substituted carbocyclic ring, heterocyclic ring, aryl or heteroaryl;
  • R4 is H, a C1-10 alkyl or C2-10 alkenyl optionally containing one or more non-adjacent heteroatoms selected from N, O and S, and optionally substituted with a carbocyclic or heterocyclic ring; or R3 and R4 together with N may form an optionally substituted ring;
  • each R5 is a substituent at any position on ring W; and is H, OR2, amino, alkoxy, amido, halogen, cyano or an inorganic substituent; or R5 is C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, —CONHR1, each optionally substituted by halo, carbonyl or one or more non-adjacent heteroatoms; or two adjacent R5 are linked to obtain a 5-6 membered optionally substituted carbocyclic or heterocyclic ring that may be fused to an additional optionally substituted carbocyclic or heterocyclic ring; and
  • n is 1-6.
  • In the above formula (1), B may be absent when Z1 is N, or is H or a halogen when Z1 is C. In certain embodiments, U sometimes is not H. In some embodiments, at least one of Z1-Z4 is N when U is OH, OR2 or NH2.
  • In some embodiments, the compound has the general formula (2A) or (2B):
  • Figure US20090291437A1-20091126-C00002
  • wherein A, B, V, X, U, Z, Z1, Z2, Z3, Z4, R5 and n are as defined in formula (1);
  • Z5 is O, NR1, CR6, or C═O;
  • R6 is H, C1-6 alkyl, hydroxyl, alkoxy, halo, amino or amido; and
  • Z and Z5 may optionally form a double bond.
  • In one embodiment, Z and Z5 in formula (2B) are non-adjacent atoms.
  • In some embodiments, compounds of the following formula (2C), or a pharmaceutically acceptable salt, ester or prodrug thereof, are utilized:
  • Figure US20090291437A1-20091126-C00003
  • wherein substituents are set forth above.
  • In some embodiments, compounds of the following formula (2D), or a pharmaceutically acceptable salt, ester or prodrug thereof, are utilized:
  • Figure US20090291437A1-20091126-C00004
  • wherein substituents are set forth above. In certain embodiments, compounds of formula (2D) substantially arrest cell cycle, such as G1 phase arrest and/or S phase arrest, for example.
  • In certain aspects, the compound has the general formula (3):
  • Figure US20090291437A1-20091126-C00005
  • wherein A, U, V, X, R5, Z and n are as described above in formula (1);
  • W1 is an optionally substituted aryl or heteroaryl, which may be monocyclic, or fused with a single or multiple ring and optionally containing a heteroatom; and
  • Z6, Z7, and Z8 are independently C or N, provided any two N are non-adjacent.
  • In the above formula (3), each of Z6, Z7, and Z8 may be C. In some embodiments, one or two of Z6, Z7, and Z8 is N, provided any two N are non-adjacent.
  • In the above formula, W together with N and Z in formula (1), (2C) or (2D), or WI in formula (2A), (2B) or (3) forms an optionally substituted 5- or 6-membered ring that is fused to an optionally substituted aryl or heteroaryl selected from the group consisting of:
  • Figure US20090291437A1-20091126-C00006
    Figure US20090291437A1-20091126-C00007
    Figure US20090291437A1-20091126-C00008
    Figure US20090291437A1-20091126-C00009
  • wherein each Q, Q1, Q2, and Q3 is independently CH or N;
  • Y is independently O, CH, C═O or NR1;
  • n and R5 is as defined above.
  • In certain embodiments, W together with N and Z in formula (1), (2C) or (2D) form a group having the formula selected from the group consisting of
  • Figure US20090291437A1-20091126-C00010
  • wherein Z is O, S, CR1, NR1, or C═O;
  • each Z5 is CR6, NR1, or C═O, provided Z and Z5 if adjacent are not both NR1;
  • each R1 is H, C1-6 alkyl, COR2 or S(O)pR2 wherein p is 1-2;
  • R6 is H, or a substituent known in the art, including but not limited to hydroxyl, alkyl, alkoxy, halo, amino, or amido; and
  • ring S and ring T may be saturated or unsaturated.
  • In some embodiments, W together with N and Z in formula (1), (2C) or (2D) forms a 5- or 6-membered ring that is fused to a phenyl. In other embodiments, W together with N and Z forms a 5- or 6-membered ring that is optionally fused to another ring, when U is NR1R2, provided U is not NH2. In certain embodiments, W together with N and Z forms a 5- or 6-membered ring that is not fused to another ring, when U is NR1R2 (e.g., NH2).
  • In the above formula (1), (2A), (2B), (2C) or (3), U may be NR1R2, wherein R1 is H, and R2 is a C1-10 alkyl optionally substituted with a heteroatom, a C3-6 cycloalkyl, aryl or a 5-14 membered heterocyclic ring containing one or more N, O or S. For example, R2 may be a C1-10 alkyl substituted with an optionally substituted morpholine, thiomorpholine, imidazole, aminodithiadazole, pyrrolidine, piperazine, pyridine or piperidine. In other examples, R1 and R2 together with N form an optionally substituted piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole, or aminodithiazole.
  • In some embodiments, U is NR1—(CR1 2)n—NR3R4; n is 1-4; and R3 and R4 in NR3R4 together form an optionally substituted piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole, or aminodithiazole. In some examples, U is NH—(CH2), —NR3R4 wherein R3 and R4 together with N form an optionally substituted pyrrolidine, which may be linked to (CH2)n at any position in the pyrrolidine ring. In one embodiment, R3 and R4 together with N form an N-methyl substituted pyrrolidine. In some embodiments, U is 2-(1-methylpyrrolidin-2-yl)ethylamino or (2-pyrrolidin-1-yl)ethanamino.
  • In the above formula (1), (2A-D) or (3), Z may be S or NR1.
  • In some embodiments, at least one of B, X, or A in formula (1), (2A) or (2B) is halo and Z1, Z2, and Z3 are C. In other embodiments, X and A are not each H when Z2 and Z3 are C. In the above formula (1), (2A) and (2B), V may be H. In particular embodiments, U is not OH.
  • In an embodiment, each of Z1, Z2, Z3 and Z4 in formula (1) or (2A-C) are C. In another embodiment, three of Z1, Z2, Z3 and Z4 is C, and the other is N. For example, Z1, Z2 and Z3 are C, and Z4 is N. Alternatively, Z1, Z2 and Z4 are C, and Z3 is N. In other examples, Z1, Z3 and Z4 are C and Z2 is N. In yet other examples, Z2, Z3 and Z4 are C, and Z1 is N.
  • In certain embodiments, two of Z1, Z2, Z3 and Z4 in formula (1) or (2A-C) are C, and the other two are non-adjacent nitrogens. For example, Z1 and Z3 may be C, and Z2 and Z4 are N. Alternatively, Z1 and Z3 may be N, and Z2 and Z4 may be C. In other examples, Z1 and Z4 are N, and Z2 and Z3 are C. In particular examples, W together with N and Z forms a 5- or 6-membered ring that is fused to a phenyl.
  • In some embodiments, each of B, X, A, and V in formula (1) or (2A-C) is H and Z1-Z4 are C. In many embodiments, at least one of B, X, A, and V is H and the corresponding adjacent Z1-Z4 atom is C. For example, any two of B, X, A, and V may be H. In one example, V and B may both be H. In other examples, any three of B, X, A, and V are H and the corresponding adjacent Z1-Z4 atom is C.
  • In certain embodiments, one of B, X, A, and V is a halogen (e.g., fluorine) and the corresponding adjacent Z1-Z4 is C. In other embodiments, two of X, A, and V are halogen or SR2, wherein R2 is a C0-10 alkyl or C2-10 alkenyl optionally substituted with a heteroatom, a carbocyclic ring, a heterocyclic ring, an aryl or a heteroaryl; and the corresponding adjacent Z2-Z4 is C. For example, each X and A may be a halogen. In other examples, each X and A if present may be SR2, wherein R2 is a C0-10 alkyl substituted with phenyl or pyrazine. In yet other examples, V, A and X may be alkynyls, fluorinated alkyls such as CF3, CH2CF3, perfluorinated alkyls, etc.; cyano, nitro, amides, sulfonyl amides, or carbonyl compounds such as COR2.
  • In each of the above formulas, U, and X, V, and A if present may independently be NR1R2, wherein R1 is H, and R2 is a C1-10 alkyl optionally substituted with a heteroatom, a C3-6 cycloalkyl, aryl or a 5-14 membered heterocyclic ring containing one or more N, O or S. If more than one NR2 moiety is present in a compound within the invention, as when both A and U are NR1R2 in a compound according to any one of the above formula, each R1 and each R2 is independently selected. In one example, R2 is a C1-10 alkyl substituted with an optionally substituted 5-14 membered heterocyclic ring. For example, R2 may be a C1-10 alkyl substituted with morpholine, thiomorpholine, imidazole, aminodithiadazole, pyrrolidine, piperazine, pyridine or piperidine. Alternatively, R1 and R2 together with N may form an optionally substituted heterocyclic ring containing one or more N, O or S. For example, R1 and R2 together with N may form piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole, or aminodithiazole.
  • Illustrative examples of optionally substituted heterocyclic rings include but are not limited to tetrahydrofuran, 1,3-dioxolane, 2,3-dihydrofuran, tetrahydropyran, benzofuran, isobenzofuran, 1,3-dihydro-isobenzofuran, isoxazole, 4,5-dihydroisoxazole, piperidine, pyrrolidine, pyrrolidin-2-one, pyrrole, pyridine, pyrimidine, octahydro-pyrrolo[3,4-b]pyridine, piperazine, pyrazine, morpholine, thiomorpholine, imidazole, aminodithiadazole, imidazolidine-2,4-dione, benzimidazole, 1,3-dihydrobenzimidazol-2-one, indole, thiazole, benzothiazole, thiadiazole, thiophene, tetrahydro-thiophene 1,1-dioxide, diazepine, triazole, diazabicyclo[2.2.1]heptane, 2,5-diazabicyclo[2.2.1]heptane, and 2,3,4,4a,9,9a-hexahydro-1H-β-carboline.
  • In some embodiments, the compound has general formula (1), (2A-D) or (3), wherein:
  • each of A, V and B if present is independently H or halogen (e.g., chloro or fluoro);
  • X is —(R5)R1R2, wherein R5 is C or N and wherein in each ˜(R5)R1R2, R1 and R2 together may form an optionally substituted aryl or heteroaryl ring;
  • Z is NH or N-alkyl (e.g., N—CH3);
  • W together with N and Z in formula (1), (2C) or (2D) or W1 in formula (2A), (2B) or (3) forms an optionally substituted 5- or 6-membered ring that is fused with an optionally substituted aryl or heteroaryl ring; and
  • U is —R5R6—(CH2)n—CHR2—NR3R4, wherein R6 is H or C1-10 alkyl and wherein in the —CHR2—NR3R4 moiety each R3 or R4 together with the C may form an optionally substituted heterocyclic or heteroaryl ring, or wherein in the —CHR2—NR3R4 moiety each R3 or R4 together with the N may form an optionally substituted carbocyclic, heterocyclic, aryl or heteroaryl ring.
  • In certain embodiments, the compound has formula (1), (2A-2D) or (3), wherein:
  • A if present is H or halogen (e.g., chloro or fluoro);
  • X if present is —(R5)R1R2, wherein R5 is C or N and wherein in each —(R5)R1R2, R1 and R2 together may form an optionally substituted aryl or heteroaryl ring;
  • Z is NH or N-alkyl (e.g., N—CH3);
  • W together with N and Z in formula (1), (2C) or (2D) or W1 in formula (2A), (2B) or (3) forms an optionally substituted 5- or 6-membered ring that is fused with an optionally substituted aryl or heteroaryl ring; and
  • U is —R5R6—(CH2)n—CHR2—NR3R4, wherein R6 is H or alkyl and wherein in the —CHR2—NR3R4 moiety each R3 or R4 together with the C may form an optionally substituted heterocyclic or heteroaryl ring, or wherein in the —CHR2—NR3R4 moiety each R3 or R4 together with the N may form an optionally substituted carbocyclic, heterocyclic, aryl or heteroaryl ring.
  • In each of the above formula, each optionally substituted moiety may be substituted with one or more halo, OR2, NR1R2, carbamate, C1-10 alkyl, C2-10 alkenyl, each optionally substituted by halo, C═O, aryl or one or more heteroatoms; inorganic substituents, aryl, carbocyclic or a heterocyclic ring. Other substituents include but are not limited to alkynyl, cycloalkyl, fluorinated alkyls such as CF3, CH2CF3, perfluorinated alkyls, etc.; oxygenated fluorinated alkyls such as OCF3 or CH2CF3, etc.; cyano, nitro, COR2, NR2COR2, sulfonyl amides; NR2SOOR2; SR2, SOR2, COOR2, CONR2 2, OCOR2, OCOOR2, OCONR2 2, NRCOOR2, NRCONR2 2, NRC(NR)(NR2 2), NR(CO)NR2 2, and SOONR2 2, wherein each R2 is as defined in formula 1.
  • As used herein, the term “alkyl” refers to a carbon-containing compound, and encompasses compounds containing one or more heteroatoms. The term “alkyl” also encompasses alkyls substituted with one or more substituents including but not limited to OR1, amino, amido, halo, ═O, aryl, heterocyclic groups, or inorganic substituents.
  • As used herein, the term “carbocycle” refers to a cyclic compound containing only carbon atoms in the ring, whereas a “heterocycle” refers to a cyclic compound comprising a heteroatom. The carbocyclic and heterocyclic structures encompass compounds having monocyclic, bicyclic or multiple ring systems.
  • As used herein, the term “aryl” refers to a polyunsaturated, typically aromatic hydrocarbon substituent, whereas a “heteroaryl” or “heteroaromatic” refer to an aromatic ring containing a heteroatom. The aryl and heteroaryl structures encompass compounds having monocyclic, bicyclic or multiple ring systems.
  • As used herein, the term “heteroatom” refers to any atom that is not carbon or hydrogen, such as nitrogen, oxygen or sulfur.
  • Illustrative examples of heterocycles include but are not limited to tetrahydrofuran, 1,3-dioxolane, 2,3-dihydrofuran, pyran, tetrahydropyran, benzofuran, isobenzofuran, 1,3-dihydro-isobenzofuran, isoxazole, 4,5-dihydroisoxazole, piperidine, pyrrolidine, pyrrolidin-2-one, pyrrole, pyridine, pyrimidine, octahydro-pyrrolo[3,4-b]pyridine, piperazine, pyrazine, morpholine, thiomorpholine, imidazole, imidazolidine-2,4-dione, 1,3-dihydrobenzimidazol-2-one, indole, thiazole, benzothiazole, thiadiazole, thiophene, tetrahydro-thiophene 1,1-dioxide, diazepine, triazole, guanidine, diazabicyclo[2.2.1]heptane, 2,5-diazabicyclo[2.2.1]heptane, 2,3,4,4a,9,9a-hexahydro-1H-β-carboline, oxirane, oxetane, tetrahydropyran, dioxane, lactones, aziridine, azetidine, piperidine, lactams, and may also encompass heteroaryls. Other illustrative examples of heteroaryls include but are not limited to furan, pyrrole, pyridine, pyrimidine, imidazole, benzimidazole and triazole.
  • As used herein, the term “inorganic substituent” refers to substituents that do not contain carbon or contain carbon bound to elements other than hydrogen (e.g., elemental carbon, carbon monoxide, carbon dioxide, and carbonate). Examples of inorganic substituents include but are not limited to nitro, halogen, sulfonyls, sulfinyls, phosphates, etc.
  • Synthetic procedures for preparing the compounds of the present invention have been described in PCT/US05/011108 and PCT/US2005/26977, each of which is incorporated herein by reference in its entirety. Other variations in the synthetic procedures known to those with ordinary skill in the art may also be used to prepare the compounds of the present invention.
  • The compounds of the present invention may be chiral. As used herein, a chiral compound is a compound that is different from its mirror image, and has an enantiomer. Furthermore, the compounds may be racemic, or an isolated enantiomer or stereoisomer. Methods of synthesizing chiral compounds and resolving a racemic mixture of enantiomers are well known to those skilled in the art. See, e.g., March, “Advanced Organic Chemistry,” John Wiley and Sons, Inc., New York, (1985), which is incorporated herein by reference.
  • Illustrative examples of compounds having the above formula are shown in Table 1 (A-C), Tables 2-4, and in the Examples. The present invention also encompasses other compounds having any one formula (1), (2A-2D), (3) and (3A) comprising substituents U, A, X, V, and B independently selected from the substituents exemplified in the tables. For example, an isopropyl substituent in the compounds shown in Table 1A may be replaced with an acetyl substituent, or the N—CH3 pyrrolidinyl in the fused ring may be replaced with a NH-pyrrolidinyl group. Furthermore, the fluoro group may be replaced with H. Thus, the present invention is not limited to the specific combination of substituents described in various embodiments below.
  • In some embodiments, compounds of the following formula (3A), or a pharmaceutically acceptable salt, ester or prodrug thereof, are utilized:
  • Figure US20090291437A1-20091126-C00011
  • wherein substituents are set forth above.
  • In some embodiments, a compound has the following formula A-1,
  • Figure US20090291437A1-20091126-C00012
  • or a pharmaceutically acceptable salt, ester or prodrug thereof, and may be utilized in a method or composition described herein.
  • In some embodiments, a compound having the following formula B-1:
  • Figure US20090291437A1-20091126-C00013
  • or a pharmaceutically acceptable salt, prodrug or ester thereof, may be utilized in a method or composition described herein.
  • In certain aspects, the compound is of formula 4, or a pharmaceutically acceptable salt, prodrug or ester thereof:
  • Figure US20090291437A1-20091126-C00014
  • where X′ is hydroxy, alkoxy, carboxyl, halogen, CF3, amino, amido, sulfide, 3-7 membered carbocycle or heterocycle, 5- or 6-membered aryl or heteroaryl, fused carbocycle or heterocycle, bicyclic compound, NR1R2, NCOR3, N(CH2)nNR1R2, or N(CH2)nR3, where the N in N(CH2)nNR1R2 and N(CH2)nR3 is optionally linked to a C1-10 alkyl, and each X′ is optionally linked to one or more substituents;
  • X″ is hydroxy, alkoxy, amino, amido, sulfide, 3-7 membered carbocycle or heterocycle, 5- or 6-membered aryl or heteroaryl, fused carbocycle or heterocycle, bicyclic compound, NR1R2, NCOR3, N(CH2)nNR1R2, or N(CH2)nR3, where the N in N(CH2), NR1R2 and N(CH2)nR3 is optionally linked to a C1-10 alkyl, and X″ is optionally linked to one or more substituents;
  • Y is H, halogen, or CF3;
  • R1, R2 and R3 are independently H, C1-C6 alkyl, C1-C6 substituted alkyl, C3-C6 cycloalkyl, C1-C6 alkoxyl, carboxyl, imine, guanidine, 3-7 membered carbocycle or heterocycle, 5- or 6-membered aryl or heteroaryl, fused carbocycle or heterocycle, or bicyclic compound, where each R1, R2 and R3 are optionally linked to one or more substituents;
  • Z is a halogen;
  • and L is a linker having the formula Ar1-L1-Ar2, where Ar1 and Ar2 are aryl or heteroaryl.
  • In the above formula (4), L1 may be (CH2)m where m is 1-6, or a heteroatom optionally linked to another heteroatom such as a disulfide. Each of Ar1 and Ar2 may independently be aryl or heteroaryl, optionally substituted with one or more substituents. In one example, L is a [phenyl-S—S-phenyl] linker linking two quinolinone. In a particular embodiment, L is a [phenyl-S—S-phenyl] linker linking two identical quinoline species.
  • In the above formula (4), X″ may be hydroxy, alkoxy, amino, amido, sulfide, 3-7 membered carbocycle or heterocycle, 5- or 6-membered aryl or heteroaryl, fused carbocycle or heterocycle, bicyclic compound, NR1R2, NCOR3, N(CH2)n NR1R2, or N(CH2)nR3, where the N in N(CH2)n NR1R2 and N(CH2)nR3 is optionally linked to a C1-10 alkyl, and X″ is optionally linked to one or more substituents.
  • Illustrative examples of compounds of the foregoing formulae are set forth in Tables 1A-1C, Table 2, Table 3 and Table 4 attached hereto.
  • TABLE 1A
    Figure US20090291437A1-20091126-C00015
    Figure US20090291437A1-20091126-C00016
    Figure US20090291437A1-20091126-C00017
    Figure US20090291437A1-20091126-C00018
    Figure US20090291437A1-20091126-C00019
    Figure US20090291437A1-20091126-C00020
    Figure US20090291437A1-20091126-C00021
    Figure US20090291437A1-20091126-C00022
    Figure US20090291437A1-20091126-C00023
    Figure US20090291437A1-20091126-C00024
    Figure US20090291437A1-20091126-C00025
    Figure US20090291437A1-20091126-C00026
    Figure US20090291437A1-20091126-C00027
    Figure US20090291437A1-20091126-C00028
    Figure US20090291437A1-20091126-C00029
    Figure US20090291437A1-20091126-C00030
    Figure US20090291437A1-20091126-C00031
  • TABLE 1B
    Figure US20090291437A1-20091126-C00032
    Figure US20090291437A1-20091126-C00033
    Figure US20090291437A1-20091126-C00034
    Figure US20090291437A1-20091126-C00035
    Figure US20090291437A1-20091126-C00036
    Figure US20090291437A1-20091126-C00037
    Figure US20090291437A1-20091126-C00038
    Figure US20090291437A1-20091126-C00039
    Figure US20090291437A1-20091126-C00040
    Figure US20090291437A1-20091126-C00041
    Figure US20090291437A1-20091126-C00042
    Figure US20090291437A1-20091126-C00043
    Figure US20090291437A1-20091126-C00044
    Figure US20090291437A1-20091126-C00045
    Figure US20090291437A1-20091126-C00046
    Figure US20090291437A1-20091126-C00047
    Figure US20090291437A1-20091126-C00048
    Figure US20090291437A1-20091126-C00049
    Figure US20090291437A1-20091126-C00050
    Figure US20090291437A1-20091126-C00051
    Figure US20090291437A1-20091126-C00052
    Figure US20090291437A1-20091126-C00053
    Figure US20090291437A1-20091126-C00054
    Figure US20090291437A1-20091126-C00055
    Figure US20090291437A1-20091126-C00056
    Figure US20090291437A1-20091126-C00057
    Figure US20090291437A1-20091126-C00058
    Figure US20090291437A1-20091126-C00059
    Figure US20090291437A1-20091126-C00060
    Figure US20090291437A1-20091126-C00061
    Figure US20090291437A1-20091126-C00062
    Figure US20090291437A1-20091126-C00063
    Figure US20090291437A1-20091126-C00064
    Figure US20090291437A1-20091126-C00065
    Figure US20090291437A1-20091126-C00066
    Figure US20090291437A1-20091126-C00067
  • TABLE 1C
    Figure US20090291437A1-20091126-C00068
    Figure US20090291437A1-20091126-C00069
    Figure US20090291437A1-20091126-C00070
    Figure US20090291437A1-20091126-C00071
    Figure US20090291437A1-20091126-C00072
    Figure US20090291437A1-20091126-C00073
    Figure US20090291437A1-20091126-C00074
    Figure US20090291437A1-20091126-C00075
    Figure US20090291437A1-20091126-C00076
    Figure US20090291437A1-20091126-C00077
    Figure US20090291437A1-20091126-C00078
    Figure US20090291437A1-20091126-C00079
    Figure US20090291437A1-20091126-C00080
    Figure US20090291437A1-20091126-C00081
    Figure US20090291437A1-20091126-C00082
    Figure US20090291437A1-20091126-C00083
    Figure US20090291437A1-20091126-C00084
    Figure US20090291437A1-20091126-C00085
    Figure US20090291437A1-20091126-C00086
    Figure US20090291437A1-20091126-C00087
    Figure US20090291437A1-20091126-C00088
    Figure US20090291437A1-20091126-C00089
    Figure US20090291437A1-20091126-C00090
    Figure US20090291437A1-20091126-C00091
    Figure US20090291437A1-20091126-C00092
    Figure US20090291437A1-20091126-C00093
    Figure US20090291437A1-20091126-C00094
    Figure US20090291437A1-20091126-C00095
    Figure US20090291437A1-20091126-C00096
    Figure US20090291437A1-20091126-C00097
    Figure US20090291437A1-20091126-C00098
    Figure US20090291437A1-20091126-C00099
    Figure US20090291437A1-20091126-C00100
    Figure US20090291437A1-20091126-C00101
    Figure US20090291437A1-20091126-C00102
    Figure US20090291437A1-20091126-C00103
    Figure US20090291437A1-20091126-C00104
    Figure US20090291437A1-20091126-C00105
    Figure US20090291437A1-20091126-C00106
    Figure US20090291437A1-20091126-C00107
    Figure US20090291437A1-20091126-C00108
    Figure US20090291437A1-20091126-C00109
    Figure US20090291437A1-20091126-C00110
    Figure US20090291437A1-20091126-C00111
    Figure US20090291437A1-20091126-C00112
    Figure US20090291437A1-20091126-C00113
    Figure US20090291437A1-20091126-C00114
    Figure US20090291437A1-20091126-C00115
    Figure US20090291437A1-20091126-C00116
    Figure US20090291437A1-20091126-C00117
    Figure US20090291437A1-20091126-C00118
    Figure US20090291437A1-20091126-C00119
    Figure US20090291437A1-20091126-C00120
    Figure US20090291437A1-20091126-C00121
    Figure US20090291437A1-20091126-C00122
    Figure US20090291437A1-20091126-C00123
    Figure US20090291437A1-20091126-C00124
    Figure US20090291437A1-20091126-C00125
    Figure US20090291437A1-20091126-C00126
    Figure US20090291437A1-20091126-C00127
    Figure US20090291437A1-20091126-C00128
    Figure US20090291437A1-20091126-C00129
    Figure US20090291437A1-20091126-C00130
    Figure US20090291437A1-20091126-C00131
    Figure US20090291437A1-20091126-C00132
    Figure US20090291437A1-20091126-C00133
    Figure US20090291437A1-20091126-C00134
    Figure US20090291437A1-20091126-C00135
    Figure US20090291437A1-20091126-C00136
    Figure US20090291437A1-20091126-C00137
    Figure US20090291437A1-20091126-C00138
    Figure US20090291437A1-20091126-C00139
    Figure US20090291437A1-20091126-C00140
    Figure US20090291437A1-20091126-C00141
    Figure US20090291437A1-20091126-C00142
    Figure US20090291437A1-20091126-C00143
    Figure US20090291437A1-20091126-C00144
    Figure US20090291437A1-20091126-C00145
    Figure US20090291437A1-20091126-C00146
    Figure US20090291437A1-20091126-C00147
    Figure US20090291437A1-20091126-C00148
    Figure US20090291437A1-20091126-C00149
    Figure US20090291437A1-20091126-C00150
    Figure US20090291437A1-20091126-C00151
    Figure US20090291437A1-20091126-C00152
    Figure US20090291437A1-20091126-C00153
    Figure US20090291437A1-20091126-C00154
    Figure US20090291437A1-20091126-C00155
    Figure US20090291437A1-20091126-C00156
    Figure US20090291437A1-20091126-C00157
    Figure US20090291437A1-20091126-C00158
    Figure US20090291437A1-20091126-C00159
    Figure US20090291437A1-20091126-C00160
    Figure US20090291437A1-20091126-C00161
    Figure US20090291437A1-20091126-C00162
    Figure US20090291437A1-20091126-C00163
    Figure US20090291437A1-20091126-C00164
    Figure US20090291437A1-20091126-C00165
    Figure US20090291437A1-20091126-C00166
    Figure US20090291437A1-20091126-C00167
    Figure US20090291437A1-20091126-C00168
    Figure US20090291437A1-20091126-C00169
    Figure US20090291437A1-20091126-C00170
    Figure US20090291437A1-20091126-C00171
    Figure US20090291437A1-20091126-C00172
    Figure US20090291437A1-20091126-C00173
    Figure US20090291437A1-20091126-C00174
    Figure US20090291437A1-20091126-C00175
    Figure US20090291437A1-20091126-C00176
    Figure US20090291437A1-20091126-C00177
    Figure US20090291437A1-20091126-C00178
    Figure US20090291437A1-20091126-C00179
    Figure US20090291437A1-20091126-C00180
    Figure US20090291437A1-20091126-C00181
    Figure US20090291437A1-20091126-C00182
    Figure US20090291437A1-20091126-C00183
    Figure US20090291437A1-20091126-C00184
    Figure US20090291437A1-20091126-C00185
    Figure US20090291437A1-20091126-C00186
    Figure US20090291437A1-20091126-C00187
    Figure US20090291437A1-20091126-C00188
    Figure US20090291437A1-20091126-C00189
    Figure US20090291437A1-20091126-C00190
    Figure US20090291437A1-20091126-C00191
    Figure US20090291437A1-20091126-C00192
    Figure US20090291437A1-20091126-C00193
    Figure US20090291437A1-20091126-C00194
    Figure US20090291437A1-20091126-C00195
    Figure US20090291437A1-20091126-C00196
    Figure US20090291437A1-20091126-C00197
    Figure US20090291437A1-20091126-C00198
    Figure US20090291437A1-20091126-C00199
    Figure US20090291437A1-20091126-C00200
    Figure US20090291437A1-20091126-C00201
    Figure US20090291437A1-20091126-C00202
    Figure US20090291437A1-20091126-C00203
    Figure US20090291437A1-20091126-C00204
    Figure US20090291437A1-20091126-C00205
    Figure US20090291437A1-20091126-C00206
    Figure US20090291437A1-20091126-C00207
    Figure US20090291437A1-20091126-C00208
    Figure US20090291437A1-20091126-C00209
    Figure US20090291437A1-20091126-C00210
    Figure US20090291437A1-20091126-C00211
    Figure US20090291437A1-20091126-C00212
    Figure US20090291437A1-20091126-C00213
    Figure US20090291437A1-20091126-C00214
    Figure US20090291437A1-20091126-C00215
    Figure US20090291437A1-20091126-C00216
    Figure US20090291437A1-20091126-C00217
    Figure US20090291437A1-20091126-C00218
    Figure US20090291437A1-20091126-C00219
    Figure US20090291437A1-20091126-C00220
    Figure US20090291437A1-20091126-C00221
    Figure US20090291437A1-20091126-C00222
    Figure US20090291437A1-20091126-C00223
    Figure US20090291437A1-20091126-C00224
    Figure US20090291437A1-20091126-C00225
    Figure US20090291437A1-20091126-C00226
    Figure US20090291437A1-20091126-C00227
    Figure US20090291437A1-20091126-C00228
    Figure US20090291437A1-20091126-C00229
    Figure US20090291437A1-20091126-C00230
    Figure US20090291437A1-20091126-C00231
    Figure US20090291437A1-20091126-C00232
    Figure US20090291437A1-20091126-C00233
    Figure US20090291437A1-20091126-C00234
    Figure US20090291437A1-20091126-C00235
    Figure US20090291437A1-20091126-C00236
    Figure US20090291437A1-20091126-C00237
    Figure US20090291437A1-20091126-C00238
    Figure US20090291437A1-20091126-C00239
    Figure US20090291437A1-20091126-C00240
    Figure US20090291437A1-20091126-C00241
    Figure US20090291437A1-20091126-C00242
    Figure US20090291437A1-20091126-C00243
    Figure US20090291437A1-20091126-C00244
    Figure US20090291437A1-20091126-C00245
    Figure US20090291437A1-20091126-C00246
    Figure US20090291437A1-20091126-C00247
    Figure US20090291437A1-20091126-C00248
    Figure US20090291437A1-20091126-C00249
    Figure US20090291437A1-20091126-C00250
    Figure US20090291437A1-20091126-C00251
    Figure US20090291437A1-20091126-C00252
    Figure US20090291437A1-20091126-C00253
    Figure US20090291437A1-20091126-C00254
    Figure US20090291437A1-20091126-C00255
    Figure US20090291437A1-20091126-C00256
    Figure US20090291437A1-20091126-C00257
    Figure US20090291437A1-20091126-C00258
    Figure US20090291437A1-20091126-C00259
    Figure US20090291437A1-20091126-C00260
    Figure US20090291437A1-20091126-C00261
    Figure US20090291437A1-20091126-C00262
    Figure US20090291437A1-20091126-C00263
    Figure US20090291437A1-20091126-C00264
    Figure US20090291437A1-20091126-C00265
    Figure US20090291437A1-20091126-C00266
    Figure US20090291437A1-20091126-C00267
    Figure US20090291437A1-20091126-C00268
    Figure US20090291437A1-20091126-C00269
    Figure US20090291437A1-20091126-C00270
    Figure US20090291437A1-20091126-C00271
    Figure US20090291437A1-20091126-C00272
    Figure US20090291437A1-20091126-C00273
    Figure US20090291437A1-20091126-C00274
    Figure US20090291437A1-20091126-C00275
    Figure US20090291437A1-20091126-C00276
    Figure US20090291437A1-20091126-C00277
    Figure US20090291437A1-20091126-C00278
    Figure US20090291437A1-20091126-C00279
    Figure US20090291437A1-20091126-C00280
    Figure US20090291437A1-20091126-C00281
    Figure US20090291437A1-20091126-C00282
    Figure US20090291437A1-20091126-C00283
    Figure US20090291437A1-20091126-C00284
    Figure US20090291437A1-20091126-C00285
    Figure US20090291437A1-20091126-C00286
  • TABLE 2
    Figure US20090291437A1-20091126-C00287
    Figure US20090291437A1-20091126-C00288
    Figure US20090291437A1-20091126-C00289
    Figure US20090291437A1-20091126-C00290
    Figure US20090291437A1-20091126-C00291
    Figure US20090291437A1-20091126-C00292
    Figure US20090291437A1-20091126-C00293
    Figure US20090291437A1-20091126-C00294
    Figure US20090291437A1-20091126-C00295
    Figure US20090291437A1-20091126-C00296
    Figure US20090291437A1-20091126-C00297
    Figure US20090291437A1-20091126-C00298
    Figure US20090291437A1-20091126-C00299
    Figure US20090291437A1-20091126-C00300
    Figure US20090291437A1-20091126-C00301
    Figure US20090291437A1-20091126-C00302
    Figure US20090291437A1-20091126-C00303
    Figure US20090291437A1-20091126-C00304
    Figure US20090291437A1-20091126-C00305
    Figure US20090291437A1-20091126-C00306
    Figure US20090291437A1-20091126-C00307
    Figure US20090291437A1-20091126-C00308
    Figure US20090291437A1-20091126-C00309
    Figure US20090291437A1-20091126-C00310
    Figure US20090291437A1-20091126-C00311
    Figure US20090291437A1-20091126-C00312
    Figure US20090291437A1-20091126-C00313
    Figure US20090291437A1-20091126-C00314
    Figure US20090291437A1-20091126-C00315
    Figure US20090291437A1-20091126-C00316
    Figure US20090291437A1-20091126-C00317
    Figure US20090291437A1-20091126-C00318
    Figure US20090291437A1-20091126-C00319
    Figure US20090291437A1-20091126-C00320
    Figure US20090291437A1-20091126-C00321
    Figure US20090291437A1-20091126-C00322
    Figure US20090291437A1-20091126-C00323
    Figure US20090291437A1-20091126-C00324
    Figure US20090291437A1-20091126-C00325
    Figure US20090291437A1-20091126-C00326
    Figure US20090291437A1-20091126-C00327
    Figure US20090291437A1-20091126-C00328
    Figure US20090291437A1-20091126-C00329
    Figure US20090291437A1-20091126-C00330
    Figure US20090291437A1-20091126-C00331
    Figure US20090291437A1-20091126-C00332
    Figure US20090291437A1-20091126-C00333
    Figure US20090291437A1-20091126-C00334
    Figure US20090291437A1-20091126-C00335
    Figure US20090291437A1-20091126-C00336
    Figure US20090291437A1-20091126-C00337
    Figure US20090291437A1-20091126-C00338
    Figure US20090291437A1-20091126-C00339
    Figure US20090291437A1-20091126-C00340
    Figure US20090291437A1-20091126-C00341
    Figure US20090291437A1-20091126-C00342
    Figure US20090291437A1-20091126-C00343
    Figure US20090291437A1-20091126-C00344
    Figure US20090291437A1-20091126-C00345
    Figure US20090291437A1-20091126-C00346
    Figure US20090291437A1-20091126-C00347
    Figure US20090291437A1-20091126-C00348
    Figure US20090291437A1-20091126-C00349
    Figure US20090291437A1-20091126-C00350
    Figure US20090291437A1-20091126-C00351
    Figure US20090291437A1-20091126-C00352
    Figure US20090291437A1-20091126-C00353
    Figure US20090291437A1-20091126-C00354
    Figure US20090291437A1-20091126-C00355
    Figure US20090291437A1-20091126-C00356
    Figure US20090291437A1-20091126-C00357
    Figure US20090291437A1-20091126-C00358
    Figure US20090291437A1-20091126-C00359
    Figure US20090291437A1-20091126-C00360
    Figure US20090291437A1-20091126-C00361
    Figure US20090291437A1-20091126-C00362
    Figure US20090291437A1-20091126-C00363
    Figure US20090291437A1-20091126-C00364
    Figure US20090291437A1-20091126-C00365
    Figure US20090291437A1-20091126-C00366
    Figure US20090291437A1-20091126-C00367
    Figure US20090291437A1-20091126-C00368
    Figure US20090291437A1-20091126-C00369
    Figure US20090291437A1-20091126-C00370
    Figure US20090291437A1-20091126-C00371
    Figure US20090291437A1-20091126-C00372
    Figure US20090291437A1-20091126-C00373
    Figure US20090291437A1-20091126-C00374
    Figure US20090291437A1-20091126-C00375
    Figure US20090291437A1-20091126-C00376
    Figure US20090291437A1-20091126-C00377
    Figure US20090291437A1-20091126-C00378
    Figure US20090291437A1-20091126-C00379
    Figure US20090291437A1-20091126-C00380
    Figure US20090291437A1-20091126-C00381
    Figure US20090291437A1-20091126-C00382
    Figure US20090291437A1-20091126-C00383
    Figure US20090291437A1-20091126-C00384
    Figure US20090291437A1-20091126-C00385
    Figure US20090291437A1-20091126-C00386
    Figure US20090291437A1-20091126-C00387
    Figure US20090291437A1-20091126-C00388
    Figure US20090291437A1-20091126-C00389
    Figure US20090291437A1-20091126-C00390
    Figure US20090291437A1-20091126-C00391
    Figure US20090291437A1-20091126-C00392
    Figure US20090291437A1-20091126-C00393
    Figure US20090291437A1-20091126-C00394
    Figure US20090291437A1-20091126-C00395
    Figure US20090291437A1-20091126-C00396
    Figure US20090291437A1-20091126-C00397
    Figure US20090291437A1-20091126-C00398
    Figure US20090291437A1-20091126-C00399
    Figure US20090291437A1-20091126-C00400
    Figure US20090291437A1-20091126-C00401
    Figure US20090291437A1-20091126-C00402
    Figure US20090291437A1-20091126-C00403
    Figure US20090291437A1-20091126-C00404
    Figure US20090291437A1-20091126-C00405
    Figure US20090291437A1-20091126-C00406
    Figure US20090291437A1-20091126-C00407
    Figure US20090291437A1-20091126-C00408
    Figure US20090291437A1-20091126-C00409
    Figure US20090291437A1-20091126-C00410
    Figure US20090291437A1-20091126-C00411
    Figure US20090291437A1-20091126-C00412
    Figure US20090291437A1-20091126-C00413
    Figure US20090291437A1-20091126-C00414
    Figure US20090291437A1-20091126-C00415
    Figure US20090291437A1-20091126-C00416
    Figure US20090291437A1-20091126-C00417
    Figure US20090291437A1-20091126-C00418
    Figure US20090291437A1-20091126-C00419
    Figure US20090291437A1-20091126-C00420
    Figure US20090291437A1-20091126-C00421
    Figure US20090291437A1-20091126-C00422
    Figure US20090291437A1-20091126-C00423
    Figure US20090291437A1-20091126-C00424
    Figure US20090291437A1-20091126-C00425
    Figure US20090291437A1-20091126-C00426
    Figure US20090291437A1-20091126-C00427
    Figure US20090291437A1-20091126-C00428
    Figure US20090291437A1-20091126-C00429
    Figure US20090291437A1-20091126-C00430
    Figure US20090291437A1-20091126-C00431
    Figure US20090291437A1-20091126-C00432
    Figure US20090291437A1-20091126-C00433
    Figure US20090291437A1-20091126-C00434
    Figure US20090291437A1-20091126-C00435
    Figure US20090291437A1-20091126-C00436
    Figure US20090291437A1-20091126-C00437
    Figure US20090291437A1-20091126-C00438
    Figure US20090291437A1-20091126-C00439
    Figure US20090291437A1-20091126-C00440
    Figure US20090291437A1-20091126-C00441
    Figure US20090291437A1-20091126-C00442
    Figure US20090291437A1-20091126-C00443
    Figure US20090291437A1-20091126-C00444
    Figure US20090291437A1-20091126-C00445
    Figure US20090291437A1-20091126-C00446
    Figure US20090291437A1-20091126-C00447
    Figure US20090291437A1-20091126-C00448
    Figure US20090291437A1-20091126-C00449
    Figure US20090291437A1-20091126-C00450
    Figure US20090291437A1-20091126-C00451
    Figure US20090291437A1-20091126-C00452
    Figure US20090291437A1-20091126-C00453
    Figure US20090291437A1-20091126-C00454
    Figure US20090291437A1-20091126-C00455
  • TABLE 3
    Figure US20090291437A1-20091126-C00456
    Figure US20090291437A1-20091126-C00457
    Figure US20090291437A1-20091126-C00458
    Figure US20090291437A1-20091126-C00459
    Figure US20090291437A1-20091126-C00460
    Figure US20090291437A1-20091126-C00461
    Figure US20090291437A1-20091126-C00462
    Figure US20090291437A1-20091126-C00463
    Figure US20090291437A1-20091126-C00464
    Figure US20090291437A1-20091126-C00465
    Figure US20090291437A1-20091126-C00466
    Figure US20090291437A1-20091126-C00467
    Figure US20090291437A1-20091126-C00468
    Figure US20090291437A1-20091126-C00469
    Figure US20090291437A1-20091126-C00470
    Figure US20090291437A1-20091126-C00471
    Figure US20090291437A1-20091126-C00472
    Figure US20090291437A1-20091126-C00473
    Figure US20090291437A1-20091126-C00474
    Figure US20090291437A1-20091126-C00475
    Figure US20090291437A1-20091126-C00476
    Figure US20090291437A1-20091126-C00477
    Figure US20090291437A1-20091126-C00478
    Figure US20090291437A1-20091126-C00479
    Figure US20090291437A1-20091126-C00480
    Figure US20090291437A1-20091126-C00481
    Figure US20090291437A1-20091126-C00482
    Figure US20090291437A1-20091126-C00483
    Figure US20090291437A1-20091126-C00484
    Figure US20090291437A1-20091126-C00485
    Figure US20090291437A1-20091126-C00486
    Figure US20090291437A1-20091126-C00487
    Figure US20090291437A1-20091126-C00488
    Figure US20090291437A1-20091126-C00489
    Figure US20090291437A1-20091126-C00490
    Figure US20090291437A1-20091126-C00491
    Figure US20090291437A1-20091126-C00492
    Figure US20090291437A1-20091126-C00493
    Figure US20090291437A1-20091126-C00494
    Figure US20090291437A1-20091126-C00495
    Figure US20090291437A1-20091126-C00496
    Figure US20090291437A1-20091126-C00497
    Figure US20090291437A1-20091126-C00498
    Figure US20090291437A1-20091126-C00499
    Figure US20090291437A1-20091126-C00500
    Figure US20090291437A1-20091126-C00501
    Figure US20090291437A1-20091126-C00502
    Figure US20090291437A1-20091126-C00503
    Figure US20090291437A1-20091126-C00504
    Figure US20090291437A1-20091126-C00505
    Figure US20090291437A1-20091126-C00506
    Figure US20090291437A1-20091126-C00507
    Figure US20090291437A1-20091126-C00508
    Figure US20090291437A1-20091126-C00509
    Figure US20090291437A1-20091126-C00510
    Figure US20090291437A1-20091126-C00511
    Figure US20090291437A1-20091126-C00512
    Figure US20090291437A1-20091126-C00513
    Figure US20090291437A1-20091126-C00514
    Figure US20090291437A1-20091126-C00515
    Figure US20090291437A1-20091126-C00516
    Figure US20090291437A1-20091126-C00517
    Figure US20090291437A1-20091126-C00518
    Figure US20090291437A1-20091126-C00519
    Figure US20090291437A1-20091126-C00520
    Figure US20090291437A1-20091126-C00521
    Figure US20090291437A1-20091126-C00522
    Figure US20090291437A1-20091126-C00523
    Figure US20090291437A1-20091126-C00524
    Figure US20090291437A1-20091126-C00525
    Figure US20090291437A1-20091126-C00526
    Figure US20090291437A1-20091126-C00527
    Figure US20090291437A1-20091126-C00528
    Figure US20090291437A1-20091126-C00529
    Figure US20090291437A1-20091126-C00530
    Figure US20090291437A1-20091126-C00531
    Figure US20090291437A1-20091126-C00532
    Figure US20090291437A1-20091126-C00533
    Figure US20090291437A1-20091126-C00534
    Figure US20090291437A1-20091126-C00535
    Figure US20090291437A1-20091126-C00536
    Figure US20090291437A1-20091126-C00537
    Figure US20090291437A1-20091126-C00538
    Figure US20090291437A1-20091126-C00539
    Figure US20090291437A1-20091126-C00540
    Figure US20090291437A1-20091126-C00541
    Figure US20090291437A1-20091126-C00542
    Figure US20090291437A1-20091126-C00543
    Figure US20090291437A1-20091126-C00544
    Figure US20090291437A1-20091126-C00545
    Figure US20090291437A1-20091126-C00546
    Figure US20090291437A1-20091126-C00547
    Figure US20090291437A1-20091126-C00548
    Figure US20090291437A1-20091126-C00549
    Figure US20090291437A1-20091126-C00550
    Figure US20090291437A1-20091126-C00551
    Figure US20090291437A1-20091126-C00552
    Figure US20090291437A1-20091126-C00553
    Figure US20090291437A1-20091126-C00554
    Figure US20090291437A1-20091126-C00555
    Figure US20090291437A1-20091126-C00556
    Figure US20090291437A1-20091126-C00557
    Figure US20090291437A1-20091126-C00558
    Figure US20090291437A1-20091126-C00559
    Figure US20090291437A1-20091126-C00560
    Figure US20090291437A1-20091126-C00561
    Figure US20090291437A1-20091126-C00562
    Figure US20090291437A1-20091126-C00563
    Figure US20090291437A1-20091126-C00564
    Figure US20090291437A1-20091126-C00565
    Figure US20090291437A1-20091126-C00566
    Figure US20090291437A1-20091126-C00567
    Figure US20090291437A1-20091126-C00568
    Figure US20090291437A1-20091126-C00569
    Figure US20090291437A1-20091126-C00570
    Figure US20090291437A1-20091126-C00571
    Figure US20090291437A1-20091126-C00572
    Figure US20090291437A1-20091126-C00573
    Figure US20090291437A1-20091126-C00574
    Figure US20090291437A1-20091126-C00575
    Figure US20090291437A1-20091126-C00576
    Figure US20090291437A1-20091126-C00577
    Figure US20090291437A1-20091126-C00578
    Figure US20090291437A1-20091126-C00579
    Figure US20090291437A1-20091126-C00580
    Figure US20090291437A1-20091126-C00581
    Figure US20090291437A1-20091126-C00582
    Figure US20090291437A1-20091126-C00583
    Figure US20090291437A1-20091126-C00584
    Figure US20090291437A1-20091126-C00585
    Figure US20090291437A1-20091126-C00586
    Figure US20090291437A1-20091126-C00587
    Figure US20090291437A1-20091126-C00588
    Figure US20090291437A1-20091126-C00589
    Figure US20090291437A1-20091126-C00590
    Figure US20090291437A1-20091126-C00591
    Figure US20090291437A1-20091126-C00592
    Figure US20090291437A1-20091126-C00593
    Figure US20090291437A1-20091126-C00594
    Figure US20090291437A1-20091126-C00595
    Figure US20090291437A1-20091126-C00596
    Figure US20090291437A1-20091126-C00597
    Figure US20090291437A1-20091126-C00598
    Figure US20090291437A1-20091126-C00599
    Figure US20090291437A1-20091126-C00600
    Figure US20090291437A1-20091126-C00601
    Figure US20090291437A1-20091126-C00602
    Figure US20090291437A1-20091126-C00603
    Figure US20090291437A1-20091126-C00604
    Figure US20090291437A1-20091126-C00605
    Figure US20090291437A1-20091126-C00606
    Figure US20090291437A1-20091126-C00607
    Figure US20090291437A1-20091126-C00608
    Figure US20090291437A1-20091126-C00609
    Figure US20090291437A1-20091126-C00610
    Figure US20090291437A1-20091126-C00611
    Figure US20090291437A1-20091126-C00612
    Figure US20090291437A1-20091126-C00613
    Figure US20090291437A1-20091126-C00614
    Figure US20090291437A1-20091126-C00615
    Figure US20090291437A1-20091126-C00616
    Figure US20090291437A1-20091126-C00617
    Figure US20090291437A1-20091126-C00618
    Figure US20090291437A1-20091126-C00619
    Figure US20090291437A1-20091126-C00620
    Figure US20090291437A1-20091126-C00621
    Figure US20090291437A1-20091126-C00622
    Figure US20090291437A1-20091126-C00623
    Figure US20090291437A1-20091126-C00624
    Figure US20090291437A1-20091126-C00625
    Figure US20090291437A1-20091126-C00626
    Figure US20090291437A1-20091126-C00627
    Figure US20090291437A1-20091126-C00628
    Figure US20090291437A1-20091126-C00629
    Figure US20090291437A1-20091126-C00630
    Figure US20090291437A1-20091126-C00631
    Figure US20090291437A1-20091126-C00632
    Figure US20090291437A1-20091126-C00633
    Figure US20090291437A1-20091126-C00634
    Figure US20090291437A1-20091126-C00635
    Figure US20090291437A1-20091126-C00636
    Figure US20090291437A1-20091126-C00637
    Figure US20090291437A1-20091126-C00638
    Figure US20090291437A1-20091126-C00639
    Figure US20090291437A1-20091126-C00640
    Figure US20090291437A1-20091126-C00641
    Figure US20090291437A1-20091126-C00642
    Figure US20090291437A1-20091126-C00643
    Figure US20090291437A1-20091126-C00644
    Figure US20090291437A1-20091126-C00645
    Figure US20090291437A1-20091126-C00646
    Figure US20090291437A1-20091126-C00647
    Figure US20090291437A1-20091126-C00648
    Figure US20090291437A1-20091126-C00649
    Figure US20090291437A1-20091126-C00650
    Figure US20090291437A1-20091126-C00651
    Figure US20090291437A1-20091126-C00652
    Figure US20090291437A1-20091126-C00653
    Figure US20090291437A1-20091126-C00654
    Figure US20090291437A1-20091126-C00655
    Figure US20090291437A1-20091126-C00656
    Figure US20090291437A1-20091126-C00657
    Figure US20090291437A1-20091126-C00658
    Figure US20090291437A1-20091126-C00659
    Figure US20090291437A1-20091126-C00660
    Figure US20090291437A1-20091126-C00661
    Figure US20090291437A1-20091126-C00662
    Figure US20090291437A1-20091126-C00663
    Figure US20090291437A1-20091126-C00664
    Figure US20090291437A1-20091126-C00665
    Figure US20090291437A1-20091126-C00666
    Figure US20090291437A1-20091126-C00667
    Figure US20090291437A1-20091126-C00668
    Figure US20090291437A1-20091126-C00669
    Figure US20090291437A1-20091126-C00670
    Figure US20090291437A1-20091126-C00671
    Figure US20090291437A1-20091126-C00672
    Figure US20090291437A1-20091126-C00673
    Figure US20090291437A1-20091126-C00674
    Figure US20090291437A1-20091126-C00675
    Figure US20090291437A1-20091126-C00676
    Figure US20090291437A1-20091126-C00677
    Figure US20090291437A1-20091126-C00678
    Figure US20090291437A1-20091126-C00679
    Figure US20090291437A1-20091126-C00680
    Figure US20090291437A1-20091126-C00681
    Figure US20090291437A1-20091126-C00682
    Figure US20090291437A1-20091126-C00683
    Figure US20090291437A1-20091126-C00684
    Figure US20090291437A1-20091126-C00685
    Figure US20090291437A1-20091126-C00686
    Figure US20090291437A1-20091126-C00687
    Figure US20090291437A1-20091126-C00688
    Figure US20090291437A1-20091126-C00689
    Figure US20090291437A1-20091126-C00690
    Figure US20090291437A1-20091126-C00691
    Figure US20090291437A1-20091126-C00692
    Figure US20090291437A1-20091126-C00693
    Figure US20090291437A1-20091126-C00694
    Figure US20090291437A1-20091126-C00695
    Figure US20090291437A1-20091126-C00696
    Figure US20090291437A1-20091126-C00697
    Figure US20090291437A1-20091126-C00698
    Figure US20090291437A1-20091126-C00699
    Figure US20090291437A1-20091126-C00700
    Figure US20090291437A1-20091126-C00701
    Figure US20090291437A1-20091126-C00702
    Figure US20090291437A1-20091126-C00703
    Figure US20090291437A1-20091126-C00704
    Figure US20090291437A1-20091126-C00705
    Figure US20090291437A1-20091126-C00706
    Figure US20090291437A1-20091126-C00707
    Figure US20090291437A1-20091126-C00708
    Figure US20090291437A1-20091126-C00709
    Figure US20090291437A1-20091126-C00710
    Figure US20090291437A1-20091126-C00711
    Figure US20090291437A1-20091126-C00712
    Figure US20090291437A1-20091126-C00713
    Figure US20090291437A1-20091126-C00714
    Figure US20090291437A1-20091126-C00715
    Figure US20090291437A1-20091126-C00716
    Figure US20090291437A1-20091126-C00717
    Figure US20090291437A1-20091126-C00718
    Figure US20090291437A1-20091126-C00719
    Figure US20090291437A1-20091126-C00720
    Figure US20090291437A1-20091126-C00721
    Figure US20090291437A1-20091126-C00722
    Figure US20090291437A1-20091126-C00723
    Figure US20090291437A1-20091126-C00724
    Figure US20090291437A1-20091126-C00725
    Figure US20090291437A1-20091126-C00726
    Figure US20090291437A1-20091126-C00727
    Figure US20090291437A1-20091126-C00728
    Figure US20090291437A1-20091126-C00729
    Figure US20090291437A1-20091126-C00730
    Figure US20090291437A1-20091126-C00731
    Figure US20090291437A1-20091126-C00732
    Figure US20090291437A1-20091126-C00733
    Figure US20090291437A1-20091126-C00734
    Figure US20090291437A1-20091126-C00735
    Figure US20090291437A1-20091126-C00736
    Figure US20090291437A1-20091126-C00737
    Figure US20090291437A1-20091126-C00738
    Figure US20090291437A1-20091126-C00739
    Figure US20090291437A1-20091126-C00740
    Figure US20090291437A1-20091126-C00741
    Figure US20090291437A1-20091126-C00742
    Figure US20090291437A1-20091126-C00743
    Figure US20090291437A1-20091126-C00744
    Figure US20090291437A1-20091126-C00745
    Figure US20090291437A1-20091126-C00746
    Figure US20090291437A1-20091126-C00747
    Figure US20090291437A1-20091126-C00748
    Figure US20090291437A1-20091126-C00749
    Figure US20090291437A1-20091126-C00750
    Figure US20090291437A1-20091126-C00751
    <