WO2014189306A1 - 항 ＴＮＦ-α/ＣＸＣＬ10 이중 타겟 항체 및 그의 용도 - Google Patents

항 ＴＮＦ-α/ＣＸＣＬ10 이중 타겟 항체 및 그의 용도 Download PDF

Info

Publication number
WO2014189306A1
WO2014189306A1 PCT/KR2014/004579 KR2014004579W WO2014189306A1 WO 2014189306 A1 WO2014189306 A1 WO 2014189306A1 KR 2014004579 W KR2014004579 W KR 2014004579W WO 2014189306 A1 WO2014189306 A1 WO 2014189306A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
tnf
antibody
amino acid
variable region
Prior art date
Application number
PCT/KR2014/004579
Other languages
English (en)
French (fr)
Other versions
WO2014189306A8 (ko
Inventor
강흔수
박소현
송영욱
신기철
이은영
이은봉
박영우
박범찬
이동희
김동진
윤선하
이기세
이현주
김경진
김희찬
유석호
장명희
장세일
Original Assignee
메타볼랩(주)
서울대학교 산학협력단
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 메타볼랩(주), 서울대학교 산학협력단, 한국생명공학연구원 filed Critical 메타볼랩(주)
Priority to JP2016515273A priority Critical patent/JP2016520595A/ja
Priority to AU2014269287A priority patent/AU2014269287B2/en
Priority to BR112015029224A priority patent/BR112015029224A2/pt
Priority to CN201480029427.2A priority patent/CN105263964A/zh
Priority to US14/893,071 priority patent/US10087248B2/en
Priority to EP14801159.6A priority patent/EP3000827B1/en
Priority to CA2913118A priority patent/CA2913118A1/en
Publication of WO2014189306A1 publication Critical patent/WO2014189306A1/ko
Priority to PH12015502601A priority patent/PH12015502601A1/en
Publication of WO2014189306A8 publication Critical patent/WO2014189306A8/ko
Priority to HK16111369.2A priority patent/HK1223112A1/zh

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241—Tumor Necrosis Factors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/02—Nasal agents, e.g. decongestants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/04—Antipruritics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates to a TNF-a / CXCL-10 double target antibody that specifically binds to TNF—a (tumor necrosis factor-alpha) and CXCLKKC—X—C motif chemokine 10).
  • the antibody is connected to Paul Lee peptide disulfide bond (disulfide bond) of the large heavy chain (heavy chain) with a molecular weight of smaller light chain (light chain) molecular weight to form a release dimer (heterodimer), body two releasing dual It is then connected by disulfide bonds to form tetraiiiers.
  • the polypeptide that makes a heavy chain is composed of four domains. From the N-terminus, the polypeptide consists of a variable region, a ball region, a constant region 2, and a constant region 3.
  • the polypeptide that forms a light chain consists of two domains. It consists of variable region and constant region from N-terminal. Among them, the conjugate of the variable region of the heavy chain and the variable region of the light chain is combined with one antigen.
  • the reaction between the labeled chemical marker, antigen, and its antibody ' reveals a high degree of specificity.
  • An antigenic site that interacts with an antibody is called an antigenic determinant or epitope, and the antigenic determinant and the variable region that is the antigen binding site of the antibody bind specifically do. Therefore, the antigen binding site can bind only one epitope, so that many antibodies can each provide specific immunity to antigens that carry specific determinants.
  • Bispecific antibodies have attracted attention as pharmaceuticals because of their high stability in blood and low antigenicity.
  • Bispecific antibodies can be roughly divided into two types. In the first case, the antibody is modified by recombinant DNA technology to have an antigen binding site capable of binding to two different antigens. In this case, one binding site is specific for an antigen and the second binding site is used. Can bind to two antigens simultaneously as antibodies specific for another antigen (Beck A et. Al., Nat Rev immunology 10; 345 352, 2010).
  • the second type of bispecific antibody is a very recently developed antibody that is a normal antibody with one antigen-binding site.
  • bispecific antibodies have the advantage of high target specificity because they can act by binding to specific toxic cells and target cells.
  • TNF- ⁇ blockers etanercept, infliximab, adal imumab, etc.
  • anakinra a recombinant interleukin ⁇ 1 receptor antagonist
  • inter leukin ⁇ 6 antagonists toci 1 izumab
  • CTLA4Ig abatacept
  • ⁇ eel 1 depleting agent rituximab
  • TNF- ⁇ tumor necrosis factor-alpha
  • B and T lymphocytes immune cells including B and T lymphocytes, non-immune cells, and various tumor cells
  • TNF-a is improperly produced in inflammatory diseases such as rheumatoid arthritis
  • various cells of the immune system are activated to induce cytotoxic effects, and reactions such as inflammation, tissue destruction, and organ damage appear.
  • TNF—a The main biological actions of TNF—a are first to regulate growth, differentiation and metabolism in various types of cells; Second, it stimulates lipolysis, inhibits lipoprotein lipase activity present in adipocytes, stimulates hepatic lipogenesis and induces cachexia; And third, induces apoptosi s.
  • TNF— ⁇ may exist in free form or in membrane-bound form. Both forms of TNF- ⁇ induce very strong inflammatory reactions in cells and promote disease states in tissues. TNF- ⁇ bound to the cell membrane exhibits cytotoxic and inflammatory effects through cell-to-cell contact, and is freed from the cell membrane by TNF- ⁇ converting enzyme (TACE) to exist outside the cell.
  • TACE TNF- ⁇ converting enzyme
  • TNF-a exhibits biological activity by binding to two receptors, TNF type I receptor (p55) or TNF type II receptor (p75), in bloodemia.
  • TNF type I receptor p55
  • TNF type II receptor p75
  • over-produced TNF-a stimulates macrophages in patients with rheumatoid arthritis to produce inflammatory mediators that amplify inflammatory reactions, and induce adhesion molecules in vascular endothelial cells to inflame more inflammatory cells. It is able to gather to the site where this occurred, causing fibroblasts to produce proteases that damage cartilage, bones and ligaments and worsen the disease.
  • TNF- ⁇ inhibitors were first commercialized and marketed after the first approval of etanercept from the US Food and Drug Administration for the treatment of rheumatoid arthritis in November 1998, and infliximab and adalimumab are on the market. It is becoming.
  • treatment reactions to TNF- ⁇ inhibitors vary from patient to patient, as the activity of the disease and its corresponding structural impairment, the effect on disease quality of life, and the symptoms and signs caused by the disease vary. It can vary.
  • the sensitivity to the drug, the manifestation of the effect, or side effects may also appear in various ways.
  • TNF-a inhibitors Different constituents, specific mechanisms of action, pharmacological mechanisms, and biopharmaceutical properties differ among the various types of TNF-a inhibitors.
  • Animal studies demonstrating the efficacy of TNF- ⁇ inhibitors use human TNF- ⁇ transgenic (Tg) mice, which develop arthritis similar to rheumatoid arthritis at 4-5 weeks of age, and from 9 to 10 weeks of age. Significant range of motion limitation of the lower limb joint is observed.
  • CXCL10 C-X-C motif chemokine 10
  • IP # 10 interferon gamma inducible protein 10
  • CXCL10 has cheino tactic activity and is known to be involved in mitogenic activity. It is secreted by a variety of cells, including endothelial cells, monocytes, fibroblasts and keratinocytes in response to IFN- ⁇ and also dermal macrophages and endothelial cells in delayed type hypersensitivity (DTH) in human skin. Turned out to be present in. In addition, it can be induced by IFN- ⁇ in dendritic cells as well as by induction by native IFN- ⁇ and can be induced in central nervous system cells by stimulation such as IFN-x, virus and lipopolysaccharide.
  • CXCR3 The receptor for CXCL10 has been identified as CXCR3, seven transmembrane receptors.
  • CXCR3 is expressed in activated T lymphocytes and monocytes, synovial cells, endothelial cells, Mi cells, and eosinophils.
  • Two different ligands of CXCR3, MIGdiionocyte / macrophage activating, I FN- ⁇ -inducible protein) and I—TACCIFN- -inducible T cell al ha chenioat tracUnt 1) are also known to bind CXCR3. Binding of CXCL10 to CXCR3 mediates calcium mobilization and chemotaxis in activated T cells and activated NK cells. Within the thymus CXCL10 was found to be a chemical attractant (chemoaUractant) for TCRa i3 + CD8 + T cells, TCRy ⁇ + T cells and ⁇ —type cells.
  • chemoaUractant chemical attractant
  • CXCL10 or its receptor, CXCR3 has been identified in a variety of other inflammatory and autoimmune diseases including multiple sclerosis, rheumatoid arthritis, ulcerative colitis, hepatitis, inflammatory myositis, spinal cord injury, systemic lupus erythematosus, transplant rejection, Sjogren's syndrome.
  • CXCL10 specifically acts on the inflammatory response or immune response other than the cheiiiot axis in these diseases, and how important it is as a therapeutic target.
  • Neutralizing multiple targets with one type of antibody may be a more effective therapeutic agent than monoclonal antibody therapies targeting single antigens in the treatment of autoimmune diseases, where numerous inflammatory mediators contribute to etiology.
  • Efforts to recognize two targets with antibodies made from a combination of two different antibodies have already been reported by several researchers. Recent studies (Bostrom et al. Science 2009) screen for antibodies that simultaneously neutralize vascular endothelial growth factor (VEGF) in antibody libraries that mutated the light chain CDRs of antibodies that recognize human epidermal growth factor receptor 2 (HER2). Succeeded.
  • VEGF vascular endothelial growth factor
  • the antibody is a bispecific dual antibody that recognizes both mediators that contribute to the pathogenesis of a disease, in particular, having the same structure as a normal IgG, predictable pharmacokinetic properties, and bi or monovalent. ) Has the advantage of making all antibodies.
  • many papers and patent documents are referenced and their citations are indicated.
  • the disclosures of cited papers and patent documents are The level of the technical field to which the present invention pertains and the content of the present invention are more clearly described by reference to the present specification as a whole.
  • the present inventors have tried to develop a bispecific antibody that specifically binds to TNF- ⁇ and CXCL10, and as a result, scFv having a heavy chain variable region and a light chain variable region of CXCL10 specific antibody is identified as a heavy chain constant region of TNF—a specific antibody.
  • An antibody was prepared in the form of a C-terminally bound antibody, and the antibody was confirmed to bispecifically bind to TNF—a and CXCL10, and TNF-a / CX—10 that specifically binds to TNF—a and CXCL10.
  • the present invention was completed by experimentally identifying that the dual target antibody has the ability of inhibiting TNF-a and inhibiting osteoclast differentiation.
  • an object of the present invention is to provide a TNF-a / CXCL-10 dual target antibody that specifically binds to TNF-a (tumor necrosis factor-alpha) and CXCL10 (C-X-C motif chemokine 10).
  • Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of immune diseases, including TNF-a / CXCL-10 dual target antibody.
  • the present invention provides a first antigen binding site that specifically binds to TNF- ⁇ (tumor necrosis factor-alpha), and an agent that specifically binds to CXCL10 (C—XC motif chemokine 10). 2 antigen binding site,
  • HCDR heavy chain complementarity determining region
  • HCDR2 comprising an amino acid of SEQ ID NO: 2
  • amino acid of SEQ ID NO: 3 A light chi complementarity determining region (LCDR) 1 comprising a heavy chain variable region (VH) comprising HCDR3, comprising an amino acid of SEQ ID NO: 5, an LCDR 2 comprising an amino acid of SEQ ID NO: 6,
  • a light chain variable region (VL) comprising LCDR3 comprising the amino acid of SEQ ID NO: 7,
  • the second antigen binding site is composed of HCDR1 SEQ ID NO: 10, SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID NO: 26 including amino acids selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 21, and SEQ ID NO: 25
  • a heavy chain variable region (VH) comprising an HCDR2 comprising an amino acid selected from the group comprising SEQ ID NO: 11, SEQ ID NO: 19, SEQ ID NO: 23, and SEQ ID NO: 27
  • LCDR1 comprising an amino acid selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 29, SEQ ID NO: 33, and SEQ ID NO: 37, and comprising an amino acid selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 30, SEQ ID NO: 34, and SEQ ID NO: 38
  • LCDR comprising an amino acid selected from the group consisting of LCDR2, SEQ ID NO: 15, SEQ ID NO: 31, SEQ ID NO: 35, and SEQ ID NO:
  • TNF-a / CXCL-10 dual target antibody is provided.
  • the present inventors have tried to develop a bispecific antibody that specifically binds to TNF— ⁇ and CXCL10.
  • scFv having a heavy chain variable region and a light chain variable region of a CXCL10 specific antibody is identified as a heavy chain constant region of a TNF— ⁇ specific antibody.
  • An antibody of the form C-terminally bound was prepared, and the antibody was confirmed to bispecifically bind to TNF— ⁇ and CXCL10, and TNF-a / CXCL-10 that specifically binds to TNF— ⁇ and CXCL10. It was experimentally found that the dual target antibody has TNF—a inhibitory activity and osteoclast differentiation inhibitory activity.
  • the antibody used in the present invention is a TNF- ⁇ / CXCL-10 dual target antibody that specifically binds a tumor necrosis factor-alpha (TNF-a) and a CXC motif chemokine 10 (CXCL10).
  • the antibody of the invention is a human antibody.
  • human antibody refers to an antibody from which the sequences of the variable and constant regions of the heavy and light chains are derived from humans, as described in the Examples below.
  • Engineering techniques were used to prepare TNF-a / CXCL-10 dual target human antibodies.
  • Human antibodies have advantages over non-human and chimeric antibodies: effector portions of human antibodies interact better with other parts of the human immune system (eg, complementarity-dependent cytotoxicity (CDC) or antibody-dependent cells). Cytotoxicity (ADCC) destroys the target cells more efficiently), which is why the immune response to antibodies introduced into the body is not exogenous to the exogenous non-human antibody or partially exogenous because the human immune system does not recognize human antibodies as foreign substances. Less compared to chimeric antibodies, etc.-.
  • human antibodies have a much shorter half-life in the human circulation than the half-life of human antibodies.
  • human antibodies introduced into vivo are more useful because they have substantially the same half-life as naturally occurring human antibodies, thereby reducing the dose and frequency of administration.
  • variable region refers to a portion of an antibody molecule that exhibits many variations in sequence while performing a function of specifically binding to an antigen, and CDRl, CDR2 and CDR3 are present in the variable region.
  • a framework region (FR) portion exists between the CDRs to support the CDR rings.
  • complementarity determining region is a ring-shaped region that is involved in the recognition of an antigen, and as the sequence of this region changes, the specificity of the antibody to the antigen is determined.
  • the term “panning” refers to a surface of a peptide having the property of binding to a target molecule (antibody, enzyme, cell surface receptor, etc.) from a phage library that displays the peptide on the coat of the phage. It refers to the process of selecting only phages that are expressed in.
  • the dual target antibody includes a first antigen binding site that specifically binds to TNF- ⁇ , and a second antigen binding site that specifically binds to CXCL10,
  • the first antigen binding site comprises a heavy chian complementarity determining region (HCDR) 1 consisting of the amino acid sequence of SEQ ID NO: 1, HCDR2 consisting of the amino acid sequence of SEQ ID NO: 2, HCDR3 consisting of the amino acid sequence of SEQ ID NO: 3
  • Light chian complementarity determining region (LCDR) 1 comprising a heavy chain variable region (VH) comprising amino acid sequence of SEQ ID NO: 5
  • LCDR2 consisting of the amino acid sequence of SEQ ID NO: 6
  • a light chain variable region (VL) comprising an LCDR3 composed of sequences
  • the second antigen binding site is HCDR1 comprising an amino acid selected from the group consisting of SEQ ID NOs: 9, 17, 21 and 25, HCDR2 comprising an amino acid selected from the group consisting of SEQ ID NOs: 10, 18, 22 and 26, sequence A heavy chain variable region (VH) comprising HCDR3 comprising an amino acid selected from the group consisting of numbers 11, 19, 23, and 27,
  • LCDR1 comprising an amino acid selected from the group consisting of SEQ ID NOs: 13, 29, 33, and 37
  • LCDR2 comprising an amino acid selected from the group consisting of SEQ ID NOs: 14, 30, 34, and 38, SEQ ID NOs: 15, 31, 35 and It is preferred to include, but is not limited to, a light chain comprising a light chain variable region (VL) comprising an LCDR3 comprising an amino acid selected from the group consisting of 39 or a fragment thereof.
  • VL light chain variable region
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 9, HCDR2 comprising an amino acid of SEQ ID NO: 10, HCDR3 comprising an amino acid of SEQ ID NO: 11, and ,
  • VH heavy chain variable region
  • VL light chain variable region
  • LCDR1 comprising an amino acid of SEQ ID NO: 13
  • LCDR2 comprising an amino acid of SEQ ID NO: 14
  • LCDR3 comprising an amino acid of SEQ ID NO: 15.
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 17, HCDR2 comprising an amino acid of SEQ ID NO: 18, HCDR3 comprising an amino acid of SEQ ID NO: 19, and a sequence A light chain variable region (VL) comprising an LCDR1 comprising an amino acid of No. 29, an LCDR2 comprising an amino acid of SEQ ID NO: 30, and an LCDR3 comprising an amino acid of SEQ ID NO: 31.
  • VH heavy chain variable region
  • VL sequence A light chain variable region
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 21, HCDR2 comprising an amino acid of SEQ ID NO: 22, HCDR3 comprising an amino acid of SEQ ID NO: 23, and a sequence A light chain variable region (VL) comprising an LCDR1 comprising an amino acid of No. 33, an LCDR2 comprising an amino acid of SEQ ID NO: 34, and an LCDR3 comprising an amino acid of SEQ ID NO: 35.
  • VH heavy chain variable region
  • VL sequence A light chain variable region
  • the second antigen binding site comprises a heavy chain variable region (VH) comprising HCDR1 comprising an amino acid of SEQ ID NO: 25, HCDR2 comprising an amino acid of SEQ ID NO: 26, HCDR3 comprising an amino acid of SEQ ID NO: 27, and a sequence A light chain variable region (VL) comprising LCDR1 comprising an amino acid of No. 37, LCDR2 comprising an amino acid of SEQ ID NO: 38, and 1XDR3 comprising an amino acid of SEQ ID NO: 39.
  • VH heavy chain variable region
  • VL sequence A light chain variable region
  • the first antigen binding site of the TNF-a / CXCL ′ 10 dual target antibody comprises a heavy chain variable region (VH) comprising an amino acid of SEQ ID NO: 4 and a light chain variable region (VL) comprising an amino acid of SEQ ID NO: 8 But is not limited thereto.
  • the second antigen binding site of the TNF-a / CXCL ′ 10 dual target antibody is a variable chain region (VH) comprising amino acids of SEQ ID NOs: 12, 20, 24 and 28 and amino acids of SEQ ID NOs: 16, 32, 36 and 40 It is preferred to include a light chain variable region (VL) including, but is not limited thereto.
  • VH variable chain region
  • VL light chain variable region
  • the TNF ⁇ a / CXa-10 dual target antibody comprises a heavy chain and a light chain of a first full length antibody that specifically binds TNF—a; And a heavy chain and a light chain of a second full length antibody that specifically binds CXCL10, wherein the first full length antibody And the heavy chain constant region O-terminus of the second full-length antibody is connected to each other, specifically, the light chain and the light chain of the first full-length antibody specifically binding to TNF— ⁇ ; And a fragment of a second full length antibody that specifically binds to CXCL10 and comprises a heavy chain and a light chain of a second antibody, wherein a fragment of the second antibody is linked to the heavy chain constant region C-terminus of the first full length antibody. (See FIG. 1).
  • the fragment of the TNF-a / CXCL-10 dual target antibody is preferably a single chain variable fragment (scF), but is not limited thereto.
  • scF single chain variable fragment
  • the TNF-a / CXCL-10 dual target antibody is preferably a linker between hing-body-antibody or hing-body-fragment, but is not limited thereto.
  • the present inventors cloned the gene of human CXCL10 to produce CXC.L10 antigen protein (see FIG. 2), and reacted with library phage to obtain scFv—phage that specifically binds to CXCL10.
  • the panning process was performed to infect E. coli and amplify it.
  • the titer of the colony to the metliptase of the phage subjected to the three-panning was amplified to 5.67 ⁇ 10 8- (see Table 1).
  • the inventors selected a monoclonal antibody from the group of three-paneled polyclonal phage antibody with a large _ phase binding capacity (see FIG. 3), and performed a ELISA analysis thereof to select a monoclonal antibody once more (Table 2). Reference). Fingerprinting and sequencing were performed to classify and test the monoclonal phages thus selected (see FIG. 4), through which the patterns and polypeptide sequences of the CDR regions of the VH and VL of the four selected monoclonal antibodies were obtained. (See Table 5 and Table 6).
  • the present inventors transformed 10E out of the four selected monoclonal phages into full-form IgG and inserted the heavy and light chains into the vector, respectively, and cotransformed them into host cells to prepare transformants. Through the whole Forms of the antibody were measured to determine the binding affinity for the CXCL10 antigen, it was confirmed that the value of 7 X 10-12 (see Table 8).
  • the present inventors cloned the selected 10E gene into a plasmid of Humira, an anti-TNF-a monoantibody, to prepare HuElO-101, a bispecific antibody for TNF-a and CXCL10 (see FIG. 1).
  • the molecular weight of the antibody thus prepared was confirmed to be about 187 kDa (see FIG. 6), and ELISA analysis confirmed that the binding force to TNF— ⁇ and CXCL10 was similar to that of HuElO-100 prepared through previous studies ( See FIG. 7).
  • the cytotoxicity of HuEl 101 antibody prepared by LAL test was 0.1 EU / IN. It confirmed that it was the following (refer FIG. 8).
  • the inventors evaluated the in vitro inhibition of TNF- ⁇ or CXCL10 of HuElO'101 prepared above. Specifically, it was confirmed that the HuE10-101 antibody had improved suppression ability compared to Humira using WEHI164 cells having a TNF-ci receptor (see FIGS. 41 and 42). It was confirmed that it has a CXCL10 inhibitory ability (see FIG. 43).
  • the invention is an expression vector comprising a polynucleotide encoding a first antigen binding site and an expression vector comprising a polynucleotide encoding a second antigen binding site is co-transformed into a host cell. It provides a transformant (co-transfection).
  • Polynucleotides encoding an antibody of the invention may be due to the degeneracy of codons or the above. In consideration of the codons preferred by the organism to express the antibody, various modifications can be made to the coding region within the range of not changing the amino acid sequence of the antibody expressed from the coding region, and the expression of the gene even in parts other than the coding region. Various modifications or formulas can be made without affecting Those skilled in the art will appreciate that such modified genes are also within the scope of the present invention. That is, as long as the polynucleotide of the present invention encodes a protein having equivalent activity, one or more nucleic acid bases may be substituted, deleted, inserted, or . Variations may be made by combinations thereof, and these are also included in the scope of the present invention. The sequence of such polynucleotides may be single or double stranded, and may be DNA molecules or RNA (mRNA) molecules.
  • mRNA RNA
  • expression control sequences such as promoters, terminators, enhancers, and the like, sequences for membrane targeting or secretion, etc., depending on the type of host cell in which the antibody is to be produced. It can be appropriately selected and various combinations depending on the purpose.
  • Expression vectors of the present invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors.
  • Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals and enhancers and can be prepared in various ways depending on the purpose.
  • the promoter of the expression vector may be constitutive or inducible.
  • the signal sequence includes a PhoA signal sequence and a Q pA signal sequence when the host is Escherichia sp., And ⁇ -amylase signal sequence and subtilis when the host is Baci Hus sp.
  • the present invention comprises the steps of (a) culturing the transformant; And 2) the TNF- from the culture cultured in the step.
  • a method for preparing a TNF ′ a / CXCL10 dual target antibody comprising purifying a / CXCL-10 dual target antibody.
  • the antibody according to the present invention can be mass produced by culturing the transformed host cell. Suitable culture methods and media conditions depending on the type of host cell can be easily selected by those skilled in the art from known techniques known to those skilled in the art.
  • the host cell may be a prokaryote such as E. coli or Bacillus subtil is. It may also be eukaryotic cells derived from yeast, insect cells, plant cells or animal cells such as Saccharomyces cerevisiae. More preferably, the animal cell may be an autologous or allogeneic animal cell.
  • Transformants prepared by introducing into autologous or allogeneic animal cells may be used in cell therapies for administration to a subject to treat cancer.
  • the expression vector introduction method into the host cell may be any method known to those skilled in the art.
  • the invention is a pharmaceutically effective amount of the TNF-a / CXCL-10 dual target antibody; And (b) provides a pharmaceutical composition for the prevention or treatment of immune diseases comprising a pharmaceutically acceptable carrier.
  • the pharmaceutical composition for preventing and treating immune diseases alone or in combination with a conventional pharmaceutically acceptable carrier can be used as
  • the composition of the present invention can be usefully used as an immunosuppressive agent (i ⁇ LUIO-suppressant) for preventing graft rejection of tissues or organs mediated by immune response.
  • Graft rejection is a disease caused by the genetic background between the donor and the recipient of the graft (a cell, tissue, or organ as part of the transplanted organism) (1).
  • Graft Host diseases and (2) diseases caused by the recipient's recognition of the donor's graft as a foreign substance, ie graft rejection.
  • transplanted tissues and organs that cause rejection include heart, kidney, liver, medulla ossium, skin, cornea, lung, pancreas, intest inum uben, limbs, muscles, nerves.
  • Graft zone-host disease caused by cartilage transplantation, as well as, duodenum, small intestine (smal 1-bowel), and pancreatic-islet-cel 1.
  • composition of the present invention can be applied to the treatment and prevention of autoimmune diseases.
  • Autoimmune diseases are diseases that are caused by immune cells attacking themselves without distinguishing themselves from foreign substances.
  • autoimmune diseases include rheumatoid arthritis, systemic lupus erythematos is, E-hyperimi inoglobulin E, Hashimoto's thyroiditis, and Graves' disease.
  • Grave's Disease Multiple Sclerosis, Scleroderma, Scleroderma, Progressive Systemic Sclerosis, Myasthenia Gravis, Type I Diabetes, Uveitis allergic encephalomyelitis (allergic encephalomyelitis), ⁇ gucheo 1 nephritis (gloi erulonephr itis), vitiligo (Vitilligo), gutpae tipped Sindh name (Goodpasture syndrome), Vespa jet disease (Becet 's disease), Crohn's disease (Crohn' s Disease, Ankylosing Spondylitis, Uvei tis, Thrombocytopenic purpura, Pemphigus vulgaris, Diabetes, Autoimmune hemolytic anemia utoimmune Anemia, Cryoglobulinemia, Adrenal Protein Ditrophy (ALD) and Systemic Lupus Erythematosus (SLE).
  • ALD Adrenal Protein Ditrophy
  • SLE Systemic Lupus Erythemato
  • composition of the present invention can also be used for the treatment and prevention of skin manifestations of inflammatory and hyperproliferative skin diseases and immune mediated diseases.
  • diseases are for example psoriasis, atopic dermatitis, contact dermatitis, eczema Dermatitis (eczematous dermatitises), seborrhoeis dermatitis, lichen planus, pemphigus, bullous pemphigoid, vesicular epidermolysis bullosa, urtic icaria, angioedema angioedemas, vascul it ides, erythemas, cutaneous eosinophi 1 ias, lupus erythematosus, Systemic Lupus Erythematosus (SLE), acne And Alopecia areata.
  • compositions of the present invention can be used for the treatment or prevention of eye diseases or various autoimmune diseases.
  • these diseases include keratoconjunctivitis (keratoconjunct ivi t is), chungyeo l z l "conjunctivitis (vernal conjunct ivi t is), keratitis (keratitis), herpes keratitis (herpetic keratitis), epithelial corneal muscular atrophy (dystrophia epithel ial is corneae ), Corneal leukoma, ocular pemphigus, Mooren's ulcer, scleritis, Graves' opthalmopathy, Vogts Koyanagi- Vogt -Koyanag i — Ha r ad a synd r ome), sarcoidosis, and multiple myeloma.
  • compositions of the present invention may be used for chronic obstructive pulmonary disease (COPD), asthma (eg, bronchial asthma, allergic asthma, endogenous asthma, exogenous asthma and dust asthma), especially chronic or It can also be used to treat and prevent obstructive airway diseases such as chronic asthma (eg, terminal asthma and bronchial hyperresponsiveness), bronchitis, allergic rhinitis.
  • COPD chronic obstructive pulmonary disease
  • asthma eg, bronchial asthma, allergic asthma, endogenous asthma, exogenous asthma and dust asthma
  • chronic airway diseases such as chronic asthma (eg, terminal asthma and bronchial hyperresponsiveness), bronchitis, allergic rhinitis.
  • the pharmaceutically acceptable contained in 'the pharmaceutical compositions of this invention lactose, dextrose, sucrose, sorbitan frame, the manni, starch, gum acacia, calcium phosphate, alginates , Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, stearic acid magnesium and mineral oil Including but not limited to It is not.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a sulfate, a glycerol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannito
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration , intranasal administration, intrapulmonary administration and rectal administration Or the like.
  • parenteral administration intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration , intranasal administration, intrapulmonary administration and rectal administration Or the like.
  • oral compositions should be formulated to coat the active agent or to protect it from degradation in the stomach.
  • the pharmaceutical composition may also be administered by any device in which the active agent may migrate to the target cell.
  • Suitable dosages of the pharmaceutical compositions of the present invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and reaction response to the patient. Typically, the skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the pharmaceutical composition of the present invention and the daily dose is 0.001-100 rag / kg. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to prevent or treat an immune disease.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of axles, powders, suppositories, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
  • the antibody composition of the present invention may be administered as a separate therapeutic agent or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents.
  • Antibodies can be introduced in vivo in the form of antibody-therapeutic conjugates to be used for the treatment of immune diseases.
  • Therapeutic agents include chemotherapeutic agents, radionuclides, immunotherapeutics, cytokines, chemokines, toxins, biological agents and enzyme inhibitors. Methods for binding antibiotics to antibodies are described, for example, in G. Gregoriadies, eel. Academic Press London, (1979); Arnon et al. , Recent Results in Cancer Res. , 75: 236 (1980); and Moo It on et al,, Immunolog. Res. , 62:47 (1982).
  • Preferred agents for coupling with the antibodies or antibody fragments of the invention are antibacterial, antiparasitic, antifungal and related agents, for example sulfonamides, penicillins and cephalosporins, aminoglycosides, tetracyclines, chloramphenicols, piperazine, chloroquine , Diaminopyridine, metronidide, isoniazid, rifampin, straptomycin, sulfone, erythromycin, polymyxin, nystatin, amphotericin, 5-fluorocytosine, 5-iodine—2 'deoxyuridine , 1-adamantaamine, adenine arabinoside, ammannitine, ribovarin and azithrothymidine (AZT), preferably ribovarin.
  • sulfonamides for example sulfonamides, penicillins and cephalosporins, aminoglycosides, tetracyclines, chloramphen
  • Immunomodulators that can be used as therapeutic agents in the antibody ⁇ therapeutic agent conjugate include, but are not limited to, lymphokines and cytokines.
  • the dual target antibody of the present invention is a bispecific antibody that effectively binds both TNF— ⁇ and CXCL10, TNF—a / CXCL10 can be recognized. It can be usefully used as an exogenous target antibody.
  • composition of the present invention comprises a TNF-a / CXa-10 supporting target antibody that effectively binds both TNF- ⁇ and CXCL10.
  • Dual target antibodies of the invention have superior TNF—a inhibitory activity and osteoclast differentiation inhibitory activity as compared to TNF-a or CXCL10 single target antibody.
  • composition of the present invention can be used for the prevention or treatment of immune diseases.
  • FIG. 1 is a schematic diagram of preparation of a TNFVII a / CXCL10 bispecific antibody.
  • Figure 2 shows the results of the purification of human CXCL10 protein purified using Ni-NTA column chromatography.
  • Fig. 3 shows the results of poly ⁇ phage EL ISA analysis of human CXCL10—His using phage pools after each panning.
  • the result is a BstNI fingerprint.
  • the scFv inserts were amplified from individual colonies and the amplified products were analyzed with 8% polyacrylamide gels limited to BstNI ' . Clones marked with blue letters show different groups.
  • Figure 6 shows the results of purity analysis of the purified HuElO- 101 double antibody.
  • Figure 7 is a graph measuring the binding force of the HuElO- 101 double antibody to the antigen.
  • FIG. 8 shows the results of examining the cytotoxicity of purified HuElO-101 dual antibodies.
  • 9 is a map of HuE10-101 expression vector for production cell line construction.
  • Figure 10 shows the results of the HuElO-101 expression according to the transfection conditions.
  • 11 is an image of colonies screened using DHFR.
  • 12 shows the results obtained by dot-blotting the HuElO-101 expression in a single clone selected using DHFR.
  • Figure 13 is the result of comparing the relative expression amount of single clones selected using DHFR by ELISA method.
  • FIG. 14 is a graph showing 29 clones selected according to a relatively high ELISA score in the results of FIG. 13.
  • 16 is a micrograph of preliminary cell lines growing in medium containing 100 nM MTX.
  • FIG. 17 shows the HuElO-101 expression levels of three clones with high expression rates at 100 nM MTX.
  • 19 shows the result of confirming the N-terminal amino acid sequence of HuElO-101.
  • 20 shows peptide mapping results of HuE10-K) l.
  • Fig. 25 shows evaluation results of anti-TNF- ⁇ inhibitory activity of Humira, Humira cloned antibody, HuE10-101, HuIL21R-101 and HuIL21R-100.
  • Fig. 26 is a graph showing the results of evaluating coins capacity of HuElO—101 for CXCL10.
  • NC negative control
  • PC positive control
  • PBMC peripheral blood mononuclear cell
  • PC positive control (left: Jurkat T cell, oh: PBMC)
  • Fig. 29 shows the results of measuring the inhibitory effect of osteoclast differentiation by anti—TNF— ⁇ and anti-CXCL10 (TRAP positive multinucleated cell count results).
  • FIG. 30 shows the results of TNF-Q neutralization evaluation in order to evaluate the efficacy of antibodies produced in production cell lines.
  • Figure 31 is a result of measuring the arthritis induction score after the administration of Humira and Humira clone antibody by concentration.
  • 35 is a result of measuring the arthritis induction score after HuElO-101 by concentration.
  • 36 shows the results of measuring weight change after administration of HuElO-101 by concentration.
  • Figure 37 shows the result of measuring the histological score after administration of HuElO-101 by concentration.
  • FIG. 41 shows the results of pathological changes of the Tgl97 mouse tissue obtained after the experiment.
  • Fig. 43 shows the result of comparing HuElO—101 produced in the producing cell line with the arthritis induction score and the histological score.
  • Fig. 47 shows the bones identified using micro CT in the K / BxN serum transfer arthritis mouse model.
  • 48 shows the results of histopathological lesions in the K / BxN serum transfer arthritis mouse model.
  • 49 is a schematic diagram of the evaluation of osteoclast differentiation capacity of HuElO-101 in LPS-induced inflammatory bone loss mouse model.
  • FIG. 51 shows the results of evaluating osteoclast differentiation capacity of HuElO-101 produced in production cell line in LPS-induced inflammatory bone loss mouse model.
  • FIG. 52 shows the results of quantitative analysis of osteoclast differentiation capacity of HuElO-101 produced in production cell line in LPS-induced inflammatory bone loss mouse model.
  • FIG. 53 is a schematic diagram of the efficacy evaluation of HuE10-101 in the collagen-induced arthritis mouse model.
  • Fig. 54 shows the result of confirming the cross-reaction of ⁇ hiElO 1 1 using three tissues of three non-overlapping tissues.
  • human CXCL10 protein was expressed and purified. Specifically, spleen, placenta, liver and kidney cDNA library mixes were inserted into the pET22b vector to amplify human CXCL10.
  • pET22b human CXCL10 plasmid
  • the obtained transformants were inoculated into LB plates containing ampicillin (ampicillin), and then cultured overnight, followed by shaking culture at 37 ° C. Then, when the OD600 value was 0.55, IPTG was added at a concentration of 0.5 mM, followed by incubation overnight, and centrifuged at 6 ° 500 rpm and 4 ° C. for 15 minutes to obtain a supernatant. The obtained supernatant was concentrated and reacted with Ni—NTA agarose, followed by elution after filling the agarose beads into a column. After concentration, a 15% SDS-PAGE gel was used and stained with coomassiae-.
  • Panning is based on the phage library expressing the peptide on the surface of the phage, and expresses only the phage expressing the peptide on the surface having the property of binding to the target molecule (antibody, enzyme, cell surface receptor, etc.). The process of selection. Phage panning was performed to prepare a group of phage antibodies for producing monoclonal antibodies of CXCL10. Purified human CXCL10 antigen 100 obtained in Example 1 was added to an Immunosorb tube (Nunc 470319) with 2 inf.
  • the eluted phages were amplified by infection with E. coli (XLl-Blue, stratagene, 200249). Phage amplified in the first panning 8 g of PBST (140 mM NaCKsigma, S7953-5 kg), 1.15 g of 10 mM Na 2 HP0 4 (Sigma, S7907-dibasic), 1.8 mM H 2 P0 4 (sigma, S— 5655— 500 g: monobasic) 0.2 g, 2.7 mM CKsigma p9541) 0.2 g, Twen 20 (sigma, pl379) 0.55%) wash By increasing the number of times in the phase (2nd: 13 times, 3rd: 23 times)
  • the cultured cell stocks were infected with Ml helper phage and incubated in 2XYTCMK, 5 niM MgCl 2 , 1 mM IPTG medium at 30 ° C. for 16 hours.
  • the cultured cells were centrifuged at 4500 rpm for 15 minutes at 4 ° C, and then the supernatant (1st to 3rd panning poly scFv-phage) was transferred to a new tube.
  • Scheme milk (4%) coated with two types of antigens (CXCLIO, a-myc) in 96-well immune plates (NUNC 439454) with 100 ng per well of coated complete solution at 4 ° C for 16 hours. Each well was blocked using. Each well was washed with PBS P ⁇ 20 (0.05%) 0.2 in, and then 100, 1, 2, and 3 panning poly scFV-phage were added to each well and reacted at room temperature for 2 hours.
  • Ml helper phages were infected with M () I of 1:20 and then 2XYTCM, 5 Incubated in mM MgCl 2> 1 mM IPTG medium for 16 hours at 30 ° C.
  • the cultured cells were centrifuged at 4,500 rpm for 15 minutes at 4 ° C., then the supernatant was taken off with 4% PEG 6, 000 and 3%.
  • NaCl was added to dissolve well and reacted on ice for 1 hour, after 4 ° C at 8,000 rpni for 20 minutes. After centrifugation at C, PBS was added to the pellets to dissolve, then centrifuged at 12,000 rpi for 10 minutes at 4 ° C. The supernatant was taken and transferred to a new tube for third panning to store monoclonal scFv—phage at 4 ° C.
  • the colony PCR product obtained above was obtained from 1% agarose gel (Seakem LE,
  • Example ⁇ 3-1> to in the analysis of single phage clones of each of the sequence identified by fingerprinting, 2XYTCM, 2% monoclonal cell glucose, 5 niM MgCl 2 medium (5 at 37 ° C 16
  • a DNA purification kit Nuclogen, 5112
  • pelB5 primer SEQ ID NO: 43: 5 '— CTAGATAACGAGGGCAAATCATG— 3'.
  • Sequence analysis (Solgent, Korea) was commissioned to identify the CDR regions of the VH and VL of the selected antibodies.
  • the heavy chain gene obtained by PCR was purified by DNA-gel extraction kit (Qiagen) to obtain pNATAB H vector 1 (10 ng), heavy chain (100 to 200 ng) 15! ⁇ , 10 X buffer 2 ⁇ , ligase ( One 1?, Distilled water was mixed and left at room temperature for 1 to 2 hours to connect with the vector.
  • the heavy chain gene-linked pNATAB H vector was transformed on ice with the cells for transformation (coli XL1-blue) for 30 minutes. After being left, transfection was performed by heat shock at 42 ° C. for 90 seconds, and then left for 5 minutes on ice, and then incubated at 37 ° C. for 1 hour by injecting LB medium 1 1.
  • the extracted total antibody DNA was co-transfected into 293E cells (Invi trogen) with PEI 40 ⁇ g, DNA 10 / g and light chain DNA 10 / zg.
  • Supernatants from day 2 to day 8 after transfection were obtained and purified using protein A beads, and ELISA was performed to measure the binding ability of the purified human CXCL10 antibody to antigen.
  • ELISA coated the recombinant human CXCL10 protein on a 96 well immunoplate at 100 ° C per well with a coated complete solution at 4 ° C. for 16 hours, and then blocked each well using skim milk (4%) dissolved in PBS. Wash well by adding 0.2 m £ of? 83-twen20 (0.05%) to each well, and then dilute the monoclonal antibody sequentially from 50 nM by 1/2 to 100 onto an antigen-coated plate. Reaction for 2 hours at. Each well was washed three times with 0.2 iti.g of PBS-source 20 (0.05%), and the secondary antibody, anti-human Fc ⁇ HRP, was reacted with 1: 4000 and reacted for 50 minutes at room temperature.
  • ScFv was cloned into the 3 'end of pNATABH :: Humira and named HuElO-101.
  • Humira an anti-TNF- ⁇ antibody, was prepared through gene synthesis based on the amino acid sequence of the heavy chain variable region (SEQ ID NO: 4) and the amino acid sequence of the light chain variable region (SEQ ID NO: 8).
  • PCR was performed to connect the E10 scFv to the heavy chain and variable region 3'-terminus of Humira in the vector including the heavy chain region of humira. Through this, two fragments were linked to form a single DNA fragment.
  • a pNATABH :: Hum ira / E10ScFv vector was prepared to express HuElO-1 by injecting into a pNATABH vector.
  • HEK 293E cells Invitrogen
  • pNATABH Humira in a 3: 7 ratio.
  • the supernatant was obtained four times at intervals from day 2 to day 8 obtained after transfection, and the expression level of the antibody was confirmed by Western blotting (FIG. 5), and purified using protein A beads. .
  • Western blotting was performed by collecting the cell cultures at intervals into each 1 ml tube and centrifuging at 5000 rpm for 5 minutes to remove the cells. ⁇ and 125 ⁇ of each supernatant were added to each 1 ml tube and boiled for 5 minutes. 40 ⁇ l of the 10% SDS-PAGE gel was loaded and electrophoresed, and then transferred to the membrane. After blocking the membrane with 4% skim milk for about 1 hour, the second antibody, anti-Fc-HP, was added at 1/4000 and shaken at room temperature for 4 hours. lxPBST to 3 times, and then wash the hinge results were obtained by the X-eu ray photosensitive film in a darkroom, and then sprinkled with 1 ml ECL solution to the membrane.
  • Humira showed a molecular weight of 50 and 25 k.Da of the heavy and light chains under reducing conditions, and a molecular weight of the heavy and light chains of HuElO-101 appeared at 83 and 25 kDa, respectively. It was confirmed that ScFv of EK) was fused to the heavy chain region of Humira to increase the molecular weight. Under non-white-reducing conditions, HuEl 101 was found to have a molecular weight of about 187 kDa (FIG. 6).
  • Example ⁇ 4-2> Investigation of the avidity of the bispecific antibody HuElO—101 to CXCL10 and TNF- ⁇ The same method as in Example ⁇ 4-2> to confirm the specific avidity of the bispecific antibody HuElO—101 to CXCL10 or TNF- ⁇ ELISA analysis was performed.
  • HuEl 100 antibodies were analyzed and compared in the same manner.
  • the HuElO-100 antibody was produced by connecting the E10 scFv to the variable region N-terminus of the Humira heavy chain, HuE10-l such as a double antibody to TNF- ⁇ and CXCL10, Compared with HuElO-101, the amount of expression is extremely low.
  • Humira was performed by producing 43.68 mg.
  • Chr n) -LAL (cat # C003.1, CAPE COD) was used to determine bacterial endotoxin of the purified antibody.
  • the concentration was prepared so as to be 0.03125 EU / !.
  • LAL 100 ⁇ was mixed with 100 ⁇ of reference toxin (CSE) at a concentration of 0.125 EU / ml and used for the experiment.
  • CSE reference toxin
  • LAL 100 ⁇ was prepared in 100 diluted samples.
  • the reference value is set using the protocolized file (Chromo LAL sett ing.pda).
  • X axis of standard curve is Log EU / ⁇
  • Y axis is Log Onset time.
  • the cytotoxicity level of the sample is determined by the software.
  • Lc were all sub-cloned into the pOptivec vector, and the enzyme site used for DNA linearization during transfection was Pvul inside the ampicillin gene.
  • CHO DG44 cells used as expression hosts were cultured using MEM—alpha (w /) + .10% FBS + AA medium. Upon cell passing, approximately 1-2 ⁇ 10 6 cells / well were removed from the bottom using 0.25% trypsin and one third was transferred to a new well containing 2 ml of medium. Cell line development proceeded at 96-well and 6-well plate levels.
  • FIG. 11 is a micrograph of colonies formed on 96 well plates.
  • the transfected cells grow in selection medium to form colonies.
  • FIG. 12 is a result of dot-blotting to confirm the expression of the colony of FIG.
  • the medium was 30 ⁇ and was detected by anti—Fc—HRP; clones with high expression, such as orange circles, had a darker blot.
  • Figure 13 compares the relative expression levels by ELISA method in three plates of monoclonal 16 plate plate.
  • Anti— Fab antibody ELISA folate coated with ng / well was blocked using PBS containing 5%) skim milk for 2 hours. . Thereafter, colonies were selected and 100 ⁇ added. After reaction at room temperature for 2 hours and washed three times with 0.05% PBST 200 ⁇ , anti—Fc ⁇ HRP was reacted with 100 ⁇ 1 hour to 1: 5, 000 and detected using 0PD.
  • the clones shown in purple are clones with relatively high expression rates.
  • ELISA quantitative high expression and single colony formation were selected two to three per plate.
  • the red dotted line in FIG. 14 represents the mean value, and the red colon is the selected colony.
  • MTX was added to MEM—alpha (w / o) + 10% dFBS + AA medium for amplification of HuElO-101 antibody expression.
  • the initial vertical-concentration induced degeneracy from 100 nM.
  • 29 clones of HuElO-101 selected above were dispensed at 5 ⁇ 10 5 cells per well. Colony formation was observed by switching to fresh medium every two days. When the cells were full, they were divided into 5 X 10 5 cells. After passing three times, the expression rate was confirmed by ELISA. Highly expressed clones of 100 nM completed clones were amplified with 1 y M.
  • FIG. 16 is a micrograph showing colonies forming one week after initially dispensing into 5 ⁇ 10 5 cells.
  • FIG. It was confirmed that colonies were formed by exchanging the medium every time.
  • the cells were filled in 6 wells, the cells were detached with trypsin and divided into new plates. Passing three times in this manner and then quantitated by ELISA. 6-6.
  • Quantification of HuE10-101 antibody was carried out by incubating cells depleted at each step in 5 ⁇ 10 5 cells / T-25 flask / 5 ml for 6 days. Batch was performed on cells decanted at 100 nM. Quantification using the ELISA method.
  • Single cell line separation was performed by limiting dilution using two cell groups (Humira CXCL10 cell line S7 3 ⁇ , Humira CXCL10 cell line S7 4 yM).
  • a single cell-derived cell line was obtained by seeding a 96 well plate at 1 cell / well.
  • the protein expression levels of the obtained single cell lines were analyzed by ELISA using culture medium cultured in a 24 well plate for 4 days, and a total of 20 single cell lines were selected and subjected to suspension culture in a 125 mL Erlennieyer flask (Table 9).
  • Selected 20 cell lines were suspended in floating cells, inoculated in a chemical composition medium to be 5 X cells / mL, inoculated and fed on a 34 ° C, 5% C0 2 incubator for 6 days at a stirring speed of 140 ⁇ 10 rpm. Cultured and the amount of expression was analyzed (Table 10).
  • N-terminal amino acid sequencing was analyzed by dividing the heavy and light chains of the antibody protein.
  • Glutamine amino acid is the first amino acid glutamine of the N-terminal sequence of a conventional antibody protein It is often present in a modified form with pyroglutaiiiate.
  • the heavy and light chains of HuElO-101 are both glutamic and aspartic acid, not glutamine, so there is little chance of specific modifications.
  • the N-terminal sequence of the heavy chain identified 16 amino acid sequences and the light chain identified 18 amino acid sequences.
  • the identified amino acid sequence was identical to the theoretical amino acid sequence.
  • HuE10-101 samples were precipitated with TCA to remove the storage buffer and denatured by treatment with 5 urea. After trypsin treatment, the antibody was cleaved into peptide fragments, and then PNGase-F was added and deglycosylated. Finally, the peptide was analyzed by LC-MS after removing the disulfide bond by adding DTT.
  • the N-terminal sequence of an antibody protein is more likely to produce post-translational modification (PTM) than other amino acids in the protein's expression process and may be associated with the activity of the antibody protein and other immunorejections.
  • PTM post-translational modification
  • Antibody-derived peptides cut by trypsin were subjected to LC-MS peptide mapping and LC-MS / MS sequencing analysis, where the theoretical peptide molecular weights were calculated to identify N-terminal peptides (FIG. 19A).
  • FIGS. 19A and 19C show N-terminal sequencing results of heavy and light chains of HuElO-101 by LC-MS / MS analysis, respectively.
  • the N ⁇ terminal sequences of the heavy and light chains of the HuElO-101 protein are the same peptides as the N-terminal sequences of the HuElO-101 protein.
  • Sequenced with molecular weight, the N-terminal sequence of the heavy chain was EVQLVESGGGLVQPGR and the N-terminal sequence of the light chain was identified DIQMTQSPSSLSASVGDR (FIG. 19).
  • Table 11 summarizes the theoretical molecular weight of the N-terminal sequence, the molecular weight identified in LC-MS, and the N-terminal sequence identified through ms / ms sequencing. Modifications such as pyridonecarboxylic acid form and cleavage, deamidation oxidation, which are the N-terminally modified forms of conventional proteins, were not found in HuEl 101 protein (Table 11).
  • HuE10-101 samples were precipitated with TCA to remove the storage buffer and denatured by treatment with 5 M urea. Then trypsin treatment to remove the antibody After cleavage into peptide fragments, PNGase-F was added and deglycosylated. Finally, the peptide was analyzed by LC-MS after removing the disulfide bond by adding DTT.
  • HuE10-101 has a total molecular weight of approximately 190 KDa and is composed of heavy and light chains, respectively.
  • the total amino acids consisted of 919 amino acids, 705 heavy chains, and 214 light chains (SEQ ID NO. 59 and 60).
  • a typical antibody protein has a 150 kDa molecular weight, but HuE10-10l protein has a heavy chain variable sequence coupled after the C-terminal 451 lysine of the heavy chain.
  • FIG. 20 is an eluted LC-MS chromatogram of tryptic peptides derived from HuElO-101 antibody as a result of peptide mapping analysis of the assay sample HuElO-101.
  • FIG. 20A the HT24 (m) (cle) peptide had a compound corresponding to 43Da at the N-terminus of the peptide of WSVLTVLHQDWLNGK, and the amino acid 319 asparagine was modified by deamination.
  • the LT13 (m) peptide of FIG. 20B was identified as a chemical binding peptide with an increased 43 Da compared to the theoretical molecular weight.
  • the remaining modified peptides identified in the peptide mapping table were finally identified by the LC-MS / MS peptide sequencing method as above (FIG. 21).
  • peptide mapping analysis of HuElO-101 showed 98.1% identical structure in the amino acid central structure, and only some of them were weakly deamined with chemically bound peptides and asparagine amino acids.
  • Adhesion evaluation was performed by coating 100 nM TNF- ⁇ or CXCL10 on two channels of the XPR GLC chip, and releasing the antibody. Initialize the GLC chip with 50% glycerol in the ProteOn XPR 36 for measurement and stabilize the chip by pouring the running buffer PBST L0 ⁇ Na-phosphate, 150 niM NaCl, 0.005% Tween20, pH 7.4) at 25 ° C. Let me go.
  • KD values were determined by setting the standard with PBS / T and then releasing HuEl 101 or Humira antibodies in a series of 5 concentrations diluted 1/2 of 5 nM and sending them to the coated area.
  • 100 nM TNF- ⁇ or CXCL10 was coated on the XPR GLC chip, and Humira or HuElO—101 was diluted from 5 nM by 1/2 to flow five concentrations to obtain a sensogram as shown in FIG. 23. .
  • Humira binds well to the antigen TNF- ⁇ but does not adhere to CXCL10 at all, while HuE10-101 is a double antibody that adheres well to CXCL10 as well as TNF ⁇ ⁇ .
  • Table 14 shows the KD value measurement results of the antibodies for each antigen obtained from the sensogram of FIG. 23.
  • ka is the binding constant
  • kd is the dissociation constant
  • KD is the dissociation constant obtained by dividing kd by ka.
  • Humira only measured the binding force to the antigen TNF— ⁇ and the KD was 0.116 nM.
  • the double antibody HuE10-101 showed a TNF- ⁇ binding force of 0.195 nM similar to Humira and a slightly weaker KD of 3.54 nM for CXCL10.
  • the low KD for CXCL10 seems to be due to the fact that kd is somewhat lower than that of TNF- ⁇ , in combination with the results in FIGS. 23 and 14.
  • HuEl 101 showed a binding capacity of 0.495 nM for TNF-a and 1.9 nM for CXCL10.
  • Humira which was used as a control, showed 0.5 nM of binding force only for TNF— ⁇ but did not bind as expected for CXCL10.
  • TNF- ⁇ or CXCL10 antigens were added to 96-well immunoplates and coated overnight at 4 ° C. 200 ⁇ / well was added to the scheme milk and incubated at room temperature for 2 hours. Then, HuElO-101 and Humira were each diluted in steps of 50 nM and half, respectively, in 100 ⁇ / well and incubated in silver for 2 hours. After two hours, three washes were performed with 0.053 ⁇ 4 »PBST 200 ⁇ / well. And anti-human FC-HRP (in goat) 1: 1000. After making into the skim milk PBS 100 l / well was added and incubated for 1 hour at room temperature.
  • HuElO-101 is a bispecific antibody (i speci fic) that binds well to both TNF- ⁇ and CXCL10 (FIG. 23).
  • HuElO-measured antigen binding capacity was confirmed to be 4.5 ⁇ 10 M (0.45 nM) and 1.9 ⁇ 9 M (1.9 nM), respectively.
  • Humira a control group, binds well to TNF- ⁇ as expected, but not to CXCL10. It was confirmed that no binding (FIG. 24). Its binding affinity is 1.
  • Humira (Abbott Laboratories) was used as a control antibody, Humira copy antibody (developed in the project), HuE10-101 was used as a candidate antibody. After diluting each antibody concentration by 1/2 step, the cells were cultured by adding hTNF- ⁇ , and then incubated in a 5% C0 2 , 37 ° C incubator with MTT (thiazolyl blue tetrazol ium), and then the cells were lysed. Absorbance was measured at a wavelength of 595 nm (FIG. 25).
  • Humira cloned antibodies, HuElO-101, HuIL21R-101 and HuIL21R-100 were found to have a TNF- ⁇ inhibitory activity at a lower concentration than Humira, a positive control group.
  • Humira it was confirmed that the inhibitory ability of the candidate antibody against TNF-a is improved compared to Humira (FIG. 25).
  • the experimental group was treated with HuE10-101 in the upper and lower chambers at concentrations of 50 ng / ml, 100 ng / ml and 200 ng / ml, and additionally treated with hCXCLlO in the lower chamber to create increased chemotaxis conditions by CXCL10. It was.
  • hCXCLlO was added to the lower chamber alone to determine whether chemotaxis was increased by CXCL10.
  • PC positive control group
  • osteoclast progenitor cells CD14 +
  • CD4 + cells were isolated from the blood, and the two cells were induced to differentiate into osteoclasts using a co-culture system, and TRAP (tartrate resistant acid phosphatase) Staining was performed and microscopic observation (FIG. 28).
  • TNF transgenic mouse model established by Keffer et al. In 1991 manipulated the TNF 3 'untranslated region (UTR) to inhibit TNF and introduced human TNF transgenic genes into the mouse. This increased the expression of TNF spontaneously induced arthritis. Arthritis induced by this method, similar to rheumatoid arthritis, showed synovial thickening, infiltration of inflammatory cells into the joint cavity, panus formation, and destruction of cartilage and luck.
  • UTR TNF 3 'untranslated region
  • the TNF transgenic mouse model confirms that TNF plays an important role in the development of arthritis by identifying the pathogenesis of arthritis induced by TNF. It provided an opportunity to prove it.
  • the TNF transgenic mouse model is useful for evaluating the efficacy of therapeutic agents associated with TNF.
  • TNF transgenic mouse model for evaluating the efficacy of dual antibodies against TNF.
  • Dual antibody efficacy evaluation using a TNF transgenic mouse model was conducted by a CR0 specialized institution in Greece.
  • the line used for efficacy evaluation is Tgl97 and is one of the human antibody evaluation models for rheumatoid arthritis recommended by the US Food and Drug Administration (FDA).
  • the Tgl97 strain was used to develop Infliximab (Renii cade®), a commercially available TNF— ⁇ antagonist.
  • Tgl97 strain Arthritis progression in the TNF transgenic mouse model, a Tgl97 strain, shows no clinical differences between sexes and weight loss as the disease progresses.
  • Pathological analysis of Tgl97 strains reveals inflammatory infiltration, synovial thickening, cartilage destruction, and bone erosion, very similar to rheumatoid arthritis.
  • the TglF transgenic mouse model of the Tgl97 strain will develop lesions from the 3rd week of the experiment. Models from parking 3 to 6, which are the early stages of lesions, are used to investigate the preventive effect. Therefore, the evaluation period was progressed from parking 3 to parking 9 to evaluate the efficacy of the double antibody that is the purpose of this experiment-. Clinical evaluation was performed by measuring the arthritis score and the change in body weight during the evaluation period.
  • histopathological evaluation was performed to evaluate the degree of arthritis lesion.
  • the histopathological characteristics of rheumatoid arthritis are overproliferation of articular synovial cells and destruction of cartilage tissues.
  • Mouse knee tissue was separated, fixed in formalin, decalcification, and a block made of paraffin to prepare a tissue section of 4 urn using micromum.
  • Hematoxylin and eosin (H & E) staining examined synovial inflammation, bone erosion, cartilage damage, and leukocyte infiltration. At this time, the evaluation was conducted by blind test so as not to know what sample. Histopathological evaluation was evaluated based on the following table.
  • the commercially available Humira 10 mg / kg and Humiri-replicating antibodies developed by the present inventors were administered to mice at 2 mg and 10 mg / kg doses, and clinical changes were observed and evaluated.
  • the arthritis scores of the Humira and Humira cloned antibodies were 1.48 in the Vehicle group and 0.22 in the 10 mg / kg control group, Humira.
  • the concentration of Humira clone antibody was 2 mg and 10 mg / kg, respectively, the values of 0.66 and 0.52 were shown (FIG. 31).
  • the TNF transgenic mouse model is characterized by clinically significant weight loss as the disease progresses. The weight change measurement was performed in the same manner as the arthritis score measurement schedule.
  • Humira was used as a control to evaluate the efficacy of HuIL21R-101, and experimental groups HuIL21R-101 were administered to mice at doses of 1 nig, 3 mg, and 10 mg / kg, respectively, and clinical changes were observed and evaluated. Induces Arthritis of HuIL21R— 101 It was 1.27 in the control group IG, which was a nodule- and vehicle group which measured the arthritis score, and 0.20 when the control group Humira was 10 mg / kg. When the concentration of the experimental group HuIL21R-101 was 1 mg, 3 mg, 10 mg / kg, respectively, the numerical values of 0.89, 0.73, 0.88 (Fig. 33).
  • HuIL21R-101 As a result of clinical evaluation of HuIL21R-101, the arthritis score of HuIL21R-101 did not decrease significantly and there was no significant weight gain compared to Humira. Based on the previous results of HLIIL21R-101 and the results of efficacy evaluation through the TNF transgenic mouse model, HuIL21R-101 was excluded from the final candidate antibody group.
  • Humira® was used as a control group, and HuE10-101, which was an experimental group, was administered to the mice at the dose of 6.9 mg and 13.8 mg / kg in the same amount as the control group and the mass, respectively. Clinical changes were observed and evaluated.
  • the arthr it is score of HuE10-101 was 1.65 in the Human Control IgG vehicle group and 0.06 in the control group Humira® at a concentration of 10 mg / kg.
  • the concentration of the experimental group HuElO-101 was 6.9 mg, 13.8 mg / kg, respectively, showed a value of 0.41, 0.07 (Fig. 35).
  • the TNF transgenic mouse model is characterized by clinically significant weight loss as the disease progresses.
  • the weight change measurement was performed in the same manner as the arthritis score measurement schedule.
  • the result was 18.92 g in the vehicle group and the concentration of control group Humira® was 10 mg / kg. When was 23.38 g.
  • the concentration of HLIEIO-101, the experimental group, was 6.9. When mg, 13.8 mg / kg was 21.08 g, 22.80 g (Fig. 36).
  • the arthritis score decreased similarly to the control Humira cloned antibody, and the arthritis score decreased as the concentration of HuElO-101 increased.
  • the weight decreased as the lesion progressed, and the body weight increased as the concentration of HuElO-101 increased, similar to the Humira clone antibody group.
  • the histopathological evaluation of HuElO-101 and arthritis-induced scores were compared and analyzed.3.75,1.65 for the Vehicle group and 0.75,0.06 for the Humira® group, respectively, and 6,9 mg / kg of HuElO-101, respectively.
  • the groups treated with 1.84, 0.41 and HuElO-101 at a concentration of 13.8 mg / kg were 0.75 and 0.07, respectively.
  • Three-week-old mice before drug administration had numbers of 1.33 and 0, respectively.
  • HuElO-101 and Humira® were used as treatments, it was confirmed that the two drugs had an equivalent therapeutic effect when the histopathological evaluation and the arthritis-induced scores were compared (FIG. 38).
  • HuElO-101 Clinical evaluation of the result compared to the control group although the Humira® not significantly induced arthritis score (arthritis score), as' concentration increases in HuE10-101 a result to decrease the score induced arthritis (arthritis score) could get In addition, as a result of measuring the weight change, the weight decreased as the lesion progressed, and the body weight increased as the concentration of HuE10-101 increased, similar to the Humira® group. 9-1-4. Evaluation of Efficacy of Dual Antibodies Produced in Production Cell Lines Using Humanized TNF Transgenic Mice
  • Humira® was used as a control of the retested experimental conditions, and HuE10-101, a test group, was divided into groups administered twice and three times a week at a dose of 13.8 mg / kg. Body weight changes and arthritic scores were measured from parking 3.5 to parking 9.5. As a result, the vehicle group showed 1.43, the Humira® group 0.34, the HuElO-101 group received the same number of humira® 0.28, and the HuE10-101 group administered three times a week (0.19). ).
  • the weight change measurement was performed in the same manner as the arthritis score measurement schedule.
  • the vehicle group was 15.87 g and the Humira® group was 20.50 g.
  • the group administered the same number of times as humira® showed 19.21 g, 20.58 g in the group administered three times a week (Fig. 40).
  • the arthritis score significantly decreased compared to the Humira® group of HuE10-101, and the arthritis score decreased as the concentration of HuElO-101 increased.
  • the weight decreased as the lesion progressed, and the body weight increased as the concentration of HuEl 101 increased, similar to the Humira® group (FIG. 42).
  • HuElO-101 The histopathological evaluation of HuElO-101 was compared with the arthritis-induced scores.
  • the vehicle group received 3.53, 1.435, Humira®, respectively, 1.22, 0.34, and HuElO-101, the same number of times as humira®, respectively. 1.44, 0.28, and HuElO-101, three times a week, respectively, 0.72. , 0.19.
  • cytokines were measured in mouse serum, and tissues were obtained to observe pathological changes and statistical analysis.
  • the present inventors noted that administration of serum from K / BxN spontaneous arthritis mice can cause arthritis relatively easily and that the duration of the experiment is short within 2 weeks, resulting in K / BxN serum transfer arthritis. A model was introduced.
  • K / BxN spontaneous arthritis mice used in the experiments were used more than 8 weeks of age, and the collected serum 150 ⁇ 6 weeks or more mice were administered intraperitoneally twice a day 0, day 2 to induce arthritis.
  • Day 1 clay 3 was administered HuE10-101.
  • the joints of the lower extremity of the mouse were analyzed by micro CT (NanoFocusRay) to analyze the condition of the bone joints of the mouse model of the K / BxN serum transfer arthritis that the experiment was completed.
  • the vehicle group that induced arthritis changed the shape of the joint irregularly, and the bone destruction progressed considerably.
  • the control group treated with the humira cloned antibody and the experimental group, HuElO-101 were found to have significantly reduced bone destruction compared to the vehicle.
  • the experimental group was observed almost no bone destruction similar to the group that did not receive the K / BxN serum, a negative control (Fig. 47).
  • Histopathological analysis was performed to obtain the tissues of the mouse model of K / BxN serum transfer arthritis after the experiment to determine whether morphological changes were observed in histopathologic changes.
  • vehicle group showed swelling around the joints, polymorphic leukocytes, lymphocyte infiltration, and synovial inflammation, thickening, and cartilage loss.
  • HuElO-101 treated group inflammation of the joint and destruction of cartilage were significantly suppressed.
  • H & E-dyed photos Analysis of synovial inflammation, bone erosion, and cartilage damage. Immune cell infiltration (leukocyte inf ltrat ion) was analyzed respectively.
  • LPS lipopolysaccharide
  • the increase in bone loss caused by LPS has not been elucidated in detail, but it is a signal transduction agent that activates MyD88 (myeloid differentia ion protein88) through TLR4 (Tol 1-Like Receptor4) in osteoblasts and is involved in bone resorption.
  • MyD88 myeloid differentia ion protein88
  • TLR4 Tol 1-Like Receptor4
  • Ib6 GM-CSFC granulocyte macrophage colony stimulating factor
  • PGE2 pros tag land in E2
  • N0 ni trie oxide
  • the biggest advantage of the LPS-induced inflammatory bone loss mouse model is that it can be built in a relatively short time, as in the arthritis mouse model (K / BxN serum transfer arthritis model).
  • Inflammatory bone loss mouse model induced by LPS induces inflammation by a single dose of LPS into the mouse skull.
  • HuE10-101 is then administered to the skull daily for 5 days (FIG. 49).
  • Inflammatory bone loss induced by LPS was confirmed by cranial analysis through micro CT scan. As a result, the degree of skull loss was confirmed in the vehicle group which induced bone loss by LPS administration, the control group of humira cloned antibody, the control group HuEl 101 treated group, and the negative control group (normal) LPS treated group. .
  • the degree of skull loss was confirmed in the vehicle group which induced bone loss with LPS and added only the antibody composition buffer, the humira® treated group, the control group, HuElO—101 treated group, and the normal control group that did not receive LPS. It was. As a result, it was confirmed that skull loss increased in the vehicle group. In the humira treatment group and HuElO-101 treatment group, it was confirmed that the skull loss is significantly reduced compared to the vehicle (Fig. 51).
  • the bone loss area was confirmed by an image analysis program (Image J) for a detailed analysis of the skull loss.
  • Image J image analysis program
  • the vehicle group showed 2.35 times more bone loss than the negative control group
  • the humira® treated group showed 2.15 times more bone loss than the negative control group and 0.9 times the vehicle.
  • HuElO-101 is 1.2 times compared to the negative control (P value: 0.0428) showed bone loss, 0.5 times compared to vehicle, and reduced by 48.79% (FIG. 52).
  • HuElO-101 In vivo of HuElO-101 produced from production cell line using LPS induced inflammatory bone loss mouse model. As a result of evaluating osteoclast differentiation ability, it was confirmed that HuElO-101 effectively inhibits osteoclast differentiation compared with humira®, as in the previous study.
  • Collagen-induced arthritis established by Trentham et al. In 1977, is a representative autoimmune arthritis model of rheumatoid arthritis that is currently the most widely used. Antibodies to collagen were found in the serum of rheumatoid arthritis patients, and the focus was on the fact that type II collagen present in the joint could act as an autoantigen.
  • the hallmark of the collagen-induced arthritis mouse model is that the clinical findings are similar to those of human rheumatoid arthritis. Similarities include association with class II MHC haplotypes, pathogenesis that reflects adaptive immunity by ⁇ and B cell responses specific to autoantigens, involvement of autoantibodies and complement systems in the destruction of joint tissues, and Proliferation, infiltration of lymphocytes and panus formation.
  • the present inventors have confirmed the result of the increase of CXCL10 in collagen-induced arthritis, which is an animal model of rheumatoid arthritis, through previous studies.
  • the symptom suppression experiment of collagen-induced arthritis by CXCL10 inhibitory antibody was confirmed that CXCL10 is involved in bone resorption and osteoclast differentiation promoting factor by rheumatoid arthritis.
  • Collagen-induced arthritis mouse model dissolves bovine-type ⁇ collagen (2, 4 mg / mL) with acetic acid (0.05-0.1 M) at 4 ° C and with abundant Freund's adjuvant. Suspended.
  • suspending material 0.1 mL of suspending material is first injected into the base of the tail of male DBA / 1J mice (5-9 weeks old), and after 3 weeks suspending material (0.1-0.2 ml) is added to the base of the tail (booster or second inject ion). ) Subcutaneously (FIG. 53).
  • Antibody drugs may bind to tissues when the same or related antigenic determining sites are expressed in human cells or tissues other than target cells.
  • cross reaction reactions on human tissues should always be performed at the non-clinical stage.
  • EnVision Detection System was used for immunohistochemical staining and cross-reaction was confirmed using 32 non-overlapping three tissues. As a result, it was confirmed that HuE10-101 did not bind nonspecifically to other tissues (FIG. 54).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Pulmonology (AREA)
  • Dermatology (AREA)
  • Transplantation (AREA)
  • Toxicology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Otolaryngology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 IgG 포맷 기반의 TNF-α/CXCL-10 이중 타겟 항체에 관한 것으로 구체적으로 CXCL10 특이적 항체의 중쇄 가변영역 및 경쇄 가변영역을 갖는 scFv를 TNF-α 특이적 항체의 중쇄 불변영역 C-말단에 결합된 형태의 항체는 TNF-α 및 CXCL10에 모두 효과적으로 결합하는 이중 특이성 항체임을 확인함으로써, 상기 항체는 TNF-α/CXCL10을 인식할 수 있는 이중 타겟 항체로서 유용하게 사용될 수 있다. 본 발명의 조성물은 TNF-α(tumor necrosis factor-alpha) 및 CXCL10(C-X-C motif chemokine 10)에 모두 효과적으로 결합하는 TNF-α/CXCL-10 이중 타겟 항체를 포함한다. 본 발명의 이중 타겟 항체는 TNF-α 또는 CXCL10 단일 타겟 항체와 비교하여 우수한 TNF-α 억제능 및 파골세포 분화 억제능을 갖는다. 본 발명의 조성물은 면역질환의 예방 또는 치료에 이용될 수 있다.

Description

[명세서 ]
【발명의 명칭]
항 TN F— α/C X C LlO 이중 타겟 항체 및 그의 용도 【기술 분야】
본 발명은 TNF— a (tumor necrosis factor-alpha) 및 CXCLKKC— X— C motif chemokine 10)에 특이적으로 결합하는 TNF— a /CXCL— 10 이중 타켓 항체 및 그의 용도에 관한 것이다. 【관련특허출원】
본 특허출원은 2013 년 5 월 22 일에 대한민국 특허청에 제출된 대한민국 특허출원 제 10—2013—0057475 호 및 제 1으 2013—0057762 호에 대하여 우선권을 주장하몌 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
【배경 기술】
일반적으로 항체는 분자량이 큰 중쇄 (중쇄 )와 분자량이 작은 경쇄 (경쇄)의 폴'리펩티드가 이황화 결합 (disulfide bond)으로 연결이 되어 이형 이중체 (heterodimer)을 형성하며, 두 개의 이형 이중체가 다시 이황화 결합으로 연결이 되어 4중체 (tetraiiier)를 형성한다. 중쇄를 만드는 폴리펩티드는 4개의 영역 (domain)으로 되어 있는데 N_말단에서부터 가변영역， 볼변영역 1， 불변영역 2 및 불변영역 3으로 구성되어 있으며, 경쇄를 만드는 폴리펩티드는 2개의 영역 (domain)으로 되어 있는데 N- 말단에서부터 가변영역, 불변영역으로 구성되어 있다. 이중에서 중쇄의 가변영역과 경쇄의 가변영역의 결합체가 1 개의 항원과 결합하게 된다.
세포를. 표식해 주는 화학적 표식인자인 항원 (antigen)과 이에 대한 항체 (antibody)와의 반응은 '고도의 특이성을 나타낸다. 항체와 상호작용하는 항원 부위를 항원 결정기 또는 에피토프 (epitope)라 하고， 항원 결정기와 항체의 항원 결합부위인 가변영역이 특이적으로 결합하게 된다. 그러므로 항원 결합부위는 단 1개의 항원결정기와 결합할 수 있으므로 수 많은 항체들은 각자가 특정 결정기를 가잔 항원에 대한 특유의 면역성을 제공할 수 있다.
항체는 혈중에서의 안정성이 높고, 항원성도 낮기 때문에 의약품으로서 주목되고 있다. 그 중에는 두 종류의 항원을 인식할 수 있는 이중 특이성 항체 (bispecific antibody)가 있다. 이중 특이성 항체는 크게 2 종류로 구분할 수 있다. 첫 번째는 재조합 DNA 기술에 의해서 항체를 변형시켜 2 개의 서로 다른 항원과 결합할 수 있는 항원 결합부위를 갖도록 하는 경우로 이 경우는 1 개의 결합부위는 어떠한 항원에 대하여 특이적이고， 제 2의 결합부위는 또 다른 항원에 대해서 특이적인 항체로 동시에 2 개의 항원과 결합할 수 있다 (Beck A et . al . , Nat Rev immunology 10 ;345ᅳ 352， 2010). 두 번째 종류의 이중 특이성 항체는 아주 최근 개발된 항체로 1 개의 항원결합부위를 갖는 정상적인 항체로서 2 개의 서로 다른 항원과 결합할 수 있는 능력을 갖는 항체로 투ᅳ인—원 (two— in-one) 항체로 부른다 (Bostrom, J et . al . , Science 323, 161으 1614， 2009). 이러한 투- 인-원 항체는 1 개의 항원결합 부위를 가지기 때문에 2 개의 항원과 결합하기보다는 한번에 1 개의 항원과 결합할 수는 있으나, 서로 다른 2 개의 항원에 결합할 수 있는 능력을 '갖고있는 항체이다. 투-인—원 항체는 기존의 개발에 성공한 전형적인 항체의 형태를 갖고 있기 때문에 개발에 매우 유리하다.
이러한 이중 특이성 항체는 특정 독성 세포 및 표적 세포에 결합하여 작용할 수 있으므로 표적 특이성이 높은 장점을 가진다.
1990년대 후반부터 새로 개발된 항 류마티스 약제들은 류마티스 관절염의 병태생리에 대힌- 이해가 깊어지면서， 가장 표적이 되는 물질을 차단하여 질환을 조절하고자 하는 표적 치료 (targeted therapy)의 개념이 대두되었다. 결국 특정 질환에서 표적이 되는 물질을 찾아내고， 이 표적을 차단할 수 있는 물질을 디자인하여 만들어낸 (designed drug) 생물학적 제제들이 개발되어 사용됨으로써 류마티스 관절염의 치료에 있어서 큰 변화를 가져오게 된 것이다. 이러한 제제들에는 대표적으로 TNF- α 차단제 (etanercept , infliximab, adal imumab 등), 재조합 interleukinᅳ 1 수용체 길항제인 anakinra와 함께 inter leukin一 6 antagonists(toci 1 izumab) , CTLA4Ig(abatacept ) , Β eel 1 depleting agent (rituximab) 등이 있으며 실제로 임상에 사용되고 있거나- 시험 중에 있다.
TNF- α (tumor necrosis factor-alpha)에 대한 연구는 이미 100여 년 전부터 종양 및 패혈증 환자를 대상으로 시작되었다. TNF-α는 대식세포, B와 T 림프구를 포함한 면역세포와 비면역세포， 및 다양한 종양세포에 의해 생성되며， 정상적인 생리적 염증반웅과 후천성 및 선천성 면역에 중요한 역할을 담당하고 있다. 그러나 류마티스 관절염과 같은 염증성 질환에서 TNF-a가 부적절하게 많이 생산되는 경우， 면역 체계의 다양한 세포를 활성화시켜 세포독성 효과를 유발하고 염증， 조직 파괴， 및 장기 손상 등의 반응들이 나타난다. TNF— a의 주요 생물학적 작용은 첫째 , 다양한 형태의 세포에서 성장, 분화， 대사를 조절하고; 둘째, 지방분해를 자극하며, 지방세포에 존재하는 지질단백 지질분해효소 (lipoprotein lipase) 활성을 억제하고, 간내 지방형성 (hepatic lipogenesis)을 자극하여 악액질 (cachexia)를 유발하며; 및 셋째， 세포자멸사 (apoptosi s)를 유도한다. TNF— α는 유리형 (free form)으로 존재하기도 하고 세포막에 결합된 형태 (membrane-bound form)로 존재하기도 한다. 두 가지 형태의 TNF— α는 매우 강하게 세포의 염증 반웅을 유발하고 조직 내의 질병상태를 촉진시킨다. 세포막에 결합된 TNF— α는 세포대 세포 접촉을 통해 세포독성과 염증효과를 나타내며 , TNF-α전환효소 (TACE)에 의해 세포막에서 유리형으로 떨어져 세포 밖에 존재하게 된다. TNF— a는 혈증에서 두 가지 수용체, 즉 TNF type I 수용체 (p55) 또는 TNF type II 수용체 (p75)와 결합하여 생물학적 활성을 나타낸다. 임상적으로 볼 때, 과잉 생산된 TNF- a는 류마티스관절염 환자의 대식세포를 자극하여 염증반웅을 증폭시키는 염증성 매개물질을 생산하고， 혈관내피세포에서 부착분자를 발현하게 하여 더 많은 염증세포들이 염증이 일어난 부위로 모일 수 있도록 하며， 섬유아세포로 하여금 단백분해효소를 생산하게 하여 연골, 뼈, 및 인대에 손상을 입혀 질병을 악화시킨디-. ' TNF-α 억제제는 1998 년 11 월 etanercept가 미국 식약청으로부터 류마티스 관절염의 치료제로 최초로 승인받아 상용화되어 판매되기 시작한 후 infliximab 및 adalimumab 등이 시판되고 있으며, 기존 약물의 효과와 부작용을 개선한 새로운 약물들이 개발되고 있다. 환자 개인별로 볼 때 TNF-α 억제제에 대한 치료 반웅은 질병의 활성도와 이에 상응하는 구조적 손상, 질병에 의한 삶의 질에 대한 영향， 질병에 의해 발생된 증상과 징후가 환자 개인에 따라 다르므로, 다양하게 나타날 수 있다. 또한 약물에 대한 감수성, 효과의 발현양상， 또는 부작용 역시 다양하게 나타날 수 있다. 다양한 종류의 TNF— a 억제제 사이에도 각각의 구성물질， 구체적인 작용기전, 약리기전， 및 생물학적 약제학적 성질 (biopharmaceutical properties) 등이 다르다. TNF- α 억제제의 효능을 입증하는 동물실험에는 인간 TNF— α 트랜스제닉 (Tg) 마우스를 사용하는데, Tgl97 마우스는 4 내지 5 주령 시기에 류마티스 관절염과 흡사한 관절염이 발생하며， 9 내지 10 주령부터 하지 관절의 현저한 운동범위 제한이 관찰된다.
CXCL10(C-X-C motif chemokine 10)은 인터페론 감마 유도성 단백질 10 (IPᅳ 10)이라고도 불리며 인터페론 감마 (IFN-Y )에 의해 유도되는 10 kDa 의 케모카인이다. CXCL10은 주화 활성 (cheino tactic activity)을 가지며, 세포 분열 활성 (mitogenic activity)에도 관여하는 것으로 알려져 있다. 이는 IFN-γ에 반응하여 내피 세포, 단핵구， 섬유아세포 및 각질 형성 세포를 비롯한 다양한 세포에 의해 분비되며 또한 인간 피부에서의 지연성 과민 반웅 (delayed type hypersensitivity, DTH) 에 있어서 진피 대식 세포 및 내피 세포에 존재하는 것으로 밝혀졌다. 또한, 원래 IFN— γ에 의한 유도 뿐 아니라， 수지상 세포에서 IFN-α에 의해 유도될 수 있으며 , IFN-x , 바이러스 및 리포폴리사카라이드와 같은 자극에 의해 중추 신경계 세포에서 유도될 수 있다.
CXCL10의 수용체는 7 개의 막투과성 (transmembrane) 수용체인 CXCR3로 밝혀져 있다. CXCR3은 활성화된 T 림프구와 단구, 활막세포， 내피세포， Mi세포, 호산구에서 발현된다. CXCR3의 2 가지 다른 리간드인 MIGdiionocyte/macrophage activating, I FN- γ - inducible protein) 및 I— TACCIFN- -inducible T cell al ha chenioat tracUnt 1)도 CXCR3와 결합하는 것으로 알려져 있다. CXCL10의 CXCR3에의 결합은 활성화된 T 세포와 활성화된 NK 세포에서 칼슘 이동 (calcium mobilization) 및 주화성을 매개한다. 흉선 내에서 CXCL10은 TCRa i3+ CD8+ T 세포, TCRy δ + T 세포 및 ΝΚ—타입 세포에 대한 화학 유인 물질 (chemoaUractant)인 것으로 밝혀졌다.
CXCL10 또는 그의 수용체인 CXCR3은 다발성 경화증, 류마티스 관절염, 궤양성 대장염， 간염, 염증성 근염, 척수 손상， 전신성 홍반성 루푸스， 이식 거부, 쇼그렌 증후군을 비롯한 다양한 다른 염증성 및 자가 면역 질환에서 동정된다. 그러나, 이러한 CXCL10이 이러한 질환들에서 cheiiiot axis이외에 염증반응이나 면역반웅에 구체적으로 어떻게 작용하는지， 치료 타겟으로서 어떠한 중요성을 갖는지에 대해서는 아직 구체적으로 알려진 바가 없다.
수많은 염증 매개물질이 병인에 기여하는 자가 면역 질환의 치료에 단일 항원을 표적으로 하는 단일클론항체 치료보다 한 종류의 항체로 여러 표적을 중화하면 보다 효과적인 치료제로 작용할 수 있다. 두 가지의 다른 항체를 조합하여 만든 항체로 두 가지 표적을 인지하려는 노력은 이미 여러 연구자들에 의해 보고된 바 있다. 최근 연구에 의하면 (Bostrom et al. Science 2009) , human epidermal growth factor receptor 2 (HER2)을 인지하는 항체의 경쇄 CDRs을 변이시킨 항체 라이브러리에서 혈관내피세포 성장인자 (VEGF)를 동시에 중화하는 항체를 스크리닝 하는데 성공하였다. 상기 항체는 한 질환의 병인에 기여하는 두 가지 매개물질을 모두 인지하는 (bispecific) 이중항체로서, 특히， 정상 IgG와 구조가 같고， 약물동력학 특성이 예측 가능하며， 이가 또는 일가 (bi— or monovalent) 항체를 모두 만들 수 있다는 장점이 있다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 내용】
【해결하려는 과제】
본 발명자들은 TNF-α 및 CXCL10 에 특이적으로 결합하는 이중 특이적 항체를 개발하고자 노력한 결과, CXCL10 특이적 항체의 중쇄 가변 영역 및 경쇄 가변 영역을 가지는 scFv 를 TNF— a 특이적 항체의 중쇄 불변 영역 C- 말단에 결합된 형태의 항체를 제조하였으며， 상기 항체는 TNF— a 및 CXCL10 에 이중 특이적으호 결합하는 것을 확인하였고， TNF— a 및 CXCL10 에 특이적으로 결합하는 TNF-a/CX — 10 이중 타겟 항체가 TNF- a 억제능 및 파골세포 분화 억제능을 갖는다는 것을 실험적으로 규명함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 TNF-a (tumor necrosis factor-alpha) 및 CXCL10(C-X-C motif chemokine 10)에 특이적으로 결합하는 TNF- a /CXCL-10 이중 타겟 항체를 제공하는데 있다.
본 발명의 다른 목적은 TNF-a/CXCL— 10 이중 타겟 항체를 포함하는 면역질환의 예방 또는 치료용 약제학적 조성물을 제공하는데 있디-.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명 및 청구범위에 의해 보다 명확하게 된다.
【과제의 해결 수단】
본 발명의 일 양태에 따르면， 본 발명은 TNF-α (tumor necrosis factor-alpha)에 특이적으로 결합하는 제 1 항원 결합 부위, 및 CXCL10(C— X-C motif chemokine 10)에 특이적으로 결합하는 제 2 항원 결합 부위를 포함하며 ,
여기서 상기 서열번호 1 의 아미노산을 포함하는 중쇄 상보성 결정영역 (Heavy chian complementarity determining region, HCDR) 1， 서열번호 2 의 아미노산을 포함하는 HCDR2, 서열번호 3 의 아미노산 을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고， 서열번호 5 의 아미노산을 포함하는 경쇄 상보성 결정영역 (Light chi an complementarity determining region, LCDR) 1， 서열번호 6 의 아미노산을 포함하는 LCDR2, 서열번호 7 의 아미노산을 포함하는 LCDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함하며 ,
상기 제 2 항원 결합 부위는 서열번호 9, 서열번호 17， 서열번호 21 및 서열번호 25 로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR1 서열번호 10， 서열번호 18， 서열번호 22 및 서열번호 26 으로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR2, 서열번호 11, 서열번호 19， 서열번호 23 및 서열번호 27로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 13， 서열번호 29, 서열번호 33 및 서열번호 37 로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR1, 서열번호 14, 서열번호 30, 서열번호 34 및 서열번호 38 로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR2, 서열번호 15, 서열번호 31， 서열번호 35 및 서열번호 39 로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함하는，
TNF- a /CXCL-10 이중 타겟 항체를 제공한다. 본 발명자들은 TNF— α 및 CXCL10 에 특이적으로 결합하는 이중 특이적 항체를 개발하고자 노력한 결과, CXCL10 특이적 항체의 중쇄 가변 영역 및 경쇄 가변 영역을 가지는 scFv 를 TNF— α 특이적 항체의 중쇄 불변 영역 C- 말단에 결합된 형태의 항체를 제조하였으며, 상기 항체는 TNF— α 및 CXCL10 에 이중 특이적으로 결합하는 것을 확인하였고 , TNF— α 및 CXCL10 에 특이적으로 결합하는 TNF-a/CXCL— 10 이중 타켓 항체가 TNF— a 억제능 및 파골세포 분화 억제능을 갖는다는 것을 실험적으로 규명하였다-.
본 발명에서 이용되는 항체는 TNF-a(tumor necrosis factor-alpha) 및 CXCL10(C-X-C motif chemokine 10)에 특이적으로 결합하는 TNF- α /CXCL- 10 이중 타겟 항체이다. 본 발명의 일 구현예에 따르면， 본 발명의 항체는 인간항체 (human antibody)이다.
본 명세서에서 용어 "인간 항체 (human antibody)" 는, 중쇄 및 경쇄의 가변 및 불변영역의 서열이 인간으로부터 유래한 항체를 의미， 하기의 실시예에 기재된 바와 같이 본 발명자들은 유전적 재조합 기술과 세포공학 기술을 이용하여 TNF- a/CXCL— 10 이중 타겟 인간 항체를 제조하였다. 인간 항체는 비—인간 및 키메라 항체보다 장점을 갖는다: 인간 항체의 이펙터 부분은 인간 면역계의 다른 부분과 더 양호하게 상호작용하며 (예를 들어 , 상보성 -의존 세포독성 (CDC) 또는 항체ᅳ의존 세포 세포독성 (ADCC)에 의해 더 효율적으로 표적 세포가 파괴됨), 인간 면역계가 인간 항체를 외부 물질로 인식하지 않아서 이러힌- 생체내로 유입된 항체에 대한 면역 반웅이 전체 외래 비 -인간 항체 또는 부분 외래 키메라 항체 등에 비하여 덜 하다-. 또한, 주사된 비ᅳ인간 항체는 인간 항체의 반감기보다 인간 순환계에서 매우 더 짧은 반감기를 가진다는 것이 보고 되었다. 반대로， 생체내로 유입된 인간 항체는 자연 발생 인간 항체와 실질적으로 동일한 반감기를 가지므로 투여되는 복용량과 횟수를 줄일 수 있으므로 더 유용하다.
본 명세서에서 용어 "가변영역" 은 항원과 특이적으로 결합하는 기능을 수행하면서 서열상의 많은 변이를 보이는 항체 분자의 부분을 의미하고， 가변영역에는 CDRl, CDR2 및 CDR3 가 존재한다. 상기 CDR 사이에는 프레임 워크 영역 (framework region, FR) 부분이 존재하여 CDR 고리를 지지해주는 역할을 한다.
본 명세서에서 용어 "상보성 결정 영역" 은 항원의 인식에 관여하는 고리모양의 부위로서 이 부위의 서열이 변함에 따리- 항체의 항원에 대한 특이성이 결정된다.
본 명세서에서 용어 "패닝 (panning)" 은 파아지의 외벽 (coat)에 펩타이드를 발현 (display)하는 파아지 라이브러리로부터, 표적 분자 (항체, 효소, 세포표면 리셉터 등)와 결합하는 성질을 지닌 펩타이드를 표면에 발현하고 있는 파아지만을 선택해 내는 과정을 일컫는다. 구체적으로 , 상기 이중 타겟 항체는 TNF-α에 특이적으로 결합하는 제 1 항원 결합 부위， 및 CXCL10 에 특이적으로 결합하는 제 2 항원 결합 부위를 포함하며，
상기 제 1 항원 결합 부위는 서열번호 1 의 아미노산 서열로 구성된 중쇄 상보성 결정영역 (Heavy chian complementarity determining region, HCDR) 1, 서열번호 2 의 아미노산 서열로 구성된 HCDR2, 서열번호 3 의 아미노산 서열로 구성된 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 5 의 아미노산 서열로 구성된 경쇄 상보성 결정영역 (Light chian complementarity determining region, LCDR) 1, 서열번호 6 의 아미노산 서열로 구성된 LCDR2, 서열번호 7 의 아미노산 서열로 구성된 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하며，
상기 제 2 항원 결합 부위는 서열번호 9, 17, 21 및 25 로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR1, 서열번호 10， 18, 22 및 26로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR2, 서열번호 11， 19， 23 및 27 로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고，
서열번호 13， 29, 33 및 37 로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR1ᅳ 서열번호 14, 30, 34 및 38 로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR2, 서열번호 15, 31, 35 및 39 로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함하는 경쇄 또는 그의 단편을 포함하는 것이 바람직하나 이에 한정되지 않는다.
또한, 상기 제 2 항원 결합 부위는 서열번호 9 의 아미노산을 포함하는 HCDR1, 서열번호 10 의 아미노산을 포함하는 HCDR2, 서열번호 11 의 아미노산을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 13 의 아미노산을 포함하는 LCDR1, 서열번호 14 의 아미노산을 포함하는 LCDR2, 서열번호 15 의 아미노산을 포함하는 LCDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함할 수 있다. 상기 제 2 항원 결합 부위는 서열번호 17 의 아미노산을 포함하는 HCDR1, 서열번호 18 의 아미노산을 포함하는 HCDR2, 서열번호 19 의 아미노산을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고， 서열번호 29 의 아미노산을 포함하는 LCDR1, 서열번호 30 의 아미노산을 포함하는 LCDR2, 서열번호 31 의 아미노산을 포함하는 LCDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함할 수 있다.
상기 제 2 항원 결합 부위는 서열번호 21 의 아미노산을 포함하는 HCDR1 , 서열번호 22 의 아미노산을 포함하는 HCDR2, 서열번호 23 의 아미노산을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 33 의 아미노산을 포함하는 LCDR1, 서열번호 34 의 아미노산을 포함하는 LCDR2, 서열번호 35 의 아미노산을 포함하는 LCDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함할 수 있다.
상기 제 2 항원 결합 부위는 서열번호 25 의 아미노산을 포함하는 HCDR1 , 서열번호 26 의 아미노산을 포함하는 HCDR2, 서열번호 27 의 아미노산을 포함하는 HCDR3 을 포함하는 중쇄 가변 영역 (VH)을 포함하고， 서열번호 37 의 아미노산을 포함하는 LCDR1, 서열번호 38 의 아미노산을 포함하는 LCDR2, 서열번호 39 의 아미노산을 포함하는 1XDR3 을 포함하는 경쇄 가변 영역 (VL)을 포함할 수 있다.
상기 TNF-a/CXCLᅳ 10 이중 타겟 항체의 제 1 항원 결합 부위는 서열번호 4 의 아미노산을 포함하는 중쇄 가변 영역 (VH) 및 서열번호 8 의 아미노산을 포함하는 경쇄 가변 영역 (VL)을 포함하는 것이 바람직하나 이에 한정되지 않는다..
상기 TNF-a/CXCLᅳ 10 이중 타겟 항체의 제 2 항원 결합 부위는 서열번호 12， 20， 24 및 28 의 아미노산을 포함하는 증쇄 가변 영역 (VH) 및 서열번호 16, 32, 36 및 40 의 아미노산을 포함하는 경쇄 가변 영역 (VL)을 포함하는 것이 바람직하나 이에 한정되지 않는다.
상기 TNFᅳ a/CXa-10 이중 타겟 항체는 TNF— a에 특이적으로 결합하는 제 1 전장 항체의 중쇄 및 경쇄; 및 CXCL10 에 특이적으로 결합하는 제 2 전장 항체의 중쇄 및 경쇄를 포함하고, 상기 제.1 전장 항체 및 제 2 전장 항체의 중쇄 불변 영역 O말단이 서로 연결되어 있는 것을 특징으로 하며 , 구체적으로 TNF— α에 특이적으로 결합하는 제 1 전장 항체의 증쇄 및 경쇄; 및 CXCL10 에 특이적으로 결합하고 제 2 항체의 중쇄 및 경쇄를 포함하는 제 2 전장 항체의 단편을 포함하고, 상기 제 1 전장 항체의 중쇄 불변 영역 C-말단에 제 2 항체의 단편이 연결되어 있는 것을 포함한다 (도 1 참조).
상기 TNF-a/CXCL— 10 이중 타겟 항체의 단편은 단일 사슬 가변 분절 (Single— chain variable fragment , scF )인 것이 바람직하나, 이에 한정되지 않는다.
상기 TNF— a/CXCL— 10 이중 타겟 항체는 힝 -체—항체 또는 힝-체 -단편 간의 연결은 링커 (linker)에 의해 연결되는 것이 바람직하나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예에서, 본 발명자들은 인간 CXCL10 의 유전자를 클로닝하여 CXC.L10 항원 단백질을 제조하였으며 (도 2 참조), 이를 라이브러리 파지에 반응시켜 CXCL10 에 특이적으로 결합하는 scFv—파지를 수득하였고， 이를 대장균에 감염시켜 증폭시키는 패닝 과정을 수행하였다. 이와 같이 3치- 패닝을 수행한 파지의 메트립타아제에 대한 콜로니의 역가가 5.67 X 108로 증폭됨을 확인하였디- (표 1 참조).
또한， 본 발명자들은 싱_기 결합능이 큰 3 차 패닝한 다클론 파아지 항체군에서 단일 클론 항체를 선별하였으며 (도 3 참조), 이의 ELISA 분석을 수행하여 단일 클론 항체를 한번 더 선별하였다 (표 2 참조). 이와 같이 선별한 단일클론 파지를 분류 및 검사하기 위하여 핑거프린팅 및 서열 분석을 수행하였으며 (도 4 참조)， 이를 통해 , 선별된 4 종류의 단일 클론 항체의 VH 및 VL 의 CDR 영역의 패턴 및 폴리펩티드 서열을 확인하였다 (표 5 및 표 6 참조).
또한， 본 발명자들은 상기 선별한 4 종류의 단일클론 파지 중 10E 를 전체 형태의 IgG 로 전환하여 중쇄 및 경쇄를 각각 백터에 삽입하였으며, 이를 숙주세포에 공동ᅳ형질전환하여 형질전환체를 제조하여 이롤 통해 전체 형태의 항체를 제작하여 CXCL10 항원에 대한 결합 친화도를 측정한 결과, 7 X 10— 12의 값을 확인할 수 있었다 (표 8 참조).
또한, 본 발명자들은 상기 선별된 10E 유전자를 항— TNF- a 단일항체인 휴미라의 플라스미드에 클로닝하여 TNF— a 및 CXCL10 에 이중 특이적인 항체인 HuElO— 101 을 제조하였다 (도 1 참조). 이와 같이 제작된 항체의 분자량은 약 187 kDa 임을 확인하였으며 (도 6 참조), ELISA 분석을 통해 TNF— α 및 CXCL10 에 대한 결합력이 이전 선행 연구를 통해 제조된 HuElO-100 과 유사한 정도임을 확인하였다 (도 7 참조). 추가적으로, LAL test 를 통해 제조된 HuEl으 101 항체의 세포 독성이 0.1 EU/IN. 이하임을 확인하였다 (도 8 참조).
또한, 발명자들은 상기 제조한 HuElOᅳ 101 의 TNF— α 또는 CXCL10 의 시험관 내 억제능을 평가하였다. 구체적으로, TNF- ci 수용기를 가지는 WEHI164 세포를 사용하여 HuE10-101 항체가 Humira에 비해 향상된 억제능을 가지는 것을 확인하였으며 (도 41 및 도 42 참조), 세포의 주화능 및 파골 세포의 분화가 감소되는 것을 통해 CXCL10 억제능을 가지는 것을 확인하였다 (도 43 참조).
따라서, 본 발명의 TNF-a/CXCLlO 이중 특이성 항체는 TNF— a 및 CXCL10에 동시에 강한 항원 결합능을 가짐을 확인하였다. 본 발명의 다른 일 양태에 따르면, 본 발명은 제 1 항원 결합 부위를 코딩하는 폴리뉴클레오티드를 포함하는 발현 백터 및 제 2 항원 결합 부위를 코딩하는 폴리뉴클레오티드를 포함하는 발현 백터가 숙주 세포로 공동 형질 전환 (co-transfection)된 형질전환체를 제공한다.
본 발명의 항체를 암호화하는 폴리뉴클레오티드는 코돈의 축퇴성 (degeneracy)으로 인하여 또는 상기 . 항체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여， 코딩영역으로부터 발현되는 항체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고, 코딩영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있으며, 그러한 변형 유전자 역시 본 발명의 범위에 포함됨을 당업자는 잘 이해할 수 있을 것이다. 즉， 본 발명의 폴리뉴클레오티드는 이와 동등한 활성을 갖는 단백질을 코딩하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는. 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함된다. 이러한 폴리뉴클레오티드의 서열은 단쇄 또는 이중쇄일 수 있으며， DNA 분자 또는 RNA(mRNA)분자일 수 있다.
상기 발현백터의 제작 시에는, 상기 항체를 생산하고자 하는 숙주세포의 종류에 따라 프로모터 (promoter), 종결자 (terminator ) , 인핸서 (inhancer) 등과 같은 발현조절 서열, 막 표적화 또는 분비를 위한 서열 등을 적절히 선택하고 목적에 따라 다양하게 조합할 수 있다.
본 발명의 발현백터는 플라스미드 백터， 코즈미드 백터, 박테리오 파아지 백터 및 바이러스 백터 등을 포함하나 이에 제한되지 않는다. 적합한 발현백터는 프로모터， 오퍼레이터, 개시코돈， 종결코돈, 폴리아데닐화 시그널 및 인핸서 같은 발현 조절 엘리먼트 외에도 막 표적화 또는 분비를 위한 시그널 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 발현백터의 프로모터는 구성적 또는 유도성일 수 있다. 상기 시그널 서열에는 숙주가 에쉐리키아속 (Escherichia sp.)균인 경우에는 PhoA 시그널 서열, Q pA 시그널 서열 등이, 숙주가 바실러스속 (Baci Hus sp.)균인 경우에는 α—아밀라아제 시그널 서열, 서브틸리신 시그널 서열 등이 , 숙주가 효모 (yeast)인 경우에는 MF α 시그널 서열， SUC2 시그널 서열 둥이, 숙주가 동물세포인 경우에는 인슐린 시그널 서열, α-인터페론 시그널 서열, 항체 분자 시그널 서열 등을 이용할 수 있으나, 이에 제한되지 않는다. 또한 발현백터는 백터를 함유하는 숙주 세포를 선택하기 위한 선택 마커를 포함할 수 있고， 복제 가능한 발현백터인 경우 복제 기원을 포함한다. 본 발명의 다른 일 양태에 따르면, 본 발명은 (a) 상기 형질전환체를 배양하는 단계; 및 2) 상기 단계에서 배양된 배양액으로부터 상기 TNF- a /CXCL-10 이중 타겟 항체를 정제하는 단계를 포함하는 TNFᅳ a/CXCL10 이중 타겟 항체의 제조 방법을 제공한다.
본 발명에 따른 상기 발현백터를 적절한 숙주 세포, 예를 들어, 대장균 또는 효모 세포 등에 형질전환시킨 후， 형질전환된 숙주세포를 배양함으로써 본 발명에 따른 항체를 대량 생산할 수 있다. 숙주세포의 종류에 따른 적절한 배양 방법 및 배지 조건 둥은 당해 분야의 통상의 기술자에게 알려진 공지 기술로부터 당업자가 용이하게 선택할 수 있다. 상기 숙주세포는 대장균 (E. coli) 또는 바실러스 서브틸러스 (Bacillus subtil is)와 같은 원핵 생물일 수 있다. 또한, 사카로마이세스 세르비시아 (Saccharomyces cerevisiae)와 같은 효모, 곤충 세포， 식물 세포 동물 세포로부터 유래한 진핵 세포일 수 있다. 더욱 바람직하게는， 상기 동물 세포는 자가 또는 동종 이계 동물 세포일 수 있다. 자가 또는 동종 이계 동물 세포에 도입하여 제조된 형질전환체는 개체에 투여되어 암을 치료하는 세포치료 등에 이용될 수도 있다. 상기 숙주세포로의 발현백터 도입방법은 당업자에게 공지된 어느 방법을 사용해도 무방하다. 본 발명의 다른 일 양태에 따르면, 본 발명은 상기 TNF-a/CXCL-10 이중 타겟 항체의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 면역질환의 예방 또는 치료용 약제학적 조성물을 제공한다.
본 발명의 TNF- a /CXCL-10 이중 타겟 항체는 TNF- a 억제능 및 파골세포 분화 억제능을 나타내므로 항체 단독 또는 통상의 약제학적으로 허용되는 담체와 함께 면역질환에 대한 예방 및 치료용 약제학적 조성물로 사용가능하다.
본 발명의 조성물은 면역 반웅에 의해 매개되는- 조직 또는 기관의 이식편 거부 (graft rejection)를 방지하기 위한 면역억제제 ( i隱 LUIO- suppressant)로서 유용하게 사용될 수 있다. 이식편 거부란 이식편 (이식되는 생체의 일부로 세포， 조직 또는 장기)의 공여자와 수용자간의 유전적 배경이 상이하여 (1) 공여자의 이식편 유래 면역 세포가 수요자를 외부물질로 인식하여 공격함으로써 유발되는 질환 (즉, 이식편대 숙주질환) 및 (2) 수용자가 공여자의 이식편을 외부물질로 인식하여 공격함으로써 유발되는 질환 (즉, 이식편 거부반응)을 포함한다. 거부 반웅을 일으키는 이식된 조직 및 기관의 예로서는 심장, 신장, 간, 연골질 (medulla ossium), 피부， 각막, 폐, 췌장, 소장 ( intest inum tenue), 사지 (limb), 근육， 신경 (nervus), 십이지장, 소장 (smal 1— bowel ) , 췌장 인술린 생산세포 (pancreatic-islet-cel 1) 등 뿐만 아니라, 연골질 이식에 의해 발생되는 이식편ᅳ대—숙주 질환을 들 수 있다.
또한， 본 발명의 조성물은 자가면역질환의 치료 및 예방에도 응용될 수 있다.
자가면역질환이란 면역 세포가 자신과 외부물질을 구별하지 못하고 자신을 공격하여 발생하는 질병을 통칭하는 질환이다. 자가면역질환의 예로는 류머티스 관절염 (rheumatoid arthritis), 전신성홍반성낭창 (systemic lupus erythematos i s) , E- 과면역글로불린혈증증후군 (hyperimi inoglobulin E), 하시모토씨 갑상선염 (Hashimoto's thyroiditis), 그레브스 병 (Grave' s Disease) , 다발성경화증 (multiple sclerosis), 경피증 (Sc leroderma) , 전신성 경피증 (progressive systemic sclerosis) , 중증근무력증 (myasthenia gravis), 제 1 형 당뇨 (type I diabetes), 포도막염 (uvei t is)， 알레르기성 뇌척수염 (allergic encephalomyelitis), Λ}구처 1신염 (gloi erulonephr i t i s) , 백반증 (Vitilligo), 굿패스쳐 신드름 (Goodpasture syndrome) , 베제트병 (Becet' s Disease), 크론병 (Crohn' s Disease), 강직성 척추염 (Ankylosing Spondylitis), 포도막염 (Uvei t i s)， 혈소판 감소성 자반증 (Thrombocytopenic purpura) , 심상성 천포창 (Pemphigus vulgaris) , 소아당뇨병 (Diabetes), 자가면역성 용혈성 빈혈 (Autoimmune Anemia), 크라일로글로불린증 (Cryoglobulinemia), 부신백질이영양증 (ALD) , 전신성 흥반성 낭창 (Systemic Lupus Erythematosus, SLE) 등이 있다.
또한, 본 발명의 조성물은 염증성 및 과증식성 피부질환 및 면역 매개 질환의 피부 발현의 치료 및 예방에도 사용될 수 있다. 이들 질환은 예를 들어 건선, 아토피성 피부염, 접촉성 피부염 , 습진성 피부염 (eczematous dermatitises), 지루피부염 (seborrhoeis dermatitis), 편평태선 (lichen planus), 천포창 (Pemphigus) , 유천포창 (Bullous pemphigoid), 수포성 표피 박리증 (epidermolysis bullosa), 두드러기 (urt icaria) , 혈관부종 (angioedemas) , 혈관염 (vascul i t ides) , 홍반 (erythemas)， 피부 호산백혈구증가증 (cutaneous eosinophi 1 ias) , 홍반성 낭창 (Lupus erythematosus) , 전신성 홍반성 낭창 (Systemic Lupus Erythematosus, SLE), 좌창 (acne) 및 원형탈모증 (Alopecia areata)을 포함한다.
또한, 본 발명의 조성물은 안질환 (eye diseases) 또는 다양한 자가면역성 질환의 치료 또는 예방에 사용될 수 있다. 이들 질환의 예는 각결막염 (keratoconjunct ivi t is) , 춘겨 lzl "결막염 (vernal conjunct ivi t is), 각막염 (keratitis), 헤르페스성 각막염 (herpetic keratitis), 상피각막 근위축증 (dystrophia epithel ial is corneae) , 각막백반 (corneal leukoma) , 눈천포창 (ocular pemphigus) , 무렌각막궤양 (Mooren's ulcer), 공막염 (Scleritis), 그레이브스병 (Graves ' opthalmopathy) , 보크트ᅳ 고야나기—하라다증후군 ( Vogt -Koyanag i— Ha r ad a synd r ome ) , 유육종증 (sarcoidosis), 다발성 골수증 (multiple myeloma)을 포함한다.
또한, 본 발명의 조성물은 만성 폐색성 호흡기 질환 (chronic obstructive pulmonary disease; COPD) , 천식 (asthma) (예를 들어 , 기관지 천식, 알레르기성 천식， 내인성 천식, 외인성 천식 및 먼지 천식)， 특히 만성 또는 고질적 천식 (예를 들어， 말기 천식 및 기관지 과민성), 기관지염 (bronchitis), 알러지성 비염과 같은 폐색성기도 질환의 치료 및 예방에도 사용될 수 있다.
본 발명의 '약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스， 수크로스, 솔비틀, 만니를, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘， 미세결정성 셀롤로스， 폴리비닐피를리돈， 셀롤로스, 물, 시럽, 메틸 셀롤로스， 메틸히드록시벤조에이트， 프로필히드록시벤조에이트， 활석, 스테아르산 마그네슴 및 미네랄 오일 등을 포함하나， 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제， 습윤제 , 감미제, 향미제, 유화제 , 현탁제， 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's
Pharmaceutical Sciences (19th. ed. , 1995)에 상세히 가재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고， 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입， 복강 주입, 내피 투여， 국소 투여, 비내 투여， 폐내 투여 및 직장내 투여 등으로 투여할 수 있다. 경구 투여시, 단백질 또는 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화 되어야 한다. 또한 약제학적 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식， 환자의 연령, 체중， 성， 병적 상태, 음식， 투여 시간， 투여 경로， 배설 속도 및 반웅 감웅성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물와 1 일 투여량은 0.001—100 rag/kg이다. 본 명세서에서 용어 "약제학적 유효량" 은 면역질환을 예방 또는 치료하는 데 충분한 양을 의미한다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라， 약제학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 액스제, 산제, 좌제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며， 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 항체 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 항체는 항체-치료제 결합체 형태로 생체내로 투입하여 면역질환 치료에 이용할 수 있다. 치료제는 화학치료제 , 방사성핵종 , 면역치료제 , 사이토킨， 케모킨, 독소, 생물작용제 및 효소 저해물질 등을 포함한다. 항생제를 항체에 결합시키는 방법은, 예를 들면 문헌 G. Gregoriadies, eel. Academic Press London, (1979); Arnon et al . , Recent Results in Cancer Res. ,75： 236(1980)； 및 Moo It on et al, , Immunolog. Res. , 62 :47(1982) )에 기재되어 있다.
본 발명의 항체 또는 항체 단편과 커플링 시키기기에 바람직한 약품은 항세균, 구충, 항진균 및 관련 약제들이고 예를 들면 설폰아미드, 페니실린 및 세팔로스포린， 아미노글리코시드， 테트라사이클린， 클로람페니콜, 피페라진, 클로로퀸, 디아미노피라딘， 메트로니아지드， 이소니아지드， 리팜핀, 스트랩토마이신， 설폰, 에리트로마이신， 폴리믹신, 나이스타틴， 암포테리신, 5-플루오로사이토신, 5-요오드—2' 데옥시우리딘, 1-아다만타아민， 아데닌 아라비노사이드, 암만니틴, 리바바린 및 아지도티미딘 (AZT)이며, 바람직하게는 리바바린이다. 약제를 특이적 표적 부위로 표적화하는데 적당하고 바람직한 여러 가지 조건은 예를 들어 문헌 Trouet et al. , Plenum Press, New York and London , 19ᅳ 30(1982)에 보고 되어 있다. ' 유효한 치료제를 미생물 항원에 대해 제조된 매우 특이성이 있는 항체를 사용하여 감염 병소에 직접 타켓팅하여 감염균을 선택적으로 죽임으로써 약품에 내성이 있는 감염을 치료할 때에 발생되는 많은 문제점들을 해결할 수 있다. 또한 병소로 타겟팅된 약품은 감염부위에서는 높은 농도로 약효를 상숭시킬 수 있다.
상기 항체ᅳ치료제 결합체에서 치료제로 이용될 수 있는 면역조절제는 림포카인 및 사이토카인을 포함하지만, 이에 한정되지 않는다.
【발명의 효과】
본 발명의 특징 및 이점을 요약하면 다음과 같다ᅳ :
(a) 본 발명의 이중 타겟 항체는 TNF— α 및 CXCL10에 모두 효과적으로 결합하는 이중 특이성 항체이므로, TNF— a /CXCL10을 인식할 수 있는 이증 타겟 항체로서 유용하게 사용될 수 있다.
(b) 본 발명의 조성물은 TNF-α 및 CXCL10에 모두 효과적으로 결합하는 TNF— a/CXa-10 이증 타겟 항체를 포함한다.
(c) 본 발명의 이중 타겟 항체는 TNF-a 또는 CXCL10 단일 타겟 항체와 비교하여 우수한 TNF— a 억제능 및 파골세포 분화 억제능을 갖는디-. ·
(d) 본 발명의 조성물은 면역질환의 예방 또는 치료에 이용될 수 있다.
【도면의 간단한 설명】
도 1은 TNFᅳ a/CXCL10 이중 특이적 항체의 제조 모식도이다.
도 2는 Ni-NTA 컬럼 크로마토그래피를 이용하여 정제한 인간 CXCL10 단백질의 확인한 결과이다.
도 3 은 각 패닝 후의 파지 풀을 이용한 인간 CXCL10— His 의 폴리— 파아지 (polyᅳ phage) EL ISA 분석 결과이다.
도 4 는 인간 CXCL10 의 scFv 모노파지 (mono— phage) 클론 (clone)의
BstNI 핑거프린트 (fingerprint) 결과이다. scFv 삽입체는 개별 콜로니로부터 증폭하였고， 증폭된 산물은 BstNI '으로 제한하여 8 % 폴리아크릴아미드 젤로 분석하였다. 파란 글자로 표시된 클론은 다른 그룹을 보인다.
도 5 는 HuE10-101 이중 항체의 배양 기간별 발현을을 평가한 결과이다.
도 6은 정제된 HuElO— 101 이중 항체의 순도 분석 결과이다.
도 7 은 HuElO— 101 이중 항체의 항원에 대한 결합력을 측정한 그래프이다.
도 8은 정제된 HuElO— 101 이중항체의 세포 독성을 조사한 결과이다. 도 9는 생산 세포주 구축을 위한 HuE10-101 발현 백터의 맵이다. 도 10은 형질감염 조건에 따른 HuElO— 101 발현양을 조사한 결과이다. 도 11은 DHFR를 이용하여 선별한 콜로니의 이미지이다. 도 12 는 DHFR 를 이용하여 선별한 단일 클론에서 HuElO— 101 발현을 닷-블로팅올 실시하여 확인한 결과이다.
도 13 은 ELISA 방법으로 DHFR 를 이용하여 선별한 단일 클론들의 상대적인 발현양을 비교한 결과이다.
도 14 는 도 13 의 결과에서 상대적으로 높은 ELISA 스코어에 따라 선별된 29개의 클론을 나타낸 그래프이다.
도 15는 96웰에서 최종 6웰로 옮겨진 클론들의 HuElO-101 발현율을 나타낸 결과이다.
도 16 은 100 nM MTX가 포함된 배지에서 자라는 예비 세포주에 대한 현미경 사진이다.
도 17 은 100 nM MTX 에서 발현율이 높은 3 개의 클론에 대한 HuElO- 101 발현양 측정 결과이다.
도 18은 배양 안정성을 확인한 결과이다.
도 19는 HuElO— 101의 N—말단 아미노산 서열을 확인한 결과이다. 도 20은 HuE10-K)l의 펩타이드 맵핑 결과이다.
도 21 은 HLIEIO— 101 의 구조적 특성 규명을 위해 트립신 처리 후 LC-MS 펩타이드 맵핑 분석법을 이용하여 이론적 아미노산서열의. 동질성을 확인한 결과이다.
도 22 는 CD(Circular di chroi sm)를 이용하여 HuElO— 101 단백질의 2 차 구조를 예측한 결과이다.
도 23 은 ProteOn XPR36 을 통한 Humira 와 HuElO— 101 의 TNF- α 및 CXCL10과의 결합력 평가한 결과이다ᅵ .
도 24 는 ELISA 를 기반으로 한 KD 값을 측정하여 결합 친화도 (binding affinity)를 확인한 결과이다. 도 25 는 휴미라, 휴미라 복제항체， HuE10-101, HuIL21R-101 및 HuIL21R— 100의 항 TNF-α 억제능 평가 결과이다.
도 26 은 CXCL10 에 대한 HuElO— 101 의 주화능 평가 결과를 나타낸 그래프이다.
NC: 음성 대조군， PC: 양성 대조군 (좌측: Jurkat T 세포， 우측:
PBMC) NC: negative control , PC: positive control (왼: Jurkat T cell, 오: PBMC)
도 27 은 공동배양시스템을 도입한 파골 세포 분화 실험 조건을 나타낸 모식도이다.
도 28은 TRAP 염색을 통한 파골 세포 분화 확인한 결과이다.
도 29 는 항— TNF— α 및 항 -CXCL10 에 의한 파골세포 분화의 억제 효과를 측정한 결과이다 (TRAP 양성 다핵 세포 계수 결과).
CD4+ 세포의 RANKL 유도조건 : TNF- α , CXCLIO, TNF— α+ CXCLIO 자극 도 30 은 생산 세포주에서 생산한 항체의 효능을 평가하기 위하여 TNF- Q 중화능 평가를 진행한 결과이다.
도 31 은 휴미라와 휴미라 복제항체를 농도 별로 투여 한 후 관절염 유발 점수를 측정한 결과이다.
도 32 는 휴미라와 휴미라 복제항체를 농도 별로 투여 한 후 체중 변화를 측정한 결과이다.
도 33 은 HuIL21-101 을 농도 별로 투여 한 후 관절염 유발 점수를 측정한 결과이다.
도 34 는 HuIL21-101 을 농도 별로 투여 한 후 체중 변화를 측정한 결괴-이다ᅳ
도 35 는 HuElO— 101 을 농도 별로 투여 한 후 관절염 유발 점수를 측정한 결과이다. 도 36 은 HuElO-101 을 농도 별로 투여 한 후 체중 변화를 측정한 결과이다.
도 37 은 HuElO-101 을 농도 별로 투여 한후 조직학적 점수를 측정 한 결과이다.
도 38은 관절염 유발 점수와 조직학적 점수의 비교 결과한 결과이다. 도 39 는 생산 세포주에서' 생산한 HuElO-101 을 농도 별로 투여 한 후 관절염 유발 (arthritis score) 점수 결과이다.
도 40 은 생산 세포주에서 생산한 HuElO-101 을 농도 별로 투여 한 후 체중 변화를 측정한 결과이다.
도 41 은 실험이 종료된 Tgl97 마우스 조직을 얻어 병리학적 변화 관찰한 결과이다ᅳ
도 42 는 생산 세포주에서 생산한 HuElO— 1.01 을 농도 별로 투여 한 후 조직학적 점수를 측정 한 결과이다.
도 43 은 생산 세포주에서 생산한 HuElO— 101 을 관절염 유발 점수와 조직학적 점수의 비교 결과한 결과이다.
도 44 는 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 관절염 유발 점수를 측정한 결과이다.
도 45 는 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 부종 변화를 측정한 결과이다.
도 46 은 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 부종 변화를 촬영한 결과이다.
도 47 은 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 micro CT 를 이용하여 골을 확인한 결과이다.
도 48 은 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 조직병리학적 병변을 확인한 결과이다. 도 49 는 LPS 로 유도된 염증성 골 소실 마우스 모델에서 HuElO- 101의 파골세포 분화능 평가에 대한 모식도이다.
도 50 은 LPS 로 유도된 염증성 골 소실 마우스 모델에서 HuElO— 101의 파골세포 분화능 평가한 결과이다.
도 51 은 LPS 로 유도된 염증성 골 소실 마우스 모델에서 생산세포주에서 생산한 HuElO— 101의 파골세포 분화능 평가한 결과이다. 도 52 는 LPS 로 유도된 염증성 골 소실 마우스 모델에서 생산세포주에서 생산한 HuElO-101 의 파골세포 분화능을 정량 분석한 결과이다.
도 53 은 콜라겐 유도성 관절염 마우스 모델에서 HuE10-101 의 효능평가에 대한 모식도이다.
도 54 는 중복되지 않은 3 인의 32 가지 조직을 이용하여 ᅡ hiElO一 1이의 교차 반응을 확인한 결과이다.
이하， 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
【실시예】
실시예 1: 인간 CXCL10 항원 단백질의 제조
인간 CXCL10에 대한 단일클론 항체를 제작하기 위하여 , 인간 CXCL10 단백질을 발현 및 정제하였다. 구체적으로， 인간 CXCL10을 증폭하기 위하여 비장， 태반， 간 및 신장 cDNA 라이브러리 믹스를 주형으로 하여 pET22b 백터에 삽입하였다. pET22b—인간 CXCL10 플라스미드를
BL2KDE3)로 형질전환한 후, 수득한 형질전환체는 암피실린 (ampicillin)이 포함된 LB 플레이트에 접종하여 밤새 배양 후, 37°C에서 진탕 배양하였다. 그런 다음， OD600 값이 0.55가 되면 IPTG를 0.5 mM 농도로 첨가하여 밤새 배양한 후， 6ᅳ 500 rpm, 4°C에서 15 분간 원심 분리하여 상등액을 수득하였다. 수득한 상등액을 농축하여 Ni— NTA 아가로오즈를 넣어 반웅시킨 후， 아가로오즈 비드를 컬럼에 충진한 후에 용출 (elution)하였다. 농축 후， 15 % SDS-PAGE 겔에 걸고, 코마시에 (coomassiae)로 염색하였다-. 단백질의 발현 정도를 비교하기 위하여 BSMBovain serum albumin)을 표준정량 단백질로 함께 사용하였다. 그 결과, 도 2에서 나타낸 바와 같이 , 약 15 kDa의 크기의 인간 CXCL10 단백질이 발현된 것을 확인하였다. 실시예 2: 단일클론 항체의 제조
2-1. 패닝 과정
패닝 (panning)은 파아지의 외벽 (coat)에 펩타이드를 발현 (display)하는 파아지 라이브러리로부터， 표적 분자 (항체, 효소, 세포표면 리셉터 등)와 결합하는 성질을 지닌 펩타이드를 표면에 발현하고 있는 파아지만을 선택해 내는 과정을 일컫는다. CXCL10의 단일 클론 항체를 제조하기 위한 파지 항체군을 제조하기 위하여 파지 패닝을 수행하였다. 상기 <실시예 1>에서 수득한 정제된 인간 CXCL10 항원 100 을 Immunosorb 튜브 (Nunc 470319)에 2 inf.의 코팅 완충용액 (Na2C03(sigma , S7795) 1.59 g, NaHC03(sigma, S8875) 2.93 g, NaN3(sigma( S2002), 0.2 g)으로 4°C에서 16 시간 정도 회전기 (rotator)에서 코팅한 후, 실은에서 2 시간 동안 PBS에 녹여 4 % 스킴밀크 ((BD, 232100)- IX PBS에서 4 %)를 사용하여 면역 튜브에서 차단하였다. 상기 면역 튜브에 라이브러리 파지 2 ^을 첨가하여 실온에서 2 시간 동안 반응시켰고 PBST(0.05 %)로 5 회 PBS로 2 회 세척하였다. 세척 후 특이적으로 결합한 scFv—파지들만 100 mM TEMSigma T-0886)로 용출하예 용출된 파지들을 대장균 (XLl-Blue, stratagene, 200249)에 감염시켜 증폭했다. 첫 번째 패닝에서 증폭된 파지를 PBST(140 mM NaCKsigma, S7953-5kg) 8 g, 10 mM Na2HP04(Sigma , S7907-dibasic) 1.15 g, 1.8 mM H2P04(sigma, S— 5655— 500g: monobasic) 0.2 g, 2.7 mM CKsigma p9541) 0.2 g, 트원 20(sigma, pl379) 0.55 %) 세척 단계에서 횟수만 늘려서 (2차: 13번， 3차: 23번) 동일한 방법으로 2차 및
3차 패닝을 수행하였다. 그 결과， 하기 [표 1]에서 나타낸 바와 같이 3차에서 항원에 대한 파지의 콜로니 역가 (titer)가 100 배 이상 증폭됨을 확인하였다 (표 1).
【표 1】
패닝 횟수에 따른 항 -인간 CXCL10 파아지의 콜로니 타이터
Figure imgf000027_0001
2-2. 파아지 항체 스크리닝
1차부터 3차까지 패닝하여 얼려두었던 세포 저장물 (stock)올 5 mPᅳ의 2 YTCM, 2 % 글루코오스, 5 niM MgCl2 배지에 OD600값이 0.1이 되게 넣어준 다음， 37°C에서 2 내지 3 시간 (OD600=0.5 내지 0.7)동안 배양하였다. 배양한 세포 저장물에 Ml 헬퍼 파지를 감염시키고 2XYTCMK, 5 niM MgCl2, 1 mM IPTG 배지에 30°C에서 16 시간 동안 배양하였다. 상기 배양한 세포를 4500 rpm으로 15 분 동안 4 °C에서 원심분리한 후 상등액 (1차〜 3차 패닝 poly scFv—파지)을 새 튜브로 옮겼다. 96웰 면역 플레이트 (NUNC 439454)에 두 종류의 항원 (CXCLIO, a-myc)을 웰 당 100 ng 씩 4 °C에서 16시간 정도 코팅 완층용액으로 처리하여 코팅하여 PBS에 녹인 스킴 밀크 (4 %)를 사용하여 각 웰을 차단하였다. 각 웰 마다 PBSᅳ트뷘 20(0.05 %) 0.2 in,으로 씻어준 다음 1차, 2차, 3차 패닝 폴리 scFV-파지를 각 웰에 100 씩 넣고 상온에서 2 시간 동안 반웅시켰다. 반웅 후, 다시 각 웰마다 PBS- 트윈 20(0.05 %) 0.2 in,을 사용하여 4 번 세척하였고 이차 항체인 항— M13- HRP(Amersham 27— 9421— 01)를 1:2000으로 희석하여 실온에서 1 시간 동안 반웅시켰다. 반웅 후에 ?83—트원20(0.05 %) 0.2 ,으로 세척하고 0PD 정게 (Sigma, 8787-TAB)를 PC 완층용액 (C6H807.H20(sigiTia, C0706) 5.1 g, Na2HP04( sigma, S7907) 7.3 g)에 녹인 기질 용액을 만들어 웰 당 100 ^씩 넣어 10 분 동안 발색시킨 다음 490 nm에서 흡광도를 Spec t r ophot ome t er (Mo 1 ecu 1 arDevi ce , 미국)로 측정하였다.
그 결과， 도 3에서 나타난 바와 같이 항원에 대한 결합능이 두 가지 항원에 대해 3차 poly scFV—파지에서 증강 (enrichment )됨을 ELISA를 통해 확인하였다 (도 3).
2-3. 단일 클론 파아지 선별
상기 <실시예 2-2>에서 제조한 결합능이 큰 다클론 파지 항체군 (3차 패닝)에서 얻은 콜로니 2XYTCM, 2 % 글루코스, 5 mM MgCl2 배지 1 in(이 포함된 96— deep 웰 플레이트 (바이오니아, 90030)에 분주하여 37 °C에서 16 시간 동안 배양하였다. 배양한 세포의 0D600 값이 0.1이 되도록 100 내지 200 ^를 취해 1 의 2XYTCM, 2 % 글루코오스, 5 mM MgCl2 배지에 희석한 다음, 96-deep 웰 플레이트에 분주하여 37 °C에서 0D600 값이 0.5 내지 0.7 되도록 2 내지 3 시간 동안 배양하였다. Ml 헬퍼 파지를 M()I값이 1:20이 되도록 감염시킨 후, 2XYTCM , 5 mM MgCl2> 1 mM IPTG 배지에 30 °C에서 16 시간 동안 배양하였다. 배양한 세포를 4,500 rpm으로 15 분 동안 4 °C에서 원심분리한 후， 상등액을 취해 4 % PEG 6, 000과 3 % NaCl을 첨가하여 잘 녹여 얼음에서 1 시간 동안 반웅시켰다. 반웅 후， 8,000 rpni으로 20 분 동안 4°C에서 원심분리한 후 펠릿에 PBS를 첨가하여 녹인 다음 12,000 rpi으로 10 분 동안 4°C에서 원심분리하여 상등액을 취해 새 튜브에 옮겨 3차 패닝해서 얻은 단일 클론 scFv—파지를 4°C에서 보관하였다. 2-4. 단일 클론 파아지 항체군의 ELISA 분석
96웰 면역 플레이트에 CXCL10 및 a一 niyc의 두가지 항원을 웰당 100 ng씩 넣어 4°C에서 16 시간 동안 코팅 완충용액으로 코팅한 후, PBS에 녹인 스킴밀크 (4%)를 사용하여 각 웰을 차단하였다. 각 웰마다 PBS— 트원 20(0.05%) 0.2 ^을 사용하여 세척한 다음 3차 패닝하여 얻은 단일클론 scFv—파지 (각 100 scFv-피.지 )를 각 웰에 100 / 씩 넣고 상온에서 2 시간 동안 반응시켰다. 다시 각 웰마다 ?83—트원20(0.05%) 0.2 ιι 를 사용하여 4 번 씻어준 후 2차 항체인 항— M13-HRP를 1/2000로 회석하여 실온에서 1 시간 동안 반웅시켰다. PBSᅳ트원 20 (0.05%) 0.2 ηι 로 세척한 후에 발색하여 흡광도 490 nm에서 측정하였다.
그 결과， [표 2] 에서 나타난 바와 같이 각각의 항원에 대한 결합능이 강한 단일 파이지 클론들은 인간 CXCL10— His에 대해 총 59 개의 단일 파지 클론을 수득하였다 (표 2).
【표 2】
항원 인간 CXCL10-His에 대한 단일 파아지 ELISA 결과
Figure imgf000029_0001
Figure imgf000030_0001
실시예 3: 선별한 단일 클론 파지 분류 및 검사
3-1. 핑거 프린팅에 의한 검증
상기 <실시예 2>를 통해 선별된 10 개의 단일 클론 세포를 핑거프린팅으로 검증하기 위하여 , 선별한 단일 클른 세포 각각 1 ^와 Taq DNA 중합효소 (젠닥스 5 \]/ ί) 0.2 ιΑ, 50 ρ//ί,의 정방향 프라이머 (pel Β5) (서열번호 41: 5 ' -CTAGATAACGAGGGCAAATCATG-3 ' ) 및 역방향 프라이머 (cla3) (서열번호 42: 5 '— CGTCACCMTGAAACCATC-3 ' ) 각각 0.2 ≠, 10X 완충용액 3 ≠, 10 niM dNTP mix 0.6 μί' 증류수 24.8 를 흔합하여 하기 [표 3]의 PCR 프로그램의 조건으로 콜로니 PCR(iCycler iQ, BI0- RAD)을 수행하였다.
【표 3]
Figure imgf000030_0002
Figure imgf000031_0001
상기에서 수득한 콜로니 PCR 산물은 1% 아가로스 겔 (Seakem LE,
CAMERES 50004)에서 확인하였고, BstNI (Rochell288075001 , 10 U/βί) 0.2
^를 가하여 37°C에서 2 내지 3 시간 동안 하기 [표 4]의 반웅 조건으로 반응시켰다.
【표 4】
Figure imgf000031_0002
그 결과， BstNI에 의해 잘려진 상기 단일 클론 파지 항체들의 단편을 8 % DNA 폴리아크릴 아마이드 겔 (30 % acrylamide(Bio-RAD, 161- 0156) 2/.66 10XTBE 1 , 증류수 6.27 mi , 10 % APS(sigma, Α3678) 70 ≠' TEMED(Bio-RAD, 161—0801) 7 )에서 확인하였으며， 도 3에서 나타낸 바와 같이 단일 클론 파지 항체의 다양성을 확인하였다 (도 4).
3-2. 서열 분석에 의한 검증
상기 실시예 <3— 1>에서 핑거프린팅으로 확인된 단일 파지 클론들 각각의 서열을 분석하기 위하여 , 단일 클론 세포를 2XYTCM, 2 % 글루코스, 5 niM MgCl2 배지 (5 . 에 37°C에서 16 시간 동안 배양하였다. 배양한 단일 세포으로부터 DNA 정제 키트 (Nuclogen, 5112)를 이용하여 DNA를 수득한 후， pelB5 프라이머 (서열번호 43: 5 '— CTAGATAACGAGGGCAAATCATG— 3 ' )를 이용한 서열 분석 (솔젠트, 한국)을 의뢰하여， 상기 선별된 항체의 VH 및 VL의 CDR 영역을 확인하였다. 분석된 서열을 통해 이들 항체와 생식세포 계열 (genii line) 항체군의 유사성을 NCBI의 Ig BLAST 프로그램 (//www. ncbi .nlm.nih.gov/igblast/)을 이용하여 각각의 인간 항체의 중쇄 및 경쇄의 CDR3에서 사용되고 있는 폴리펩티드를 분석하였다. 그 결과， [표 5]에서 나타낸 바와 같이 4종의 human CXCLIO에 특이적인 파지 항체를 얻었으며, 이들의 아미노산 서열은 [표 6]에 나타내었다.
【표 5】
인간 CXCLIO— His 항원에 대해 얻은 단클론 항체목록
Figure imgf000032_0001
【표 6】
인간 CXCLIO 에 대한 단일클론들의 아미노산 서열 중쇄 경쇄
Figure imgf000033_0001
실시예 4: 전체 IgG 변환 및 분석
4-1. 전체 형태 (Whole form) IgG 변환
상기 실시예 <3-2>의 4 종의 단일클론 파지 중 항체들을 scFv에서 IgG로 전환하기 위하여, 중쇄의 경우 단일클론 DNA 1 ιΛ, 중쇄 정방향 프라이머 및 중쇄 역방향 프라이머 각각 10 piole// , 10X 버퍼 5 ≠, 10 iiiM dNTP mix 1 μΐ,, pfu DNA 중합효소 (솔젠트, 2.5 U/μί) 및 0.5 .id 증류수를 흔합하여 콜로니 PCR(iCycler iQ, BI으 RAD)을 수행하였다. 또한, 경쇄의 경우도 하기 경쇄 정방향 및 역방향 프라이머를 사용하여 동일한 방법으로 콜로니 PCR을 수행하였다. 4 종의 단일클론 파 7
Figure imgf000034_0001
IgG로 변환하기 위해 사용한 프라이머는 [표 기에 나타내었다.
【표 7】 ^
IgG 변환에 사용한 프라이머 서열
Figure imgf000034_0003
그 후， PCR로 수득한 중쇄 유전자를 DNA—겔 추출 키트 (Qiagen)로 정제하여 pNATAB H 백터 1 (10 ng), 중쇄 (100 내지 200 ng) 15 !Λ, 10 X 버퍼 2 ≠, 연결효소 (1
Figure imgf000034_0002
1 ≠, 증류수를 흔합하여 실온에서 1 내지 2 시간 방치하여 백터와 연결하였다. 상기 중쇄 유전자를 연결한 pNATAB H 백터를 형질전환용 세포 ( coli XL1— blue)와 함께 얼음에 30 분 동안 방치한 후， 42°C에서 90 초 동안 열충격을 주어 형질도입 (transfection)하고 다시 얼음에서 5 분 동안 방치한 뒤 LB 배지 1 1 을 주입하여 1 시간 동안 37°C에서 배양하였다. 그 후， 암피실린이 포함된 LB 고체 배지에 도말하여 37°C에서 16 시간 동안 배양하였다. 배양 후 생성된 단일 콜로니를 암피실린이 포함된 LB 액체 배지 5 in.ᅳ에 접종하여 37°C에서 16 시긴- 동안 배양하였다. 상기 배양액으로부터 DNA— prep 키트 (Nuclogen)를 이용하여 DNA를 추출하였다. 또한, 경쇄는 pNATAB L 백터를 사용하여 상기와 같은 방법으로 DNA를 추출하였다. 4-2. 항 -CXCL10 항체의 정제 및 항원 결합 친화도 측정
추출한 전체 형태 항체 DNA는 293E 세포 ( Invi trogen)에 PEI 40 ^g, DNA 10 /g 및 경쇄 DNA 10 /zg을 넣어 공동—형질감염을 하였다. 형질감염 후 얻은 2일 차부터 8일 차까지의 상등액을 수득하여 단백질 A 비드를 이용하여 정제를 하였고， 정제된 인간 CXCL10 항체의 항원에 대한 결합력을 측정하기 위하여， ELISA를 수행하였다.
구체적으로 ELISA는 96 웰 면역플레이트에 재조합 인간 CXCL10 단백질을 웰당 100 ng 씩 4°C에서 16 시간 동안 코팅 완층용액으로 코팅한 후， PBS에 녹인 스킴밀크 (4 %)를 사용하여 각 웰을 차단하였다 ·, 각 웰마다 ?83-트원20(0.05 %) 0. 2 m£을 가하여 씻어준 다음， 단일클론 항체를 50 nM부터 1/2씩 순차적으로 희석하여 항원이 코팅된 플레이트에 100 씩 넣고 상온에서 2 시간 동안 반웅시켰다. 다시 각 웰마다 PBS- 트원 20(0.05 %) 0.2 iti.g을 가하여 3 번 씻어준 후 이차 항체인 항 -인간 Fcᅳ HRP를 1:4000으로 회석하여 실온에서 50 분 동안 반웅시켰다. PBS— 트원 20(0.05 %) 0.2 in.으로 씻어준 후에 0PD 정제를 PC 완층용액에 넣은 기질 용액을 웰당 100 씩 넣어 5 분 동안 발색시켜 흡광도 490 ππι에서 분광광도계 (Spectrophotometer)로 측정하였고, 상기 ELISA 결과는 Graphpacl prism ver.4 소프트웨어 (CA 92037： Graphpacl Software Inc. , USA)를 사용하여 분석하였다ᅳ
그 결과， [표 8]에서 나타난 바와 같이, 정제된 항— CXCL10 항체의 항원에 대한 결합력 (KD)이 우수한 것을 확인하였다 (표 8).
【표 8】
인간 CXCL10에 대한 정제된 전체 IgG 항체의 KD값
Figure imgf000036_0001
실시예 5: CXCL10 및 TNF-α 이증-특이적 항체의 제조
5-1. 이중 특이적 항체 HuElO-101의 제조 및 정제
함—인간 CXCL10 단일항체 및 블록버스터 항 -TNFᅳ a 단일항체인 휴미라 (humira)를 융합한 이중 특이적 항체를 제작하기 위하여， 상기 <실시예 3>에서 제조한 항—인간 CXCU0 단일 클론 항체 중 E10의 ScFv를 pNATABH:：휴미라의 3' 말단에 클로닝하여 이를 HuElO-101로 명명하였다. 항 -TNF-α 항체인 휴미라는 중쇄 가변영역의 아미노산 서열 (서열 번호: 4) 및 경쇄 가변영역의 아미노산 서열 (서열 번호: 8)을 토대로 유전자 합성을 통하여 제조하였다. 그런 다음， humira의 중쇄영역을 포함하는 백터에서 휴미라의 중쇄 및 가변영역 3'-말단에 E10 scFv를 연결하기 위해 PCR을 수행하였으며， 이를 통해 두 개의 단편을 연결하여 하나의 DNA 단편으로 만들어 이를 다시 pNATABH 백터에 삼입하여 HuElO— 1이을 발현하기 위한 pNATABH:： Hum ira/E10ScFv 백터를 제조하였다. 그런 다음, HEK 293E 세포 (Invitrogen)에 pNATABH：： Hum i ra/E10ScFv 및 pNATABH: : Humira를 3:7의 비을로 공동 -형질감염하였다. 형질감염 후 얻은 2일 차부터 8일 차까지의 이를 간격으로 상등액을 4회 수득하여 항체의 발현량을 웨스턴 블롯팅 (western blotting)으로 확인한 후 (도 5)， 단백질 A 비드를 이용하여 정제하였다. 웨스턴 블롯팅은 세포 배양액을 이를간격으로 수집하여 1 ml 튜브에 각각 넣은 다음 세포를 제거하기 위해 5000 rpm으로 5분간 원심분리한 후 얻은 상등액을 단백질 샘플 버퍼 25 μ ΐ와 각각의 상등액 125 μ ΐ를 각각의 1 ml 튜브에 넣어서 5분간 끓였다. 10% SDS-PAGE 겔에 40 μ 1씩 로딩한 후 전기영동 한 다음, 멤브레인에 트랜스퍼하였다. 멤브레인을 4% 스킴 밀크로 1시간 가량 블로킹한 후， 2차 항체인 항— Fc— H P를 1/4000으로 첨가한 뒤 상온에서 4시간 가량 흔들어 주었다. lxPBST로 3회 세척힌 · 후 ECL 용액 1 ml을 멤브레인에 뿌린 다음 암실로 엑스ᅳ레이 필름으로 감광시켜 결과를 얻었다.
그 결과, 도 5에서 나타낸 바와 같이 HuElO-101 항체의 발현을 확인하였으며， 최종 정제된 항체의 회수율은 7 mg/L로 일시적 (transient) 발현을 통한 방법으로는 많은 양이 발현됨을 확인하였다 (도 6).
또한, 정제한 항원의 QC 분석을 위하여, Agilent 2100
Bioanalyzer ( Inc , Agi lent Technologies , Germany)의 Agi lent Protein 230 kit (5067-1517) 첩을 이용하여 겔 -유사 이미지와 절대 정량 (Absolute Quantitation)을 확인하였다 ·. 분석은 감소 (reducing)와 비—감소 (non- reducing) 조건에서 각각 수행하였으며， 대조군으로 휴미라를 함께 분석하였다.
그 결과， 도 6에서 나타낸 바와 같이， 휴미라는 환원 (reducing) 조건에서 중쇄와 경쇄의 분자량이 50과 25 k.Da에서 나타나며, HuElO— 101의 중쇄와 경쇄의 분자량은 각각 83과 25 kDa에서 나타나 휴미라의 중쇄영역에 EK)의 ScFv가 융합되어 분자량은 증가됨을 확인하였다. 비—흰-원 (non- reducing) 조건에서 HuEl으 101의 분자량은 약 187 kDa 임을 확인하였다 (도 6).
5-2. 이중 특이적 항체 HuElO— 101의 CXCL10 및 TNF- α에 대한 결합력 조사 이중 특이적 항체 HuElO— 101의 CXCL10 또는 TNF— α에 대한 특이적인 결합력을 확인하기 위하여 상기 실시예 <4— 2>와 동일한 방법으로 ELISA 분석을 수행하였다. HuElO— 101의 결합력의 수준을 비교하기 위해, HuEl으 100 항체와 동일한 방법으로 분석하여 비교하였다. 한편， 상기 HuElO— 100 항체는 휴미라 중쇄의 가변영역 N—말단에 E10 scFv를 연결시켜 제작하였으며 , HuE10-l이과 같은 TNF— α와 CXCL10에 대한 이중항체이나, HuElO— 101에 비해 발현량이 극히 저조한 단점이 있다.
그 결과, 도 7에서 나타난 바와 같이 CXCL10에 대한 결합력은
HuElO-100 및 HuElO— 101 두 항체에서 각각 3.0X 10_L1M (R2=0.99) 및
4.7XKT10M (R2=0.99)을 나타냄을 확인하였으며 , TNF- α에 대한 결합력은
각각 4.1X10— "M (R2=0.989)과 3.5X10_1LM (R2=0.99)로 유사한 결합력
정도를 가지는 것을 확인하였다 (도 7).
5-3. 이중 특이적 항체 HuE10-101의 세포 독성 조사
이중 특이적 항체 HuElO— 101의 동물실험을 위하여 세포 독성을
조사하였다. HuE10-K)l은 60.28 mg을 생산하여 조사하였으며 , 대.조군으로
휴미라를 43.68 mg 생산하여 수행하였다.
HuE10-101을 정제한 후, 정제된 항체의 세균내독소 (bacterial endotoxin)를 측정하기 위해서 Chr이 n)-LAL(cat# C003.1, CAPE COD)을
이용하였다. 대조군으로 사용되는 기준 독소 (CSE, control 스탠다드
세균내독소; cat# E0005, CAPE COD)를 1 EU/ml부터 2 배씩 회석하여 최소
농도가 0.03125 EU/！ 이 되도록 준비하였다. 음성 대조군으로 LRW(LAL reagent water, cat# WPIOOI, CAPE COD) 100 에 LAL 100 βί을 넣어주고,
양성 대조군으로 0.125 EU/ml 농도의 기준 독소 (CSE) 100 ^에 LAL 100 ¬를 섞어 실험에 사용하였디-. 분석을 위해 LRW로 50 /zg/n 의 일정 농도가
되도록 희석한 시료 100 에 LAL 100 ^를 준비하였다. 추가로 시료의
간섭확인을 위해 생성물질 양성 대조군 실험을 하는데， 상기 희석한 시료
50 에 0.125 EU/in« 기준 독소 (CSE) 50 ^과 LAL 100 ,를 넣어
준비하였다. VersaMax 마이크로플레이트 reader (Molecular devices)로
측정시 프로토콜화 한 파일 (Chromo LAL sett ing.pda)을 이용하여 기준값을
정하였다. 플레이트는 37°C로 10 분 정도 예열하여 준비한 후 실험을
시작하였다. LAL을 처리함과 동시에 프로토콜화 한 파일을 시작하여 0D를
측정하였다. 스탠다드 곡선의 X축은 Log EU/ιιώ, Y축은 Log Onset time으로
작성되며, 시료의 세포내독성 수치는 측정한 0D를 소프트웨어 상에서
자동으로 계산하여 EU/III,로 표시하였다. 스탠다드 곡선의 R2 값이 0.98이상 되는 경우에 측정치에 대한 신뢰성을 두었다.
그 결과, 도 8에서 나타난 바와 같이, HuE10-101 및 휴미라의 내독소 레벨을 알아보기 위하여 LAL 테스트를 수행한 결과 HuE10-101 및 휴미라의 LAL 값은 모두 0.1 EU/ml 이하임을 확인하였다 (도 8).
.
실시예 6: HuE10-101 생산 세포주 확립
6-1. 세포주용 HuElO— 101 발현 백터 제조
HuE10-101 항체의 HuE10-101 항체 중쇄와 경쇄의 발현을 위한 플라스미드는 invitrogen의 pOptiVec 시스템을 사용하였다. pOptiVec 시스템의 장점으로는 관심유전자와 선택 마커인 DHFR이 동일 전사체 상에 존재하여 유전자 증폭이 용이하다는 점이다. HuE10-101ᅳ He와 HuE10-101-
Lc는 모두 pOptivec 백터에 서브-클로닝 되었으며, 형질감염시 DNA 선형화에 사용된 효소 위치는 암피실린 유전자 내부의 Pvul을 이용하였다. 플라스미드 맵은 도 9와 같다. 형질감염 시약으로 리포펙타민 2000을 사용하였고 DNA ： 리포펙타민 2000 = 1 ： 1, 1.5, 2의 비율로 사용하였다.
6—2. CHO DG44 유지
발현 숙주로 사용된 CHO DG44 세포는 MEM—알파 (w/) + .10% FBS + AA 배지를 사용하여 배양하였다. 세포 패싱 (passing) 시 약 1-2 x 106 세포 /웰을 0.25% 트립신을 사용하여 바닥에서 떼어낸 후 1/3을 2 ml의 배지가 포함된 새 웰로 트랜스퍼 하였다. 세포주 개발은 96웰 및 6웰 플레이트 수준에서 진행하였디ᅳ .
6-3. 형질감염
형질감염 전일 4 X 105 세포를 6웰 플레이트에 분주한 후 약 16시간 동안 배양기에서 배양하였다. 형질감염 당일 세포 상태를 관찰하고 형질감염에 적합한지 확인 후 MEM-알파 (w/) (-FBS, -AA) 배지로 2번 세척하였다. 1 ml의 MEM—알파 (w/) (—FBS, -AA) 배지를 첨가 후 약 1시간 동안 배양기에서 배양하였다. 형질감염에 필요한 DNA는 선형화한 HuElO- 101-Hc와 HuElO— 101-Lc를 사용하였으며 2 ig(Hc ： 1 g + Lc ： 1 g)과 리포펙타민 2000 4 . !을 MEMᅳ알파 (w/) (-FBS, -AA) 100 에 흔합 후 상온에서 약 30분간 반응 시켰다 (DNA: 리포펙타민 2000 = 1 : 1， 1.5, 2)의 세 가지 비율로 사용하였다. 위의 예시는 1:2의 비율이다. 흔합액을 웰에 떨어뜨리는 방식으로 형질감염하였으며 6시간 후 MEMᅳ알파 (w/) + 10% FBS + AA 배지로 교환하였다. 형질감염은 모두 2배수로 진행하였다.
형질감염이 잘 되었는지 확인하기 위하여 웨스턴 블롯을 실시하였다. 형질감염 후 2— 3일 후에 6웰에 세포가 꽉 찼을 때， 배지를 수득하여 웨스턴 블롯을 수행하였다. 10% SDS PAGE 겔을 이용하였고, 배지는 30 μΐ 로딩하였다. DNA: 리포펙타민 2000 二 1 ： 2의 조건에서 형질감염이 가장 잘 이루어진 것을 확인하였다 (도 10).
6-4. 단일 콜론 선별
약 이를 후 형질감염된 DG44의 16개의 96¾ 플레이트에서 단일 클른 선별을 진행하였다. 트립신으로 세포를 모두 떼어낸 후 카운팅 하여 1웰 당 200 세포씩 되도록 분주하였다. 이 때 DHFR에 의한 선별을 위하여 MEM—알파 (w/o) + 10% dFBS + AA 배지를 사용하였다. 2주 후 콜로니 생성 여부를 관찰하였으며 배지를 수득하여 ELISA를 통해 HulOE-101의 발현정도를 확인하여 높은 발현율을 갖는 29개의 클론을 선별하였다.
도 11은 96웰 플레이트에 형성된 콜로니를 촬영한 현미경 사진이다.
DHFR에 의한 선별을 위하여 MEM—알파 (w/o) + 10% clFBS + AA 200 에 200 세포 /웰이 되게 깔아주게 되면 형질감염 된 세포들은 선별 배지에서 자라게 되어 콜로니를 형성하게 된다.
도 12는 도 11의 콜로니의 발현확인을 위해 닷-블로팅을 실시한 결과이다. 배지는 30 μί를 사용하였고 항— Fc— HRP로 탐지하였다； 주황색 동그라미와 같이 발현율이 높은 클론은 좀 더 진한 블롯을 갖는 것을 확인할 수 있었다.
도 13은 단일 클론 선별한 16 플레이트 증 3개의 플레이트에서 ELISA 방법으로 상대적인 발현양을 비교한 것이다. 항— Fab 항체를 100 ng/웰로 코팅한 ELISA 폴레이트에 2시간 동안 5%) 스킴밀크를 포함하는 PBS를 이용하여 블로킹 하였다. . 그 후 콜로니를 선별한 배지를 수득하여 100 ≠ 첨가하였다. 2시간 상온에서 반응 후 0.05% PBST 200 ^로 3번 세척해 준 후 항— Fcᅳ HRP를 1:5, 000으로 100 ≠ 1시간 반웅시킨 후 0PD를 이용해 탐지하였다. 보라색으로 표시한 클론들이 선별된 발현율이 상대적으로 높은 클론들이다.
ELISA 정량한 것 중 발현이 높고, 단일 콜로니를 형성한 것을 한 플레이트 당 2— 3개씩 골랐다. 도 14의 빨간색 점선은 평균값을 표현한 것이고, 빨간색 별표로 표시한 것이 선택한 콜로니이다.
16개의 플레이트 중 ELISA를 통해 발현이 높은 29개의 콜로니를 선별하였고， 96웰에서 48웰, 24웰， 6웰 순으로 세포를 증폭하였다. 최종 6웰에서 5 X 105 세포 /웰로 분주한 후 이를 뒤에 세포기- 꽉 찼을 때, 배지를 수득하여 ELISA를 통해 정량하였다. 도 15에서 빨간색으로 표시된 클론은 6웰에서도 발현량이 유지되어 100 nM MTX로 유전자 증폭 과정을 진행하였다.
6-5. 유전자 증폭
HuElO-101 항체 발현의 증폭을 위하여 MTX를 MEM—알파 (w/o) + 10% dFBS + AA 배지에 첨가하여 사용하였다. 초기 시직- 농도는 100 nM부터 적웅을 유도하였다. 앞에서 선별한 HuElO-101 29개의 클론을 웰당 5 x 105 세포로 분주하였다. 2일 주기로 새 배지로 교환해 주면서 콜로니 형성을 관찰하였으며， 세포가 꽉 차면 다시 새로운 세포에 5 X 105 세포로 나누었다. 세 번 패싱 한 후 ELISA를 통해 발현율을 확인하였다. 100 nM 완료된 클론 중 발현이 높은 클론은 1 y M로 유전자 증폭을 하였다.
도 16은 처음에 5 X 105 세포로 분주한 후 일주일 후에 콜로니가 형성된 것을 보여주는 현미경 사진이다. 이를마다 배지를 교환하며 콜로니가 형성된 것을 확인하였고, 6웰에 꽉 차게 되면 트립신으로 세포를 떼어 새 플레이트에 나누었다. 이와 같은 방법으로 세 번 패싱한 후 ELISA를 통해 정량하였다. 6-6. 100 nM에서 선별된 예비 세포주들의 HuE10-101 발현율
HuE10-101 항체의 정량은 각 스텝 별 적웅된 세포를 5 X 105 세포 /T- 25 플라스크 /5 ml에 6일간 배양하는 방식으로 실시하였다. 100 nM 에 적웅된 세포에서 배치 (batch)를 실시하였다. ELISA 방법을 사용하여 정량하였다.
100 nM에서 유전자 증폭은 클론별로 적응 속도가 다 다르기 때문에, 가장 빨리 자라는 세 개 클론부터 T-25 플라스크에 5 X 105로 분주하여 6일 후 배지를 수득해 ELISA로 정량하였다. ELISA는 위에서 설명한 것과 같은 방법을 이용하였다. 그 결과 S17 클론이 40 mg/L로 가장 높은 발현율을 보이는 것으로 확인됐다. 따라서 이 S17 클론은 1 MTX로 유전자 증폭을 유도하였다 (도 17).
6-7. 단일 세포주에서의 단백질 발현양 확인
2종의 세포군 (Humira CXCL10 cell line S7 3 μΜ, Humira CXCL10 cell line S7 4 yM)을 이용하여 한계희석법에 의해 단일세포주 분리를 수행하였다. 단알세포주를 확보하기 위하여 1 세포 /웰로 96 웰 플레이트에 시딩하여 군집을 형성한 단일세포 유래의 세포주를 획득하였다. 획득한 단일 세포주들의 단백질 발현양은 24 웰 플레이트에서 4 일간 배양한 배양액을 이용하여 ELISA로 분석하였으며 아래의 총 20 개의 단일 세포주를 선별하여 125 mL Erlennieyer flask에서 부유배양 적웅을 하였다 (표 9).
【표 9】
Figure imgf000042_0001
Figure imgf000043_0001
선별된 20개의 세포주는 부유 세포에 적웅 후， 5 X 세포 /mL 이 되도록 화학조성 배지에 잘 풀어서 접종하여， 34 °C, 5 % C02 배양기에서 교반속도 140 土 10 rpm으로 6일 동안 유가식 배양하였고, 발현양을 분석하였다 (표 10).
【표 10]
Figure imgf000043_0002
Figure imgf000044_0001
6- 8. 항체 생산 세포주의 발현 안정성
발현양의 분석 결과를 통해서 발현양이 약 50 ug/mL 이상을 나타내는 10 개의 세포주를 선별하여 장기 계대 배양 동안 발현 안정성을 확인하기 위한 배양을 하였다. 부유 배잉 : 적웅 후 동결 보관된 세포를 화학조성 배지에 해동한 후 125 mL Erlenmeyer flask 에서 3 일 간격으로 90 일 동안 계대 배양 하였다. 계대 마다 배양액 일부를 수획하여 동결 보관 하였고 ELISA 에 의한 발현양 분석 결과를 바탕으로 안정성을 분석하여 생산성이 높고, 계대 배양 안정성이 80% 이상 유지되는 세포주를 공정개발을 위한 세포주로 선별하였다. 분석결과를 바탕으로 S7 (4 μΜ) 一 3 세포주를 최종 선별하였고， S7 (4 UM) ― 3 세포주의 30 계대까지의 배양 안정성을 배양 초기 (4—9 계대) 와 26 ~ 30 계대에서의 평균 발현양을 비교 분석한 결과 계대배양 안정성이 95% 이상 유지됨을 확인하였다. 따라서 S7 (4 μΜ) - 3 세포주를 공정 개발 및 10 g 생산을 위해 생산용 세포주로 사용하였다 (도 18). 실시예 7: 항체의 물리화학적 특성 분석
7- 1. 항체의 구조 또는 구성성분에 관한 분석 .
7-1-1. N-말단 아미노산 서열 확인
Nᅳ말단 아미노산 서열분석은 항체 단백질의 중쇄와 경쇄로 나누어 분석하였다.
통상의 항체 단백질의 N-말단 서열의 첫 번째 아미노산인 글루타민으로 되었을 경우 글루타민 아미노산이 피를리돈카복실산 (pyroglutaiiiate)로 변형된 형태로 존재하는 경우가 높다. 하지만 HuElO-101 의 중쇄와 경쇄는 모두 글루타민이 아닌 글루탐산과 아스파르트산으로 되어 있어 특이적 변형이 발생할 가능성이 매우 낮다
분석결과 중쇄의 N-말단 서열은 16개의 아미노산 서열을 확인하였고, 경쇄는 18 개의 아미노산 서열을 확인하였음. 확인된 아미노산 서열은 이론적인 아미노산 서열과 동일하였다
HuE10-101 시료를 TCA 로 침전하여 저장버퍼를 제거하고 5 우레아를 처리하여 변성시켰다. 트립신을 처리하여 항체를 펩타이드 조각으로 절단시킨 후 PNGase-F 를 넣고 탈글리코실화 시켰다. 마지막으로 DTT 를 넣어 이황화결합을 제거한 후 LC-MS 로 펩타이드 분석 실험을 수행하였다. 항체 단백질의 N-말단 서열은 단백질의 발현 과정에서 다른 부분의 아미노산에 비해 PTM(post-translational modification:^ 발생 가능성이 높고, 항체 단백질의 활성도와 기타 면역거부 반웅에도 연관될 수 있다. HuElO-101 은 구조적으로 중쇄와 경쇄로 나누어져 있고, 본 실험에서는 중쇄의 N-말단과 경쇄의 N-말단을 각각 LC-MS/MS 방법에 의해 최종 시원싱하였다. N-말단 분석을 위해 트립신을 사용하여 각각의 중쇄 N- 말단 분석과 경쇄 N-말단 분석을 하였다.
트립신에 의해 잘려진 항체 유래 펩타이드들은 LC-MS 펩타이드 맵핑과 LC— MS/MS 시뭔싱 분석방법을 수행 하였고， 여기서 각각의 이론적 펩타이드 분자량을 계산하여 N—말단 펩타이드를 파악하였다 (도 19a).
동일 조건의 LC-MS 를 먼저 수행하여 해당 펩타이드의 유지 (retention) 시간을 확인하였고, 같은 LC 조건을 사용하여 LC-MS/MS 분석을 수행하여 펩타이드 시퀀싱을 하였다. N-말단 시퀀싱 결과 도 19a 와 도 19c 는 각각 LC-MS/MS 분석법에 의한 HuElO-101 의 중쇄와 경쇄의 N—말단 시퀀싱 결과이다. 결과에서 보듯이 HuElO-101 단백질의 중쇄 및 경쇄 의 Nᅳ 말단 서열은 이론적 HuElO-101 단백질의 N-말단 서열과 동일한 펩타이드 분자량과 시퀀싱되었고， 중쇄의 N—말단 서열은 EVQLVESGGGLVQPGR 이고, 경쇄의 N—말단 서열은 DIQMTQSPSSLSASVGDR 확인되었다 (도 19).
표 11 은 N-말단 서열의 이론적 분자량과 LC-MS 에서 확인된 분자량, ms/ms 시퀀싱을 통해 확인된 N-말단 서열을 정리한 것이다. 통상의 단백질의 N-말단의 변형 형태인 피를리돈카복실산 형태와 절단， 탈아미드화 산화와 같은 변형은 HuEl으 101 단백질에서는 확인되지 않았다 (표 11).
【표 11】
Figure imgf000046_0001
HT: Heavy chain t rypt i c peptide
LT: Light chain tryptic peptide 이상의 결과에서 HuEl으 101 N-말단 서열 확인 시험을 통해서 중쇄의 N—말단 서열은 EVQLVESGGGLVQPGR 확인되었고 , 경쇄의 N—말단서열은 DIQMTQSPSSLSASVGDR 확인 되었고， 특이적 변형은 확인 되지 않았다. 7-1—2. 펩티드 분석
HuElO-101 의 구조적 특성 규명을 위해 프로테아제 (트립신) 처리 후 LC-MS 펩타이드 ¾핑 분석법을 이용하여 이론적 아미노산서열의 동질성을 확인하였다.
이론적 단백질 아미노산 예상 서열과 98% 이상의 동일한 서열로 확인되었고， 일부 아미노산에서 화학 결합으로 인한 변형이 발생하였지만, 이것은 실험 및 분석 과정에서 나올 수 있는 양의 아주 적은 것이었다.
HuE10-101 시료를 TCA 로 침전하여 저장 버퍼를 제거하고 5 M 우레아를 처리하여 변성시켰다. 그런 다음 트립신을 처리하여 항체를 펩타이드 조각으로 절단시킨 후 PNGase-F 를 넣고 탈글리코실화시켰다. 마지막으로 DTT 를 넣어 이황화결합을 제거한 후 LC— MS 로 펩타이드 분석 실험을 수행하였다.
HuE10-101 의 전체 분자량은 약 190 KDa 의 거대 단백질로 중쇄와 경쇄로 각각 구성되어 있다. 총 아미노산은 919 개로 구성되며 중쇄는 705 개， 경쇄는 214 개로 구성되었다 (서열목록 제 59 서열 및 제 60 서열). 통상의 항체 단백질은 150kDa 분자량이지만 HuE10-10l 단백질은 중쇄의 C- 말단 451 라이신 뒤에 추가로 중쇄의 가변 서열이 결합되었다.
HuE10-101 단백질의 중쇄 /경쇄의 구조적 특성 분석을 위해 HuElO一 101 단백질 서열을 프로테아제에 의해 잘려진 이론적 펩타이드 분자량과 실제 HuE10-101 단백질의 LC-MS 크로마토그램 프로파일에서 나온 펩타이드 피크 어사인된 펩타이드 분자량을 기준으로 해딩 · 펩타이드의 질량의 일치도로 분석하였다. 도 20 은 분석 시료 HuElO— 101 의 펩타이드 맵핑 분석 결과로 HuElO— 101 항체에서 유래된 트립틱 펩타이드의 용출되는 LC-MS 크로마토그램이다.
HuE10-101 단백질 유래 펩타이드의 개수가 많아서 도 20a 및 도 20b 로 각각 용출되는 시간으로 나누어 펩타이드 피크의 어사인 결과를 나타내었다.
이론적인 HuE10-101 항체 단백질의 중쇄와 경쇄 서열의 트립틱 펩타이드 분자량과 LC-MS 크로마토그램에서 검출된 펩타이드의 분자량과 시뭔싱 결과를 정리한 것이다. 트립신을 이용한 펩타이드 맵핑 분석에서 1.9%의 항체 단백질의 서열을 확인하지 못했다. 이것은 단백질을 프로테아제로 자를 경우에 잘려진 뎁타이드의 크기가 아주 작거나 특정 펩타이드의 시그널이 아주 약하게 검출 되기 때문이다. 또한 항체 단백질에 예측 불가능한 PTM(post-translational mod ί eat ion)이 되어 있을 경우 질량 값만을 기준으로는 확인 할 수 없다. 이런 예측 불가능한 펩타이드는 LC-MS/MS 로 펩타이드 시뭔싱을 하여 최종 확인하였다. 표 16 과 17 에서 이론적인 트립틱 펩타이드의 분자량보다 차이를 보이는 펩타이드를 확인할 수 있었고, 증쇄에서 7 개, 경쇄에서 3 개의 변형 펩타이드를 확인 하였다. 표 12 와 13 의 변형된 펩타이드의 동정은 LOMS/MS 를 진행하여， 최종 디- 노보 시퀀싱을 통해 서열 내 변화를 확인 하였다. 위 결과에서 중쇄와 경쇄는 공통적으로 아스파라긴 아미노산에 탈아민화 형태와 일부 화합물의 결합 형태 또한 확인 되었다.
【표 12]
Figure imgf000048_0001
Figure imgf000049_0001
Figure imgf000050_0001
HT: Heavy chain trypt ic peptide (de) Asn deamidat ion
(m): modification (chemical a tachment) * De— glycosylated peptide
N.D Not detected 【표 13】
Figure imgf000051_0001
LT22 212-214 154 55 103 37 77 78 62 42 308.08 1
LT21-22 208-214 812,34 406 67 271 45 203 84 163 27 406.66 2
LT: Light chain trypt ic peptide
(de): Asn deamidat ion
(m)： modification (chemical attachment) 도 20 에서 LC— MS/MS 디—노보 시퀀싱한 결과처럼， 펩타이드에 화합물의 결합이 확인되었다. 도 20a 에서 HT24(m)(cle) 펩타이드는 WSVLTVLHQDWLNGK 의 펩타이드에서 N—말단에 43Da 에 해당하는 화합물이 결합 되어 있었고， 319 번 아스파라긴 아미노산이 탈아민화로 변형되어 있었다. 도 20b 의 LT13(m) 펩타이드는 이론적 분자량에 비해 43 Da 이 증가한 화학 결합 펩타이드로 확인되었다. 펩타이드 맵핑 테이블에서 확인된 나머지 변형된 펩타이드는 위와 같은 LC-MS/MS 펩타이드 시퀀상 방법으로 최종 확인하몄다 (도 21).
따라서 전체 아미노산 (중쇄와 경쇄) 919 개중 902 개의 아미노산이 HuE10-101 단백질의 중쇄 /경쇄의 아미노산과 일치하는 것을 확인하였다. 최종 분석 후 전체 서열 커버리지는 98.1%로 확인 되었다.
이상의 결과에서 HuElO— 101 에 대한 펩타이드 맵핑 분석을 통해 아미노산 중심 구조에서 98.1 % 동일한 구조를 가지며, 일부에 한해 화학 결합된 펩타이드와 아스파라긴 아미노산에 약하게 탈아민화된 것을 확인 하였다.
7-2-1. CD(Circular Dichroism) 분석
본 실험은 CD(Circular dichroism)를 이용하여 시료의 2 차 구조를 예측하고자 하였다. CD 분석 하여 얻은 Far— UV 데이터를 JASC0 사의 2차구조 예측 프로그램을 이용하여 2차 구조 예측을 하였다 (도 22) . 도 22 에서 보듯, 300-200 nm 의 far— UV 분석 결과 HuElO— 101 시료는 베타 77.9%, 턴 22.1%의 비율로 존재하는 것을 확인하였다.
7-2-2. SPR (Surface lasmon resonance) 분석
HuE10-101 의 항원에 대한 결합력 분석을 위해 SPR 장비중의 하나인 바이오래드 (Bi으 Rad) 사의 ProteOn XPR36 을 이용하였다. 항원인 TNF- α 또는 CXCL10 을 따로 코팅하여 항체의 결합력을 분석한 결과， HuElO— 101 은 TNF— α에 대해서는 0.195 nM, CXCLIO 에 대해서는 3.54 nM 의, 결합력을 보였다. 대조군으로 사용한 Huniira 의 경우는 TNF- α에 대해서만 0.116 nM의 결합력을 보였을 뿐， CXCL10에 대해서는 예상대로 결합하지 않았다.
XPR GLC 칩 2 개의 채널에 100 nM 의 TNF- α 또는 CXCL10 을 각각 코팅하고, 항체를 홀려주는 방식으로 결합력 평가를 수행하였다. 측정을 위하여 ProteOn XPR 36 에 GLC 칩을 50% 글리세를을 사용하여 초기화 시킨 다음 25°C 조건에서 러닝 버퍼 PBST L0 ιτιΜ Na-포스페이트, 150 niM NaCl , 0.005% Tween20, pH 7.4)를 홀려주어 chip 안정화를 시켜주었다. GLC 5 개 채널에 0.04 M N-ethyl-N' -(3一 dimethyl aminopropyl ) car bod i imide (EDC)와 0.001 M sulfo-N- hydroxysucc in imide (sulfo— NHS)을 1:1 비율로 30 μ ΐ/분의 유속으로 220 \ 양을 홀려주어 채널을 활성화 시켰다. 뒤이어 100 nM 의 TNF-α 또는 CXCL10 은 pH 5.5 아세테이트 버퍼를 사용하여 30 μ ΐ/분 속도로 코팅하였다. 1 Μ 에탄을아민ᅳ HCKpH 8.5)로 활성화된 칩을 불활성화 시켰다. 고정화 (iiiimobil ization) 레밸이 800 RU( resonance units) 임을 확인하였다. PBS/T로 기준을 정한 다음 HuEl으 101 또는 Humira 항체를 5 nM 로부터 1/2 씩 희석한 5 가지 일련의 농도를 만들어 코팅된 곳에 홀려보냄으로써 KD 값을 구하였다. XPR GLC 칩에 100 nM 의 TNF- α 또는 CXCL10 을 코팅하였고 , Humira 또는 HuElO— 101 을 5 nM 부터 1/2 씩 희석하여 5 개의 농도를 흘려보내준 결과 도 23과 같은 센소그램을 얻었다. .
도 23 에서 보듯, Humira 는 항원인 TNF-α에는 잘 결합하나 CXCL10 에는 전혀 붙지 않는 결과를 보인 반면， HuE10-101 은 TNFᅳ α 뿐만이 아니라 CXCL10에도 잘 붙는 이중항체임을 재확인 하였다.
표 14 는 도 23 의 센소그램으로부터 얻어진 각 항원에 대한 항체들의 KD값 측정 결과이다. ka는 결합상수를 나타내며, kd는 해리상수， 그리고 KD 는 해리항수로 kd 값을 ka 로 나누어 얻어진 값이다. Humira 는 항원인 TNF— α와의 결합력만이 측정되었으며 KD 는 0.116 nM 로 나타났다. 이와 달리 이중항체인 HuE10-101 은 TNF— α의 결합력은 Humira 와 유사한 0.195 nM 을 그리고 CXCL10 에 대해서는 이것보다는 다소 약한 3.54 nM 의 KD 를 보였다. CXCL10 에 대한 KD 가 낮은 이유는 도 23 과 표 14 의 결과를 종합해서 볼 때 kd 가 TNF— α와의 그것에 비해 다소 낮은 것이 원인으로 보인다.
【표 14】
Figure imgf000054_0001
N.D : Not Detec ed
Ka ： association rate constant
kd ： dissociation rate constant
KD ： equilibrium dissociation constant 7-3. 면역화학적 분석
7-3-1. EL ISA (Enzyme-linked immunosorbent assay)
HuE10-101 의 항원에 대한 면역 화학적 분석을 위해 ELISA 를 수행하였다. 항원인 TNF-α 또는 CXCL10 을 각각 따로 코팅하여 항체의 결합력을 분석한 결과, HuEl으 101 은 TNF-a에 대해서는 0.495 nM, CXCL10 에 대해서는 1.9 nM 의 결합력을 보였다. 대조군으로 사용한 Humira 의 경우는 TNF— α에 대해서만 0.5 nM 의 결합력을 보였을 뿐 , CXCL10에 대해서는 예상대로 결합하지 않았다.
96 웰의 면역플레이트에 항원인 TNF-α 또는 CXCL10 을 100 ng/웰씩 넣어 4°C에서 하룻밤 동안 코팅하였다. >스킴 밀크 200 μ ΐ/웰을 넣어주고 2 시간 상온에서 배양하였다. 그런 다음 HuElO— 101 과 Humira 를 각각 50 nM 부터 1/2 씩 단계 희석하여 100 μ ΐ/웰을 넣고 2 시간 동안 상은에서 배양하였다. 두시간 후 0.05¾» PBST 200 μ ΐ/웰로 3 번 세척하였다. 그리고 항 -인간 FC-HRP(in goat)를 1:1000. 으로 스킴 밀크 PBS 에 만든 후 100 li l/웰을 넣고 1 시간 동안 상온에서 배양하였다. 그런 다음 한 시간 후 0.05% PBST 200 ti l/웰로 3 번 세척하였다. 0PD 용액을 만든 후 100 μ ΐ/웰에 넣어준 후 발색이 되면, 정지 버퍼로 반웅을 멈춘 후 492 nm 파장에서 측정하였다.
ELISA 를 기반으로 한 KD 값을 측정한 결과 다음과 같은 결합 친화도를 확인하였다. 측정값에 대한 신뢰성을 나타내는 R2 값이 0.97 이상으로 모든 실험에 대한 신뢰도가 높음을 보여주었다. 결과에서 HuElO- 101 은 TNF-α와 CXCL10 에 모두 잘 결합하는 이중특이성 ( i speci f ic) 항체임이 확인되었다 (도 23). HuElO-측정된 항원 결합력은 각각 4.5ΧΚΓ10 M (0.45 nM)과 1.9ΧΚΓ9 M (1.9 nM)인 것을 확인하였다. 반면, 대조군인 Humira 는 예상했던 대로 TNF-α에는 잘 결합하였으나, CXCL10 에는 전혀 결합하지 않는 것을 확인하였다 (도 24). 그에 대한 결합 친화도는 1.
M (0.15 nM)으로 HuElO-101과 오차범위 내에서 비슷하였다 (표 15).
【표 15】
Figure imgf000056_0001
실시예 8: 후보항체의 생체 외 (in vitro) 효능 평가
8-1. TNF-a 억제능 평가
후보 항체의 TNF-a 억제능을 확인하기 위하여 TNF-a 수용체를 가지고 있는 WEHI164 세포를 이용한 항 -TNF-a 억제능 평가 기법을 확립하였다.
대조 항체로는 휴미라 (Abbott Laboratories)를 사용하였으며, 후보 항체로는 휴미라 복제항체 (과제에서 개발한 것임), HuE10-101 를 사용하였다. 각각의 항체 농도를 1/2 단계 희석한 다음 hTNF-α를 첨가하여 세포배양 한 다음 MTT(thiazolyl blue tetrazol ium)를 첨가하여 5% C02 , 37 °C 배양기에서 배양한 후 세포를 용해시킨 다음 595 nm 의 파장에서 흡강도를 측정하였다 (도 25).
분석 결과 휴미라 복제항체， HuElO-101, HuIL21R-101, HuIL21R- 100 (과제에서 개발한 것임)에서 양성 대조군인 휴미라보다 낮은 농도에서 TNF-α 억제능이 있음이 관찰되었디-. 이러한 결과로 TNF-a에 대한 후보 항체의 억제능이 휴미라에 비해 향상되는 것을 확인하였다 (도 25).
8-2. CXCL10 억제능 평가 후보 항체의 효능 검증을 위하여 트랜스웰 시스템을 이용한 세포 주화능 (chemotaxis) 실험 기법을 확립하였다. 본 발명자들이 선행연구를 통해 CXCL10 에 의해 T 세포의 주화능이 증가된다고 밝힌 결과를 토대로 CXCL10 에 의해 증가된 세포 주화능에 항 -CXCL10 항체인 HuE10-101 을 처리하였을 때의 주화능 변화를 관찰하였다. Jurkat T 세포를 5.0 μιιι 포어 사이즈 세포 배양 트랜스웰에 4시간 동안 배양하여 Jurkat T 세포의 이동을 확인하였다. 실험군에는 HuE10-101 을 50 ng/ml, 100 ng/ml , 200 ng/ml 로 농도로 상부와 하부 챔버에 처리하였고, CXCL10 에 의해 증가되는 주화능 조건을 만들기 위하여 하부 챔버에는 추가로 hCXCLlO 을 처리하였다. 양성대조군에는 하부 챔버에만 hCXCLlO 을 단독으로 넣어 CXCL10 에 의해 주화능이 증가되는지 확인하였디-. 그 결과 양성대조군 (PC) 보다 실험군에서의 세포 이동이 효과적으로 감소하는 것을 확인하였다 (도 26).
기존의 파골세포 분화 실험에서는 M-CSF 와 RANKL 을 직접 첨가하여 대식세포를 파골세포로 분화시킨다. 그러나 CXCL10 자극에 의해 CD4+ 세포로부터 방출되는 RANKL 의 양에 따른 파골 세포 분화의 정도를 분석하기 위하여， 본 발명자들은 CD4+/CD14+ 동시 배양 시스템을 도입하여 파골 세포 분화를 유도하는 실험 조건을 확립하였다 (도 27). '
파골세포로의 분화 억제능을 확인하기 위하여， 혈액에서 파골세포 전구세포 (CD14+)와 CD4+ 세포를 분리한 후 두 세포를 동시 배양 시스템을 이용하여 파골 세포 분화를 유도하였고， TRAP(tartrate resistant acid phosphatase) 염색을 시행하고 현미경 관찰하였다 (도 28).
HuE10-101 에 의한 파골세포 분화 억제능을 확인한 결과, 휴미라를 사용한 대조군 (G— I)에 비해 , TNF-α와 CXCL10 자극올 각각 단독으로 처리한 군과 TNF-a와 CXCL10 을 함께 자극해 준 동시 배양 시스템에서 파골 세포 분화가 농도 의존적이지는 않지만 감소하는 것을 확인하였다 (도 29). 8- 4. 항체의 TNF-α 중화능 평가
생산 세포주에서'생산한 항체의 효능을 평가하기 위하여 2 차년도에 확립한 TNF-α 증화능 평가를 진행하였다. 본 실험에는 TNF-a 수용체를 가지고 있는 WEHI164 세포를. 이용하였다. 대조 항체로는 humira (Abbott Laboratories)를 사용하였고， 실함군은 HuE10-101 를 사용하였다. 각각의 항체 농도를 1/2 단계 희석 (serial dilution) 한 다음 재조합 인간 TNF- α를 첨가하여 세포배양 한 다음 M T(thiazolyl blue tetrazoliuin)를 첨가하여 5% C02> 37 °C 배양기에서 배양한 후 세포를 용해시킨 다음 595 議의 파장에서 흡강도를 측정하여 EC50 값을 분석하였다ᅳ
분석 결과 HuElO— 101 처리 군에서 대조군인 humira® 처리 군보다 낮은 농도에서 TNF-α 중화능이 있음이 최종 확인하였다. 또한， 2 차년도에 사용되었던 항체를 비교하였을 때 새로 개발한 생산 세포주에서 생산한 항체에서의 TNF— a 중화능이 향상되는 것을 확인하였다 (도 30). 실시예 9: 항체의 생체 내 (in vivo) 효능 평가
9- 1. 인간화 TNF 마우스에서 이중항체의 효능평가
9-1-1. 인간화 TNF 형질전환 마우스
1991 년 Keffer 등이 확립한 TNF 형질전환 마우스 모델은 TNF 를 억제하는 역할을 하는 TNF 3' UTR( untranslated region)이 없도록 조작하여 인간 TNF 이식 유전자를 마우스에 도입하였다. 이로 인해 TNF 의 발현을 증대시킴으로써 자발적으로 관절염이 유도되도록 하였다. 이와 같은 방법으로 유도된 관절염은 류마티스 관절염과 유사하게 병리학적으로 활막의 비후, 관절강 내로의 염증세포의 침윤， 파누스 형성과 연골과 뻐의 파괴를 나타내었다.
TNF 형질전환 마우스 모델은 TNF 에 의해 유도되는 관절염의 발병 기전의 확인을 통하여 TNF 가 관절염의 발병에 중요한 역할을 한다는 것을 증명할 수 있는 계기를 마련하였다. 현재 TNF 와 관련된 치료제의 효능을 평가하는데 TNF 형질전환 마우스 모델이 유용하게 활용되고 있다.
따라서 , 본 발명자들은 TNF 에 대한 이중 항체의 효능평가를 위하여 TNF 형질전환 마우스 모델을 이용하였다. TNF 형질전환 마우스 모델을 이용한 이중항체 효능평가는 그리스 소재의 CR0 전문 기관에 의뢰하여 진행하였다. 효능평가에 이용된 계통은 Tgl97 이며, 미국식품의약국 (FDA)에서 권고한 류마티스 관절염에 대한 인간항체 평가 모델 중에 하나이다. 현재 시판 중인 TNF— α 길항제인 Infliximab (Renii cade®)개발에 있어 Tgl97 계통을 이용하였다.
Tgl97 계통 인 TNF 형질전환 마우스 모델의 관절염 진행은 성별 간에 임상적 차이가 나타나지 않으며 질병이 진행됨에 따라 일반 마우스와 비교할 때 체중 감소를 나타내는 것이 특징이다. Tgl97 계통의 조직을 병리학적으로 분석해보면 류마티스 관절염과 매우 유사하게 염증성 침윤, 활막의 비후， 연골 파괴， 골의 침식 등을 관찰 할 수 있다.
Tgl97 계통의 TNF 형질전환 마우스 모델은 실험 시작 3 주차부터 병변이 발생하게 된다. 병변 초기인 3 주차부터 6 주차까지의 모델은 예방 효과를 알아보기 위하여 쓰이며, 6 주차부터 9 주차까지는 치료 효과를 알아보는데 주로 이용된다. 따라서 본 실험의 목적인 이중항체의 효능을 평가를 위하여 평가 기간은 3 주차부터 9 주차까지 진행하였디-. 임상적 평가는 평가 기간 동안의 관절염 유발 점수 (arthritis score)와 체중의 변화 측정을 통해 진행하였다.
【표 16】 관절염 유발 점수 (arthritis score)
Figure imgf000059_0001
Figure imgf000060_0001
또한， 실험 종료 후에는 조직 병리학적 평가를 통하여 관절염 병변 정도를 평가 하였다ᅳ 류마티스성 관절염의 조직 병리학적 특징으로는 관절 활막세포의 과증식과 이를 원인으로 하는 연골 조직의 파괴가 대표적인 특징이다. 마우스 무릎 조직을 분리하여 포르말린에 고정하고, 석회질 제거 단계를 거쳐 파라핀으로 블록을 제작하여 마이크로름을 이용하여 4 urn 의 조직 절편을 제작하였다. H&E( hematoxylin and eosin) 염색하여 활막 조직의 염증도 (synovial inflammation), 뻐 침식정도 (bone erosion) , 연골세포 파괴정도 (carti lage damage) 그리고 면역세포의 침윤 (leukocyte infiltration) 등을 조사하였다. 이때 평가는 어떤 샘플인지 알지 못하도록 블라인드 테스트로 진행하였다. 조직병리학적 평가 (Histopatholog al Evaluation)는 다음 표를 기준으로 평가하였다.
【표 17】 Histopathology scoring sys em
HISTO P ATH O LOGIC A L C RITE RIA FOR SCO RI G ARTH RITIC
I.；：;1 '；,; ',：... PHENOTYPE
SCORE1 CRITERIA
Figure imgf000061_0001
9-1-2. 인간화 TNF 형질전환 마우스를 이용한 후보 항체의 효능평자 결과
기존에 상용화 되어 널리 사용되는 휴미라 10 mg/kg 와 본 발명자들이 개발한 휴미리- 복제항체를 2 mg, 10 mg/kg 용량으로 마우스에 투여한 다음， 임상적 변화 관찰 및 평가 하였다. 휴미라와 휴미라 복제항체의 관절염 유발 점수 (arthritis score)를 측정한 결과, Vehicle 군에서 1.48 이였으며， 대조군인 휴미라가 10 mg/kg 의 농도일 때 0.22 이였다. 휴미라 복제항체의 농도가 각각 2 mg, 10 mg/kg 일 때 0.66, 0.52 의 수치를 나타내었다 (도 31). TNF 형질전환 마우스 모델은 질병이 진행함에 따라 임상적으로 상당한 체중 감소를 보이는 것이 특징이다. 체중 변화 측정은 관절염 유발 점수 (arthritis score) 측정 일정과 동일하게 진행하였다. Vehicle 군에서 15.26 g 이였으며, 대조군인 휴미라가 10 mg/kg 의 농도일 때 20.23 g 이였다. 휴미라 복제항체의 농도가 각각 2 mg, 10 mg/kg 일 때 18.3 g, 20.58 g 의 수치를 나타내었다 (도 32). 휴미라 복제항체의 임상적 평가 결과 대조군인 휴미라와 유사하게 휴미라 복제항체의 농도가 증가할수록 관절염 유발 점수 (arthritis score)가 감소하였으며， 뚜렷한 체중 증가를 보였다.
HuIL21R-101 의 효능 평가를 위하여 대조군으로 휴미라를 사용하였고， 실험군인 HuIL21R— 101 을 각각 1 nig, 3 mg, 10 mg/kg 의 용량으로 마우스에 투여한 다음， 임상적 변화 관찰 및 평가하였다. HuIL21R— 101 의 관절염 유발 점수 (arthritis score)를 측정한 결괴-, Vehicle 군 인 인간 대조군 I G 에서 1.27 이였으며， 대조군인 휴미라가 10 mg/kg 의 농도일 때 0.20 이였다. 실험군인 HuIL21R— 101 의 농도가 각각 1 mg, 3 mg, 10 mg/kg 일 때 0.89, 0.73, 0.88 의 수치를 나타내었다 (도 33). 체증 변화를 측정한 결과, Vehicle 군에서 15.4g 이였으며, 대조군인 휴미라의 농도가 10 mg/kg 일 때는 20.9 g 이였다. 실험군인 HuIL21R— 101 의 농도가 각각 1 nig, 3 mg, 10 mg/kg일 때 15.1 g, 16.0 g, 16.5 g을 나타내었다 (도 34).
. HuIL21R-101 의 임상적 평가 결과， 대조군인 휴미라에 비하여 HuIL21R-101 의 관절염 유발 점수 (arthritis score)가 유의하게 감소하지 않았으며， 뚜렷한 체중 증가를 보이지 않았다. HLIIL21R-101 의 선행 결과와 TNF 형질전환 마우스 모델을 통한 효능평가 결과를 토대로 HuIL21R-101 은 최종 후보항체 군에서 제외하였다.
9-1-3. 인간화 TNF 형질전환 마우스를 이용한 이증 항체의 효능 평가 결과 대조군으로 Humira®를 사용하였고, 실험군인 HuE10-101 를 각각 6.9 mg, 13.8 mg/kg 의 용량으로 대조군과 질량 대비 동량으로 마우스에 투여한 다음, 임상적 변화 관찰 및 평가하였다. HuE10-101 의 관절염 유발 점수 (arthr it is score)를 즉정한 결과， Vehicle 군 인 Human Control IgG 에서 1.65 이였으며， 대조군인 Humira®가 10mg/kg 의 농도일 때 0.06 이였다. 실험군인 HuElO— 101 의 농도가 각각 6.9 mg, 13.8 mg/kg 일 때 0.41, 0.07 의 수치를 나타내었다 (도 35).
TNF 형질전환 마우스 모델은 질병이 진행함에 따라 임상적으로 상당한 체중 감소를 보이는 것이 특징이다. 체중 변화 측정은 관절염 유발 점수 (arthritis score) 측정 일정과 동일하게 진행하였다. 그 결과， Vehicle 군에서 18.92 g 이였으며 , 대조군인 Humira®의 농도가 10 mg/kg 일 때는 23.38 g 이였다. 실험군인 HLIEIO-101 의 농도가 각각 6.9. mg, 13.8 mg/kg일 때 21.08 g, 22.80 g을 나타내었다 (도 36).
HuElO-101 의 임상적 평가 결과, 대조군인 휴미라 복제항체와 유사하게 관절염 유발 점수 (arthritis score)가 감소하였으며, HuElO-101 의 농도가 증가함에 따라 관절염 유발 점수 (arthritis score)가 감소하는 결과를 얻을 수 있었다. 또한, 체중 변화를 측정한 결과 병변이 진행됨에 따라 감소되었던 체중이 휴미라 복제항체군과 유사하게 HuElO-101 의 투여 농도가 증가할수록 체중이 증가하는 것을 관찰하였다.
조직 병리학적 평가 결과， Vehicle 군에서 3.75 이였으며, 대조군인 Humira®의 농도가 10 nig/kg 일 때 0.75 이였다. 실험군인 HuElO-101 의 농도가 각각 6.9 mg, 13.8 mg/kg 일 때 1.84, 0.75 의 수치를 나타내었다. 약물 투여 전 3 주령 마우스는 1.33 의 수치를 나타내었다. HuElO-101 와 Humira®의 조직 병리학적 평가 결과 동등한 효과를 나타냄을 확인 할 수 있었다 (도 37).
HuElO-101 의 조직 병리학적 평가와 관절염 유발 점수 결과를 비교 분석하였다ᅳ Vehicle 군은 각각 3.75,1.65, Humira®군은 각각 0.75,0.06, HuElO-101 를 6,9 mg/kg 의 농도로 처리한 군은 각각 1.84, 0.41, HuElO- 101 를 13.8 mg/kg 의 농도로 처리한 군은 각각 0.75, 0.07. 약물 투여 전 3 주령 마우스는 각각 1.33， 0 의 수치를 나타내었다. HuElO— 101 와 Humira®를 치료제로 사용하였을 때 조직 병리학적 평가와 관절염 유발 점수 결과를 비교하였을 때 두 약물이 동등한 치료 효과를 나타냄을 확인 할 수 있었다 (도 38).
HuElO-101의 임상적 평가 결과 대조군 인 Humira®에 비하여 관절염 유발 점수 (arthritis score)가 유의하게 감소하지 않았으나, HuE10-101 의 '농도가 증가함에 따라 관절염 유발 점수 (arthritis score)가 감소하는 결과를 얻을 수 있었다. 또한， 체중 변화를 측정한 결과 병변이 진행됨에 따라 감소되었던 체중이 Humira® 군과 유사하게 HuE10-101 의 투여 농도가 증가할수록 체중이 증가하는 것을 관찰하였다. 9-1-4. 인간화 TNF 형질전환 마우스를 이용한 생산세포주에서 생산한 이중항체의 효능 평가 결과
생산세포주로부터 생산한 항체의 효능 평가를 확인하기 위하여 TNF 형질전환 마우스 모델을 이용한 효능 평가를 추가로 진행하였다.
재시행한 실험 조건의 대조군으로 humira®를 사용하였고， 실험군인 HuE10-101 는 13.8 mg/kg 의 용량으로 일주일에 두 번 및 세 번 투여하는 군으로 나누었다. 3.5 주차부터 9.5 주차까지의 체중 변화와 관절염 유발 점수 (arthritic score)를 측정하였다. 그 결과 Vehicle 군은 1.43, Humira® 군은 0.34, HuElO— 101 을 humira®와 동등한 횟수로 투여한 군은 0.28, HuE10-101 를 일주일에 세 번 투여한 군은 0.19 의 수치를 나타내었다 (도 39).
체중 변화 측정은 관절염 유발 점수 (arthritis score) 측정 일정과 동일하게 진행하였다. 그 결과, Vehicle 군에서 15.87 g 이였으며， Humira® 투여군은 20.50 g 이였다. humira®와 동등한 횟수로 투여한 군은 19.21 g, 일주일에 세 번 투여한 군은 20.58 g을 나타내었다 (도 40).
HuE10-101 의 Humira® 군에 비하여 관절염 유발 점수 (arthritis score)가 유의하게 감소하였고， HuElO-101 의 농도가 증가함에 따라 관절염 유발 점수 (arthritis score)가 감소하였다. 체중 변화를 측정한 결과 병변이 진행됨에 따라 감소되었던 체중이 Humira® 군과 유사하게 HuEl으 101의 투여 농도가 증가할수록 체중이 증가하는 것을 관찰하였다 (도 42).
HuElO— 101 의 조직 병리학적 평가 결과， Vehicle 군에서 3.53 이였으며， Humira® 투여군은 1.22 이였다. humira®와 동등한 횟수로 투여한 군은 1.44, 일주일에 세 번 투여한 군은 0.72 의 수치를 나타내었다. 약물 투여 전 3.5 주령 마우스는 1.44 의 수치를 나타내었다. HuElO-101 와 Humira®의 조직 병리학적 평가 결과 HuElO-101 를 일주일에 세 번 투여한 군의 조직 병리학적 평가 수치가 낮게 측정되어 Humira®보다 효과가 좋음을 확인할 수 있었다 (도 41， 42).
HuElO-101 의 조직 병리학적 평가와 관절염 유발 점수 결과를 비교 분석하였다. Vehicle 군은 각각 3.53,1.435, Humira®군은 각각 1.22,0.34, HuElO-101 를 humira®와 동등한 횟수로 투여한 군은 각각 1.44, 0.28， HuElO-101 를 일주일에 세 번 투여한 군은 각각 0.72, 0.19. 약물 투여 전 3주령 마우스는 각각 1.44, 0.06의 수치를 나타내었다 (도 43).
HuElO-101 와 Humira®를 치료제로 사용하였을 때 조직 병리학적 평가와 관절염 유발 점수 결과를 비교하였을 때 두 약물이 동등이상의 치료 효과를 나타냄을 확인 할 수 있었다.
추후, 마우스 혈청에서 사이토카인을 측정하였으며， 조직을 얻어 병리학적 변화 관찰과 통계학적 분석도 진행 중에 있다.
9-2. K/BxN 혈청을 이용한 마우스 모델에서 이중항체의 효능평가
9-2-1. K/BxN 자발성 관절염 동물모델 (K/BxN serum transfer arthritis model )
관절염 (K/BxN serum transfer arthritis) 마우스 모델은 Benoist 와
Mathis 등이 확립하였으며 , C57BL/6 배경하의 KRN TCR 형질전환 마우스를 N0D(non-obese diabetic) 마우스와 교배하여 얻은 모델이다. KRN TCR 형질전환 발병기전은 KRN TCR 이 리보핵산 분해효소 (ribonuclease)뿐만 아니라 글루코오스 6 인삼염 이성화 효소 (glucose 6 phosphate isomerase, GPI) 282-294 를 인지하도록 항원특이성을 바꾸어 B 세포에 의해 생성되는 항 -GPI 항체가 관절염의 발생에 핵심적인 역할을 하도록 만든 것이다. 이 모델은 생후 4 주 무렵이 되면 저절로 관절염이 걸리게 되어 K/BxN 자발성 관절염으로 명명되었으며, 관절염의 증상은 류마티스 관절염과 유사한 양상을 보인다.
K/BxN 마우스의 관절을 병리학적으로 관찰해 보면 류마티스 관절염 환자와 콜라겐 유도 관절염 모델에서 나타나는 백혈구 침윤, 활막 세포의 증식, 파누스 .형성, 활막염, 뼈와 연골의 파괴 등의 임상적 소견이 관찰되며, 면역학적 소견으로 B 세포의 다클론 활성， 고감마글로불린혈증, 자가 항체의 생성 둥의 특징을 보인다. 다만 류마티스 관절염의 한 지표로 간주되는 류마티스 인자가 나타나지. 않는 다는 점이 류마티스 관절염 증상과 상이한 점이다.
본 .발명자를은 K/BxN 자발성 관절염 마우스에서 채취된 혈청을 투여하면 관절염을 비교적 쉽게 유발시킬 수 있다는 점과 실험 기간이 2 주 이내로 짧다는 점에 착안하여 류마티스 관절염 (K/BxN serum transfer arthritis) 모델을 도입하였다.
9-2-2. K/BxN 자발성 관절염 마우스 모델을 이용한 효능평가 결과
실험에 이용된 K/BxN 자발성 관절염 마우스는 8 주령 이상을 이용하였으며, 채취된 혈청 150 ^을 6 주령 이상의 마우스에 각각 day 0, day 2 에 2 회 복강 내로 투여하여 관절염을 유도하였다. day 1, clay 3 에는 HuE10-101을 투여하였다.
임상적 평가는 관절염 유발 점수 (arthritis score)와 부종 증가율 평가를 통해 확인하였다. K/BxN 마우스의 혈청 최종 투여일 이후 다음 날부터 관절염이 유발하였으며, 전체적으로 관절염 유발 점수 (arthritis score)와 부종 증가율은 마지막 혈청 투여일로부터 약 8-9 일째에 최고조에 이르렀다가 점차 감소하는 양상을 나타냈다. 관절염 마우스 모델을 통해 얻은 관절염 유발 점수 결과， 음성대조군인 K/BxN 혈청을 투여하지 않은 군에서 0, Vehicle 군에서 7.87, 대조군인 휴미라 복제 항체 10 mg/kg 농도에서는 5.83 을 나타냈다. 또한， 실험군인 HuElO— 101 의 10 mg/kg 농도일 때 4 의 수치를 나타냈다 (도 44). 부종 증가율 평가 결과， 음성대조군인 K/BxN 혈청을 투여하지 않은 군에서 3.83, Vehicle 군에서 23.34, 대조군인 휴미라 복제 항체 10 mg/kg 농도에서는 16.58 을 나타냈다. 실험군인 HuEl으 101 의 10 mg/kg 농도일 때 13.67 의 수치를 나타냈다 (도 45). K/BxN 혈청을 이용한 마우스 모델을 이용한 HuE10 101 의 임상적 평가 결과， 대조군인 휴미라 복제항체 보다 관절염 유발 점수 (arthritis score)와 부종 증가율이 감소하는 것을 관찰하였다 (도 46).
또한， 실험이 종료된 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 골 관절을 상태를 분석 하기위하여 마우스 하지의 관절들을 마이크로 CT (NanoFocusRay) 장비로 분석하였다. 그 결과， 관절염을 유도한 Vehicle 군은 관절 모양이 불규칙하게 변하였으며 , 골 파괴가 상당히 진행되어 있음을 알 수 있었다. 이에 비해 대조군인 humira 복제 항체 처리 군, 실험군인 HuElO— 101 처리한 군은 골파괴가 vehicle 에 비해 현저하게 감소되었음을 확인하였다. 특히 실험군은 음성대조군인 K/BxN 혈청을 투여하지 않은 군과 비슷하게 골 파괴가 거의 관찰되지 않았다 (도 47).
형태학적인 변화기- 조직병리학적 변화에서도 관찰되는지 확인하기 위하여 실험이 종료된 K/BxN 혈청 트랜스퍼 관절염 마우스 모델의 조직을 얻어 조직병리학적 분석을 진행하였다. H&E로 조직을 염색하여 확인한 결과 Vehicle 군에서는 관절 주위의 부종과 다형 백혈구， 림프구 등의 침윤이 뚜렷이 나타났으며, 활막의 염증， 비후, 관절면의 연골 손실을 관찰할 수 있었다. 반면에 humira 복제 항체 처리 군, HuElO— 101 처리한 군 에서는 관절의 염증반웅， 연골의 파괴가 현저히 억제되었다. H&E 로 염색한 사진을 분석하여 활막 조직의 염증도 (synovial inflammation), 골 침식정도 (bone erosion), 연골세포 파괴정도 (car t i lage damage). 면역세포의 침윤 (leukocyte inf i ltrat ion)을 각각 분석하였다. 그 결과 활막 조직의 염증도 (synovial inflammation^ 골 침식정도 (bone erosion) , 연골세포 파괴정도 (carti lage damage) . 면역세포의 침윤 ( leukocyte inf i ltrat ion) 4 가지 모두 Vehicle 군에 비해 감소하는 양상을 보였으며 대조군인 humira 를 처리한 군보다 HuE10-101 을 처리한 군에서 통계적으로 유의하게 감소함을 확인하였다 (도 48). 9-3. LPS 로 유도된 염증성 골 소실 마우스 모델을 이용한 이중항체의 효능평가
9-3-1. LPS-유도 두개골 골 흡수 (LPS- induced calvarial bone resorption)
1995 년 Nishihara 등이 확립한 동물 모델로 염증성 골 파괴의 병인 인자인 LPS(lipopolysaccharide)를 이용하여 염증성 골 소실을 유도하는 방법이다.
LPS 에 의한 골 손실의 증가는 기전에 대하여 자세히 밝혀지지 않았으나, 조골세포에서 TLR4(Tol 1-Like Receptor4)를 통한 MyD88(myeloid differentia ion protein88)을 활성회- 시키고, 골 흡수에 관여 하는 신호 전달 물질인 IL-1( inter leukin-1) , Iᄂ一 6， GM-CSFC granulocyte macrophage colony stimulating factor) , PGE2( pros tag land in E2) , N0(ni trie oxide) 등의 분비를 촉진하여 조골세포에서 RANKL 의 발현을 촉진하여 파골 세포의 분화를 유도 하는 것으로 보고되고 있다.
LPS로 유도된 염증성 골 소실 마우스 모델의 가장 큰 장점은 관절염 마우스 모델 (K/BxN serum transfer arthritis model)과 마찬가지로 비교적 단기간 내에 모델 구축이 가능하다는 점이다. LPS로 유도된 염증성 골 소실 마우스 모델은 LPS 를 마우스 두개골에 단회 투여하여 염증을 유도한다. 그런 다음 5 일 동안 매일 HuE10-101 을 두개골에 투여한다 (도 49). LPS 로 유도된 염증성 골 소실여부는 마이크로 CT 촬영을 통한 두개골 분석을 통해 확인하였다. 그 결과 LPS 를 투여하여 골 소실을 유도한 Vehicle 군과 대조군인 humira 복제 항체 처리 군， 실험군인 HuEl으 101 처리한 군, 음성대조군인 (normal) LPS 를 투여하지 않은 군의 두개골 소실 정도를 확인하였다. 그 결과， Vehicle 군에서 두개골 소실이 현저하게 나타남을 확인하였다. 또한， humira 복제 항체 처리 군과 실험군인 HuElO-101 를 처리한 군에서는 두개골 소실이 Vehicle 에 비해 현저하게 감소됨을 확인하였다. 결론적으로, LPS 로 유도된 염증성 골 소실 마우스 모델을 이용하여 HuElO-101 의 생체 내 (in vivo)에서의 파골 세포 분화능을 평가한 결과 HuElO— 101 이 humira 에 비해 파골 세포 분화를 효과적으로 억제하는 것을 확인할 수 있었다 (도 50).
생산세포주로부터 생산한 항체의 효능 평가를 확인하기 위하여 LPS 로 유도된 염증성 골 소실 마우스 모델을 이용한 효능 평가를 추가로 진행하였다.
그 결과 LPS 로 골 소실을 유도하고 항체 조성 버퍼만 넣어준 Vehicle 군과 대조군인 humira® 처리 군, HuElO— 101 처리한 군， LPS 를 투여하지 않은 음성대조군인 (normal) 군의 두개골 소실 정도를 확인하였다. 그 결과， Vehicle 군에서 두개골 소실이 증가함을 확인하였다. humira 처리 군과 HuElO— 101 를 처리한 군에서 Vehicle 에 비해 두개골 소실이 현저하게 감소됨을 확인하였다 (도 51).
두개골 소실에 대한 면밀한 분석을 위하여 골 소실 면적을 이미지 분석 프로그램 (Image J) 을 통하여 확인하였다. 그 결과 음성대조군에 비하여 Vehicle 군은 2.35 배 정도 골 소실이 증가하였고, 반면 humira®를 처리한 군은 음성대조군에 비해 2.15 배 정도 골 소실을 보였고, vehicle 에 비해서는 0.9 배였다. HuElO-101 은 음성 대조군에 비해 1.2 배 (P value: 0.0428) 정도 골 소실을 보였고, vehicle 에 비해서는 0.5 배였고， 48.79 % 정도 감소됨을 확인하였다 (도 52).
LPS 로 유도된 염증성 골 소실 마우스 모델을 이용하여 생산세포주로부터 생산한 HuElO-101 의 생체 내 (in vivo)에서의. 파골 세포 분화능을 평가한 결과 선행 연구의 결과와 마찬가지로 HuElO— 101 이 humira®에 비해 파골 세포 분화를 효과적으로 억제하는 것을 확인할 수 있었다.
9-5. 콜라겐 유도성 관절염 마우스 모델에서 이중항체의 효능평가
1977 년에 Trentham 등에 의해 확립된 콜라겐 유도성 관절염은 현재 가장 널리 쓰이고 있는 류마티스 관절염의 대표적인 자가면역성 관절염모델이다. 류마티스 관절염 환자의 혈청에서 콜라겐에 대한 항체가 발견되었고, 관절에 존재하는 타입 Π 콜라겐이 자가 항원으로 작용할 수 있다는 점에서 착안하였다.
콜라겐 유도성 관절염 마우스 모델의 특징은 임상적인 소견이 사람의 류마티스 관절염과 전반꺽으로 유사하다는 점이다. 유사성을 갖는 것은 클래스 II MHC 단상형 (haplotype)과의 연관성， 자가 항원에 특이적인 Τ, B 세포반웅에 의한 적응면역을 반영하는 발병기전, 관절 조직 파괴에 자가 항체와 보체계의 관여， 활막 세포의 증식과 림프구의 침윤 및 파누스 형성 등이 있다.
본 발명자들은 선행연구를 통해 류마티스 관절염의 동물 모델인 콜라겐 유도성 관절염에서 CXCL10 의 증가 된다는 결과를 확인 바가 있다. 또한, CXCL10 억제항체에 의한 콜라겐 유도 관절염의 증상 억제 실험을 통하여 CXCL10 이 류마티스 관절염에 의한 골흡수 및 파골 세포 분화 촉진 인자에 관여함을 규명하였다. 콜라겐 유도성 관절염 마우스 모델은 4°C 하에서 아세트산 (0.05-0.1 M)로 우형 (bovine-type) Π 콜라겐 (2, 4 mg/mL)을 용해하고 동둥한 양의 프로인트 보강제 (Freund's adjuvant)로 현탁하였다. 현탁 물질 0.1 mL 을 수컷 DBA/1J 마우스 (5-9 주령) 꼬리 기저부에 피하투여 (first inject ion)하며, 3 주 후에 현탁 물질 (0.1-0.2 ml)을 꼬리 기저부에 추가 (booster or second inject ion)로 피하 투여하였다 (도 53) .
콜라겐 유도성 관절염 마우스 모델의 임상적 평가는 TNF 형질전환 마우스 모델 이용한 효능평가와 동일 기준으로 관절염 유발 점수 (arthritis score)로 평가할 것이며， 추가로 병리학적 검사 및 면역 염색， 염증성 사이토카인 등의 측정을 병행하여 평가할 예정이다. 실시예 10: 항체의 교차 반웅성 시험
항체의약품은 표적세포 이외의 사람세포나 조직에 동일하거나 연관된 항원 결정 부위가 발현되었을 경우， 조직에 항체가 결합할 수도 있다.
교차 반웅성 또는 비표적 조직에 대한 결합 여부를 규명하기 위하여 항상 사람 조직에 대한 교차 반웅성 연구를 비임상 단계에서 수행하여야 한다고. 단클론항체 의약품의 평가가이드 (KFDA, 2005)에 명시되어 있어 항체의약품의 조직교차반웅 시험 (KFDA, 2013) 가이드 라인을 참고하여 교차반웅성 시험을 진행하였다. 면역조직화학염색법으로 EnVision Detection System 을 이용하였으며 중복되지 않은 3 인의 32 가지 조직을 이용하여 교차 반웅을 확인하였다. 그 결과 HuE10-101 이 다른 조직에 비특이적으로 결합하지 않는 다는 것을 확인 할 수 있었다 (도 54).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바， 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일뿐이며， 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서， 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims

【청구의 범위】
【청구항 1】
TNF- a (tumor necrosis factor-alpha)에 특이적으로 결합하는 제 1 항원 결합 부위 및 CXCLKKC-Xᅳ C motif chemokine 10)에 특이적으로 결합하는 제 2 항원 결합 부위를 포함하며,
상기 제 1 항원 결합 부위는 서열번호 1의 아미노산을 포함하는 중쇄 상보성 결정영역 (Heavy chian complementarity determining region, HCDR ) 1， 서열번호 2의 아미노산을 포함하는 HCDR2, 서열번호 3의 아미노산 을 포함하는 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고， 서열번호 5의 아미노산을 포함하는 경쇄 상보성 결정영역 (Light chian com lementarity determining region, LCDR) 1， 서열번호 6의 아미노산을 포함하는 LCDR2, 서열번호 7의 아미노산을 포함하는 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하며 ,
상기 제 2 항원 결합 부위는 서열번호 9, 서열번호 17， 서열번호 21 및 서열번호 25 로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR1, 서열번호 10, 서열번호 18， 서열번호 22 및 서열번호 26으로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR2, 서열번호 11, 서열번호 19, 서열번호 23 및 서열번호 27로 구성된 군으로부터 선택되는 아미노산을 포함하는 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 13， 서열번호 29, 서열번호 33 및 서열번호 37로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR1, 서열번호 14， 서열번호 30, 서열번호 34 및 서열번호 38로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR2, 서열번호 15, 서열번호 31， 서열번호 35 및 서열번호 39로 구성된 군으로부터 선택되는 아미노산을 포함하는 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하는 TNF-a/CXCL-10 이중 타¾ 항체 .
【청구항 2】
제 1 항에 있어서, 상기 제 1 항원 결합 부위는 서열번호 4의 아미노산을 포함하는 중쇄 가변 영역 (VH)을 포함하는 것을 특징으로 하는 TNF- a /CXCL-10 이중 타겟 항체 .
【청구항 3】
제 1 항에 있어서 , 상기 제 1 항원 결합 부위는 서열번호 8의 아미노산을 포함하는 경쇄 가변 영역 (VU을 포함하는 것을 특징으로 하는 TNF-a/CXCL-10 이중 타겟 항체.
【청구항 4]
제 1 항에 있어서 , 상기 제 2 항원 결합 부위는 서열번호 12의 아미노산을 포함하는 중쇄 가변 영역 (VH)을 포함하는 것을 특징으로 하는 TNF-a/CXCL-10 이중 타겟 항체.
【청구항 5】
제 1 항에 있어서, 상기 제 2 항원 결합 부위는 서열번호 16의 아미노산을 포함하는 경쇄 가변 영역 (VL)을 포함하는 것을 특징으로 하는 TNF-a/CXCL-10 이중 타겟 항체.
【청구항 6】
제 1 항에 있어서, 상기 제 2 항원 결합 부위는 서열번호 9의 아미노산을 포함하는 HCDR1, 서열번호 10의 아미노산을 포함하는 HCDR2, 서열번호 11의 아미노산을 포함하는 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고， 서열번호 13의 아미노산올 포함하는 LCDR1, 서열번호 14의 아미노산을 포함하는 LCDR2, 서열번호 15의 아미노산을 포함하는 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하는 TNF-a/CXCL-10 이중 타겟 항체 .
【청구항 7】
제 1 항에 있어서, 상기 제 2 항원 결합 부위는 서열번호 17의 아미노산을 포함하는 HCDR1ᅳ 서열번호 18의 아미노산을 포함하는 HCDR2, 서열번호 19의 아미노산을 포함하는 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고， 서열번호 29의 아미노산을 포함하는 LCDR1, 서열번호 30의 아미노산을 포함하는 LCDR2, 서열번호 31의 아미노산을 포함하는 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하는 TNF— a/CXCL— 10 이증 타겟 항체.
【청구항 8】
제 1 항에 있어서， 상기 제 2 항원 결합 부위는 서열번호 21의 아미노산을 포함하는 HCDR1, 서열번호 22의 아미노산을 포함하는 HCDR2, 서열번호 23의 아미노산을 포함하는 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 33의 아미노산을 포함하는 LCDR1, 서열번호 34의 아미노산을 포함하는 LCDR2, 서열번호 35의 아미노산을 포함하는 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하는 TNF— a/CXa-10 이중 타겟 항체 .
【청구항 9】
제 1 항에 있어서， 상기 제 2 항원 결합 부위는 서열번호 25의 아미노산을 포함하는 HCDR1, 서열번호 26의 아미노산을 포함하는 HCDR2, 서열번호 27의 아미노산을 포함하는 HCDR3을 포함하는 중쇄 가변 영역 (VH)을 포함하고 , 서열번호 37의 아미노산을 포함하는 LCDR1, 서열번호 38의 아미노산을 포함하는 LCDR2, 서열번호 39의 아미노산을 포함하는 LCDR3을 포함하는 경쇄 가변 영역 (VL)을 포함하는 TNF— ci/CXCL-10 이중 타겟 항체 .
【청구항 10】
제 1 항에 있어서， 상기 TNF-a/CXa-10 이중 타겟 항체는 TNF- a에 특이적으로 결합하는 제 1 전장 항체의 중쇄 및 경쇄; 및 CXCL10에 특이적으로 결합하는 제 2 전장 항체의 중쇄 및 경쇄를 포함하고， 상기 제 1 전장 항체 및 제 2 전장 항체의 중쇄 불변 영역 C-말딘 -이 서로 연결되어 있는 것을 특징으로 하는 TNF-a/CXCL— 10 이중 타겟 항체 .
【청구항 11】
제 1 항에 있어서, 상기 TNF— a/CXCL-10 이중 타겟 항체는 TNF— a에 특이적으로 결합하는 제 1 전장 항체의 중쇄 및 경쇄; 및 CXCL10에 특이적으로 결합하고 제 2 항체의 중쇄 가변영역 및 경쇄 가변영역를 포함하는 제 2 전장 항체의 단편을 포함하고， 상기 제 1 전장 항체의 중쇄 불변 영역 C—말단에 제 2 항체의 단편이 연결되어 있는 것을 특징으로 하는 TNF- a /CXCL-10 이중 타겟 항체 .
【청구항 12]
제 11 항에 있어서， 상기 항체의 단편은 단일 사슬 가변 분절 (Singleᅳ chain variable fragment , scFv)인 것을 특징으로 하는 TNF一 a /CXCL-10 이중 타켓 항체 .
【청구항 13】
제 10 항 또는 제 11 항에 있어서， 항체ᅳ항체 또는 힝-체—단편 간의 연결은 링커 (linker)에 의해 연결되는 것을 특징으로 하는 TNF— a/CXCL-10 이중 타겟 항체 .
【청구항 14】
제 1 항의 제 1 항원 결합 부위를 코딩하는 폴리뉴클레오티드를 포함하는 발현 백터 및 제 2 항원 결합 부위를 코딩하는 폴리뉴클레오티드를 포함하는 발현 백터를 공동 형질감염 (co一 transfection)시킨 형질전환체.
【청구항 15】
다음 단계를 포함하는 TNF- a /CXCL10 이중 타겟 항체의 제조 방법 : (a) 제 14 항의 형질전환체를 배양하는 단계; 및 (b) 상기 단계 (a)에서 배양된 배양액으로부터 제 1 항의 항체를 정제하는 단계.
【청구항 16]
(a) 제 1 항 내지 제 13 힝- 중 어느 한 항의 TNF-a/CXCLᅳ 10 이중 타겟 항체의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 면역질환의 예방 또는 치료용 약제학적 조성물.
【청구항 17]
제 16 항에 있어서, 상기 면역질환은 자가면역질환, 염증성질환 , 세포, 조직 또는 기관의 이식거부 (transplantation rejection)인 것을 특징으로 하는 면역 질환의 예방 또는 치료용 약제학적 조성물.
【청구 ¾■ 18]
제 17 항에 있어서, 상기 자가면역질환 또는 염증성질환은 류머티스성 관절염 (rheumatoid arthritis), 염증성 장질환 ( inf la隱 atory bowel disease) , 건선 (psoriasis)， 천식 (asthma), 아토피성 피부염 (atopic dermatis), 알레르기성 비염 (allergic rhinitis), 만성폐색성 기관지 질환 (chronic obstructive pulmonary disease) 및 습진 (eczema)으로부터 선택되는 것을 특징으로 하는 면역질환의 예방 또는 치료용 약제학적 조성물.
【청구항 19]
유효성분으로서 제 1 항 내지 제 13 항 중 어느 한 항의 TNFᅳ α /CXCL-10 이중 타겟 항체를 포함하는 조성물을 대상 (subject)에 투여하는 단계를 포함하는 면역질환의 예방 또는 치료 방법.
PCT/KR2014/004579 2013-05-22 2014-05-22 항 ＴＮＦ-α/ＣＸＣＬ10 이중 타겟 항체 및 그의 용도 WO2014189306A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2016515273A JP2016520595A (ja) 2013-05-22 2014-05-22 抗ＴＮＦ−α／ＣＸＣＬ１０二重ターゲット抗体及びその用途
AU2014269287A AU2014269287B2 (en) 2013-05-22 2014-05-22 Anti-TNF-alpha/CXCL10 double-targeting antibody and use thereof
BR112015029224A BR112015029224A2 (pt) 2013-05-22 2014-05-22 Anticorpo de alvo duplo tnf-alfa/cxcl10, transformante, método de produção de um anticorpo de alvo duplo tnf-alfa/cxcl10, composição farmacêutica e método de prevenção ou tratamento de uma doença imunológica
CN201480029427.2A CN105263964A (zh) 2013-05-22 2014-05-22 抗-TNF-α/CXCL10双靶向抗体及其应用
US14/893,071 US10087248B2 (en) 2013-05-22 2014-05-22 Anti-TNF-α/CXCL10 double-targeting antibody and use thereof
EP14801159.6A EP3000827B1 (en) 2013-05-22 2014-05-22 Anti-tnf-alpha/cxcl10 double-targeting antibody and use thereof
CA2913118A CA2913118A1 (en) 2013-05-22 2014-05-22 Anti-tnf-.alpha./cxcl10 double-targeting antibody and use thereof
PH12015502601A PH12015502601A1 (en) 2013-05-22 2015-11-23 ANTI-TNF-a/CXCL10 DOUBLE-TARGETING ANTIBODY AND USE THEREOF
HK16111369.2A HK1223112A1 (zh) 2013-05-22 2016-09-29 抗- -α/ 雙靶向抗體及其應用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20130057762 2013-05-22
KR20130057475 2013-05-22
KR10-2013-0057475 2013-05-22
KR10-2013-0057762 2013-05-22

Publications (2)

Publication Number Publication Date
WO2014189306A1 true WO2014189306A1 (ko) 2014-11-27
WO2014189306A8 WO2014189306A8 (ko) 2015-12-03

Family

ID=51933801

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/004579 WO2014189306A1 (ko) 2013-05-22 2014-05-22 항 ＴＮＦ-α/ＣＸＣＬ10 이중 타겟 항체 및 그의 용도

Country Status (11)

Country Link
US (1) US10087248B2 (ko)
EP (1) EP3000827B1 (ko)
JP (1) JP2016520595A (ko)
KR (1) KR101671955B1 (ko)
CN (1) CN105263964A (ko)
AU (1) AU2014269287B2 (ko)
BR (1) BR112015029224A2 (ko)
CA (1) CA2913118A1 (ko)
HK (1) HK1223112A1 (ko)
PH (1) PH12015502601A1 (ko)
WO (1) WO2014189306A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017220989A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 and il-2 cytokines
EP3960762A4 (en) * 2019-04-26 2022-08-31 Y-Biologics Inc. BISPECIFIC ANTIBODY THAT SPECIFICALLY BINDS IL-17A AND TNF-ALPHA

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3630836A1 (en) * 2017-05-31 2020-04-08 Elstar Therapeutics, Inc. Multispecific molecules that bind to myeloproliferative leukemia (mpl) protein and uses thereof
US10633458B2 (en) 2018-04-10 2020-04-28 Y-Biologics Inc. Cell engaging binding molecules
WO2019197979A1 (en) * 2018-04-10 2019-10-17 Y-Biologics Inc. Cell engaging binding molecules
KR102088789B1 (ko) * 2018-06-20 2020-03-13 인하대학교 산학협력단 항 TNF/IFN scFv-Fc 이중 표적 항체 및 이의 이용
KR102385046B1 (ko) 2020-08-24 2022-04-13 에스큐엔지니어링(주) 드론에 탈부착 점검장치를 이용한 다목적 구조물 검사장치
CN117836318A (zh) * 2021-03-31 2024-04-05 加利福尼亚大学董事会 用于降解靶蛋白的双特异性结合剂-配体融合物
KR102357756B1 (ko) 2021-05-14 2022-02-09 유한회사 서해항공방제 드론을 이용한 유해 조수 및 곤충 방제장치 및 그를 구비하는 드론
CN114432502B (zh) * 2021-12-31 2023-02-03 中山大学附属第八医院（深圳福田） 一种负载op3-4多肽、抗cxcl9抗体的水凝胶及其制备方法与应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050053600A1 (en) * 2003-09-09 2005-03-10 Lane Thomas E. Methods for treating rheumatoid arthritis
KR20100097720A (ko) * 2007-11-30 2010-09-03 글락소 그룹 리미티드 항원-결합 작제물
US8258268B2 (en) * 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
KR20120125611A (ko) * 2009-12-29 2012-11-16 이머전트 프로덕트 디벨롭먼트 시애틀, 엘엘씨 이종이량체 결합 단백질 및 이의 용도
WO2013055958A1 (en) * 2011-10-11 2013-04-18 Genentech, Inc. Improved assembly of bispecific antibodies

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK0929578T3 (da) * 1996-02-09 2003-08-25 Abbott Lab Bermuda Ltd Humane antistoffer, der binder human TNFalfa
EP1866416A2 (en) 2005-03-22 2007-12-19 Medstar Health Inc. Delivery systems and methods for diagnosing and treating cardiovascular diseases
CA2903138A1 (en) * 2005-05-16 2006-11-23 Abbvie Biotechnology Ltd. Use of tnfa inhibitor for treatment of erosive polyarthritis
EP1895947A2 (en) * 2005-06-17 2008-03-12 Abbott Laboratories Improved method of treating degenerative spinal disorders
SG2014010029A (en) * 2005-08-19 2014-08-28 Abbott Lab Dual variable domain immunoglobin and uses thereof
JP2012228248A (ja) * 2005-08-19 2012-11-22 Abbott Lab 二重可変ドメイン免疫グロブリン及びその使用
KR20130121601A (ko) * 2012-04-27 2013-11-06 주식회사에이앤알쎄라퓨틱스 인간 항 ｃｘｃｌ－１０ 항체 및 이를 포함하는 류마티스 관절염 치료용 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050053600A1 (en) * 2003-09-09 2005-03-10 Lane Thomas E. Methods for treating rheumatoid arthritis
US8258268B2 (en) * 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
KR20100097720A (ko) * 2007-11-30 2010-09-03 글락소 그룹 리미티드 항원-결합 작제물
KR20120125611A (ko) * 2009-12-29 2012-11-16 이머전트 프로덕트 디벨롭먼트 시애틀, 엘엘씨 이종이량체 결합 단백질 및 이의 용도
WO2013055958A1 (en) * 2011-10-11 2013-04-18 Genentech, Inc. Improved assembly of bispecific antibodies

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARNON ET AL., RECENT RESULTS IN CANCER RES., vol. 75, 1980, pages 236
BECK A, NAT REV IMMUNOLOGY, vol. 10, 2010, pages 345 - 352
BOSTROM, J, SCIENCE, vol. 323, 2009, pages 1610 - 1614
GENNARO: "Remington's Pharmaceutical Sciences 19th ed.,", 1995
MOOLTON ET AL., IMMUNOLOG. RES., vol. 62, 1982, pages 47
See also references of EP3000827A4

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017220989A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 and il-2 cytokines
WO2017220988A1 (en) 2016-06-20 2017-12-28 Kymab Limited Multispecific antibodies for immuno-oncology
WO2017220990A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 antibodies
EP3960762A4 (en) * 2019-04-26 2022-08-31 Y-Biologics Inc. BISPECIFIC ANTIBODY THAT SPECIFICALLY BINDS IL-17A AND TNF-ALPHA

Also Published As

Publication number Publication date
US20160108118A1 (en) 2016-04-21
US10087248B2 (en) 2018-10-02
AU2014269287A1 (en) 2015-12-10
EP3000827A1 (en) 2016-03-30
CN105263964A (zh) 2016-01-20
EP3000827B1 (en) 2020-04-22
CA2913118A1 (en) 2014-11-27
EP3000827A4 (en) 2016-08-24
BR112015029224A2 (pt) 2017-09-19
PH12015502601A1 (en) 2016-02-29
HK1223112A1 (zh) 2017-07-21
WO2014189306A8 (ko) 2015-12-03
AU2014269287B2 (en) 2016-08-25
KR20150010919A (ko) 2015-01-29
KR101671955B1 (ko) 2016-11-07
JP2016520595A (ja) 2016-07-14

Similar Documents

Publication Publication Date Title
WO2014189306A1 (ko) 항 ＴＮＦ-α/ＣＸＣＬ10 이중 타겟 항체 및 그의 용도
WO2022042690A1 (zh) Ccr8抗体及其应用
TWI701259B (zh) ４﹘１ｂｂ抗體及其製備方法和應用
RU2509777C2 (ru) Анти-mif антитела
KR20190134614A (ko) B7-h3 항체, 이의 항원-결합 단편 및 이의 의학적 용도
WO1998046644A1 (en) Novel protein and process for producing the same
KR102523150B1 (ko) 항-테나신 c 항체 및 이의 용도
JP7334912B2 (ja) 抗プレキシンａ１アゴニスト抗体
CN110724193B (zh) 人单克隆抗il-32抗体、多核苷酸、载体、宿主细胞、制备方法、组合物及应用
WO2015113494A1 (zh) 双功能融合蛋白及其制备方法和用途
KR101525919B1 (ko) 자가면역 질환 예방 및 치료를 위한 ｔｎｆｒ２를 기반으로 하는 이중 항체
EP4265269A1 (en) Use of taci protein
TW201915022A (zh) Ｉｌ－５抗體、其抗原結合片段及醫藥用途
JP2021534204A (ja) 抗ＳＩＲＰｇ化合物
CN113637074A (zh) NKp46抗体及其制备方法和应用
WO2024140994A1 (zh) 一种融合蛋白
EP4238995A1 (en) Wars-neutralizing antibody and use thereof
JP7346576B2 (ja) 抗ｏｘ４０モノクローナル抗体とその応用
AU2020480890A1 (en) ANTI-OX40L ANTIBODY, ANTI-OX40L/ANTI-TNFα BISPECIFIC ANTIBODY, AND USES THEREOF
CN113166273A (zh) 具有il-7活性的双功能分子
CN116710484A (zh) Wars中和抗体及其用途
TW202222831A (zh) 抗-OX40L抗體、抗OX40L和抗-TNFα雙特異性抗體及其用途
JP2020534273A (ja) リシル−ｔＲＮＡ合成酵素Ｎ末端に特異的に結合する抗体を有効成分として含む免疫細胞の遊走関連疾患の予防又は治療用薬学的組成物

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480029427.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14801159

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2913118

Country of ref document: CA

Ref document number: 2016515273

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14893071

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 12015502601

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 2014801159

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2014269287

Country of ref document: AU

Date of ref document: 20140522

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015029224

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: IDP00201508665

Country of ref document: ID

ENP Entry into the national phase

Ref document number: 112015029224

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20151123