WO2014174470A1 - Isolated naive pluripotent stem cells and methods of generating same - Google Patents
Isolated naive pluripotent stem cells and methods of generating same Download PDFInfo
- Publication number
- WO2014174470A1 WO2014174470A1 PCT/IB2014/060954 IB2014060954W WO2014174470A1 WO 2014174470 A1 WO2014174470 A1 WO 2014174470A1 IB 2014060954 W IB2014060954 W IB 2014060954W WO 2014174470 A1 WO2014174470 A1 WO 2014174470A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- naive
- psc
- inhibitor
- cells
- mbd3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0608—Germ cells
- C12N5/0611—Primordial germ cells, e.g. embryonic germ cells [EG]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/15—Transforming growth factor beta (TGF-β)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2306—Interleukin-6 (IL-6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/235—Leukemia inhibitory factor [LIF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/40—Regulators of development
- C12N2501/42—Notch; Delta; Jagged; Serrate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/602—Sox-2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/603—Oct-3/4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/604—Klf-4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/605—Nanog
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/606—Transcription factors c-Myc
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases [EC 2.]
- C12N2501/727—Kinases (EC 2.7.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/999—Small molecules not provided for elsewhere
Definitions
- the present invention in some embodiments thereof, relates to isolated naive pluripotent stem cell, novel culture medium which can be used to generate same and methods of generating and culturing same and, more particularly, but not exclusively, to methods of improving dedifferentiation of somatic cells for generation of induced pluripotent stem cells.
- ESC-like cells termed induced pluripotent (iPS) cells can be generated from somatic cells by ectopic expression of different transcription factors, originally Oct4, Sox2, Klf4 and c-Myc (Takahashi and Yamanaka, 2006), that share all defining features with naive mouse ESCs (Takahashi and Yamanaka, 2006; Hanna et al., 2009a).
- the reprogramming process typically requires extensive cell proliferation of a period of at least one week, after which a certain fraction of the cell progeny successfully converts into ES-like state in an unpredictable pattern and with different time latencies (Hanna et al., 2009b).
- somatic cells Despite of these advances, the reprogramming efficiency of somatic cells remains to be low, even in the most optimized reprogramming recipes used (up to 0.1- 20%) (Hanna et al., 2010b). Further, per a starting individual somatic epigenome challenged with the overexpression of reprogramming factors, the outcome is highly stochastic, and the majority of cells assume different levels of reprogramming (Hanna et al., 2009b). The latter has allowed the isolation of a variety of intermediate populations identified by surface markers that can be further challenged and perturbed to generate iPSCs in a random manner (Polo et al., 2012).
- Embryonic stem cells were first isolated from mouse embryos by explanting the inner cell mass (ICM) of developing embryos in vitro in the presence of the leukemia inhibitory factor (LIF) cytokine and mouse embryonic feeder (MEF) cells (Hanna et al., 2010a; Takahashi and Yamanaka, 2006).
- Mouse ESCs recapitulate molecular signatures of the nascent ICM and are, therefore, termed as "naive pluripotent cells" (Hanna, 2010; Hanna et al., 2010a; 2009a; Takahashi and Yamanaka, 2006).
- EpiSCs pluripotent cells
- FGF2 also known as “basic fibroblast growth factor (bFGF)”
- Activin Ang et al., 2011; Mansour et al., 2012; Onder et al., 2012; Tesar et al., 2007.
- FGF2 also known as “basic fibroblast growth factor (bFGF)”
- Activin Ang et al., 2011; Mansour et al., 2012; Onder et al., 2012; Tesar et al., 2007.
- bFGF basic fibroblast growth factor
- EpiSCs are highly inefficient in generating animal chimeras, have already undergone X chromosome inactivation, and demonstrate heterogeneous expression of early lineage-commitment markers (Hanna et al., 2009a; 2010a). Hanna Y., et al. (2009a) have recently defined the relationships between the two distinct types of pluripotent states. Whereas naive murine pluripotent cells can differentiate into a primed EpiSC-like state in vitro by promoting Activin and FGF2 signaling, EpiSCs can epigenetically revert back to ESC-like naive pluripotency by defined signaling stimuli.
- ESCs derived from humans nearly share several defining features with EpiSC cells, rather than with mouse ESCs.
- the maintenance of human ES cells requires FGF2 and Activin (rather than LIF/Stat3 signaling), they are highly sensitive to passaging as single cells, display heterogeneous expression of epiblast and lineage commitment markers, and utilize the proximal enhancer element to drive the expression of Oct4 in the post-implantation Epiblast (rather than the distal Oct4 enhancer active in the ICM) (Hanna et al., 2009a; 2009b).
- human ESCs correspond to the primed pluripotent state rather than the naive state of mouse ESCs and that this could be the underlying reason for the biological properties of conventional human ESCs that impede their use for disease related research (Hanna et al., 2010b; Polo et al., 2012).
- Mouse naive ESC cells can be derived from Non-obese diabetogenic (NOD) mice blastocysts only if additional signaling molecules or transcription factors are exogenously provided together with LIF cytokine (e.g. Naive NOD ESC and iPSCs could be propagated in PD0325901/CHIR99021/LIF or Kenopaullone/CHIR99021/LIF or constitutive expression of Klf4/Lif and c-Myc/LIF conditions) (Hanna et al., 2009a).
- NOD Non-obese diabetogenic mice blastocysts only if additional signaling molecules or transcription factors are exogenously provided together with LIF cytokine (e.g. Naive NOD ESC and iPSCs could be propagated in PD0325901/CHIR99021/LIF or Kenopaullone/CHIR99021/LIF or constitutive expression of Klf4/Lif and c-Myc/L
- LIF cytokine and ERK1/2 inhibitor PD0325901 and GSK3b inhibitor CHIR99021 (abbreviated as 2i supplemented conditions - two small molecule inhibitors of ERK1/2 signaling and GSK3 to promote WNT signaling, abbreviated as "PD/CH” or “2i” conditions) together with over-expression of OCT4/KLF4 or KLF2/KLF4 induced conversion of conventional human ES and iPS cells to what was then mistakenly referred as human naive pluripotent state reminiscent of that of mouse ESCs (Hanna et al., 2010b).
- naive human ESCs were pluripotent by several available criteria including embryonic body differentiation and in vivo teratoma formation. Importantly, they were epigenetically and molecularly distinct from conventional "primed" human ESCs/iPSCs.
- "Naive" hPSCs generated by Hanna et al., 2010b exhibited XIST methylation on both X alleles, high single cell cloning efficiency and showed a gene expression pattern that resembled that of naive mouse ES cells (lack of MHC class I expression, and clustered with murine naive ESCs in cross-species unbiased gene clustering for 9773 expressed orthologue genes) (Hanna et al., 2010b).
- XIST was completely methylated in the previously referred naive human ESC/iPSCs and the cells lacked any XIST transcription (Hanna et al., 2010b), which is inconsistent with in vivo results on human blastocysts that clearly show XIST transcription (without forming XIST bodies, i.e., XIST coated X chromosomes) (Okamoto et al., 2011).
- XIST X-inactive specific transcript
- an expression level of transcription factor E3 is characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immuno staining assay.
- the isolated primate (e.g., human) naive PSC of some embodiments of the invention being in a pluripotent state, wherein when the isolated naive PSC is incubated in the presence of an agent selected from the group consisting of Bone morphogenetic protein 4 (BMP4), JNK inhibitor, and P38 inhibitor, the naive PSC remains in the pluripotent state, and maintains a pluripotent phenotype.
- BMP4 Bone morphogenetic protein 4
- JNK inhibitor JNK inhibitor
- P38 inhibitor a pluripotent phenotype
- the primate (e.g., human) naive PSC is characterized by reduced methylation of CpG islands as compared to a level of methylation of the CpG islands in a primate (e.g., human) primed PSC.
- an isolated population of naive PSCs comprising at least 10% of the isolated primate (e.g., human) naive PSC cells of some embodiments of the invention.
- isolated primate e.g., human
- a cell culture comprising the isolated naive PSC of some embodiments of the invention, or the isolated population of naive PSCs of some embodiments of the invention and a culture medium.
- the culture medium is capable of maintaining the naive PSC in an undifferentiated and pluripotent state for at least 10 passages.
- a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF), transforming growth factor beta 1 (TGF i), a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor beta 1
- PKC protein kinase C
- ROCK inhibitor a ROCK inhibitor
- a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor, a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
- TGFR transforming growth factor receptor
- FGFR fibroblast growth factor receptor
- PKC protein kinase C
- ROCK inhibitor a ROCK inhibitor
- the STAT3 activator is selected from the group consisting of leukemia inhibitory factor (LIF) and interleukin 6 (IL6).
- the culture medium further comprising at least one additional agent selected from the group consisting of: insulinlike growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGF1 insulinlike growth factor 1
- IGFII insulin-like growth factor II
- BMP bone morphogenetic protein
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- the culture medium further comprising at least one additional agent selected from the group consisting of: insulinlike growth factor 1 (IGF1), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGF1 insulinlike growth factor 1
- IGFII insulin-like growth factor II
- BMP4 bone morphogenetic protein 4
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor forskolin
- Kenpaullone Kenpaullone
- BayK8644 BayK8644
- Bixl294 Bixl294
- SCF stem cell factor
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the PKC inhibitor.
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the TGF i and the protein kinase C inhibitor.
- the culture medium further comprises an FGFR inhibitor.
- the culture medium further comprises TGFR inhibitor.
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the TGF i and the protein kinase C inhibitor.
- the culture medium further comprises an FGFR inhibitor.
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the bFGF and the TGFpl.
- the culture medium further comprises a ROCK inhibitor.
- the culture medium further comprises a protein kinase C inhibitor.
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
- the culture medium further comprises a Sonic Hedgehog pathway (SHH) inhibitor.
- SHH Sonic Hedgehog pathway
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
- the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
- FGFR fibroblast growth factor receptor
- the culture medium further comprises an agent selected from the group consisting of insulin-like growth factor II (IGFII), stem cell factor (SCF) and transforming growth factor beta 1 (TGF i).
- IGFII insulin-like growth factor II
- SCF stem cell factor
- TGF i transforming growth factor beta 1
- a culture medium comprising leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a protein kinase C inhibitor
- the culture medium of some embodiments of the invention further comprises an FGFR inhibitor.
- the culture medium of some embodiments of the invention further comprises a TGFR inhibitor.
- a culture medium comprising leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a JNK inhibitor
- TGF i protein kinase C inhibitor
- the culture medium of some embodiments of the invention further comprises a FGFR inhibitor.
- a culture medium comprising leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor basic fibroblast growth factor
- TGF i transforming growth factor-beta 1
- the culture medium of some embodiments of the invention further comprises a ROCK inhibitor. According to some embodiments of the invention, the culture medium of some embodiments of the invention further comprises a protein kinase C inhibitor.
- the culture medium of some embodiments of the invention further comprising a factor selected from the group consisting of: bone morphogenetic protein 4 (BMP4), IGF1, IGFII, Forskolin, FGFR inhibitor, TGFR inhibitor, KenpauUone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 IGF1
- IGFII IGF1
- Forskolin FGFR inhibitor
- TGFR inhibitor TGFR inhibitor
- KenpauUone KenpauUone
- BayK8644 Bixl294
- SCF stem cell factor
- the culture medium of some embodiments of the invention further comprising BMP type I receptors (ALK2,3,6) inhibitor.
- the culture medium of some embodiments of the invention further comprises ascorbic Acid.
- the culture medium of some embodiments of the invention further comprises oleic Acid.
- the culture medium of some embodiments of the invention further comprises Linoleic Acid.
- the culture medium of some embodiments of the invention further comprises Pipecolic Acid.
- the culture medium of some embodiments of the invention being devoid of animal serum.
- the culture medium of some embodiments of the invention further comprises serum replacement.
- a cell culture comprising cells and the culture medium of some embodiments of the invention.
- the culture medium is capable of maintaining naive pluripotent stem cell in an undifferentiated state for at least 2 passages.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and
- an expression level of transcription factor E3 (TFE3) in the naive PSC is characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immuno staining assay,
- the PSC is a primate PSC.
- the PSC is a human PSC.
- the conditions comprise the culture medium of some embodiments of the invention.
- the conditions comprise hypoxia.
- the conditions comprise a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF), transforming growth factor beta 1 (TGF 1), a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor, wherein the STAT3 activator is selected from the group consisting of leukemia inhibitory factor (LIF) and interleukin 6 (IL6).
- bFGF basic fibroblast growth factor
- TGF 1 transforming growth factor beta 1
- PKC protein kinase C
- ROCK inhibitor ROCK inhibitor
- NOTCH inhibitor a NOTCH inhibitor
- the conditions comprise a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor, a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor, wherein the STAT3 activator is selected from the group consisting of leukemia inhibitory factor (LIF) and interleukin 6 (IL6).
- TGFR transforming growth factor receptor
- FGFR fibroblast growth factor receptor
- PLC protein kinase C
- ROCK inhibitor ROCK inhibitor
- NOTCH inhibitor wherein the STAT3 activator is selected from the group consisting of leukemia inhibitory factor (LIF) and interleukin 6 (IL6).
- LIF leukemia inhibitory factor
- IL6 interleukin 6
- the conditions comprise a culture medium which further comprises at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGF1 insulin-like growth factor 1
- IGFII insulin-like growth factor II
- BMP bone morphogenetic protein
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- the conditions comprise a culture medium which further comprises at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGF1 insulin-like growth factor 1
- IGFII insulin-like growth factor II
- BMP4 bone morphogenetic protein 4
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor forskolin
- Kenpaullone Kenpaullone
- BayK8644 BayK8644
- Bixl294 Bixl294
- SCF stem cell factor
- the conditions include a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a protein kinase C inhibitor
- the conditions include a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, and a JNK inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a JNK inhibitor
- the conditions include a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a BMP inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a BMP inhibitor
- the culture medium further comprises FGFR inhibitor.
- the culture medium further comprises TGFR inhibitor.
- the conditions include a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a JNK inhibitor
- TGF i protein kinase C inhibitor
- the culture medium further comprises FGFRi.
- the conditions include a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- the culture medium further comprises a ROCK inhibitor.
- the culture medium further comprises a protein kinase C inhibitor.
- the culture medium further comprises a factor selected from the group consisting of: bone morphogenetic protein 4 (BMP4), IGF1, IGFII, Forskolin, FGFR inhibitor, TGFR inhibitor, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 IGF1
- IGFII IGF1
- Forskolin FGFR inhibitor
- TGFR inhibitor TGFR inhibitor
- Kenpaullone Kenpaullone
- BayK8644 BayK8644
- Bixl294 stem cell factor
- the culture medium further comprises an ascorbic acid.
- the culture medium further comprises an oleic Acid.
- the culture medium further comprises a Linoleic Acid.
- the culture medium further comprises a Pipecolic Acid.
- the culture medium being devoid of animal serum.
- the culture medium further comprises serum replacement.
- the culture medium further comprises an MBD3 inhibitor.
- the culture medium further comprises a chromodomain helicase DNA binding protein 4 (CHD4) inhibitor.
- CHD4 chromodomain helicase DNA binding protein 4
- the culture medium further comprises P66 alpha coiled-coil domain.
- the non-naive PSC is selected from the group consisting of a primed PSC, a blastocyst, an induced pluripotent stem cell (iPSC) and a somatic cell.
- a primed PSC a blastocyst
- iPSC induced pluripotent stem cell
- the PSC comprises a somatic cell then the method further comprising subjecting the somatic cell to de-differentiation conditions, to thereby obtain an induced pluripotent stem cell.
- the de-differentiation conditions comprise expressing within the somatic cell at least two growth factors selected from the group consisting of Oct4, Sox2, Klf4 and c-Myc.
- a method of improving generation of induced pluripotent stem cells (iPSCs) from a somatic cell comprising:
- inhibiting Mbd3 activity is performed by inhibiting binding of the Mbd3 to the nucleosome remodeling and deacetylase (NuRD) complex.
- NuRD nucleosome remodeling and deacetylase
- inhibiting the binding of the Mbd3 to the NuRD complex is performed using a chromodomain helicase DNA binding protein 4 (CHD4) inhibitor.
- CHD4 chromodomain helicase DNA binding protein 4
- inhibiting the binding of the Mbd3 to the NuRD complex is performed using a P66 alpha coiled-coil domain.
- inhibiting the Mbd3 expression is performed using a protein kinase C (PKC) inhibitor.
- PKC protein kinase C
- the method further comprising exogenously expressing embryonic stem (ES) cell expressed Ras (ERAS) coding sequence or activating endogenous expression of the ERAS in the somatic cell.
- ES embryonic stem
- ERAS Ras
- expressing is effected for at least 48 hours such that the inhibiting the Mbd3 is effected to 10-30% of a level of the Mbd3 prior to the expressing.
- expressing is effected for about 48 hours and the inhibiting is effected after the about 48 hours.
- the iPSC is a murine iPSC.
- the method of some embodiments of the invention further comprising culturing the murine iPSC in a medium which comprises LIF, an ERK1/2 inhibitor, and a GSK3b inhibitor.
- the method further comprises: (c) culturing the primate (e.g., human) iPSC in a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a P38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a P38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- the medium further comprises a ROCK inhibitor.
- step (c) is performed following about 48 hours from the expressing of step (a).
- expressing is performed using
- expressing is performed using RNA transfection of the growth factors.
- expressing is performed using protein transfection of the growth factors.
- the PSC is selected from the group consisting of embryonic stem cell (ESC), induced pluripotent stem cells (iPSCs), and embryonic germ cell (EGC).
- ESC embryonic stem cell
- iPSCs induced pluripotent stem cells
- ECC embryonic germ cell
- the naive PSC expresses XIST.
- the naive PSC is devoid of XIST bodies.
- the naive ESC is capable of X-inactivation when induced to differentiate.
- the naive PSC is capable to differentiate into the endodermal, mesodermal and ectodermal embryonic germ layers.
- the naive PSC is capable of being maintained in the undifferentiated and pluripotent state for more than 20 passages in culture.
- the naive PSC expresses a lower level of MHC class I as compared to a primed PSC under identical detection assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST, expresses XIST, exhibits XIST bodies and exhibits a H3K27me3/polycomb focus.
- the naive PSC is characterized by at least 10 % more RNA polymerase II pausing on chromosomes as compared to a primed PSC under identical assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST, expresses XIST, exhibits XIST bodies and exhibits a H3K27me3/polycomb focus.
- the isolated naive PSC has an inhibited p38 pathway as compared to a primed PSC.
- the isolated naive PSC has an inhibited JNK pathway as compared to a primed PSC.
- the isolated naive PSC has an inhibited ROCK pathway as compared to a primed PSC.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- the culture medium further comprises FGFR inhibitor. According to some embodiments of the invention, the culture medium further comprises TGFR inhibitor.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- the culture medium further comprises FGFRi.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- an isolated naive pluripotent stem cell obtainable by the method of some embodiments of the invention.
- the naive pluripotent stem cell comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- a method of generating differentiated cells comprising subjecting the naive pluripotent stem cells generated according to some embodiments of the invention, or the isolated naive pluripotent stem cells of some embodiments of the invention to differentiation conditions, thereby generating differentiated cells.
- a method of generating a primordial germ cell comprising culturing a primate (e.g., human) naive pluripotent stem cell in a culture medium selected capable of inducing the primate naive pluripotent stem cells into primordial germ cell, wherein the culture medium comprises a Rho kinase (ROCK) inhibitor and bone morphogenetic protein 4 (BMP4), thereby generating the primordial germ cell.
- a primate e.g., human
- a culture medium selected capable of inducing the primate naive pluripotent stem cells into primordial germ cell
- the culture medium comprises a Rho kinase (ROCK) inhibitor and bone morphogenetic protein 4 (BMP4)
- the primate naive pluripotent stem cell comprises:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- the primordial germ cell is characterized by CD61 (intergrin beta 3) expression pattern. According to some embodiments of the invention, the primordial germ cell is characterized by CD61 + /SSEA4 + expression pattern.
- the culture medium used by the method of generating primordial germ cell further comprises at least one agent selected from the group consisting of: leukemia inhibitory factor (LIF), Stem Cell Factor (SCF) and Epidermal Growth Factor (EGF).
- LIF leukemia inhibitory factor
- SCF Stem Cell Factor
- EGF Epidermal Growth Factor
- an isolated population of primate primordial germ cells comprising primate primordial germ cells generated according to the method of some embodiments of the invention.
- the isolated population of primate primordial germ cells comprising at least 50% of primordial germ cells characterized by CD61 + /SSEA4 + expression pattern.
- a method of treating a subject in need thereof comprising administering the primordial germ cells of some embodiments of the invention to a gonad tissue of the subject, thereby treating the subject in need thereof.
- the subject suffers from infertility.
- kits comprising the primate primordial germ cells of some embodiments of the invention and a medicament for treating infertility.
- a method of generating a chimeric animal comprising introducing the isolated naive primate (e.g., human) PSC of some embodiments of the invention, or the primordial germ cells of some embodiments of the invention into a pre-implantation embryo of a host animal, thereby generating the chimeric animal.
- isolated naive primate e.g., human
- the method further comprising allowing said pre-implantation embryo to grow ex vivo or in vivo.
- the introducing is performed in vivo.
- the introducing is performed in vitro or ex vivo.
- the pre-implantation embryo comprises at least 4 cells.
- the pre-implantation embryo comprises no more than 128 cells.
- the host animal is a mouse.
- the isolated naive PSC or the primordial germ cell is allogeneic to the host animal.
- the isolated naive PSC or the primordial germ cell is xenogeneic to the host animal.
- FIGs. 1A-N show that Mbd3 inhibition boosts epigenetic reversion of mouse primed pluripotent cells to naive pluripotency.
- FIGs. 1A-B An siRNA screen for factors that can boost epigenetic reversion of primed EpiSCs into naive ESCs. Nanog- GFP mouse EpiSCs were used for the screening, and Nanog-GFP reactivation is used as a specific marker for naive pluripotency formation after expansion in 2i/LIF conditions.
- FIG. 1A Schematic illustration depicting the siRNA screen.
- FIG. IB A histogram depicting percentage of Nanog-GFP expressing cells as a result of inhibition with the tested siRNAs.
- FIGs. 1C-G Mbd3 +/+ and Mbd3 flox/" EpiSCs were tested for reversion into naive cells in 2i/LIF.
- FIG. 1C Schematic illustration of the reversion assay from EpiSCs into Naive ES-like colonies.
- FIGs. 1D-G Microscopy photographs depicting formation of naive ES-like colonies from Mbd3 +/+ EpiSCs (FIG. ID) or & ⁇ 3 ⁇ / ⁇ EpiSCs (FIG. IE). Note the dramatically increased reprogramming efficiency in Mbd3 depleted cells.
- FIGs. ID Mbd3 +/+ EpiSCs
- & ⁇ 3 ⁇ / ⁇ EpiSCs FIG. IE
- FIG. 1F-G Mbd3 flox/" Rosa26-CreER +/" Nanog- GFP +/” cells are shown under phase microscopy (FIG. IF) and fluorescence microscopy (FIG. 1G). Note the homogenous reactivation of Nanog-GFP marker (FIG. 1G).
- FIG. 1H Single cell cloning efficiency and quantification for EpiSC reprogramming efficiency into naive ESCs from different mutant lines. Notably, pBRY-Mbd3 rescue constructs stably expressed in the indicated lines, reduced reprogramming efficiency back to those observed in Mbd3 +/+ WT cells.
- FIGs. II- J are Western blot analyses indicating Mbd3 expression levels in different mutant ES lines. Mbd3 flox/" cells had over 80% reduction in Mbd3 expression levels in comparison to Mbd3 +/+ cells. Mbd3 _/ ⁇ cells has complete absence of Mbd3 protein.
- FIGs. 1K-L are photographs of Agouti colored chimeras obtained from reprogrammed EpiSCs following Mbd3 depletion. Shown are two examples of chimeric mice generated after microinjection of reverted cells into naive pluripotency.
- FIG. 1M is a schematic illustration depicting generation of chimeras for the purpose of isolating day E8.5 PGCs.
- Mbd3 flox/" and Mbd3 +/+ ESC lines were targeted with Oct4-GFP reporter and injected into host chimeras.
- FIG. IN - a histogram depicting evaluation of generation of naive ES-like cells from PGCs.
- FIGs. 10-T are images depicting confocal immuno staining analysis for temporal Mbd3 expression in developing mouse embryos.
- FIG. 1R Morula stage
- FIG. IS Blastocyst at embryonic day 3.25
- FIG. IT Blastocyst at embryonic day 3.75.
- Arrows indicate polar body. Note the reduction in Mbd3 expression after fertilization, and how it gets re- expressed at the late blastocyst stage.
- Right panels represent enlargement of the highlighted dashed areas.
- FIGs. 2A-0 show derivation of ESCs from Mbd3 _/" blastocysts.
- FIG. 2A - a schematic illustration of generation of naive mouse ESCs. Mbd3 +/" heterozygous mice were mated, and ESCs were derived from blastocysts in naive defined 2i/LIF conditions. Mbd3 _/ ⁇ ESCs were obtained at expected Mendelian ratio.
- FIGs. 2B-C are images of the Mbd3 _/" ES cells initial colony at day 9 (FIG. 2B) and of the naive Mbd3 _/" ESCs established and imaged at passage 4 (FIG.
- FIGs. 2D-E Images of MBD3 wild type (+/+) and depleted (-/-) ESCs stained for alkaline phosphatase (AP) pluripotent stem cells marker. Note the significant AP staining in the MBD3 _/ ⁇ ESCs demonstrating they normally express stem cell markers.
- FIGs. 2H-0 are Western blot analyses for pluripotency markers of MBD3 wild type (+/+) or depleted (-/-) ESCs.
- FIGs. 3A-G depict genetically engineered systems for deterministic reprogramming in mouse cells.
- FIG. 3 A - The present inventors have established a reprogrammable mouse Mbd3 +/+ and Mbd3 flox/" iPSC lines carrying (1) an Oct4-GFP reporter, (2) mCherry constitutively expressed marker, (3) m2RtTa and (4) a TetO inducible OKSM polycistronic cassette. These lines were injected into host blastocysts, and their differentiated derivatives were re-isolated in vitro. Subsequently, reprogramming efficiency and progression can be analyzed following DOX induction. This exact system allows 6 day 100% reprogramming as shown in FIGs. 4A-0.
- FIGs. 3B-D photographs of isolated Mbd3 flox/" ESCs at phase contrast (FIG. 3B), and fluorescence microscopy.
- FIG. 3C staining for mCherry expression (red);
- FIG. 3D staining for Oct4-GFP expression (green).
- FIGs. 3E-F Western blot analyses using anti-Mbd3 (FIG. 3E) and anti Hsp90 (FIG. 3F) staining.
- FIG. 3G Southern blot analysis showing correct gene targeting of the Rosa26 locus with Cre-ER knock in construct introduced into Mbd3 flox/" ESCs.
- FIGs. 4A-P show deterministic and synchronized reprogramming of mouse fibroblasts into iPSCs following Mbd3 depletion.
- FIG. 4A - Mbd3 WT and depleted (flox/- or -/-) cells were directly infected with lentiviruses expressing a polycistronic OKSM cassette, and expanded in mouse naive 2i/LIF conditions. Reprogramming efficiency was evaluated by measuring percentage of Oct4-GFP + cells, and it was noted that of > 95% Oct4-GFP + levels was observed in Mbd3 depleted cells.
- FIG. 4A - Mbd3 WT and depleted (flox/- or -/-) cells were directly infected with lentiviruses expressing a polycistronic OKSM cassette, and expanded in mouse naive 2i/LIF conditions. Reprogramming efficiency was evaluated by measuring percentage of Oct4-GFP + cells, and it was noted that of > 95% Oct
- Reprogramming efficiency at day 10 was calculated by dividing the number of Oct4-GFP+ wells by mCherry+ wells (mCherry was used to normalize for plating efficiency). The 2i/LIF conditions were applied starting from day 2. Please note that in Mbd3 depleted samples (flox/- or -/-) all mcherry+ clones became Oct4-GFP + cells (indicated as green).
- FIGs. 4C-E depict immunostaining analyses of the Mbd3 +/+ iPSC (FIG. 4C), the Mbd3 flox/" iPSC (FIG. 4D) or the Mbd3 _/" iPSC (FIG. 4E) clones for the Oct4 (left), Nanog (middle) or Alkaline Phosphatase (AP) (right) pluripotency markers.
- FIGs. 4F-G are photographs of Agouti coat colored chimera (FIG. 4F) and germ-line transmission from Mbd3 flox/" iPSCs derived (FIG. 4G). This indicates that Mbd3 depleted iPSCs can give rise to adult chimeric animals following injection into host mice, and are pluripotent.
- FIGs. 4H-I are images depicting live imaging of reprogramming of Mbd3 (FIG. 4H) and Mdb3 (FIG. 41) cells, after plating 50 cells per well.
- FIGs. 4J-0 are images depicting immunofluorescence of Mdb3 +/+ (FIGs. 4J, 4K and 4L) or Mdb3 flox/ ⁇ (FIGs. 4M, 4N and 40) cells stained for mCherry (FIGs. 4J and 4M), Oct4-GFP (FIGs. 4K and 4N) and mCherry Oct4-GFP (FIGs. 4L and 40).
- mCherry+ and Oct4-GFP+ nearly >90% co-localize in Mbd3 flox/ ⁇ cells, and not in WT cells.
- FIGs. 4Q-R depict radically efficient and synchronized iPSC reprogramming to pluripotency.
- FIGs. 5A-F show comparative analysis of Mbd3 depleted somatic cell properties during reprogramming.
- FIG. 5A - A histogram depicting the results of RT-PCR analysis demonstrating relative transgene induction levels in different somatic cells (from BU-V19-OSKM transgenic reprogrammable systems) in the presence or absence of DOX as indicated. Results are presented with +/- s.d. (standard deviation) of 3 replicates per sample. Transgene induction level was not altered in Mbd3 depleted MEF or B cells on DOX for 8 days.
- FIGs. 5B-C Western blot analysis using anti heat shock protein 90 (Hsp90) (FIG. 5B) and anti-Mbd3 (FIG.
- FIG. 5C A histogram depicting the results of RT-PCR analysis demonstrating relative transgene induction levels in different somatic cells (from NGFP1 transgenic reprogrammable systems) in the presence or absence of DOX as indicated. Results are presented with +/- s.d. of 3 replicates per sample. Transgene induction level was not altered in Mbd3 depleted MEF (mouse embryonic fibroblasts) or B cells on DOX for 8 days.
- FIG. 5D A histogram depicting the results of RT-PCR analysis demonstrating relative transgene induction levels in different somatic cells (from NGFP1 transgenic reprogrammable systems) in the presence or absence of DOX as indicated. Results are presented with +/- s.d. of 3 replicates per sample. Transgene induction level was not altered in Mbd3 depleted MEF (mouse embryonic fibroblasts) or B cells on DOX for 8 days.
- FIG. 5E is a histogram depicting the results of a flow cytometry based detection of apoptosis in wild type and Mbd3 depleted MEFs and B cells following DOX induction. The results indicate that apoptosis levels were similar upon transgene induction in both cell samples.
- FIGs. 5A-E exclude changes or defects in transgene induction or proliferation as underlying causes for enhanced reprogramming in Mbd3 depleted somatic cells.
- FIGs. 6A-B show that Mbd3 deletion renders deterministic and complete reprogramming of multiple adult somatic cell types.
- Indicated somatic cells from NGFPl-control (FIG. 6A), NGFPl-Mbd3 KD [knockdown (KD)] (FIG. 6B) adult chimeras were isolated and subjected to single cell reprogramming and evaluation of Nanog-GFP expression after 8 days of DOX.
- EpiSC Epiblast stem cells
- NPC Neural precursors
- HSC Hematopoietic Stem Cell
- CMP Common Myeloid progenitor
- Monocytes - blood cells macrophages
- Pro-B lymphocytes Pro-B lymphocytes
- Mature B mature B lymphocytes
- Mature T mature T cells. Near 100% efficiency was obtained from all Mbd3 flox/" (Mbd3 -depleted) somatic cell types tested. Average of 2-3 independent experiments per each cell type is shown.
- FIG. 7 shows that Mbd3 depleted cells are completely reprogrammed and transcriptionally indistinguishable from ESCs/iPSCs by 8 days of DOX induction.
- Gene expression analysis was conducted on the indicated genetically matched mouse samples.
- Mbd3 flox/" but not Mbd3 +/+ , MEFs clustered differently from donor somatic MEFs only after 4 days of OKSM (DOX) induction.
- DOX OKSM
- FIGs. 8A-Q show deterministic and synchronized reprogramming following Mbd3 depletion in mouse and human cells.
- FIGs. 8A-D Images of Mbd3 flox/" (FIGs. 8A and 8C) and Mbd3 +/+ cells at day 8 (FIGs. 8A and 8B) or at passage 2 (FIGs. 8C and 8D). Note that colonies obtained following Mbd3 flox/" somatic cell reprogramming have ESC-like morphology and become GFP homogenous for Nanog expression at passage 1.
- FIG. 8E - A histogram depicting quantification of Nanog-GFP positive cells.
- FIGs. 8F-K show flow cytometry analyses of a partially reprogrammed cell clone containing OSKM transgenes, without reactivation of the Oct4-GFP reporter following treatment with: FIG. 8F - untreated; FIG. 8G - scrambled siRNA day 20; FIG. 8H - untreated day 20; FIG. 81 - 5-aza + TSA Day 20; FIG. 8J - Mbd3 siRNA Day 5; FIG. 8K - Mbd3 siRNA Day 6.
- Mbd3 knockdown resulted in complete and rapid completion of reprogramming.
- FIG. 8L Mbd3 flox/" human ES cells were generated by genetic engineering with TALE nuclease effectors. Targeting strategy for a floxed conditional allele is shown.
- FIGs. 8M-N Western blot analyses of correctly targeted ⁇ 03 ⁇ /" clone, based on southern blot verification, using anti-MBD3 antibody (FIG. 8M) or anti-HSP90 antibody (FIG. 8N).
- FIG. 80 - MBD3 +/+ and MBD3 flox/" iPSCs carrying DOX inducible OKSM transgene were labeled with constitutively expressed mCherry and targeted with an OCT4-GFP knock-in allele.
- In vitro differentiated fibroblasts from the latter lines were reprogrammed as indicated in the scheme.
- 98-100% of human Mbd3 flox/" fibroblasts become GFP+ IPSCs after 8 days of transgene induction.
- FIGs. 8P-Q Images of MBD3 flox/" cells in WIS-NHSM medium. MBD depleted human pluripotent stem cells have a dramatic round mouse-ESC like morphology and grow homogenously. These results indicate that Mbd3 inhibition might further improve WIS-NHSM naive growth conditions (described herein).
- FIGs. 8R-S Alleviating Mbd3 expression facilitates transition to ground state pluripotency in mouse and human cells.
- OKSM DOX
- FIG. 8S Monoclonal lines established from Mbd3 +/+ and flox/" secondary cells and reprogrammed in 2i-LIF + DOX. Fraction of pre-iPS clones that did not reactivate Oct4 or Nanog GFP markers (either SSEA1 positive or negative) is shown. GFP negative clones could not be established from Mbd3 depleted cells, as they all became fully reprogrammed already by day 10.
- FIG. 9 is schematic presentation of evolutionary analysis of the NuRD complex and other associated proteins.
- the present inventors assigned orthologs for many human proteins that are either known to be part of the NuRD complex (or are related to these proteins), from 15 representative metazoan species (mouse - M.musculus, platypus - O.anatinus, zebra finch - T.guttata, chicken - G.gallus, frog - X. tropicalis, zebrafish - D.rerio, pufferfish - T.nigroviridis, lancelet - B.floridae, sea urchin - S.purpuratus, mosquito - A.gambiae, fruit fly -D.
- T. adhaerens melanogaster, honeybee - A.mellifera, beetle - T.castaneum, sea anemone - N. vectensis, trichoplax - T. adhaerens), and the yeast S.cerevisiae, as an outgroup.
- the last metazoan in this list - T. adhaerens represents a basal group of metazoan, and is used to study the origins of animal multicellularity. Proteins that have an ortholog in T. adhaerens were likely to be present in the basal multicellular animals, while proteins that appear in yeast precede animal multicellularity.
- the color scale indicates degree of homology, i.e., percentage of sequence similarity between proteins.
- FIGs. 10A-P demonstrate that siRNA inhibition of MBD3 promotes human iPSC reprogramming by OSKM.
- FIG. 10A - A schematic illustration depicting secondary human reprogrammable fibroblasts carrying DOX inducible OSKM transgenes, being subjected to the depicted reprogramming protocol with DOX.
- FIG. 10B anti MBD3 antibody
- IOC anti-Hsp90 antibody
- FIG. 10D In WIS- NHSM growth conditions, Knockdown of Mbd3 at days 2 and 4, but not with scrambled control siRNA, dramatically increased the formation of alkaline phosphatase-i- iPSC clones.
- FIG. 10E Schematic illustration of a single round reprogramming. Human fibroblasts are subject to treatment with MBD3 siRNA at 7 and 2 days prior to mRNA transfection with the OSKM and Lin28 factors.
- FIGs. lOF-0 are images of the formed iPSCs.
- FIG. 10F Day 7 iPS colony, passage 0;
- FIGs. 10I-J - IPSCs (Passage 7) stained with Dapi (blue, nuclear staining) (FIG. 101) and with OCT4 (red) (FIG. 10J); FIGs. 10L-M - IPSCs (Passage 10) stained with Dapi (blue, nuclear staining) (FIG. 10L) and with Nanog (red) (FIG. 10M); FIGs. lON-0 - IPSCs (Passage 10) stained with Dapi (blue, nuclear staining) (FIG. 10N) and with TRA1-60 (green) (FIG. 10O); FIGs. 10H, 10K and 10P - histological staining of cells differentiated from the iPSCs.
- FIGs. 11A-P demonstrate mechanisms of Mbd3 function and influence on reprogramming to pluripotency.
- FIGs. 11A-H are immunoblot analyses using anti MBD3 antibody (FIGs. 11A-D) or anti-FLAG antibody (FIGs. l lE-11). Constructs encoding Flag-tagged OCT4 (FIGs. 11A and HE), or KLF4 (FIGs. 11C and 11G) or SOX2 (FIGs. 1 IB and 1 IF) or HDAC1 (used as a positive control; FIGs. 1 ID and 11H) were transfected into HEK293T cells in combination with MBD3.
- the cell lysates were immunoprecipitated (IP) with an anti-Flag antibody (or anti-IgG as control), followed by an immunoblot analysis (IB).
- IB immunoblot analysis
- the expression levels in whole-cell lysates or IP extract were determined by IB anti-Flag (FIGs. 11E-H) or anti-Mbd3 (FIGs. 11A-D).
- IB anti-Flag FIGs. 11E-H
- anti-Mbd3 FIGs. 11A-D
- FIGs. 11I-P - are immunoblot analyses using anti MBD3 antibody (FIGs. 11I-L) or anti-FLAG antibody (FIGs. 11M-P). Reproducing the experiment in FIGs. 11A-H, but by overexpressing of Mbd2, instead of Mbd3.
- FIGs. 11L and I IP Constructs encoding Flag-tagged OCT4 (FIGs. I ll and 11M), or KLF4 (FIGs. UK and 110) or SOX2 (FIGs. 11J and UN) or HDAC1 (used as a positive control; FIGs. 11L and I IP) were transfected into HEK293T cells in combination with MBD2. This analysis demonstrated lack of enriched or specific interaction for MBD2 with reprogramming factors OSK. These results indicate that Mbd3 directly interacts with reprogramming pluripotency factors, and thus by recruiting the NuRD complex, it inhibits their activity and prevents the reactivation of their downstream target genes.
- FIGs. 12A-V demonstrate in vitro stabilization of transgene independent and long-term stable naive human pluripotent cells.
- FIG. 12A - A schematic illustration depicting the strategy used for calibrating conditions to isolate naive transgene independent iPSCs in the presence of ERK inhibition.
- the present inventors used C2 human iPSC line carrying DOX-inducible lentiviruses (TetO) encoding Oct4, Sox2, Klf4 and c-Myc. This cell line was targeted with TALE effector nuclease to insert a GFP-2A-Puro allele in the endogenous OCT4 locus.
- TALE DOX-inducible lentiviruses
- GFP+ C2 cells can be grown in 2i/LIF conditions but only with the presence of DOX, and approximately 60% of correctly targeted clones specifically expressed GFP.
- the present inventors screened for addition of small molecule factors and cytokines that allow obtaining Oct4-GFP positive cells in the absence of DOX and presence of ERK inhibition. Two Pools of combined factors were used for the screen as indicated. Pool 1: ERKi, GSK3 i, LIF, BMP4, IGF, P38L JNKi, Forskolin. Pool 2: FGFi, TGFi, Kenpaullone, Go6983, BayK8644, Bixl294, ROCKi and SCF.
- FIG. 12E A histogram depicting percentage of Oct4-GFP + colonies on day 20 relative to control cells in the presence of different combinations of factors as indicated.
- Cells were expanded in the 14F + bFGF/TGF i medium which includes the 14 factors [which are the 16 factors of pools 1 and 2, yet without inhibitors of FGF and TGF pathways] and with TGF i and bFGF.
- FIG. 12F A histogram depicting percentage of Oct4-GFP+ colonies on day 8 relative to control cells.
- Knockout serum replacement can be substitute only with using N2 supplement and either 1% albumax or 1% Defined fatty acid mix concentrate (FAA) (Invitrogen).
- FIG. 12G Summary of essential elements calibrated to expand human naive pluripotent cells for long term and without exogenous transgenes. This media is termed WIS-NHSM (Weizmann Institute of Science- Naive Human Stem cell Medium).
- FIG. 12H A histogram depicting percentage of Oct4-GFP+ colonies on day 8 relative to control cells grown under various conditions as indicated.
- FIG. 121 Karyotype of transgene independent CI naive pluripotent cell line in WIS-NHSM media.
- FIGs. 12J phase contrast
- FOG. 12K fluorescence
- FIGs. 12L-N are images depicting morphological staining of teratoma formation from the C2 iPS clone line shown in FIGs. 12I-K. Note the differentiation into cells of the mesoderm (FIG. 12L), endoderm (FIG. 12M) and ectoderm (FIG. 12N) embryonic germ layers, demonstrating the pluripotency of the naive C2 iPSC cell line.
- FIGs. 120-R are images depicting iPSCs that were derived from BJ fibroblasts. Human naive iPSCs can be directly formed from human BJ fibroblasts, following direct infection with an OKSM polycistronic cassette delivered by a lentivirus.
- FIG. 120 phase contrast of iPSC colonies at day 6 DOX in WIS-NHSMP3 medium; FIG. 20P - phase contrast of BJ iPSC at passage 3; FIG. 12Q - fluorescent microscopy showing Nanog expression (green staining) of BJ fibroblasts derived iPS cells at passage 8. The inset shows DAPI staining (blue); FIG. 12R - fluorescent microscopy showing SSEA4 expression (red staining) of BJ iPSC cells at passage 13. The inset shows DAPI staining (blue); Altogether, FIGs. 120-R show that the established BJ iPSC line expressed all pluripotency marker tested. FIG.
- FIG. 12S - Cells were expanded in the presence of bFGF/TGFp and Pooll factors, and the essential factors required for maintaining OCT4-GFP+ cells in the absence of DOX were determined by screening for loss of GFP upon withdrawal of these components (green font).
- FIG. 12T Summary of essential elements calibrated to expand human naive pluripotent cells for long term and without exogenous transgenes. This optimized media is termed WIS-NHSM (Weizmann Institute of Science- Naive human Stem cell Medium).
- FIG. 12U Components of optimized WIS-NHSM conditions.
- FIG. 12V Representative large-field view of OCT4-GFP+ hiPSC colonies grown in WIS-NHSM media.
- FIGs. 13A-W demonstrate the derivation of human naive iPSCs and ESCs from already established primed/conventional ESCs lines or blastocysts.
- FIG. 13A - A schematic illustration depicting epigenetic reversion of primed/conventional human ESCs to ground state naive state, and without genetic modifications.
- Primed already established cell line HI, H9, BGOl, WIBR2, WIBR3 hESCs and CI, C2 iPSCs were plated on gelatin/vitronectin-coated plates and grown in WISNHSM conditions. Within 5 days, many cells differentiate, but round dome colonies emerge.
- FIGs. 13B-E are microscopic phase contrast images.
- FIG. 13D - BGOl cell line on day 5 in the WIS-NHSM medium;
- FIG. 13E BGOl cell line at passage 31.
- FIGs. 13F-J are microscopic images demonstrating expression of pluripotent markers by naive BGOl, as a representative example.
- FIGs. 13F-J demonstrate that the naive pluripotent stem cells (PSCs) express all known human pluripotent markers, and retain a normal 46XY male karyotype after many passages in the absence of exogenous transgenes. All naive lines described here in show no signs of deterioration, crisis or decay with expansion (for over 70 passages thus far).
- FIG. 13K-M are images depicting morphological staining of teratomas formed from the naive PSCs. Shown are cells of the mesoderm (FIG. 13K), ectoderm (FIG. 13L) and endoderm (FIG. 13M) embryonic germ layers, demonstrating that the naive PSCs are pluripotent as shown by their ability to generate differentiated teratomas in vivo.
- FIG. 13N - a schematic illustration depicting generation of a human naive PSC from a blastocyst. A Human ICM-blastocyst was plated on feeder cells in WIS-NHSM conditions.
- FIG. 130 Images depicting phase contrast microscopy of a naive PSC at passages 0 (day 6) and 3, formed from a human blastocyst that was cultured in WIS-NHSM medium.
- FIG. 13P images of a fluorescence microscopy showing a naive WIS 1 hESC stained with Hoechst (upper panel, blue staining), nanog (second from top panel, green staining), SSEA4 (third from top panel, red staining), and a merged image of the Hoechst, Nanog and SSEA4 (bottom panel).
- FIG. 13Q images of a fluorescence microscopy showing a naive WIS 1 hESC stained with Hoechst (upper panel, blue staining), OCT4 (green staining, middle panel), and a merged image of Hoechst and OCT4 (bottom panel).
- FIG. 13Q images of a fluorescence microscopy showing a naive WIS 1 hESC stained with Hoechst (upper panel, blue staining), OCT4 (green staining, middle panel), and a merged image of Hoechst and OCT4 (bottom panel).
- FIG. 13P-U demonstrate that the naive WIS 1 hESC line is pluripotent based on pluripotency marker expression (FIGs. 13P-R) and teratoma differentiation in vivo (FIGs. 13S-U).
- FIG. 13V - Naive hiPSCs can be directly formed from human BJ fibroblasts, following reprogramming with mRNA transfection in WIS- NHSM conditions. Note distinct domed colony emerging 10 days after factor transduction.
- FIG. 13W - Naive hiPSCs can be directly formed from human BJ fibroblasts in WIS-NHSM conditions.
- FIGs. 14A-D are images (phase contrast microscopy) depicting the morphology of genetically matched naive and primed human pluripotent cell lines.
- FIGs. 14A-B Representative images showing distinct morphology for embryo -derived naive hESCs in WIS-NHSM conditions (Marked as "WIS 1 hESC”, “WIS2 hESC”, “LIS 1 hESC” and “LIS2 hESC” grown on feeder cells (FIG. 14B) or without feeder cells (FIG. 14A).
- FIGs. 14C-D Representative images showing distinct morphology for conventional/primed pluripotent cells lines (FIG.
- Naive cells display a more domed morphology and with a less distinct cell-cell boundary.
- P indicates the passage number.
- P indicates number of passages already achieved in naive WIS-NHSM conditions.
- P includes number of passages already achieved in naive WIS-NHSM conditions (6 passages) and in primed conditions.
- FIGs. 15A-M demonstrate signaling state and karyotype of human naive iPSCs and ESCs.
- FIG. 15C HSP90; FIG. 15D - Total p38; FIG. 15E - pP38 180,182; FIG. 15F -
- WIBR3 naive hESCs that are grown in WIS-NHSM conditions show specific blocked and reduced activity for ERK1, P38 and JNK in naive pluripotency.
- FIGs. 15H-I are karyotypes of different naive human ESCs and iPSCs.
- FIGs. 15N-S demonstrate karyotype and clonal stability of human naive pluripotent cells. Shown are representative karyotype analysis results indicating normal karyotypes of different naive hESC and hiPSCs. FIG. 15N - CI naive hiPSC; FIG. 150
- FIG. 15P WIBR3 naive hESC
- FIG. 15Q - BG01 naive hESC
- FIG. 15R - LIS 1 naive hESC FIG. 15S - LIS2 naive hESC.
- the passage number (p) at which cells were harvested for karyotyping is indicated.
- FIGs. 16A-H are images depicting immunostaining analyses for pluripotency markers on naive WIBER3 hESCs.
- FIG. 16A Hoechst (blue staining, left panel), TRA1-80 (green staining, middle panel), and a merged image (right panel);
- FIG. 16B Hoechst (blue staining, left panel), TRA1-80 (green staining, middle panel), and a merged image (right panel);
- FIG. 16C Hoechst (blue staining, left panel), KLF4 (red staining, middle panel), and a merged image (right panel);
- FIG. 16A Hoechst (blue staining, left panel), TRA1-80 (green staining, middle panel), and a merged image (right panel);
- FIG. 16C Hoechst (blue staining, left panel), KLF4 (red staining, middle panel), and a merged image (right panel);
- FIG. 16D Hoechst (blue staining, left panel), KLF4 (red staining, middle panel), and a merged image (right panel);
- FIG. 16E Hoechst (blue staining, left panel), SSEA1 (middle panel), and a merged image (right panel);
- FIG. 16F Hoechst (blue staining, upper panel), TRA1-60 (green staining, second panel), Nanog (red staining, third panel), and a merged image (bottom panel);
- FIG. 16G Hoechst (blue staining, upper panel), E-cadherin (green staining, second panel), Oct4 (red staining, third panel), and a merged image (bottom panel);
- FIGs. 17A-H are images depicting immunostaining analyses for pluripotency markers on naive CI hiPSC.
- FIG. 17A Hoechst (blue staining, left panel), TRA1-80 (green staining, middle panel), and a merged image (right panel);
- FIG. 17B Hoechst (blue staining, left panel), TRA1-80 (green staining, middle panel), and a merged image (right panel);
- FIG. 17C Hoechst (blue staining, left panel), KLF4 (red staining, middle panel), and a merged image (right panel);
- FIG. 17A Hoechst (blue staining, left panel), TRA1-80 (green staining, middle panel), and a merged image (right panel);
- FIG. 17C Hoechst (blue staining, left panel), KLF4 (red staining, middle panel), and a merged image (right panel);
- FIG. 17D Hoechst (blue staining, left panel), Nanog (red staining, middle panel), and a merged image (right panel);
- FIG. 17E Hoechst (blue staining, left panel), SSEAl (middle panel), and a merged image (right panel);
- FIG. 17F Hoechst (blue staining, upper panel), TRAl-60 (green staining, second panel), Nanog (red staining, third panel), and a merged image (bottom panel);
- FIG. 17G Hoechst (blue staining, upper panel), E-cadherin (green staining, second panel), Oct4 (red staining, third panel), and a merged image (bottom panel);
- FIGs. 18A-F are images depicting immunostaining analyses for pluripotency markers on naive C2 hiPSC (FIGs. 18A-F).
- FIG. 18A Hoechst (blue staining, upper panel), KLF4 (red staining, second panel), and a merged image (bottom panel);
- FIG. 18B Hoechst (blue staining, upper panel), TRA1-81 (yellow staining, second panel), and a merged image (bottom panel);
- FIG. 18C Alkaline phosphatase (AP; upper panel), Hoechst (blue staining, second panel), SSEAl (third panel), and a merged image (bottom panel);
- FIG. 18D Hoechst (blue staining, upper panel), TRAl-60 (yellow staining, second panel), Nanog (red staining, third panel), and a merged image (bottom panel);
- FIG. 18E Hoechst (blue staining, upper panel), E-cadherin (green staining, second panel), Oct4 (red staining, third panel), and a merged image (bottom panel);
- FIG. 18D Hoechst (blue staining, upper panel), TRAl-60 (yellow staining, second panel), Nanog (red staining, third panel), and a merged image (bottom panel);
- FIG. 18E Hoechst (blue staining, upper panel), E-cadherin (green staining, second panel), Oct4 (red staining, third panel), and a merged image (bottom panel);
- FIGs. 19A-I are images demonstrating the in vitro differentiation potential of human naive ESCs and iPSCs. Shown are images for day 6 EB structures from the indicated cell lines (defined by name and passage number). Images indicate differentiated embryonic body structures.
- FIG. 19F Naive WIS 1 EBs (passage 13);
- FIGs. 19J-0 - qRT-PCR analysis for expression of lineage differentiation markers (FIG. 19J - BRACHYURY; FIG. 19K - SOX17; FIG. 19L - PAX6; FIG. 19M - AFP; FIG. 19N - SOX1) and a pluripotency marker (FIG. 190 - OCT4).
- EBs were generated from the following cell lines: WIBR3 ESC, HI ESC, BG01 ESC, CI iPSC, C2 iPSC, WIS 1 ESC, WIS2 ESC, LIS 1 ESC and LIS2 ESC. All cell lines tested showed marked upregulation of lineage commitment genes and down regulation of OCT4 pluripotency marker, consistent with lineage differentiation. Relative qRT-PCR expression levels were normalized to levels expressed in naive pluripotent cells prior to differentiation.
- FIGs. 20A-L are images demonstrating the in vivo differentiation potential of human naive ESCs and iPSCs.
- Human naive iPSCs and ESCs expanded in WIS-NHSM conditions for the indicated number of passages. The cells were harvested and injected in immune-deficient mice subcutaneously, and examined for teratoma formation.
- FIG. 20A Naive WIBR3 hESC (Passage 9);
- FIG. 20F Naive H9 hESC (passage 20); FIG. 20G - Naive WIBR1 hESC (passage 21); FIG. 20H - Naive C2 hiPSC (passage 41); FIG. 201 - Naive CI hiPSC (passage 51); FIG. 20J - Naive BJ1 hiPSC (passage 25); FIG. 20K - Naive LIS 1 hESC (Passage 9); FIG. 20L - Naive LIS2 hESC (passage 9). All tested lines gave rise to well differentiated mature teratomas with cells from the three germ lineages: endoderm, mesoderm and ectoderm. "P" indicates passage number in WIS-NHSM conditions at which cells were harvested and injected.
- FIGs. 20M-T Individual subcloned naive lines from WIBR3 (FIGs. 20M-P) and BGOl (FIGs. 20Q-T) hESC lines (sub clones numbered 1-4) were also found pluripotent with competency to form mature teratomas.
- FIGs. 21A-L demonstrate distinct signaling dependence and response for human naive ESCs/iPSCs that resembles murine ESCs/iPSCs. Shown are histograms depicting colony formation of pluripotent cell lines in various media. Cell populations were equally divided and plated on gelatin/vitronectin coated plates in the indicated growth medium in which these cell lines are normally maintained (mouse naive cells in a medium containing 2i/LIF, naive hESCs/iPSCs in a WIS-NHSM medium, mouse EpiSCs and human primed ESCS/iPSCs in a KSR/bFGF/TGF medium). 36 hours later the wells were supplemented with the indicated inhibitors or growth factors.
- FIG. 21 A - Naive 129 mESC; FIG.
- FIG. 21B Primed 129 mEpiSC; FIG. 21C - Naive WIBR3 hESC; FIG. 21D - Primed/conventional WIBR3 hESC; FIG. 21E - Naive CI hiPSC; FIG. 21F - Primed/conventional CI hiPSC; FIG. 21G - naive CI hESC; FIG. 21H - primed CI hESC; FIG. 211 - Naive WIS 1 hESC; FIG. 21 J - Primed WIS 1 hESC; FIG. 21K - LIS 1 hESC; FIG. 21L - primed LIS 1 hESC.
- human naive ESCs remain pluripotent in the presence of different ERK, GSK3 and RAF inhibitors.
- Human naive pluripotent cells do not differentiate in response to BMP4 (up to 5-10 ng/ml BMP4) or forskolin supplementation.
- Primed human ESCs/iPSCs differentiated upon ERK, GSK3b, RAF inhibition, or stimulation with BMP4 or forskolin.
- naive human ESCs/iPSCs are unique from any previously reported naive pluripotent lines, in that they rely on LIF and bFGF/TGF signaling (together with presence of multiple ERK, p38 and JNK inhibitors).
- FIGs. 22A-K demonstrate unique signaling requirement and response for naive hESCs/iPSCs.
- Naive hESCs/iPSCs grown in WIS-NHSM conditions supplemented with 5 ng/ml BMP4 remain pluripotent, and can differentiate into teratomas in vivo. Shown are images of morphological staining the teratomas formed by the naive PSCs.
- FIGs. 22D-F - Naive CI hiPSC [Passage 25 with BMP4 (5 ng/ml)];
- FIG. 22G Naive HI constitutively active Stat 3 (expanded under "naive conditions" WIS-NHSM conditions without LIF).
- FIG. 22H Naive WIS l-Stat3-CA (expanded in naive WIS-NHSM conditions without LIF). Note differentiation into endoderm (FIGs. 22A, 22D, 22G (left panel) and 22H (left panel)), mesoderm (FIGs. 22B, 22E, 22G (middle panel), and 22H (middle panel)) and ectoderm (FIGs. 22C, 22F, 22G (right panel) and 22H (right panel)) embryonic germ layers.
- FIGs. 22A, 22D, 22G (left panel) and 22H (left panel) mesoderm
- FIGS. 22B, 22E, 22G (middle panel) mesoderm
- ectoderm FIGS. 22C, 22F, 22G (right panel) and 22H (
- FIG. 22I-K are immunofluorescence images depicting expression of pluripotent markers in naive hESCs/iPSCs carrying a constitutively activate Stat3 mutant.
- FIG. 221 Hoechst (blue staining, upper panel), Nanog (green staining, second panel), SSEA4 (red staining, third panel), and a merged image (bottom panel);
- FIG. 22J Hoechst (blue staining, upper panel), Oct4 (green staining, second panel), and a merged image (bottom panel);
- FIG. 22K Hoechst (blue staining, upper panel), SSEA3 (green staining, second panel), and a merged image (bottom panel).
- naive hESCs/iPSCs carrying a constitutively activate Stat3 mutant remain pluripotent in the absence of exogenous LIF from WIS-NHSM media, based on teratoma formation and immunostaining for pluripotency markers.
- naive hESCs/iPSCs described herein share defining features with rodent naive PSCs in their dependence on LIF/Stat3 signaling to remain pluripotent in WIS-NHSM conditions, and tolerance for exogenous BMP4 cytokine, at least at low levels of BMP4 up to 5 ng/ml - 10 ng/ml as tested herein.
- FIGs. 23A-D demonstrate that female Naive hESCs/iPSCs retain a unique pre-X inactivation state in WIS-NHSM conditions.
- FIGs. 23A - Shown are bisulfite sequencing analyses of six CpG sites in single clones of an XIST promoter amplicon (lower panels). Note that in naive cells both alleles are demethylated, while in primed cells one of the alleles becomes silenced. Methylation of Oct4 locus CpG are shown as controls (upper panels).
- FIG. 23B - A histogram depicting quantification of an RT-PCR analysis of the XIST transcript in various naive and somatic cells.
- FIGs. 23C-D Immuno-fluorescence analysis showing presence of H3K27me3/polycomb bodies.
- FIG. 23C Naive WIBR3 hESC;
- FIG. 23D Differentiated cells from naive WIBR3 hESC. Note the trace numbers of cells that were found to have H3K27me3/polycomb bodies in nuclei of naive cells (FIG. 23C) as compared to the significant presence of H3K27me3/polycomb bodies in the differentiated cells therefrom.
- FIGs. 24A-C demonstrate that the naive human ESCs/iPSCs exhibit a distinct transcriptional program.
- FIG. 24A Hierarchical clustering of differentially expressed genes on different conventional/primed and naive hESC/hiPSC lines as indicated. Note how all naive hESCs/iPSCs clustered independently from all primed samples. Note how naive WIBR3 hESCs, when transferred again (re-primed) into conventional primed growth conditions, cluster with all other primed samples indicating that these states are interconvertable by growth conditions.
- FIGs. 24B-C Histograms of surface expression of MHC class I using FACS analysis on the indicated naive and primed cell lines.
- FIG. 24A Hierarchical clustering of differentially expressed genes on different conventional/primed and naive hESC/hiPSC lines as indicated. Note how all naive hESCs/iPSCs clustered independently from all primed samples. Note how n
- 293HEK cells were used as a control for differentiated cells (that typically express high MHC class I levels).
- Median Fluorescence Intensity (MFI) values are indicated. This shows that naive cells express no/low levels of MHC class I, while primed cells express medium and higher levels of MHC class I. No stain curves for each cell line are also included to have accurate controls for the MHC class I stained samples.
- MFI Median Fluorescence Intensity
- FIGs. 25A-M demonstrate presence of a unique Oct4 enhancer utilization in naive hESCs/hiPSCs.
- FIG. 25 A - A histogram depicting evaluation of human Oct4 distal enhancer and proximal enhancer reporter gene activity in the indicated pluripotent cell lines. Baseline activity was analyzed by transfecting with an empty vector. Predominant utilization of distal enhancer is clearly evident in hESCs/iPSCs grown in naive WIS-NHSM conditions.
- FIGs. 25B-M flow cytometry analyses of WIBR3 hESCs that were stably transfected with either: 1) Oct4-GFP-2A reporter that marks all types of pluripotent cells [naive and primed; (FIGs.
- FIGs. 25F-G and 25L-M - cells grown in a differentiation medium cells were subjected to flow cytometry analyses after 21 days in a differentiation medium, when the cells were differentiated into fibroblasts.
- detaPE-Oct4-GFP reporter is more active in naive WIS-NHSM conditions (FIG. 25H), relative to primed/conventional conditions (FIG. 25J), or to cells differentiated into fibroblasts (FIG. 25L).
- delatDE-OCT4-GFP reporter is active in primed/conventional conditions (FIG.
- FIGs. 26A-K depict cross species mouse-human chimeric embryos.
- FIGs. 26A-C - shown are images demonstrating that naive human iPSCs can contribute to mouse development in vivo.
- Human naive C2 iPSCs were constitutively labeled with GFP and BCL-2 overexpression vector. Cells were aggregated with developing mouse embryo morulas, and 24 hours GFP cells were viable in developing early mouse embryos. These results indicate that human naive cells grown in WIS-NHSM conditions can contribute to cross-species chimeric organisms.
- FIG. 26D-K show how GFP labeled human naive iPSCs can be injected into E2.5 mouse morulas, and remain integrated in blastocysts at E3.5.
- FIG. 26D - loading of human naive GFP+ (positive) iPSCs
- FIG. 26E injection of the cells shown in FIG. 26D into mouse morula
- FIGs. 26F-H show the injected cells into the mouse morula at the day of injection (Inj.) under bright field (FIG. 26F), EGFP (Enhanced Green Fluorescent Protein) (FIG. 26G) and a merged image (FIG. 26H).
- FIGs. 26I-K show the injected cells into the mouse morula at one day after injection.
- FIG. 261 bright field
- FIG. 26K Merged image.
- FIG. 27 depicts the nucleic acid sequence of the XIST amplicon (SEQ ID NO:70) formed using bisulfite sequencing according to some embodiments of the invention, with the CpG islands highlighted in yellow. Note that in the shown amplicon there are six CpG islands.
- FIGs. 28A-C depict nuclear/cytoplasm ratio in the expression level of transcripts in naive human ESCs.
- FIGs. 28A-B - Naive and primed hESCs were double immunostained for TFE3 and OCT4. Cells were counter- stained for DAPI (nuclear staining). Representative confocal images are shown for primed LIS2 hESC line and naive LIS2 hESC line. Insets are enlargements of the dashed boxes. Predominant nuclear localization was observed in naive hESCs but not in cells grown under primed conditions.
- FIG. 28C - Quantitative unbiased imaging analysis for preferential nuclear localization was conducted on randomly selected 200 cells from independent image frames per sample.
- FIGs. 29A-D depict epigenetic configuration of human naive pluripotency.
- FIGs. 29A-B are immunostaining analyses for OCT4 and DNMT3B [DNA (cytosine-5-)- methyltransferase 3 beta] in human naive (FIG. 29B) and primed (FIG. 29A) cells. Human naive cells down-regulate DNMT3B protein expression, but not OCT4 protein expression.
- FIGs. 29C-D are histograms of the change in methylation between primed and naive samples in human and mouse. The histograms depict the distribution of the per-CpG difference in methylation, calculated for all CpGs residing in CpG rich regions (>4% CpG content) and having a coverage of >10x in both samples. For clarity, only CpGs with a non-zero change in methylation are included in the histogram. The distribution is left-skewed, indicating a general reduction in methylation in the naive samples.
- FIGs. 30A-I depict DNA methylation changes in human naive pluripotency.
- FIGs. 30A-C are Western blot analyses for DNMT3A (FIG. 30A), DNMT3B (FIG. 30B) and HSP90 (FIG. 30C) levels in human primed and naive ESCs/iPSCs. Note the significant downregulation of the expression levels of DNMT3A (FIG. 30A), DNMT3B (FIG. 30B) in the naive human PSCs as compared to primed PSCs.
- FIG. 30D Histogram of the change in methylation between primed WIBR3 cells and naive LIS2 cells.
- the histogram depicts the distribution of the per-CpG difference in methylation, calculated for all CpGs residing in CpG rich regions (>4% CpG content) and having a coverage of >10x in both samples. For clarity, only CpGs with a non-zero change in methylation are included in the histogram.
- the bar-plot on the right counts the number of CpGs in which this difference exceeds two standard-deviations, and the naive sample has lower methylation (blue) or the primed sample has lower methylation (green).
- the dotted line indicates the expected number of CpGs with a difference that exceeds two standard deviation assuming a normal distribution.
- FIG. 30E The same analysis as in FIG.
- FIG. 30F Composition of naive WIS-NHSM medium that is devoid of FGF2 and TGFB cytokines, and instead retains PKCi, FGFRi and TGFRi.
- the medium includes: LIF (20 ng/ml), ERKl/2i (PD0325901 1 ⁇ ), GSK3pi (CHIR99021 3 ⁇ ), JNKi (SP600125 10 ⁇ ), P38i (BIRB796 2 ⁇ ), FGFRi (PD173074 0.2 ⁇ ), TGFpl (8 ng/ml) +/- ROCKi (Y27632 2 ⁇ ).
- FIG. 30G - Human naive iPSCs and ESCs expanded for 8 days under these conditions show dramatic reduction in total methylated cytosine levels (mdC), as determined by LC-MS quantitative analysis and normalized to dG abundance levels.
- FIG. 30G - Human naive iPSCs and ESCs expanded for 8 days under these conditions show dramatic reduction in total methylated cytosine levels (mdC), as determined by LC-MS quantitative analysis and normalized to dG abundance levels.
- FIG. 301 Relative methylation of FMRl promoter region in naive and primed human iPSCs derived from Fragile X male patient fibroblasts. Naive human Fragile X iPSCs show predominant loss of methylation at FMRl promoter in Fragile X patients. * t-test P value ⁇ 0.05.
- FIGs. 31A-E depict numerical description of direct iPSC reprogramming following Mbd3 depletion.
- FIG. 31A Secondary NGFPl-control (Mbd3 +/+) , Nanog over expression (NGFPl-Nanog OE ) and Mbd3 depleted (NGFP 1 -Mbd3 ⁇ )
- Pre-B cells were subjected to DOX reprogramming and measured weekly using FACS (for monoclonal wells), and also with daily polyclonal Nanog-GFP follow-up in the first 8 days of reprogramming.
- FIGs. 31B-C Cumulative percentage of Nanog-GFP+ wells versus time on DOX, measured for various clonal B -cell-derived populations.
- NGFPl- control, NGFPl-Nanog OE and NGFPl-Mbd3 KD latencies show distinctly different cumulative distributions.
- FIG. 3 IB days on DOX
- FIG. 31C Cell divisions on DOX.
- FIGs. 31D-E Fitting of NGFPl-control (FIG. 3 ID) and NGFPl-Mbd3 KD (FIG. 3 IE) reprogramming latencies (measured in days) to a deterministic step function model, using adjusted R (see details in methods) statistics for goodness of fit.
- FIGs. 32A-H depict mechanisms for Mbd3 inhibitory effect on OSKM during reprogramming to pluripotency.
- FIGs. 32A-B - Constructs encoding Flag-tagged OCT4, c-MYC, KLF4, SOX2, NANOG or HDAC1 (used as a positive control) were transfected into HEK293T cells in combination with Mbd3.
- the cell lysates were immunoprecipitated (IP) with an anti-Flag antibody (or anti-IgG as control), followed by an immunoblot analysis (IB).
- IB immunoblot analysis
- the expression levels in whole-cell lysates or IP extract were determined by IB with anti-Flag (FIG. 32B) or anti-Mbd3 (FIG. 32A).
- FIG. 32C Functional enrichment of Mbd3 direct targets as was measured in somatic MEFs before and after OSKM induction.
- FIG. 32D Functional enrichment of ⁇ 2 ⁇ (Chd4) direct targets as was measured in somatic MEFs before and after OSKM induction. Color levels indicate enrichment -values (calculated using Fisher exact test) that pass FDR threshold of 0.0001%. White indicates enrichments falling below that threshold.
- FIG. 32C Functional enrichment of Mbd3 direct targets as was measured in somatic MEFs before and after OSKM induction.
- FIG. 32D Functional enrichment of ⁇ 2 ⁇ (Chd4) direct targets as was measured in somatic MEFs before and after OSKM induction.
- Color levels indicate enrichment -values (calculated using Fisher exact test) that pass FDR threshold of 0.0001%.
- White indicates enrichments falling below that threshold.
- FIG. 32G Reprogramming efficiency of Mbd3 flox/" MEFs after infection with lentiviruses encoding wild-type and different mutant Mbd3 inserts as indicated in the panel. Error bars indicate s.d. of biological triplicates. * Indicates significant P value ⁇ 0.001 in comparison to uninfected control sample.
- FIG. 32H Scheme depicting mechanistic model for inducing pluripotency in somatic cells.
- FIGs. 33A-G - depict Knockdown screen for epigenetic repressors in EpiSCs.
- FIG. 33A Knockdown efficiency of the indicated siRNA pools in EpiSCs measured by qRT-PCR. Expression values for each gene were normalized to those measured in control siRNA. Error bars indicated s.d. * indicates student t test p Value ⁇ 0.05.
- FIGs. 33B-C Phase images of Mbd3 +/+ (FIG. 33B) and Mbd3 flox/" (FIG. 33C) EpiSC lines in this study. The cell lines had typical flat morphology when expanded on gelatin/vitronectin or Matrigel coated plates (feeder free conditions).
- FIGs. 33D-E Oct4 Immunostaining on EpiSC lines. Mbd3 +/+ EpiSC (FIG.
- FIG. 33D Mbd3 flox/" EpiSC
- FIG. 33E Mbd3 flox/" EpiSC
- FIGs. 33F-G - EpiSC lines were pluripotent as evident by their ability to form mature differentiated teratomas upon microinjection subcutaneously in immune- deficient mice.
- Mbd3 +/+ EpiSC (FIG. 33F), Mbd3 flox/" EpiSC (FIG. 33G).
- FIGs. 34A-C depict derivation of ESCs from Mbd3 _/" blastocysts.
- FIG. 34A-B Histograms depicting RT-PCR analyses for Oct4 and trophoblast marker expression of Mbd3 +/+ (FIG. 34A) and Mbd3 _/" (FIG. 34B) ESCs expanded either in FBS/LIF or 2i/LIF conditions. Only Mbd3 _/ ⁇ ESCs and only in serum conditions upregulate trophoblast differentiation markers. Stringent serum free 2i/LIF conditions maintain Mbd3 _/ ⁇ ESCs indistinguishably from Mbd3 +/+ ESCs. Error bars indicate s.d. of biological triplicate samples.
- FIG. 34C Agouti chimera derived following blastocyst microinjection with Mbd3 _/ ⁇ ESC line carrying rescue expression transgene for Mbd3.
- FIGs. 35A-C depict transcriptional expression of Mbd3 during pre-implantation development.
- FIGs. 35A-B - RT-PCR analyses demonstrating the expression of Mbd3 (FIG. 35B) and Nanog (FIGs. 35A) during early mouse development, presented as a relative quantification column scheme. Error bars indicate s.d. of biological triplicates.
- Mbd3 transcript is detected at low levels in oocytes while Mbd3 protein is readily detected by immunostaining in oocytes and zygotes (FIGs. 36A-D and FIGs. 10-T), consistent with maternal inheritance.
- FIG. 35C Relative transcriptional levels of MBD3 in human pre-implantation embryos based on available repository transcriptional measurements in early human developing embryos [intranet (dot) cmrb (dot) eu/Human_embryos/home.html], and showing a similar trend to that measured in mouse embryos.
- FIGs. 36A-J depict immunostaining analysis for Mbd3.
- FIGs. 36A-D Immunostaining for Mbd3 in mouse oocytes, indicating maternal inheritance of Mbd3.
- FIGs. 36E-H Immunostaining for Mbd3 and lineage markers in E5.5 post- implantation epiblast, indicating prominent expression as seen in late-blastocyst stage (FIGs. 10-T).
- FIGs. 37A-C depict comparative analysis of Mbd3 depleted somatic cell properties during reprogramming.
- FIG. 37A Reprogramming efficiency following infection with indicated MEF lines with moloney retroviruses encoding individual factors.
- FIG. 37B Reprogramming efficiency following infection with indicated MEF lines with polycistronic OKSM encoding lentivirus.
- FIG. 37C Mbd3 flox/" MEFs were infected with polycistronic OKSM vector in LIF containing ES medium with or without the indicated exogenous supplements. * Indicates student t-test p value ⁇ 0.01 relative to Mbd3 +/+ control. Reprogramming efficiency was evaluated by Oct4-GFP levels on day 9 following transduction without cell splitting during the process.
- FIGs. 38A-B show that Mbd3 depletion renders deterministic and radically efficient reprogramming of multiple adult somatic cell types.
- FIG. 38A - Mbd3 +/+ , Mbd3 _/ ⁇ and Mbd3 flox/" MEFs, adult tail tip derived fibroblast (TTF) and neural precursor cells (NPC) were tested for iPSC formation in 2i/LIF with or without OKSM lentiviral transduction. This analysis indicates that OKSM is essential for iPS formation, and that Mbd3 depletion alone is not sufficient to reprogram any of these cells types to pluripotency (even after 30 days of follow up).
- FIGs. 39A-D depict teratoma formation by Mbd3 _/" iPSCs.
- FIGs. 39A-C Randomly selected Mbd3 _/ ⁇ iPSC clones (clones 1, 2, and 3) were expanded and injected subcutaneously in immunodeficient mice. All lines generated teratomas containing differentiated cells from the three germ lineages (mesoderm, endoderm and ectoderm). These results are consistent with results obtained from Mbd3 _/ ⁇ ESCs (Kaji et al. development 2007).
- FIG. 39D - Mbd3 _/ ⁇ iPSCs can retain normal karyotype (40) after expansion in 2i/LIF defined conditions. P indicates passage number.
- FIGs. 40A-E depict time-lapse live microscopic imaging and tracking of cell reprogramming.
- Schematic representation of the main steps of automated segmentation protocol This protocol was used to automatically analyze time-lapse full well mosaic data, measured for two fluorescent wavelengths.
- the main protocol steps include: filtering plate margins, applying adaptive detection for each channel and time point, isolating dense colonies using specific morphological filter, clustering using low-pass- filter (LPF) and connected components clustering, extracting colony information and Oct4-GFP activation information per colony and conducting statistical analysis over all time-points information (see methods).
- LPF low-pass- filter
- FIGs. 41A-D depict time evolution of mCherry and Oct4-GFP reactivation in full well mosaic (FIG. 41A) and 3 representative single Mbd3 flox/" colonies (FIGs. 41B- D) out of approximately 100 colonies tracked.
- FIGs. 42A-E Time-lapse live imaging of deterministic iPSC reprogramming.
- FIGs. 42A-C Full well mosaic images of mCherry (FIG. 42A), Oct4-GFP (FIG. 42B) and combined channels (FIG. 42C) at day 6 following DOX in 2i/LIF 5% p0 2 conditions.
- ES-like mCherry+ colonies are abundant and co-localize with Oct4-GFP signal in Mbd3 flox/ ⁇ cells.
- FIG. 42D Cumulative distribution of Oct4-GFP+ colonies (red graph) and density function of Oct4-GFP+ activation (blue bar plot) for Mbd3 flox/ ⁇ , statistics were analyzed from all detected colonies (approximately 100 segmented colonies per well).
- Results show a very narrow window of synchronized Oct4-GFP activation around day 4.5, more than 50% of the colonies reactivated Oct4-GFP at 0.5 day interval.
- FIG. 42E Box-plot graph showing the distribution of intra-colony progeny Oct4-GFP activation (which is the ratios of Oct4-GFP+ & mCherry+ pixels out of all mCherry+ pixels within each segmented colony), as a function of time after induction, Box plot centers indicate the median values, and box edges indicate the 25 th and 75 th percentiles. Statistics were calculated from 100 segmented colonies (all detected colonies). At day 6, 95% of Mbd3 flox/ ⁇ colonies have more than 85% Oct4-GFP positive progeny cells.
- FIGs. 43A-B depict radically enhanced Oct4-GFP reactivation and iPSC formation.
- Mbd3 flox/" secondary cells synchronously and rapidly reactivate Oct4-GFP by day 7 in the entire donor cell population.
- wells at the indicated time points were harvested for analysis without prior passaging and splitting during the reprogramming course. 1 out of 3 independent experiments is shown.
- FSC - forward scatter Note the dramatic reactivation of Oct4-GFP occurring in the narrow time window at days 4-5, as also seen in microscopic time-lapse live imaging measurements.
- FIGs. 44A-B depict characterization of the effect for Mbd3 expression reconstitution during deterministic reprogramming of somatic cells to pluripotency.
- FIG. 44A - Scheme demonstrates experimental strategy for defining the temporal ability of Mbd3 during reprogramming to inhibit iPS formation.
- FIG. 44B - Secondary OSKM reprogrammable Mbd3 flox/" MEFs were tested for their amenability to reprogramming following over-expression of Mbd3, Mbd2 or empty FUW lentiviruses at different time points during reprogramming. Mbd2 or mock-vector transfection, did not result in a decrease in iPSC reprogramming efficiency.
- Introducing Mbd3 drastically reduced iPSC formation when delivered before day 5 in reprogramming. 1 out of 2 representative experiments is shown. Average of duplicates is shown per condition. Error bars indicate s.d.
- FIGs. 45A-B depict gene expression analysis during iPSC reprogramming following Mbd3 depletion.
- FIG. 45A- Gene expression was measured in donor fibroblasts before and after DOX induction and compared to established pluripotent iPSCs and ESC lines.
- DOX OKSM
- FIGs. 46A-E depict gene expression pattern changes during iPSC reprogramming. Single gene expression progression describes the extent to which each gene reaches its expression value in iPSC. These values were quantified using the followin transformation
- This transformation represents a distance from MEF expression values (set to 0) towards iPS values (set to 1).
- Selected group of pluripotency related genes or selected targets of Mbd3, are plotted in different time points after DOX induction. Red bars represent progression of gene expression in Mbd3 flox/" and blue bars represent progression of gene expression in Mbd3 +/+ .
- FIG. 46B Fast induction of multiple pluripotency related genes including Sall4, Lin28a, Utfl and Nanog can be seen 4 days after OSKM induction in Mbd3 flox/" , but not Mbd3 +/+ .
- FIG. 46C These genes reach their levels observed in iPS/ES cells (around 1) by day 8, in Mbd3 flox/" but in most cases not in Mbd3 +/+ .
- FIGs. 46D-E Single cell qRT-PCR analysis for detection of pluripotency gene markers. Analysis was conducted on Mbd3 +/+ (FIG. 46D) and Mbd3 flox/" (FIG. 46E) MEFs before (day 0) and 6 days after DOX induction.
- FIGs. 47A-B depict clustering of all histone marks values, as measured over differentially expressed genes.
- IP Immunoprecipitation
- FIG. 47A Hierarchical clustering of H3K4me3, H3K27me3 and H3K27ac focusing on the top 1323 genes whose gene expression differentiated between wild type MEF and ESC samples (see methods).
- Hierarchical clustering was calculated using Spearman correlation as a distance metric and average linkage. Results show that by day 8 Mbd3 flox/" , but not Mbd3 +/+ , were epigenetically similar to established ESCs and iPSCs line.
- FIG. 47A Hierarchical clustering of H3K4me3, H3K27me3 and H3K27ac focusing on the top 1323 genes whose gene expression differentiated between wild type MEF and ESC samples (see methods).
- Hierarchical clustering was calculated using Spearman correlation as a distance metric and average linkage. Results show that by day 8 Mbd3 flox/" , but not Mbd3 +/+ , were epigenetically similar to established ESCs and iPSCs
- Mbd3 flox/ but not Mbd3 +/+ , MEFs clustered differently from donor somatic MEFs only after 4 days of OKSM (DOX) induction.
- DOX OKSM
- Mbd3 flox/ cells show epigenetic signature that strongly correlates with established ESCs and iPSCs line.
- Mbd3 +/+ population does not show strong correlation with pluripotent ESCs-iPSC lines even after 8 days of reprogramming.
- FIGs. 48A-C depict clustering of each histone mark separately.
- Hierarchical clustering of H3K27me3 (FIG. 48A), H3K27ac (FIG. 48B) and H3K4me3 (FIG. 48C) z-score values focusing on the top 1323 genes whose gene expression differentiated between wild type MEF and ES samples (see methods).
- Hierarchical clustering was calculated using Spearman correlation as a distance metric and average linkage. Results show that even when considering each histone mark separately, by day 8 Mbd3 flox/ ⁇ , but not Mbd3 +/+ , were epigenetically similar to established ESC and iPSC lines.
- FIGs. 49A-B depict changes in DNA methylation level during deterministic reprogramming.
- OS KM DOX
- the average methylation level of low- passage Mbd3 +/+ iPSCs (calculated across the same set of CpGs) is provided as a dashed line for reference.
- FIG. 49B - The same analysis of average methylation was repeated as in (a). However only the 18,749 CpGs (out of 34,522) that reside in CpG rich areas (i.e. CpG abundance > 4%) were used.
- FIGs. 50A-C depict deterministic and synchronized iPSC reprogramming following Mbd3 depletion in 2i/LIF conditions.
- FIG. 50A Representative examples of partially reprogrammed (Pre-iPSC lines) generated from secondary Mbd3 +/+ MEFs and expanded in 2i/LIF + DOX conditions. Note the lack of Oct4-GFP expression in mCherry+ pre-iPSC lines. Subcloned Oct4-GFP+/mCherry+ iPSC line is shown as a positive control (bottom panel row).
- FIG. 50B Previously described (Mikkelsen, T. S. et al.
- FIG. 51 depicts enhancing cell fusion based reprogramming by Mbd3 depletion in 2i/LIF conditions. Inhibiting Mbd3 expression promotes robust reprogramming to pluripotency via cell fusion reprogramming assay between somatic MEFs and ESCs.
- Mbd3 +/+ and Mbd3 _/ ⁇ ESCs (that do not carry Oct4-GFP reporter) were made transgenic with a construct encoding constitutive CAAGS promoter driven Hygromycin resistance cassette.
- Their ability to reprogram wild type of Mbd3 depleted (Mbd3 flox/ ⁇ ) MEFs (carrying Oc4-GFP reporter and constitutive Puromycin resistance cassette) via PEG mediated cell fusion was evaluated.
- FIGs. 52A-C demonstrate TALE nuclease based targeting of MBD3 locus in human pluripotent cells.
- FIG. 52A Schematic overview depicting the targeting strategy for generating of conditional knockout allele of MBD3 that allows excision of Exon 2 following Cre recombinase transfection. Southern blot probes are shown as black lines, exons as blue boxes. Digestion sites for Nhel and Hindlll are indicated.
- FIGs. 52B-C Southern blot analyses following targeting of human WIBR3 hESC lines with the 5' probe (FIG. 52B) and with the 3' probe (FIG. 52C). Targeting efficiency was high and allowed isolation of clones where both alleles were correctly modified following a single round of targeting.
- FIGs. 53A-E demonstrate that depleting Mbd3 expression facilitates human iPSC formation from in vitro differentiated fibroblasts.
- FIG. 53A - MBD3 +/+ and MBD3 fiox/- IPSCS CARRYING D Q X inducible OKSM transgene were labeled with constitutively expressed mCherry and targeted with an OCT4-GFP knock-in allele 54 (Hockemeyer, D. et al. Nat Biotechnol 29, 731-734, 2011). hi vitro differentiated fibroblasts from the latter lines were reprogrammed as indicated in the scheme.
- FIG. 53B Normal karyotype of 1 ⁇ 3 ⁇ / ⁇ iPSC clone maintained in WIS-NHSM growth conditions.
- FIG. 53C-E Pluripotency of randomly selected iPSC clones (1, 2, and 3) as evident by teratoma formation and generation of differentiated cells form three germ lineages (mesoderm, endoderm and ectoderm).
- FIGs. 54A-G demonstrate that siRNA inhibition of MBD3 promotes human iPSC reprogramming by OSKM.
- FIGs. 54A-B - MBD3 siRNA treatment of human primary fibroblasts allows generation of iPSCs by only two rounds of reprogramming with mRNA transfection with OSKM and LIN28 factors, (STEMGENT) and alleviates the need for many rounds of repeated mRNA transfections with pluripotency factors. Note the number of nanog+/SSEA4+ colonies at day 8 in cells treated with MBD3 siRNA, but not in cells treated with the control siRNA (FIG. 54B).
- FIG. 54A-G demonstrate that siRNA inhibition of MBD3 promotes human iPSC reprogramming by OSKM.
- FIGs. 54A-B - MBD3 siRNA treatment of human primary fibroblasts allows generation of iPSCs by only two rounds of reprogramming with mRNA transfection with OSKM and LIN28 factors, (STEMGENT) and alleviat
- FIG. 54C Representative human iPSC clones (1 and 2) are shown at different time points and passages (P indicates passage number; day 7 and passage 11).
- FIGs. 54D-F Pluripotency of randomly selected clones (1 and 2) is shown by specific staining for OCT4 and SSEA4 pluripotency markers (FIG. 54D) and teratoma formation (FIGs. 54E and 54F).
- FIG. 54G Human naive cells were injected subcutaneously into SCID immune-deficient mice and formed after 4-8 weeks well differentiated teratoma tumors with differentiation into the three lineages [(endoderm (left), ectoderm (middle) and mesoderm (right)]. This indicates the cells are functionally pluripotent.
- FIGs. 55A-D depict reprogramming kinetics following Mbd3 depletion.
- FIG. 55B Two replicates of NGFPl-control and NGFP1-Mbd3 KD measured daily over 10 days. Results show fast Nanog-GFP activation of >95% of NGFPl-Mbd3 KD cells between day 4 and 6.
- FIGs. 55C-D - NGFPl-control FIG. 55C
- NGFPl-Mbd3 KD FIG.
- FIG. 55D reprogramming latencies (measured in days), fitted to multiple tandem rate limiting step models.
- FIG. 55C (middle) - Fitting plot of NGFP1-Mbd3 +/+ to multi-phase process with two exponential transitions and single intermediate state.
- FIG. 55D (middle) - Fitting plot of NGFP1-
- FIGs. 56A-F depict statistical analysis using Gaussian distribution. NGFP1- control and NGFP1-Mbd3 KD reprogramming latencies were fit to Gaussian distribution.
- FIGs. 56A-B Goodness of fit plots for fitting of NGFP1-Mbd3 +/+ (FIG. 56A) and NGFPl-MbdSTM (FIG. 56B) to Gaussian distribution.
- FIG. 56C-D Graphs showing 12-fold reduction in average reprogramming time (FIG. 56C), and 80-fold reduction in
- FIGs. 57A-E depict quantification of iPSC reprogramming after integrating cell cycle variability.
- the variability observed in the reprogramming latency measurements was quantified and further compared to the inherent cell cycle variability.
- the graph shows that while the coefficient of variation in the Mbd3 +/+ sample is 0.5, the MbdSTM coefficient of variation is reduced to 0.09, tightly proximal to the cell cycle estimated coefficient of variation (0.08).
- Error bars represent 95% confidence intervals for the coefficient of variation, as estimated by maximum likelihood and calculated by propagation of error (see methods).
- FIG. 57B - Using a Brownian motion (BM) model, the present inventors have estimated the dynamic variability for each sample (see methods). This variability is the ratio of the Brownian motion standard deviation ( o) divided by the Brownian motion drift parameter ( v), where /v > 1 corresponds with a high variability dynamics. The present inventors show that while the dynamic variability in the Mbd3 +/+ sample is ojv > 5, the Mbd3 KD and cell cycle measurements show both a dynamic variation of ⁇ / ⁇ - 0.5.
- BM Brownian motion
- FIG. 57C Illustration of the first passage time model.
- BM Brownian motion
- the present inventors assume that reprogramming time depends on the first time in which some master regulator (i.e. Nanog or Oct4) transient from their low inactive state to high expression state by passing a fixed expression threshold.
- FIGs. 58A-D depict modeling of a multiple rate-limiting process in the context of iPSC reprogramming.
- NGFP1-Mbd3 +/+ and NGFPl-MbdBTM reprogramming latencies were fit to multiple tandem rate limiting step models.
- Each experimental dataset was tested against models with 1 to 5 exponential transitions. Fitting was done with nonlinear regression and adjusted R statistic (see methods).
- FIG. 58A - Fitting of NGFP1-Mbd3 +/+ to single exponential transition with no intermediate states. Note that NGFP1-Mbd3 +/+ fit poorly (adj R 2 0.94) to a single transition process.
- FIGs. 59A-G depict modeling of a multiple rate-limiting process in the context of iPSC reprogramming.
- the fitting results were validated using a second fitting procedure based on weighted nonlinear fit by chi minimization (see methods).
- the graphical goodness of fit is given in the left panels (FIGs. 59A, C, E), and the observational errors (residuals) are given in the right panels (FIGs. 59B, D, F).
- FIG. 59C-D Fitting of NGFP1-Mbd3 +/+ to multi-phase process with two exponential transitions and single intermediate state.
- FIGs. 59E-F Fitting of NGFP1-Mbd3 +/+ to multi-phase process with three exponential transitions and two intermediate states.
- FIG. 59G Chi values obtained with the different models for NGFP1-Mbd3 +/+ (blue) and NGFPl-MbdSTM (red), indicating that the best fit model for NGFP1-Mbd3 is a single exponential transition with no intermediate states, and the best fit model for NGFP1-Mbd3 +/+ is multi-phase process with three exponential transitions and two intermediate states.
- FIGs. 60A-C depict direct interaction of Mbd3/NuRD with OS KM pluripotency factors during reprogramming.
- FIG. 60A Over-expression of Flag-tagged Mbd3 simultaneously with Oct4, Sox2, Klf4, c-Myc or Nanog in HEK293 cells was followed by Co-immunoprecipitation (co-IP) assay. Immunoblot analysis (IB) using antibodies against Oct4, Sox2, Klf4, c-Myc and Nanog showed specific binding between Mbd3 and the pluripotent factors except Nanog.
- FIG. 60B - A knock in targeting strategy in murine V6.5 ESCs with a targeting construct generating endogenously labeled Flag- tagged Oct4 allele.
- FIG. 60C Co-IP assay of Chd4 (Mi2b), the core subunit of the NuRD complex, in secondary Mbd3 +/+ fibroblasts 3 days after Dox induction and applying 2i/LIF conditions.
- FIGs. 61A-C demonstrate that Mbd3 binds pluripotent proteins in ESC but not Mbd2.
- FIG. 61 A - The present inventors established an ESC line carrying recovery of Flag-tagged Mbd3 transgene inserted in Mbd3 _/ ⁇ ESC line. Co- immunoprecipitation using flag beads followed by western blot shows that Mbd3 strongly binds the Mi2b and Mta2 members of the NuRD complex, but not Mbd2. Moreover, Mbd3 interacts with Sall4 pluripotency reprogramming factor in ESCs.
- FIGs. 62A-C demonstrate that MBD domain of Mbd3 is critical for direct interaction with OSKM reprogramming factors.
- Deletion mutations in the MBD site of Mbd3 was designed in order to find the binding region of Mbd3.
- Flag-tagged mutation constructs were co-transfected with Oct4, Sox2, Klf4 and c-Myc in HEK 293T cells for 48 hours followed by Co-immunoprecipitation with anti-flag beads and immunoblot against Oct4, Klf4, Sox2 and c-Myc. This analysis showed loss of binding and interaction between Mbd3 and OSKM when deletion covering 25-49 amino acid region of Mbd3 were used (as schematically shown in FIG. 62C).
- FIG. 63 depicts motif enrichment analysis for Mbd3 binding following reprogramming. Top motifs abundant among Mbd3 binding regions following OSKM induction. Shown are the sequence logos of selected motifs, along with associated factors, the Z score and the P values. The motifs were inferred using SeqPos software in Cistrome package (see methods).
- FIGs. 64A-H depict the effect of Mbd3 depletion on targets common to OSKM and Mi2b.
- FIGs. show a reduction in Mi2b binding to OSKM targets upon Mbd3 depletion.
- FIGs. 65A-E depict the effect of Mbd3 depletion on OSKM target genes.
- FIGs. 65A-B Box plot centers indicate the median value, and box edges indicate the 25 th and 75 th percentiles. P-values of distribution differences indicated in the graph (in each panel) were estimated with paired sample t-test.
- FIG. 65A Distribution of gene expression fold-change relative to MEF of Mbd3 +/+ samples (blue) and Mbd3 flox/ ⁇ samples (red) throughout reprogramming (0, 4 days, 8 days and iPS/ES) as described in FIG.
- FIG. 65B Distribution of histone marks and Oct4 binding levels in z-score values at day 4 after OSKM (DOX) induction, calculated from the same set of 2928 genes described above.
- FIGs. 65C-E - Profiles of H3K27me3 (FIG. 65C), H3K27ac (FIG. 65D) and H3K4me3 (FIG. 65E) read densities at day 4, are plotted for four representative OSKM target genes (Sall4, Klf5, Prdml4 and Tbx3).
- the profiles describe read density normalized to z-score between 1 Kb upstream to TSS and TES.
- Mbd3 flox/" profiles of H3K27ac and H3K4me3 are significantly increased (>3 Std), and H3K27me3 significantly reduced, in comparison to Mbd3 +/+ sample (blue area).
- FIGs. 66A-F depict the effect of Mbd3 depletion on OSKM and Mbd3. Box plot centers indicate the median value, and box edges indicate the 25 th and 75 th percentiles. P- values of distribution differences indicated in the graph were estimated with paired sample t-test.
- FIG. 66B Same as in 65B but calculated over genes that are bound by Mbd3 and are upregulated during reprogramming (differentially expressed gene signature described in methods). Results here show similar trends to what was described in FIGs. 65A-B.
- 66C-F Distribution of histone marks and Oct4 binding levels in z-score values in Mbd3 depleted (Mbd3 flox/ ⁇ ) or wild type (Mbd3 +/+ ) cells.
- the results presented in FIGs. 66C-F demonstrate that in the Mbd3 depleted samples, during reprogramming Mbd3 targets and/or OSKM targets acquire more open chromatin and get easily and fully reactivated.
- FIGs. 67A-D demonstrate that pluripotency promoting epigenetic activators are essential for both deterministic and stochastic iPSC formation.
- FIGs. 68A-K demonstrate that naive human stem cells share defining epigenetic features with mouse ESCs.
- FIG. 68A-B - As representative examples, characterization for WIS 1 (FIG. 68A) and WIS2 (FIG. 68B) naive hESCs is shown. The cells were taken at the indicated passage number (Passage 31 for WIS 1, and Passage 27 for WIS2) and express all human pluripotent markers tested (i.e., NANOG, TRA-1-60, OCT4, TRA-1-81, SSEA3, SOX2 and SSEA4), and do not express SSEA1. All naive lines described herein show no signs of deterioration, crisis or decay with expansion (for over 30-70 passages thus far tested).
- FIGs. 68C-H The pluripotent capacity of the naive human cells WIS 1 at passage 33 (FIGs. 68C, E and G) and WIS2 at passage 19 (FIGs. 68D, F, H) was evaluated by the ability to form teratomas with cells of all three embryonic germ layers. Representative hematoxylin and eosin staining of teratoma sections are shown.
- FIG. 681- K Representative confocal images obtained after double immuno staining for OCT4 and H3K27me3 on naive (FIG. 681), primed (FIG. 68J) and differentiated samples (Embryoid bodies, obtained from naive cells; FIG. 68K).
- Naive female pluripotent cells nearly lack the formation of H3K27m3 foci that mark the inactive X allele (FIG. 681, less than 2% of the cells exhibit the H3K27m3 foci).
- FIGs. 69A-I depict global transcriptional profile of human naive pluripotency.
- FIG. 69B Cross-species hierarchical clustering of naive and primed pluripotent cells from mice and humans.
- FIGs. 69C-D - Gene expression across different naive samples is less noisy and more homogenous than across different primed samples.
- a box plot showing the median and quartiles of the distributions of the coefficients of variance ( ⁇ / ⁇ ) calculated for each of the homologous genes.
- FIG. 69C human naive versus human primed pluripotent stem cells
- FIG. 69D mouse naive versus mouse primed pluripotent stem cells
- FIGs. 69E-F Naive human (FIG. 69F) and primed human (FIG. 69E) hESCs were double immunostained for TFE3 and OCT4. Representative confocal images are shown for LIS2 hESC line. Insets are enlargements of the dashed boxes. Oct4 staining is localized to the nucleus in both states of cells (primed and naive).
- FIG. 69G Quantitative unbiased imaging analysis for preferential nuclear localization was conducted on randomly selected 200 cells from independent image frames per sample. Box and whisker plots of nuclear/cytoplasmic TFE3 ratios in naive and primed mouse and human ESCs are shown. Naive hESCs showed distributions similar to those in naive mESCs, and the nuclear enrichment was lost in primed human and mouse ESCs * t-test P values ⁇ 1 x 10 ⁇ 100 .
- FIG. 69G Quantitative unbiased imaging analysis for preferential nuclear localization was conducted on randomly selected 200 cells from independent image frames per sample. Box and whisker plots of nuclear/cytoplasmic TFE3 ratios in naive and primed mouse and human ESCs are shown. Naive hESCs showed distributions similar to those in naive mESCs, and the nuclear enrichment was lost in primed human and mouse ESCs * t-test P values ⁇ 1 x 10 ⁇ 100 .
- FIG. 691 Principal Component Analysis showing that human ICM samples are closer to Naive than to Primed samples (along the 1st principal component axis). Primed samples are also more dispersed, showing higher variability and heterogeneity, and not as closely grouped as human Naive and ICM samples are.
- FIGs. 70A-J depict epigenetic configuration of human naive pluripotency.
- FIGs. 70A-J depict epigenetic configuration of human naive pluripotency.
- FIGs. 70A-B Profiles of H3K27me3 chromatin mark of developmental genes in human (FIG. 70A) and mouse (FIG. 70B), naive (blue) and primed (red), represented as normalized read-density.
- Human profiles indicate average and s.d. (error-bars) calculated over 5 different cell lines (CI, LIS2, WIBR3, WIBR3-MBD3mut and BGOl). Average difference between plots is indicated alongside variance and P-values (calculated with paired-sample t-test).
- FIGs. 70C-D Chromatin landscape of 5 pluripotent example genes.
- H3K27me3 and H3K4me3 marks are shown for naive (blue) and primed (red) cell lines, in both human (FIG. 70C) and mouse (FIG. 70D), showing high consistency between the organisms.
- FIGs. 70E-F Same as in FIGs. 70C-D for 5 developmental genes.
- FIGs. 70I-J Histograms of the change in methylation between primed and naive samples in human (FIG. 701) and mouse (FIG. 70J). The histograms depict the distribution of the per-CpG difference in methylation, calculated for all CpGs residing in CpG rich regions (>4% CpG content) and having a coverage of >10x in both samples.
- FIGs. 71A-G depict signaling and functional characteristics of human naive pluripotency.
- FIG. 71A - LIF/Stat3 is required for stabilization of the in vitro stability of naive hESC/hiPSCs in WIS-NHSM.
- Naive V6.5 NOD mESCs, naive WIS 1 and HI hESCs, and BJ naive hiPSCs were electroporated with mock a pBRY-CAGGS-flox- DsRedT4-IRES-Puro control plasmid, a plasmid encoding a dominant negative Stat3 Y705F mutant (Stat3-DN), or a plasmid Stat3-C constitutively active mutant (pBRY- Stat3-CA).
- Cells were passaged three times in the presence of puromycin selection. After 20 days, colonies positive for OCT4 pluripotency markers were counted and normalized to colonies from cells electroporated with empty vector.
- FIGs. 71B-C - Upper panels indicate schemes for gene targeting of OCT4 (FIG. 71C) and COLIA (FIG. 7 IB) loci. Tables indicate number and percentage of correctly targeted ES clones, as determined by both 5' and 3' southern blot validation strategies.
- FIG. 71D - Secondary iPSC reprogramming efficiency of wild-type and MBD3 depleted (MBD3 mut ) cells when reprogramming in naive (blue scheme) or primed/conventional (red scheme) conditions. Error bars indicate s.d.m (n 3).
- FIGs. 72A-D demonstrate defining and optimizing conditions for capturing transgene independent human naive pluripotent iPSCs.
- DOX the cells express the endogenous pluripotency OCT4 (consistent with previously described results and teratoma formation ability of these cells (Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A.
- FIG. 72B Genetically unmodified BJ1 naive hiPSC line generated by mRNA reprogramming approach, showed similar dependence to that observed to CI.2 naive hiPSC line (expanded without DOX), in WIS-NHSM conditions (FIG.
- FIG. 72C For further optimizing naive growth conditions, 1% Albumax can be substituted by using either 15% KSR (knockout serum replacement) or 1% chemically defined lipid concentrate (Invitrogen). 1% albumax was used in WIS-NHSM defined throughout the study and used for molecular analysis of naive cells.
- KSR knockout serum replacement
- Invitrogen 1% albumax was used in WIS-NHSM defined throughout the study and used for molecular analysis of naive cells.
- Naive hiPSCs can be grown without feeder cells either on matrigel coated plates, vitronectin coated plates or 0.2% gelatin + lng/ml vitronectin coated plates (but not gelatin alone). * student's t test P value ⁇ 0.01 relative to control Gelatin + feeder cells (MEF) condition. One representative experiment is shown out of 3 performed.
- FIGs. 73A-F depict immuno staining for pluripotency markers on newly embryo derived naive hESCs.
- SSEA1 which is specific for mouse (both naive and primed stem cells) and not human pluripotent cells, is not expressed on naive hESCs.
- FIG. 73C-F Expression of KLF2 and ESRRB pluripotency factors in naive hESCs.
- Representative confocal double immuno staining images demonstrating expression of KLF2 and ESRRB pluripotency factors in naive human and mouse ESCs.
- FIGs. 74A-D depict enhanced growth rate and single cell cloning efficiency of human naive pluripotent stem cells.
- FIG. 74A-D depict enhanced growth rate and single cell cloning efficiency of human naive pluripotent stem cells.
- 74A Population doubling time of various mouse and human pluripotent stem cell lines. After plating each cell lines in replicates, cells were harvested at days 2,4 and 6 and there growth was normalized by counting cell number at each stage and calculating growth rate relative to the number of cells harvested and counted at day 2 (rather than number of plated cells to account for variability in survival after plating). Error bars represent s.d., and P values represent t- test of average from primed hESC/hiPSC lines to average of naive hESC/hiPSC lines. FIG.
- FIG. 74B Single-cell cloning efficiency of different pluripotent stem cell lines as determined by the number of wells containing NANOG+ colonies 6 days after plating (with or without ROCK inhibitor as indicated in the figure). * indicates student's t-test P value ⁇ 0.01 between the average of the compared groups. Error bars indicate s.d. These results highlight an enhanced single cell survival and cloning efficiency of naive pluripotent cells, in comparison to conventional hESCs/hiPSCs.
- FIG. 74C Cross species differences in ERAS protein expression influence remaining growth properties differences between genetically unmodified human and mouse naive PSCs.
- FIGs. 75A-I depict predominant utilization of distal enhancer element in mouse and human naive pluripotency.
- FIG. 75A Schematic illustration demonstrating the relative localization of the evolutionary conserved distal and proximal enhancer elements in the human OCT4 locus.
- Distal enhancer (DE) and proximal enhancer (PE) are highlighted in the human OCT4 locus, and were accordingly deleted in ⁇ and ADE reporter constructs used in this study. Insertion site of GFP-2A-Puromuycin resistance cassette by BAC recombineering is indicated.
- FIGs. 75B-E -WIS 1 FIGs. 75B and 75C
- LIS2 also referred to as "LIS39" herein
- naive hESCs were stably transfected with APE-OCT4-GFP-2A reporter construct that marks naive pluripotency configuration.
- GFP expression was specifically detected by flow cytometry in naive pluripotent cells (FIGs. 75B and 75D), while their genetically matched primed cells generated after 10 days in primed/conventional hESC conditions did not show GFP expression (FIGs. 75C and 75E).
- FIGs. 75H-I - naive CI.2 hiPSC propagated in WIS-NHSM media showed specific expression of GFP marker (FIG. 75H), while CI cells grown in previously described 2i/LIF + DOX conditions (to induced OSK transgenes) down regulate GFP activity and had a heterogeneous expression pattern (FIG. 751). The latter is consistent with data in FIGs.
- transgene dependent naive pluripotent cells are unstable relatively to the genetically unmodified and transgene independent cells described in this study.
- FIGs. 76A-C demonstrate that female naive hESCs/hiPSCs retain a unique pre- X inactivation state in WIS-NHSM conditions.
- FIG. 76A - Confocal images obtained after double immunostaining for OCT4 and H3K27me3 on naive, primed and differentiated samples were analyzed and quantified for the fraction of cells with nuclear H3K27me3 foci that mark the inactive X allele. Average percentages of 150- 200 individual cells counted per sample from at least ten independent frames are shown. Error bars indicate s.d. * indicates student's t-test P value ⁇ 0.01 when comparing samples to naive pluripotent cells.
- RPKM read-per-kilo base-per-million reads
- RPKM were measured for each gene between 1 Kb upstream to TSS (Transcription Start Site) and TES (Transcription Ending Site). Shown are 4 human cell lines (WIBR3, CI, LIS2, WIS2). Blue - naive cell lines, Red - primed cell lines.
- Lines WIBR3, CI and LIS2 are females and BGOl is a male cell line. Distributions of H3K9me3 in female primed cells are significantly higher compared to their naive counterparts, while in male cells they are the same. P-values were calculated with 1-tail paired-sample t-test.
- FIGs. 77A-B depict distinct transcriptome for human naive ESCs/iPSCs.
- FIG. 77A Microarray transcriptional profile of selected pluripotency and lineage- specific marker genes, their mean expression ratio in primed hESCs and naive hESCs relative to the median of all samples. Values are shown in natural scale. Error bars represent SEM of each gene. Asterisks denote statistically significant differentially expressed genes in which the false discovery rate was ⁇ 0.05 between the naive and primed groups of samples. Panel was generated by R software.
- FIG. 78 depicts GO ontology analysis for genes down regulated in human naive pluripotency.
- GO ontology categories enriched for and down-regulated genes in naive pluripotency, checked and visualized using the online tool GOrilla.
- Color bar shows p- values
- the FIG. shows only trees containing GO terms with p-values ⁇ 10-5, resulting in FDR corrected p-values ⁇ 0.05.
- FIGs. 79A-D depict transcriptional comparison of in vitro and in vivo isolated human pluripotent cells.
- FIG. 79A Hierarchical clustering of gene expression of genes differentially expressed between Naive and Primed samples, in human cell lines and in the human inner-cell-mass (ICM), using Spearman correlation. Note that while the ESC samples previously derived by Belmonte and colleagues cluster with the Primed samples derived herein, the human ICM samples cluster with the Naive samples.
- FIG. 79B Hierarchical clustering of the mean expression profile of all the genes in the different groups (Naive, Primed, Belmonte's ESCs, and ICM), using Spearman correlation.
- FIG. 79A Hierarchical clustering of gene expression of genes differentially expressed between Naive and Primed samples, in human cell lines and in the human inner-cell-mass (ICM), using Spearman correlation. Note that while the ESC samples previously derived by Belmonte and colleagues cluster with the Primed samples derived herein, the human
- FIG. 79C Hierarchical clustering of the mean expression profile of differentially expressed genes in all individual samples.
- FIG. 79D Principal Component Analysis showing that human ICM samples are closer to Naive than to Primed samples (along the 1st principal component axis). Primed samples are also more dispersed, showing higher variability and heterogeneity, and not as closely grouped as Naive and ICM samples are.
- FIGs. 80A-D depict distinct MHC class I and TFE3 protein cellular localization pattern in naive human pluripotent cells. Shown are representative confocal images of double immunostaining for OCT4 and TFE3 followed by fluorescence intensity profiling of the yellow-dashed box area.
- FIGs. 81A-D depict enhanced surface E-CADHERIN expression in human naive pluripotent cells.
- FIGs. 82A-B depict cross-species clustering of naive and primed pluripotency.
- FIG. 82A Cross-species gene expression hierarchical clustering of all 9,803 orthologous genes represented on both mouse and human gene arrays used in this study, clustered using Pearson correlation.
- Naive mouse and human pluripotent cells formed a distinct group apart from primed mEpiSCs and conventional/primed hESCs and hiPSCs.
- Heat map showing row -normalized expression levels (log-ratio) with red and green colors representing up and down regulated genes, respectively. Naive cells are labeled in blue, primed cells are labeled in red.
- Mouse samples were obtained from either 129 or NOD strains.
- FIG. 82B Boxplot of gene-specific gene expression levels in Primed samples showing higher noise and heterogeneity than in Naive samples. This pattern is consistent with the genome- wide data in FIGs. 69A-G. Five out of nine genes are significantly more variable, tested by F-test of equality of variances).
- FIGs. 83A-D depict global H3K27me3 and H3K4me3 deposition in naive and primed pluripotent cells.
- FIGs. 84A-G depict gnome wide redistribution of H3K27me3 in human naive pluripotency.
- FIGs. 84A-B Distribution of H3K27me3 peaks in different genomic components (promoter, gene-body and intergenic region), as a function of the peak density (represented as RPKM, read-per-kilobase-per-million-reads), in human cell lines (WIBR3, CI and BGOl).
- the peaks distribute differently from primed, with lower number of peaks in promoters and gene bodies, compared to primed conditions.
- FIGs. 84D-E Number of enhancers of class I (active transcription) and class II (poised) in naive (blue) vs. primed (red) human (FIG. 84D) and mouse (FIG. 84E). In human, numbers correspond to common enhancers in lines WIBR3 and CI.
- FIGs. 84 F-G Expression level distribution of genes associated with class I and class II enhancers, present in either naive cells only (blue) or in primed cells only (red) in human (FIG. 84F) or mouse (FIG. 84G) cells. Expression level distribution of all genes is presented as control. Boxes represent 25th and 75 th quantiles, and whiskers represent min and max values that are not outliers.
- FIGs. 85A-C - Primed/conventional WIBR3 human ESCs were passaged in 12 different WIS-NHSM based conditions.
- FIG. 85A depicts the compositions of the different variations of the WIS-NHSM conditions used in this experiment, in addition to the basic medium of KO-DMEM, supplemented with 1% ALB UMAX, 50 microgram/ml ⁇ g/ml) L-ascorbic acid, N2 supplement (Invitrogen) and additional 6.25 mg human insulin. Small molecules and cytokines were included as indicated in combinations of conditions 1-12. Cells were expanded on 0.2% Gelatin coated plates for 25 days (6 passages). FIG.
- FIGs. 86A-C depict the influence of MAPK signaling perturbation on human naive and primed pluripotent cells.
- FIG. 86C - qRT-PCR analysis for lineage commitment gene upregulation 72 hours after withdrawal of p38i and/or JNKi from WIS-NHSM conditions. These results indicate that the components in WIS- NHSM conditions cooperatively promote pluripotency stability and counter-balance and neutralize pro-differentiation effects induced by some of the ingredients. Error bars indicate s.d.m (n 3). Representative results of one out of three biological replicates experiments is shown. * indicates student's t-test P value ⁇ 0.01.
- FIGs. 87A-B depict signaling requirements for maintaining naive hESCs and hiPSCs.
- FIG. 87A - WIS 1 and LIS 1 naive hESCs were targeted with the APE-OCT4- GFP reporter and analyzed for the ability to retain naive pluripotency in different conditions as indicated.
- OCT4-GFP+ levels detected by FACS from two experimental replicates were averaged. Error bars indicate s.d.
- the results indicate ERK inhibition is essential for maintaining hESCs in WIS-NHSM, and this effect can be achieved by using two different ERK inhibitor (PD 0325901 or PD184352).
- FIGs. 88A-J demonstrate different defined growth conditions which enable maintenance of mouse naive pluripotency.
- FIGs. 88A-G - V6.5 mESCs carrying the naive pluripotency specific APE-Oct4-GFP reporter were maintained in distinct chemically defined growth conditions as indicated in the panel labels: FIG. 88A - N2B27 LIF; FIG. 88B - N2B27 ERKi/GSK3pi (2i)/LIF; FIG. 88C - N2B27 p38i/GSK3pi/LIF; FIG. 88D - N2B27 JNKi/GS K3 ⁇ /LIF ; FIG. 88E - WIS-NHSM; FIG.
- the analysis indicates that naive GFP+ mESCs can be maintained in LIF, GSK3pi together with either ERKl/2i, p38i or JNKi.
- FIGs. 88H-J - Representative images of high-contribution chimeras generated after blastocyst microinjection of the indicated lines.
- FIGs. 89A-D depict competence of different mouse naive growth conditions in tetraploid embryo complementation assay.
- FIG. 89A -V6.5 naive mESCs were expanded in the indicated conditions for 12 passages, after which they were tested for tetraploid complementation assay to form all-ESC animals. The analysis indicates unrestricted developmental potential is equivalently obtained at the functional level when naive mESCs are expanded with either p38i, JNKi or ERKl/2i (together with supplementation of LIF and GSK3pi in all conditions).
- FIGs. 89B-C Representative images of "all-ESC" agouti coat colored animals obtained.
- V6.5 naive mESCs were expanded in the indicated conditions for 12 passages, after which they were tested for tetraploid complementation assay to form all-ESC animals.
- the analysis indicates unrestricted developmental potential is equivalently obtained at the functional level when naive mESCs are expanded with p38i, Jnki or Erkl/2i (together with supplementation of LIF and GSK3pi in all conditions).
- FIG. 90 depicts LIF/STAT3 signaling dependence by naive hESCs/iPSCs.
- Interfering with LIF/STAT3 signaling results in specific upregulation of lineage commitments genes in naive hESCs. * Indicates student t test P values ⁇ 0.01 compared to control WIS-NHSM conditions. Error bars indicate s.d.
- FIGs. 91A-C depict unique signaling requirement and response to BMP4 for naive hESCs/iPSCs.
- FIGs. 91A-B - qRT-PCR levels of the indicated commitment genes after subjecting naive (FIG. 9 IB) and primed (FIG. 91 A) WIS 1 hESCs to BMP4 for 72 hours. Averages of biological triplicates are indicated, as normalized levels to un- stimulated control. Error bars indicate s.d.m (n 3).
- Naive WIBR3 hESCs upregulated ID3 (inhibitor of DNA binding 3, dominant negative helix-loop-helix protein; Gene ID: 3399) in response to BMP4 (5-10 ng/ml bone morphogenetic protein 4), but not trophoblast early markers CDX2 (caudal type homeobox 2; Gene ID: 1045) and HAND1 (heart and neural crest derivatives expressed 1; Gene ID: 9421).
- FIG. 91C Global gene expression analysis indicates that naive WIS2, H9 and BGOl expanded with the addition of BMP4 for 12 passages, retain a transcriptional program that clusters with naive hESCs and hiPSCs, rather than primed cells. Hierarchical clustering of genome-wide gene expression of human cell lines, using Euclidean distance.
- Heat map showing row-normalized expression levels with red and green colors representing up and down regulated genes, respectively. Note the two left-most genetically identical samples that were used for Batch effect correction, allowing two different datasets to be united for further analysis (see online Methods).
- FIGs. 92A-D depict reprogramming efficiency of Mbd3 + Secondary MEF after knockdown of Mbd3 (Mbd3 siRNA) or Chd4 (Chd4 siRNA).
- FIG. 92A - MEFs were subjected to reprogramming with STEMCCA-OKSM with DOX induction, and on day 3 the 2i/LIF medium was added. The indicated siRNAs were added on days 2, 4 and 6.
- FIG. 93 shows that P66a-CC interrupts Mbd3 binding to Chd4.
- 293T cells were transfected with both with Flag-Mbd3 (WT) and P66a-CC (SEQ ID NO:71; GenBank Accession NO. NM_017660.3) or a control vector (mCherry), Mbd3 interacting proteins were pulled down by immunoprecipitation (IP) using Flag-magnetic beads.
- IP immunoprecipitation
- FIGs. 94A-B depict the generation of a mCherry knock in reporter allele in Nanos3 locus of a naive human ESC (WIS l).
- FIG. 94 A A schematic illustration depicting genetic engineering via TALENs in WIS l naive human ESCs to generate mCherry knock in reporter allele in Nanos3 locus. Scheme indicates targeting strategy.
- FIG. 94B Southern blot analysis depicting correctly targeted allele (mut) in a number of WIS clones (2h, 4g, 8a, and 8e).
- FIG. 95 illustrates the differentiation strategy of naive EIS 1 NANOS 3 -cherry reporter human ESCs into primordial germ cell (PGC)-like cells (abbreviated as PGCLC). Shown are images of the cells/colonies during the differentiation process.
- PPC primordial germ cell
- FIGs. 96A-I depict the process of differentiating human ESCs into primordial germ cell like cells.
- FIG. 96A schematic illustration of the differentiation process.
- FIGs. 96B-I FACS analyses for detecting PGCLC marker expression NANOS 3- Cherry.
- FIG. 96B - naive ESCs;
- FIG. 96C primed EpiLC;
- FIGs. 96D-F - cells were cultured in a PGC medium which included BMP4;
- FIGs. 96G-I - cells were cultured in a PGC medium which did not include BMP4. Shown are FACS results after 2 (FIGs. 96D and 96G), 4 (FIGs. 96E and 96H), and 6 (FIGs.
- FIGs. 97A-H depict expression of PGC markers in human PGCLC cells. Shown are real-time PCR analyses for expression of different PGC markers during the induction protocol.
- FIG. 97A - TFAP2c also known as AP2gamma
- FIG. 97B - BLIMP1 also known as PRDM1 - PR domain containing 1, with ZNF domain: Gene ID:639
- FIG. 97C - PRDM14 PR domain containing 14
- FIG. 97D - STELLA developmental pluripotency associated 3
- FIG. 97E - DND1 DND microRNA-mediated repression inhibitor 1
- FIG. 97F - NANOS 3 nonos homolog 3
- FIG. 97G - INTEGRIN B3 [integrin, beta 3 (platelet glycoprotein Ilia, antigen CD61)]; FIG. 97H - VASA; Results clearly show that PGCLC markers are induced in protocol applied on human naive ESCs, including STELLA (FIG. 97D), INTEGRINB3 (FIG. 97G), BLIMPl (FIG. 97B) and VASA (FIG. 97H).
- FIGs. 98A-B depict FACS analyses of conventional/primed human ESCs that were subjected to the same induction protocol as described in Example 11 of the Examples section which follows, and in FIGs. 95-97 above.
- FIGs. 99A-G depict reprogramming of MBD3 knocked down human fibroblasts.
- FIG. 99A - Human BJ fibroblasts were infected with TRIPZ MBD3 shRNA lentiviruses (3.1, 3.2, 3.3 indicate three different hairpin constructs targeting MBD3). Shown is a histogram with quantification of real time PCR expression for MBD3 which was conducted after 72 hours with or without DOX induction. The results validate down-regulation of MBD3 in human fibroblasts in a DOX dependent manner.
- FIGs. 99B-C Reprogramming of MBD3 knocked down human fibroblasts. Shown are the reprogrammed cells which express shMBD3-red fluorescent protein (RFP) in red fluorescence (FIG. 99B) or in bright filed (BF; FIG. 99C).
- FIGs. 99D-G Reprogramming of MBD3 KD primary human fibroblasts with overexpression of OKSM and ERAS in NHSM conditions. Shown are the clonal populations with ES-like morphology appeared at days 5 (FIGs. 99D-E) and 11 (FIGs. 99F-G). Phase contrast images are shown in FIGs. 99D and 99F. Red fluorescence images are shown in FIGs. 99E and 99G. MBD3 knocked-down clones that over express ERAS develop in 5 days, and were subjected for iPSC follow up analysis.
- RFP shMBD3-red fluorescent protein
- FIGs. 100A-T show staining for OCT4, SSEA4, TRAl-60 and TRA1-81 pluripotency markers on cells reprogramming in NHSM conditions following 10 days of OKSM, RtTa, ERAS and MBD3 shRNA DOX induction.
- FIGs. 100A-D - Cells were stained for DAPI (FIG. 100A), OCT4 (FIG. 100B), and SSEA4 (FIG. lOOC).
- FIGs. 100E-I - Cells were stained for DAPI (FIG. 100E), OCT4 (FIG. 100F), SSEA4 (FIG. 100G).
- FIG. 1001 - Staining for the MBD3-shRNA induction reporter Note the co-localization of shMBD3 with cells expressing the OCT4 and SSEA4 pluripotency markers.
- FIGs. 100J-N - Cells were stained for DAPI (FIG. 100J), OCT4 (FIG. 100K), TRAl-60 (FIG. 100L).
- FIG. 100N - Staining for the MBD3-shRNA induction reporter Note the co-localization of shMBD3 with cells expressing the OCT4 and TRAl-60 pluripotency markers.
- FIGs. 100O-S - Cells were stained for DAPI (FIG. 100O), OCT4 (FIG. 100P), TRA1-81 (FIG. 100Q).
- FIG. 100T - A histogram depicting quantification of the Nanog+/TRA1-60+ human iPSC colonies at day 10.
- iPSC colony numbers were counted at day 10 by staining for NANOG and TRAl-60 markers (FIG. 100T). Note the dramatic increase in iPSC formation from primary human somatic cells when MBD3 inhibition is introduced.
- FIGs. 101A-B are Western blot analyses showing expression of MBD3 (FIG. 101B) and of HSP90 (FIG. 101A) in v6.5 mouse ES cells after different treatments.
- V6.5 mouse ES cells were expanded for 4 days in the indicated conditions and subjected to Western blot analysis for MBD3 protein expression. The conditions are indicated in the FIG. above the lanes. Following are the abbreviations and concentrations of the indicated factors and agents.
- PBS phosphate buffered saline
- 2i/LIF small-molecule inhibitors CHIR99021 (CH, 3 ⁇ - Axon Medchem) and PD0325901 (PD, 1 ⁇ - TOCRIS), with 20 ng/ml LIF
- DMSO Dimethyl sulfoxide at a concentration of 0.1%
- TGFRi inhibitor of transforming growth factor receptor; SB431542 at 5 micromolar
- PKC-i inhibitor of protein kinase C
- Go6983 at 5 micromolar
- FIG. 102 - A histogram depicting the effect of the various WIS-NHSM media that are specified in Table 3 (Example 13 of the Examples section which follows) on methylation of DNA (% of total methylated cytosine levels (5 mdC) normalized to dG.
- FIG. 103 - A histogram depicting the effect of the various WIS-NHSM media that are specified in Table 3 (Example 13 of the Examples section which follows) on relative DNMT3L mRNA expression (normalized to primed cells).
- FIG. 104 - A histogram depicting the effect of the various WIS-NHSM media that are specified in Table 3 (Example 13 of the Examples section which follows) on relative DNMT3B mRNA expression (normalized to primed cells).
- FIG. 105- A histogram depicting the effect of the various WIS-NHSM media that are specified in Table 3 (Example 13 of the Examples section which follows) on % OCT4 + WIBR3 cells after 9 passages on 0.2% gelatin plates.
- FIGs. 106A-D FACS analyses for anti human CD61 (integrin B3) expression in human naive ESCs (FIGs. 106A-B) and PGCLCs (day 4 after induction; FIGs. 106C- D) carrying the NANOs3 mCherry knock-in reporter.
- FIGs. 106A and 106C - control cells (not stained with the antibody);
- FIGs. 108A-C Signaling and functional characteristics of human naive pluripotency.
- FIG. 108A Pluripotency maintenance by different pluripotent cell lines cultivated in various media conditions.
- the present inventors tested pluripotency maintenance by different pluripotent cell lines cultivated in various media conditions.
- Cell populations were equally divided and plated on gelatin/vitronectin coated plates in the indicated growth medium in which these cell lines are normally maintained (mouse naive cells - N2B27-2i/LIF, naive hESCs/hiPSCs - WIS-NHSM, mEpiSCs and primed hESCs/hiPSCs - in KSR/bFGF/TGFp conditions). 36 hours later the wells were supplemented with the indicated inhibitors or growth factors. After 14 days (2 passages), wells were analyzed by OCT4 immunostaining of direct detection of OCT4- GFP pluripotency reporter expression, to determine the relative percentage of undifferentiated pluripotent cells.
- FIG. 108B - LIF/Stat3 is required for stabilization of the in vitro stability of naive hESC/hiPSCs in WIS-NHSM.
- Naive V6.5 mESCs, naive WIS 1 and HI hESCs, and BJ naive hiPSCs were electroporated with mock a pBRY-CAGGS-flox-DsRedT4-IRES-Puro control plasmid, a plasmid encoding a dominant negative Stat3 Y705F mutant (Stat3-DN), or a plasmid encoding Stat3-CA constitutively active mutant (pBRY-Stat3-CA).
- Cells were passaged three times in the presence of puromycin selection. After 20 days, colonies positive for OCT4 pluripotency markers were counted and normalized to colonies from cells electroporated with empty vector.
- FIG. 108C Representative images showing human naive GFP labeled iPSC derived cell integration into different locations in the anterior part of an E10.5 mouse embryo.
- 1st column shows the whole embryo (z-stack interval is 30 um, 18 focal-planes total).
- the 2nd column shows a zoom in images focusing on the head region (white square Rl) where the hiPSC-derived cells (GFP positive cells) are pointed out (arrowheads, z-stack interval is 20 ⁇ , 11 stacks total).
- 3rd column shows the posterior part of the embryo (yellow square R2) where no GFP positive cells were detected (z-stack interval is 20 ⁇ , 9 focal-planes total).
- Light-blue square in the first two images in the 2nd column represent the area shown in the insert at the corner of each image, (ov-optic vesicle, op- optic pit, fba-first branchial arch, flb-forelimb bud, s-somite). Scale bar in all images is 50 ⁇ .
- FIG. 109A - CI human naive iPSCs were targeted with constitutively CAGGS promoter driven EGFP into the human AAVS 1 locus via ZFN utilization. Subsequently cells were microinjected into E2.5 mouse early morulas, and micro-manipulated embryos were allowed to recover and develop into blastocysts in vitro for additional 24 hours. Images show specific GFP+ human cell survival and integration in mouse pre-implantation embryos.
- FIG. 109A - CI human naive iPSCs were targeted with constitutively CAGGS promoter driven EGFP into the human AAVS 1 locus via ZFN utilization. Subsequently cells were microinjected into E2.5 mouse early morul
- FIG. 109C Representative confocal analysis following immunostaining for GFP (green) OCT4 (red) and CDX2 (magenta) was done 24 hours following mouse morula microinjections with GFP labeled naive hiPSCs. Note surviving GFP+ cells (white arrow) that specifically integrate and stain positive for OCT4, but not CDX2 (No co-localization between GFP and Cdx2 was not observed). Scale bar 10 ⁇ .
- FIG. 109D Subsequently, mouse blastocysts were implanted in vivo in mice and allowed to develop for additional 7 days in vivo (as indicated), before dissection and confocal analysis.
- FIG. 109E - Naive hiPSC derived cells are integrated into different locations at the craniofacial region of an E10.5 mouse embryo.
- First image in each row shows the maximum intensity projection of all z-stacks.
- the present invention in some embodiments thereof, relates to an isolated primate (e.g., human) naive pluripotent stem cell, novel culture medium which can be used to generate same and methods of generating and culturing same and, more particularly, but not exclusively, to methods of improving dedifferentiation of somatic cells for generation of induced pluripotent stem cells.
- isolated primate e.g., human
- novel culture medium which can be used to generate same and methods of generating and culturing same and, more particularly, but not exclusively, to methods of improving dedifferentiation of somatic cells for generation of induced pluripotent stem cells.
- the present inventors have uncovered the conditions, which are required for isolating and generating a primate (e.g., human) naive pluripotent stem cell, and maintaining same in the naive state.
- a primate e.g., human
- an isolated primate e.g., human
- naive pluripotent stem cell comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein:
- TFE3 transcription factor E3
- pluripotent stem cell refers to an undifferentiated cell (e.g., a primate cell, a mammalian cell) capable of differentiating into all three embryonic germ cell layers, i.e., to the mesoderm, ectoderm and endoderm embryonic germ layers.
- the pluripotent stem cell is selected from the group consisting of embryonic stem cell (ESC), induced pluripotent stem cells (iPSCs), and embryonic germ cell (EGC).
- the primate naive pluripotent stem cell is of homo sapiens (human), monkey, chimpanzee, Gorillas, Rhesus and/or Baboon.
- PSC pluripotent stem cell
- the pre-X-inactivation state is characterized by presence of two unmethylated alleles of an X-inactive specific transcript (XIST) gene in the female cell, and presence an unmethylated allele of the XIST gene in a male cell.
- XIST X-inactive specific transcript
- the XIST gene is located on human Xql3.2 chromosome and has the sequence depicted in clone NC_000023.10 (73040486..73072588, complement, based on GenBank version GRCh37.pl0.
- the XIST gene has a non-coding RNA which is provided in GenBank Accession NO. NR_001564.2 (SEQ ID NO:20).
- presence of two unmethylated alleles of XIST gene in a female cell refers to having below about 20% of CpG methylated reads sequenced in the XIST promoter, e.g., below about 19%, below about 18%, below about 17%, below about 16%, below about 15%, below about 14%, below about 13%, below about 12%, below about 11%, below about 10%, below about 9%, below about 8%, below about 7%, below about 6%, below about 5%, below about 4%, below about 3%, below about 2%, below about 1%, e.g., 0% (e.g., complete absence) of CpG methylated reads sequenced in the XIST promoter.
- presence of one unmethylated allele of XIST gene in a male cell refers to having below about 20% of CpG methylated reads sequenced in the XIST promoter, e.g., below about 19%, below about 18%, below about 17%, below about 16%, below about 15%, below about 14%, below about 13%, below about 12%, below about 11%, below about 10%, below about 9%, below about 8%, below about 7%, below about 6%, below about 5%, below about 4%, below about 3%, below about 2%, below about 1%, e.g., 0% of CpG methylated reads sequenced in the XIST promoter.
- a non-limited example of the XIST promoter which includes CpG islands which can be either methylated or unmethylated is provided in the XIST promoter amplicon set forth by SEQ ID NO:70.
- the human naive PSC is characterized by a reduced methylation of CpG islands as compared to a level of methylation of the CpG islands in a human primed PSC.
- human naive iPSCs and human naive ESCs are characterized by significantly low levels of total methylated cytosine out of the total guanine nucleotides in each cell (e.g., 1-2%, Figure 30G) as determined by Liquid Chromatography - Mass Spectrometry (LC-MS) quantitative analysis.
- LC-MS Liquid Chromatography - Mass Spectrometry
- the human naive PSC is characterized by 0-3% of total methylated cytosine out of the total Guanine nucleotides in the naive PSC cell.
- the primed PSC or a somatic cell has between 3.5%-5% of total methylated cytosine out of the total Guanine nucleotides in the primed PSC cell.
- the naive pluripotent stem cell of some embodiments of the invention is in a naive state.
- nonaive state refers to being in an undifferentiated state wherein both alleles of the X-inactive specific transcript (XIST) gene of the female cell are unmethylated, or wherein the XIST allele of the male cell is unmethylated.
- XIST X-inactive specific transcript
- naive PSCs of some embodiments of the invention (which are in a pre-X inactivation and a naive state) can upon differentiation inactivate one of the X chromosome alleles and methylate one of the XIST genes.
- the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the presence of ERK1/2 inhibitors (e.g., as exemplified here in below).
- the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the absence of TGF signaling inhibition (e.g., in the absence of TGF i).
- the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the presence of TGF stimulation, e.g., in the presence of TGF i and/or FGF2 stimulation.
- the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the presence of ERKl/2 inhibitors and in the presence of TGF i stimulation (e.g., by addition of TGF i) and/or FGF2 stimulation.
- PSC human embryonic stem cells
- hESC human embryonic stem cells
- hiPSC human induced pluripotent stem cells
- hEGC human embryonic germ cells
- isolated refers to at least partially separated from the natural environment e.g., from the primate (e.g., mammalian) embryo or the primate (e.g., mammalian) body.
- embryonic stem cells refers to embryonic cells which are capable of differentiating into cells of all three embryonic germ layers (i.e., endoderm, ectoderm and mesoderm), or remaining in an undifferentiated state.
- embryonic stem cells may comprise cells which are obtained from the embryonic tissue formed after gestation (e.g., blastocyst) before implantation of the embryo (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBCs) which are obtained from a post- implantation/pre-gastrulation stage blastocyst (see WO2006/040763) and embryonic germ (EG) cells which are obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
- gestation e.g., blastocyst
- EBCs extended blastocyst cells
- EG embryonic germ
- Induced pluripotent stem cells are cells obtained by de-differentiation of adult somatic cells which are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm).
- pluripotency i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm.
- such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics.
- the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell.
- the embryonic stem cells of some embodiments of the invention can be obtained using well-known cell-culture methods.
- human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo preimplantation embryos or from in vitro fertilized (IVF) embryos. Alternatively, a single cell human embryo can be expanded to the blastocyst stage.
- the zona pellucida is removed from the blastocyst and the inner cell mass (ICM) is isolated by immunosurgery, in which the trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting.
- the ICM is then plated in a tissue culture flask containing the appropriate medium which enables its outgrowth. Following 9 to 15 days, the ICM derived outgrowth is dissociated into clumps either by a mechanical dissociation or by an enzymatic degradation and the cells are then re-plated on a fresh tissue culture medium. Colonies demonstrating undifferentiated morphology are individually selected by micropipette, mechanically dissociated into clumps, and re -plated.
- ES cells can also be used according to some embodiments of the invention.
- Human ES cells can be purchased from the NIH human embryonic stem cells registry [Hypertext Transfer Protocol://grants (dot) nih (dot) gov/stem_cells/registry/current (dot) htm].
- Non-limiting examples of commercially available embryonic stem cell lines are BG01, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03, TE32, CHB-4, CHB-5, CHB-6, CHB-8, CHB-9, CHB-10, CHB-11, CHB-12, HUES 1, HUES 2, HUES 3, HUES 4, HUES 5, HUES 6, HUES 7, HUES 8, HUES 9, HUES 10, HUES 11, HUES 12, HUES 13, HUES 14, HUES 15, HUES 16, HUES 17, HUES 18, HUES 19, HUES 20, HUES 21, HUES 22, HUES 23, HUES 24, HUES 25, HUES 26, HUES 27, HUES 28, CyT49, RUES 3, WA01, UCSF4, NYUES 1, NYUES2, NYUES3, NYUES4, NYUES5, NYUES6, NYUES7, UCLA 1, UCLA 2, UCLA 3, WA077 (H7)
- ES cells can be obtained from other species as well, including mouse (Mills and Bradley, 2001), golden hamster [Doetschman et al., 1988, Dev Biol. 127: 224-7], rat [Iannaccone et al., 1994, Dev Biol. 163: 288-92] rabbit [Giles et al. 1993, Mol Reprod Dev. 36: 130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36: 424-33], several domestic animal species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43: 255-60; Wheeler 1994, Reprod Fertil Dev.
- EBCs Extended blastocyst cells
- EBCs can be obtained from a blastocyst of at least nine days post fertilization at a stage prior to gastrulation.
- the zona pellucida Prior to culturing the blastocyst, the zona pellucida is digested [for example by Tyrode's acidic solution (Sigma Aldrich, St Louis, MO, USA)] so as to expose the inner cell mass.
- the blastocysts are then cultured as whole embryos for at least nine and no more than fourteen days post fertilization (i.e., prior to the gastrulation event) in vitro using standard embryonic stem cell culturing methods.
- EG cells are prepared from the primordial germ cells obtained from fetuses of about 8-11 weeks of gestation (in the case of a human fetus) using laboratory techniques known to anyone skilled in the arts.
- the genital ridges are dissociated and cut into small chunks which are thereafter disaggregated into cells by mechanical dissociation.
- the EG cells are then grown in tissue culture flasks with the appropriate medium.
- the cells are cultured with daily replacement of medium until a cell morphology consistent with EG cells is observed, typically after 7-30 days or 1-4 passages.
- Shamblott et al. [Proc. Natl. Acad. Sci. USA 95: 13726, 1998] and U.S. Pat. No. 6,090,622.
- iPS Induced pluripotent stem cells
- somatic cells can be generated from somatic cells by genetic manipulation of somatic cells, e.g., by retroviral transduction of somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KLF4 [Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al.
- Chromosome X inactivation is an early developmental process in mammalian females that transcriptionally silences one of the pair of X chromosomes, thus providing dosage equivalence between males and females.
- the process is regulated by several factors, including a region of chromosome X called the X inactivation center (XIC).
- XIC comprises several non-coding and protein-coding genes, and XIST gene was the first non-coding gene identified within the XIC.
- XIST When XIST bodies are present, then XIST is exclusively expressed from the XIC of the inactive X chromosome, and is essential for the spread of X-inactivation.
- the methylation status of the XIST gene can be determined by various methods such as bisulfite sequencing [Lengner Cell 141, 872-883 (2010); Hanna et al., Cell 143, 508-525 (2010), each of which is fully incorporated herein by reference in its entirety] of the promoter region of the XIST gene.
- the XIST promoter region can be amplified by the following PCR primers: Forward primer (used on bisulfite treated DNA): 5'-taa att tta aat taa tta aat tat (SEQ ID NO:22), and Reverse primer (used on bisulfite treated DNA): 5'- tgt ttt aga aag aat ttt aag tgt aga ga (SEQ ID NO:23).
- the amplicon region amplified by the above primers (203 bp covering human XIST transcription start site) is provided in SEQ ID NO:70.
- a representative result of such XIST bisulfite sequencing is shown in Figure 23A.
- the CpG islands in the XIST promoter amplicon are highlighted in yellow in Figure 27.
- methylation specific PCR assay for the XIST gene.
- Bisulfite treatment of genomic DNA is performed with the EpiTect Bisulfite kit (Qiagen, Germany).
- Methylation- specific PCR utilizes this sodium bisulfite treatment to distinguish methylated from unmethylated DNA.
- Purified, non-methylated and methylated human DNA standards include the Human Methylated & Non- methylated DNA set (Zymo Research, USA). Each sample is analyzed in two independent MS -PCR reactions.
- PCR reactions included 25 ⁇ PCR reaction mix which contained 2X PCR HotStart Premix buffer (Takara, Tokyo, Japan), 0.5 ⁇ primer-M forward and 0.5 ⁇ primer-M reverse in the PCR reaction amplifying the methylated imprint specifically or 0.5 ⁇ primer-U forward and 0.5 ⁇ primer-U reverse in the unmethylated PCR, and 2 ⁇ of bisulfite-modified DNA.
- Primer pairs for methylation and unmethylation specific PCR for XIST gene include: Unmethylation forward 5'- TGTTTTTTTGTTTATTGGGGTTGTG (SEQ ID NO:21 ; M97168, 691-715), and Unmethylation reverse 5 ' - AC AACT AACCTAA ACC AAATT ATAC A (SEQ ID NO:67; M97168, 944-970); Methylation forward 5'-TGTTTTTTTGTTTATCGGGGTCGCG (SEQ ID NO:68; M97168, 691-715) and Methylation reverse 5'- C G A ATT AT AC G AC A A ATCT A A A AT A AC G (SEQ ID NO:69; M97168, 927-954) can be used as described elsewhere (Kawakami T, et al., Lancet.
- XIST unmethylated DNA fragments in male-derived plasma as a tumour marker for testicular cancer which is fully incorporated herein by reference in its entirety
- the polymerase is activated at 95°C for 5 minutes.
- DNA is amplified in 35 cycles at 94°C, 60°C, 72°C for 45 seconds each, followed by a final extension at 72°C for 5 minutes.
- the resulting PCR fragments are 264 bp (base pairs) for the methylated allele (M) and 280 bp for the unmethylated allele (U).
- PCR products are separated on a 2% agarose gel, stained with ethidium bromide and visualized under UV illumination.
- the methylation status of the XIST gene can be determined using Southern blot analyses using methylation- sensitive restriction enzymes and probes specific to the XIST gene (or CpG islands), essentially as described in Lengner Cell 141, 872-883 (2010); and Hanna et al., Cell 143, 508-525 (2010), each of which is fully incorporated herein by reference in its entirety.
- a methylation assay which can be used to determine the methylation status of the XIST gene in a cell (TAKASHI SADO et al., DEVELOPMENTAL DYNAMICS 205: 421-434 (1996).
- Genomic DNA is prepared from the cells using known methods (e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992)). Briefly, 10 ⁇ g of DNA is digested with one of methylation sensitive enzymes (Hpall, Cfol, MZuI, SacII, and Aual) in combination with EcoRI or EcoRI + PuuII according to the manufacturers' recommendation. Digestion is carried out overnight with 10-fold excess of each enzyme in reaction volume of 300 ⁇ .
- Hpall, Cfol, MZuI, SacII, and Aual methylation sensitive enzymes
- Restricted DNA is purified by phenol extraction, precipitated with ethanol, electrophoresed on 1% or 2% agarose gel, blotted onto Hybond N + (Amersham, Buckinghamshire, UK), and probed by a cDNA fragment of Xist 5' portion (probe 1) or a genomic Hpal-Mlul fragment of the 5' upstream region (probe 2) labeled by random priming. Subsequent washes are carried out in accordance with the membrane manufacturer's recommendation.
- the skilled in the art is capable of distinguishing between an unmethylated allele of XIST and a methylated allele of XIST, and thus can easily distinguish between a female cell having two unmethylated alleles of the XIST gene or a female cell having one methylated and one unmethylated allele of XIST.
- the skilled in the art can easily distinguish between a male cell having a methylated XIST allele or a male cell having an unmethylated XIST allele.
- the isolated primate e.g., human
- the isolated primate e.g., human
- the isolated primate is in an undifferentiated and pluripotent state (capable of differentiating into all three embryonic germ layers).
- Primed human PSCs such as hiPSCs or hESCs are induced to differentiation upon incubation with bone morphogenetic protein 4 (BMP4), JNK inhibitor, and P38 inhibitor [Hanna et al., Cell 143, 508-525 (2010); De Los Angeles, et al., Curr. Opin. Genet. Dev. 22, 272-282 (2012)].
- BMP4 bone morphogenetic protein 4
- JNK inhibitor JNK inhibitor
- P38 inhibitor P38 inhibitor
- the naive PSC of some embodiments of the invention is "resistant" to induction of differentiation by BMP4, JNK inhibitor, and/or P38 inhibitor.
- incubation of the naive PSC with BMP4 or forskolin did not alter the undifferentiated and pluripotent state of the Naive PSCs.
- an agent selected from the group consisting of Bone morphogenetic protein 4 (BMP4), JNK inhibitor, and P38 inhibitor the naive PSC remains in the pluripotent state.
- the naive PSC has an inhibited p38 pathway as compared to a primed PSC.
- p38 activity is inhibited in the naive PSC.
- the level of p38 RNA and/or phosphorylated p38 protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of p38 RNA and/or phosphorylated p38 protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to p38 inhibition.
- the naive PSC has an inhibited JNK pathway as compared to a primed PSC.
- JNK activity is inhibited in the naive PSC.
- the level of JNK RNA and/or phosphorylated JNK protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of JNK RNA and/or phosphorylated JNK protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to JNK inhibition.
- the naive PSC has an inhibited ROCK pathway as compared to a primed PSC.
- ROCK activity is inhibited in the naive PSC.
- the level of ROCK RNA and/or phosphorylated ROCK protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of ROCK RNA and/or phosphorylated ROCK protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to ROCK inhibition.
- Monitoring the differentiation state of pluripotent stem cells - During the culturing step the pluripotent stem cells are further monitored for their differentiation state.
- Cell differentiation can be determined upon examination of cell or tissue-specific markers which are known to be indicative of differentiation.
- primate PSCs may express the stage- specific embryonic antigen (SSEA) 4, the tumour-rejecting antigen (TRA)-l-60 and TRA-1-81.
- SSEA stage-specific embryonic antigen
- TRA tumour-rejecting antigen
- Undifferentiated pluripotent stem cells highly express SSEA4, TRA-1-60 and TRA-1-81 markers and down regulate their expression upon differentiation.
- Tissue/cell specific markers can be detected using immunological techniques well known in the art [Thomson JA et al., (1998). Science 282: 1145-7]. Examples include, but are not limited to, flow cytometry for membrane-bound markers, immunohistochemistry for extracellular and intracellular markers and enzymatic immunoassay, for secreted molecular markers.
- Determination of PSC differentiation can also be effected via measurements of alkaline phosphatase activity.
- Undifferentiated human ES cells have alkaline phosphatase activity which can be detected by fixing the cells with 4% paraformaldehyde and developing with the Vector Red substrate kit according to manufacturer's instructions (Vector Laboratories, Burlingame, California, USA).
- an isolated population of naive PSCs comprising at least about 10%, at least about 12%, at least about 14%, at least about 16%, at least about 18%, at least about 20%, at least about 22%, at least about 24%, at least about 26%, at least about 28%, at least about 30%, at least about 32%, at least about 34%, at least about 36%, at least about 38%, at least about 40%, at least about 42%, at least about 44%, at least about 46%, at least about 48%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% of the isolated human naive PSC cells of some embodiments of the invention.
- the isolated population of cells is positive for one or more markers. Positive is also abbreviated by (+). Positive for a marker means that at least about 70%, 80%, 85%, 90%, 95%, or 100% of the cells in the population present detectable levels of the marker (e.g., OCT4, NANOG, TRA1- 81, TRAl-60, SSEA3, SSEA4) assayed by a method known to those of skill in the art [e.g., fluorescent activated cell sorter (FACS) analysis, immunofluorescence, immunohistochemistry, Western blot analysis].
- FACS fluorescent activated cell sorter
- the cells stain positively with anti SSEA3 antibody as determined using FACS or stained positive by immunofluorescence or immunohistochemistry using the OCT4 antibody.
- the OCT4, NANOG, TRA1-81, TRAl-60, SSEA3, SSEA4-positive cells stain negatively to one or more markers, e.g., SSEA1.
- Negative is also abbreviated by (-). Negative for a marker means that no more than about 30%, no more than about 25%, no more than about 20%, no more than about 15%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, no more than about 1%, of the cells in the population present detectable levels of the marker (e.g., SSEA1) assayed by a method known to those of skill in the art such as immunofluorescence or FACS. Such a marker presentation either of a single cell or an isolated population of cells is also referred to as a signature.
- the present inventors have shown a population of stem cells having about 99% of naive PSC.
- the naive PSC expresses
- Methods of detecting XIST expression include for example reverse transcriptase - polymerase chain reaction (RT-PCR) analysis using XIST specific PCR primers, e.g., the forward primer: 5'- AGGGAGCAGTTTGCCCTACT (SEQ ID NO:24), and the reverse primer: 5'- CACATGCAGCGTGGTATCTT (SEQ ID NO: 25), as shown in Figure 23B.
- RT-PCR reverse transcriptase - polymerase chain reaction
- the naive PSC is devoid of
- XIST bodies refers to a XIST-coated inactive X chromosome.
- RNA fluorescent in situ hybridization FISH
- FISH fluorescence in situ hybridization
- human pluripotent stem cells are harvested, MEF-depleted, and cytospun onto glass slides before fixation.
- cDNA probes are generated to XIST exon 1 (GenBank Accession No. U80460: 61251-69449, SEQ ID NO:26) and exon 6 (GenBank Accession No.
- the naive PSC is devoid of an H3K27me3/polycomb focus.
- H3K27me3/polycomb focus refers to nuclear focus obtained following immuno- staining that corresponds to condensed inactive X chromosome.
- H3K27me3/polycomb focus are known in the art and include for example, the use of immuno-fluorescence analysis using anti H3K27me3 antibodies (e.g., Rabbit anti H3K27me3, Millipore, CA, USA Catalogue number 07- 449), as shown for example in Figures 23C-D.
- anti H3K27me3 antibodies e.g., Rabbit anti H3K27me3, Millipore, CA, USA Catalogue number 07- 449
- the naive PSC has a low XIST expression level while being in the naive state, without inactivation of any of the X chromosomes and without presence of XIST bodies.
- the naive PSC is capable of X- inactivation when induced to differentiate.
- the naive PSC is capable of differentiation into the endodermal, mesodermal and ectodermal embryonic germ layers.
- Methods of determining ability of stem cells to differentiate into the endodermal, mesodermal and ectodermal embryonic germ layers include for example generation of embryoid bodies (in vitro) or teratomas (in vivo) as shown in the Examples section which follows and in Figures such as 12L-N, 13K-M, 13S-U, 19A-I, and 20A-T.
- embryonic bodies refers to three dimensional multicellular aggregates of differentiated and undifferentiated cells derivatives of three embryonic germ layers.
- Embryoid bodies are formed upon the removal of the naive PSCs from feeder layers or feeder cells-free culture systems.
- Naive PSCs removal can be performed using type IV Collagenase treatment or Trypsin for a limited time.
- the cells are transferred to tissue culture plates containing a culture medium supplemented with serum and amino acids.
- EBs are further monitored for their differentiation state.
- Cell differentiation can be determined upon examination of cell or tissue- specific markers which are known to be indicative of differentiation.
- EB-derived- differentiated cells may express the neurofilament 68 KD which is a characteristic marker of the ectoderm cell lineage.
- the differentiation level of the EB cells can be monitored by following the loss of expression of Oct-4, and the increased expression level of other markers such as oc- fetoprotein, NF-68 kDa, a-cardiac and albumin.
- Methods useful for monitoring the expression level of specific genes are well known in the art and include RT-PCR, semiquantitative RT-PCR, Northern blot, RNA in situ hybridization, Western blot analysis and immunohistochemistry.
- Teratomas The pluripotent capacity of the naive PSCs of some embodiments of the invention can also be confirmed by injecting cells into SCID mice [Evans MJ and Kaufman M (1983). Pluripotential cells grown directly from normal mouse embryos. Cancer Surv. 2: 185-208], which upon injection form teratomas. Teratomas are fixed using 4 % paraformaldehyde and histologically examined for the three germ layers (i.e., endoderm, mesoderm and ectoderm).
- naive PSCs are often also being monitored for karyotype, in order to verify cytological euploidity, wherein all chromosomes are present and not detectably altered during culturing.
- Cultured naive PSCs can be karyotyped using a standard Giemsa staining and compared to published karyotypes of the corresponding species.
- the naive PSC is capable of being maintained in the undifferentiated and pluripotent state, while maintaining the naive state (as defined above) for more than about 20 passages in culture, e.g., for at least about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75 and about 80 passages while in culture.
- the naive PSC which is maintained in the undifferentiated, pluripotent and naive state (as defined above), expresses significantly lower levels SOXl as compared to the level of expression present in primed PSC (e.g., primed ESC) under identical SOX1 assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
- primed PSC e.g., primed ESC
- the naive PSC expresses a lower level of MHC class I as compared to a primed PSC under identical detection assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
- the level of MHC class I can be determined by various methods known in the art such as FACS analysis using specific antibodies to detect the surface expression of the MHC class I molecules (e.g., see Figures 24B and 24C), and using fluorescently labeled anti HLA-A,B,C antibody (BD Biosciences).
- the naive PSC is characterized by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% more RNA polymerase II pausing on chromosomes as compared to a primed PSC under identical assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
- the naive PSC exhibiting a pre-X inactivation status similar to the pre-X inactivation status of a human Inner cell mass (ICM).
- ICM Human Inner cell mass
- a cell culture comprising the isolated naive PSC of some embodiments of the invention, or the isolated population of naive PSCs of some embodiments of the invention and a culture medium.
- the culture medium is capable of maintaining the naive PSC in an undifferentiated and pluripotent state for at least 10 passages.
- the cell culture can be maintained in vitro, under culturing conditions, in which the cells are being passaged for extended periods of time (e.g., for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more), while maintaining the cells in their naive pluripotent and undifferentiated state.
- culture medium refers to a solid or a liquid substance used to support the growth of stem cells and maintain them in an undifferentiated state.
- culture medium refers to a liquid substance capable of maintaining the stem cells in an undifferentiated state.
- the culture medium used by the present invention can be a water-based medium which includes a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids, proteins such as cytokines, growth factors and hormones, all of which are needed for cell proliferation and are capable of maintaining the stem cells in an undifferentiated state.
- a culture medium can be a synthetic tissue culture medium such as Ko-DMEM (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), DMEM/F12 (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), or DMEM/F12 (Biological Industries, Biet Haemek, Israel), supplemented with the necessary additives as is further described hereinunder.
- all ingredients included in the culture medium of the present invention are substantially pure, with a tissue culture grade.
- the present inventors have identified a novel culture medium which can be used to generate naive PSC and maintain them in a pluripotent and undifferentiated state.
- a novel culture medium which can be used to generate naive PSC and maintain them in a pluripotent and undifferentiated state.
- Figures 12A-G, 85A-C, 102, 103, 104, and 105, and Tables 3, 4, and 5 in the Examples section which follows following laborious experimentations the present inventors have uncovered the factors needed for maintaining naive PSCs in the "naive state", as was evidenced by the expression of OCT4-GFP+ (positive) cells and percentage of total methylated cytosine (% 5mdC).
- a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF), transforming growth factor beta 1 (TGF i), a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor beta 1
- PKC protein kinase C
- ROCK inhibitor a ROCK inhibitor
- a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor, a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
- TGFR transforming growth factor receptor
- FGFR fibroblast growth factor receptor
- PKC protein kinase C
- ROCK inhibitor a ROCK inhibitor
- STAT3 refers to the signal transducer and activator of transcription 3 gene product (acute -phase response factor) (Gene ID 6774). In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators.
- Known STAT3 activators include, but are not limited to, interferon (IFN), epidermal growth factor (EGF), interleukin 5 (IL5), interleukin 6 (IL6), hepatocyte growth factor (HGF), leukemia inhibitory factor (LIF) and bone morphogenetic protein 2 (BMP2).
- the STAT3 activator which is used by the medium, cells and/or methods of some embodiments of the invention is selected from the group consisting of LIF, IL6 and EGF.
- the STAT3 activator which is used by the medium, cells and/or methods of some embodiments of the invention is selected from the group consisting of LIF, and IL6.
- the STAT3 activator which is used by the medium, cells and/or methods of some embodiments of the invention is LIF.
- the culture medium further comprising at least one additional agent selected from the group consisting of: insulinlike growth factor 1 (IGFl), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, KenpauUone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGFl insulinlike growth factor 1
- IGFII insulin-like growth factor II
- BMP bone morphogenetic protein
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor Forskolin, KenpauUone, BayK8644, Bixl294, and stem cell factor (SCF).
- the culture medium further comprising at least one additional agent selected from the group consisting of: insulinlike growth factor 1 (IGFl), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGFl insulinlike growth factor 1
- IGFII insulin-like growth factor II
- BMP4 bone morphogenetic protein 4
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor forskolin
- Kenpaullone Kenpaullone
- BayK8644 BayK8644
- Bixl294 Bixl294
- SCF stem cell factor
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the PKC inhibitor.
- the culture medium further comprising FGFR inhibitor.
- the culture medium further comprising TGFR inhibitor.
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the TGF i and the protein kinase C inhibitor.
- the culture medium further comprising an FGFR inhibitor.
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the bFGF and the TGF i.
- the culture medium further comprising a ROCK inhibitor.
- the culture medium further comprising a protein kinase C inhibitor.
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
- the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
- BMP bone morphogenetic protein
- TGFR transforming growth factor receptor
- the culture medium further comprising a Sonic Hedgehog pathway (SHH) inhibitor.
- SHH Sonic Hedgehog pathway
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
- the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
- FGFR fibroblast growth factor receptor
- the culture medium further comprises an agent selected from the group consisting of insulin-like growth factor II (IGFII), stem cell factor (SCF) and transforming growth factor beta 1 (TGF i).
- IGFII insulin-like growth factor II
- SCF stem cell factor
- TGF i transforming growth factor beta 1
- the culture medium comprising leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
- the culture medium further comprising a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi).
- FGFR fibroblast growth factor receptor
- the culture medium further comprising a transforming growth factor receptor inhibitor (TGFRi).
- TGFRi transforming growth factor receptor inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- a protein kinase C inhibitor further comprises a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi).
- FGFRi fibroblast growth factor receptor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a transforming growth factor receptor inhibitor (TGFRi).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a protein kinase C inhibitor
- TGFRi transforming growth factor receptor inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- a protein kinase C inhibitor further comprises a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi).
- FGFRi fibroblast growth factor receptor
- TGFRi transforming growth factor receptor inhibitor
- the culture medium comprising leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a JNK inhibitor
- TGF i protein kinase C inhibitor
- medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor further comprising FGFR inhibitor (FGFRi).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a JNK inhibitor
- TGF i protein kinase C inhibitor
- FGFRi protein kinase C inhibitor
- the culture medium comprising leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF l).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a JNK inhibitor
- JNK inhibitor basic fibroblast growth factor
- TGF transforming growth factor-beta 1
- LIF leukemia inhibitor factor
- LIF refers to a polypeptide which comprises the amino acid sequence as set forth by GenBank Accession No. NP_001244064.1 (SEQ ID NO: 119), encoded by the nucleotide sequence set forth in GenBank Accession No. NM_001257135 (SEQ ID NO:30).
- the LIF used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of naive primate (e.g., human) PSCs, while maintaining their pluripotent capacity.
- LIF can be obtained from various manufacturers such as Millipore, Peprotech, and R&D systems.
- LIF is provided at a concentration range from about 0.5 nanogram per milliliter (ng/ml) to about 1000 ng/ml, e.g., about 1-1000 ng/ml, e.g., about 1-900 ng/ml, e.g., about 1-800 ng/ml, e.g., about 1- 700 ng/ml, e.g., about 1-600 ng/ml, e.g., about 1-500 ng/ml, e.g., about 1-400 ng/ml, e.g., about 1-300 ng/ml, e.g., about 1-200 ng/ml, e.g., about 1-100 ng/ml, e.g., about 1- 50 ng/ml, e.g., about 2-50 ng/ml, e.g., about 4-50 ng/ml, e.g., about 5-50 ng/ml, e
- ng/ml
- IL6 refers to a polypeptide which comprises the amino acid sequence set forth by GenBank Accession No. NP_000591.1 (SEQ ID NO: 120), which is encoded by the nucleic acid set forth by GenBank Accession No. NM_000600.3 (SEQ ID NO: 111).
- the IL6 used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of naive primate (e.g., human) PSCs, while maintaining their pluripotent capacity.
- IL6 can be obtained from various manufacturers such as Speed BioSystems, Millipore, Peprotech, and R&D systems.
- IL6 is provided at a concentration range from about 0.1 ng/ml to about 100 ng/ml, e.g., about 0.1-90 ng/ml, e.g., about 0.1-80 ng/ml, e.g., about 0.1-70 ng/ml, e.g., about 0.1-50 ng/ml, e.g., about 0.1-40 ng/ml, e.g., about 0.1-30 ng/ml, e.g., about 0.1-20 ng/ml, e.g., about 0.1-10 ng/ml, e.g., about 0.1-8 ng/ml, e.g., about 0.1-7 ng/ml, e.g., about 0.1-6 ng/ml, e.g., about 0.1-5 ng/ml, e.g., about 0.1-4 ng/ml, e.g., about 0.1-3
- TGF i refers to an isoform beta-1 ( ⁇ ) of the transforming growth factor beta (e.g., homo sapiens TGF i, GenBank Accession No. NP_000651; SEQ ID NO:28, which is encoded by the sequence depicted in GenBank Accession No. NM_000660.5; SEQ ID NO:31). TGF acts in inducing transformation and also acts as a negative autocrine growth factor. TGF i isoform can be obtained from various commercial sources such as R&D Systems Minneapolis MN, USA.
- TGF i is provided at a concentration range from about 0.1 nanogram per milliliter (ng/ml) to about 500 ng/ml, e.g., about 0.1-400 ng/ml, e.g., about 0.1-300 ng/ml, e.g., about 0.1-200 ng/ml, e.g., about 0.1-100 ng/ml, e.g., about 0.1-50 ng/ml, e.g., about 0.1-30 ng/ml, e.g., about 0.1- 20 ng/ml, e.g., about 0.1-10 ng/ml, e.g., about 0.1-8 ng/ml, e.g., about 0.1-7 ng/ml, e.g., about 0.1-6 ng/ml, e.g., about 0.1-5 ng/ml, e.g., about 0.1-4 ng/ml
- activators of TGF/ACTIVIN pathway including ACTIVIN A (also known as Inhibin beta A, INHBA, Gene ID: 3624; GenBank Accession No. NM_002192.2 (SEQ ID NO: 123), which encodes GenBank Accession No. NP_002183.1; SEQ ID NO: 117) can be used to replace TGF l.
- ACTIVIN A also known as Inhibin beta A, INHBA, Gene ID: 3624; GenBank Accession No. NM_002192.2 (SEQ ID NO: 123), which encodes GenBank Accession No. NP_002183.1; SEQ ID NO: 117
- the TGF i cytokine can be replaced with recombinant Nodal and/or Activin.
- basic fibroblast growth factor or “FGF2” which are interchangeably used herein refer to a polypeptide of the fibroblast growth factor (FGF) family, which bind heparin and possess broad mitogenic and angiogenic activities.
- the mRNA for the BFGF gene contains multiple polyadenylation sites, and is alternatively translated from non-AUG (CUG) and AUG initiation codons, resulting in five different isoforms with distinct properties.
- the CUG-initiated isoforms are localized in the nucleus and are responsible for the intracrine effect, whereas, the AUG-initiated form is mostly cytosolic and is responsible for the paracrine and autocrine effects of this FGF.
- the bFGF used by the medium of some embodiments of the invention is provided in GenBank Accession No. NP_001997 (SEQ ID NO:29).
- BFGF can be obtained from various manufacturers such as Peprotech, RnD systems, Millipore.
- the bFGF used by the medium of some embodiments of the invention is provided from R&D Systems (Catalog Number: 233-FB).
- bFGF is provided at a concentration range from about 0.5 nanogram per milliliter (ng/ml) to about 500 ng/ml, e.g., about 1-500 ng/ml, e.g., about 1-400 ng/ml, e.g., about 1-300 ng/ml, e.g., about 1- 200 ng/ml, e.g., about 1-100 ng/ml, e.g., about 1-80 ng/ml, e.g., about 1-70 ng/ml, e.g., about 1-70 ng/ml, e.g., about 1-60 ng/ml, e.g., about 1-50 ng/ml, e.g., about 1-40 ng/ml, e.g., about 1-30 ng/ml, e.g., about 1-20 ng/ml, e.g., about 2-20 ng/ml,
- any of the proteinaceous factors used in the culture medium of some embodiments of the invention can be recombinantly expressed or biochemically synthesized.
- naturally occurring proteinaceous factors such as bFGF and TGF can be purified from biological samples (e.g., from human serum, cell cultures) using methods well known in the art.
- Biochemical synthesis of the proteinaceous factors of the present invention can be performed using standard solid phase techniques. These methods include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation and classical solution synthesis.
- Recombinant expression of the proteinaceous factors of the present invention can be generated using recombinant techniques such as described by Bitter et al., (1987) Methods in Enzymol. 153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89, Brisson et al. (1984) Nature 310:511-514, Takamatsu et al. (1987) EMBO J. 3:17-311, Coruzzi et al. (1984) EMBO J.
- the proteinaceous factors of the present invention e.g., the LIF, IL6, TGF i, or bFGF
- a polynucleotide sequence encoding the LIF, IL6, TGF i, or bFGF [e.g., the polynucleotide set forth by SEQ ID NO: 30 (LIF, GenBank Accession No. NM_001257135), SEQ ID NO: 31 (TGF i, GenBank Accession NO. NM_000660), SEQ ID NO: 32 (BFGF, GenBank Accession NO. NM_002006), SEQ ID NO: l l l (IL6, GenBank Accession No.
- NM_000600.3 is preferably ligated into a nucleic acid construct suitable for expression in a host cell [i.e., a cell in which the polynucleotide encoding the polypeptide-of-choice (e.g., the LIF, IL6, TGF i, or bFGF) is expressed].
- a host cell i.e., a cell in which the polynucleotide encoding the polypeptide-of-choice (e.g., the LIF, IL6, TGF i, or bFGF) is expressed.
- the host cell employed is a eukaryotic host cell, more preferably a mammalian host cell such as human cell or CHO cell). Additional description of nucleic acid constructs (or expression vectors) which can be used to produce a polypeptide-of-interest (e.g., the proteinaceous factors described above) is provided hereinunder.
- ERK1 refers to the mitogen-activated protein kinase 3 (MAPK3) isoform 1 set forth by GenBank Accession No. NP_002737.2 (SEQ ID NO:33), the MAPK3 isoform 2 set forth by GenBank Accession No. NP_001035145.1 (SEQ ID NO:34), the MAPK3 isoform 3 set forth by GenBank Accession No. NP_001103361.1 (SEQ ID NO:35) and/or ERK1 set forth in GenBank Accession No. M84490 (SEQ ID NO:36) having the MAPK signaling activity.
- MAPK3 mitogen-activated protein kinase 3
- M84490 SEQ ID NO:36
- ERP2 refers to the mitogen-activated protein kinase 1 (MAPKl) set forth by GenBank Accession No. NP_002736.3 (SEQ ID NO:37) and/or GenBank Accession No. NP_620407.1 (SEQ ID NO:38) having the MAPK signaling activity.
- ERKl/2 inhibitor refers to any molecule capable of inhibiting the activity of ERKl/2 as determined by Western blot protein detection of phosphorylated ERKl/2 proteins.
- Non-limiting examples of ERKl/2 inhibitors include PD0325901 (AXONMEDCHEM - AXON 1408), PD98059 (AXONMEDCHEM - Axon 1223), and PD184352 (AXONMEDCHEM - AXON 1368); or even inhibitors of RAF (which is upstream of ERK) such as Sorafenib or SB (AXONMEDCHEM -AXON 1397).
- PD0325901 is provided at a concentration range from about 0.01 microM ( ⁇ ) to about 50 ⁇ , e.g., between about 0.05-45 ⁇ , e.g., between about 0.1-50 ⁇ , e.g., between about 0.1-45 ⁇ , e.g., between about 0.1-40 ⁇ , e.g., between about 0.1-35 ⁇ , e.g., between about 0.1-30 ⁇ , e.g., between about 0.1-25 ⁇ , e.g., between about 0.1-20 ⁇ , e.g., between about 0.1-15 ⁇ , e.g., between about 0.1-10 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.3-10 ⁇ , e.g., between about 0.4-10 ⁇ , e.g., between about 0.5-10 ⁇ , e.g., between about 0.6-10 ⁇ , e.g.
- PD98059 is provided at a concentration range from about 0.1 microM ( ⁇ ) to about 70 ⁇ , e.g., between about 0.1-65 ⁇ , e.g., between about 0.1-55 ⁇ , e.g., between about 0.1-50 ⁇ , e.g., between about 0.1-45 ⁇ , e.g., between about 0.1-40 ⁇ , e.g., between about 0.1-35 ⁇ , e.g., between about 0.1-30 ⁇ , e.g., between about 0.1-25 ⁇ , e.g., between about 0.1-20 ⁇ , e.g., between about 0.1-15 ⁇ , e.g., between about 2-20 ⁇ , e.g., between about 5-15 ⁇ , e.g., about 10 ⁇ , e.g., between about 0.1-10 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.3
- PD 184352 is provided at a concentration range from about 0.1 microM ( ⁇ ) to about 70 ⁇ , e.g., between about 0.1-60 ⁇ , e.g., between about 0.1-50 ⁇ , e.g., between about 0.5-50 ⁇ , e.g., between about 0.5-45 ⁇ , e.g., between about 0.5-40 ⁇ , e.g., between about 0.1-35 ⁇ , e.g., between about 0.5-30 ⁇ , e.g., between about 0.5-25 ⁇ , e.g., between about 0.5-20 ⁇ , e.g., between about 0.5-15 ⁇ , e.g., between about 0.5-10 ⁇ , e.g., between 0.5-9 ⁇ , e.g., between 0.5-8 ⁇ , e.g., between 0.5-7 ⁇ , e.g., between 0.9-6 ⁇ , e.g., between 0.8-5 ⁇ ,
- Sorafenib is provided at a concentration range from about 0.1 microM ( ⁇ ) to about 70 ⁇ , e.g., between about 0.1-60 ⁇ , e.g., between about 0.1-50 ⁇ , e.g., between about 0.5-50 ⁇ , e.g., between about 0.5-45 ⁇ , e.g., between about 0.5-40 ⁇ , e.g., between about 0.1-35 ⁇ , e.g., between about 0.5-30 ⁇ , e.g., between about 0.5-25 ⁇ , e.g., between about 0.5-20 ⁇ , e.g., between about 0.5-15 ⁇ , e.g., between about 0.5-10 ⁇ , e.g., between 0.5-9 ⁇ , e.g., between
- GSK3b refers to the glycogen synthase kinase 3 beta protein set forth by GenBank Accession Nos. NP_002084.2 (SEQ ID NO: 121) and/or NP_001139628.1 (SEQ ID NO: 122) having the WNT signaling regulatory activity via its kinase activity.
- GSK3b inhibitor refers to any molecule capable of inhibiting the activity of GSK3b as determined by specifically inhibiting levels of phosphorylated GSK3b (out of total GSK3b present in a cell).
- GSK3b inhibitors include CHIR99021 (AXONMEDCHEM - AXON 1386), BIO (AXONMEDCHEM - Axon 1693), and Kenpaullone (TOCRIS - cat no. 1398).
- CHIR99021 is provided at a concentration range of between about 0.1-50 ⁇ , e.g., from about 0.2 ⁇ to about 50 ⁇ , e.g., between about 0.2-45 ⁇ , e.g., between about 0.2-50 ⁇ , e.g., between about 0.2-45 ⁇ , e.g., between about 0.2-40 ⁇ , e.g., between about 0.2-35 ⁇ , e.g., between about 0.2-30 ⁇ , e.g., between about 0.2-25 ⁇ , e.g., between about 0.2-20 ⁇ , e.g., between about 0.2-15 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.3-10 ⁇ , e.g., between about 0.4-10 ⁇ , e.g., between about 0.5-10 ⁇ , e.g., between about 0.5-10 ⁇ , e.
- BIO is provided at a concentration range of between about 0.1-70 ⁇ , e.g., from about 0.2 ⁇ to about 70 ⁇ , e.g., between about 0.2-60 ⁇ , e.g., between about 0.2-55 ⁇ , e.g., between about 0.2-50 ⁇ , e.g., between about 0.2-45 ⁇ , e.g., between about 0.2-40 ⁇ , e.g., between about 0.2-35 ⁇ , e.g., between about 0.2-30 ⁇ , e.g., between about 0.2-25 ⁇ , e.g., between about 0.2-20 ⁇ , e.g., between about 0.2-15 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.3-10 ⁇ , e.g., between about 0.4-10 ⁇ , e.g., between about 0.5-10 ⁇ , e.g., between about 0.6-10
- Kenpaullone is provided at a concentration range of between about 0.1-70 ⁇ , e.g., from about 0.2 ⁇ to about 70 ⁇ , e.g., between about 0.2-60 ⁇ , e.g., between about 0.2-55 ⁇ , e.g., between about 0.2-50 ⁇ , e.g., between about 0.2-45 ⁇ , e.g., between about 0.2-40 ⁇ , e.g., between about 0.2-35 ⁇ , e.g., between about 0.2-30 ⁇ , e.g., between about 0.2-25 ⁇ , e.g., between about 0.2-20 ⁇ , e.g., between about 0.2-15 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.3-10 ⁇ , e.g., between about 0.4-10 ⁇ , e.g., between about 0.5-10 ⁇ , e.g., between about 0.5-10 ⁇ ,
- p38 refers to the "p38a (alpha)" mitogen-activated protein kinase 14 (MAPK14), which includes MAPK14 isoform 1 set forth by GenBank Accession No. NP_001306.1 (SEQ ID NO:39), MAPK14 isoform 2 set forth by GenBank Accession No. NP_620581.1 (SEQ ID NO:40), MAPK14 isoform 3 set forth by GenBank Accession No. NP_620582.1 (SEQ ID NO:41) and MAPK14 isoform 4 set forth by GenBank Accession No. NP_620583.1 (SEQ ID NO:42); " ⁇ 38 ⁇ (beta)” (MAPK11), which is set forth by GenBank Accession No.
- NP_002742.3 SEQ ID NO:43
- ⁇ 38 ⁇ (gamma) MAK12
- GenBank Accession No. NPJ302960.2 SEQ ID NO:44
- ⁇ 38 ⁇ (delta) MAK13
- GenBank Accession No. NP_002745.1 SEQ ID NO:45
- p38 inhibitor refers to any molecule (e.g., small molecules or proteins) capable of inhibiting the activity of p38 family members as determined by Western blot quantification of phosphorylated p38 levels.
- Non-limiting examples of p38 inhibitors include SB203580 (AXONMEDCHEM - Axon 1363), and SB 202190 (AXONMEDCHEM - Axon 1364), LY 2228820 (AXONMEDCHEM- Axon 1895), BIRB796 (Axon Medchem 1358) and PD169316 (AXONMEDCHEM - Axon 1365).
- examples of p38 inhibitors also include BMP inhibitors like Dorsomorphin (AXONMEDCHEM - Axon 2150) and LDN193189 (AXON MEDCHEM AXON 1509) or other inhibitors of the BMP pathway such as recombinant NOGGIN protein [GenBank Accession No. NP_005441.1 (SEQ ID NO: 118)] can be used to replace small molecule inhibitors of BMP signaling.
- PDSB203580 is provided at a concentration range of between about 0.5-70 ⁇ , e.g., from about 1 ⁇ to about 70 ⁇ , e.g., between about 1-60 ⁇ , e.g., between about 1-55 ⁇ , e.g., between about 1-50 ⁇ , e.g., between about 1-45 ⁇ , e.g., between about 1-40 ⁇ , e.g., between about 1- 35 ⁇ , e.g., between about 1-30 ⁇ , e.g., between about 1-25 ⁇ , e.g., between about 1-20 ⁇ , e.g., between about 1-15 ⁇ , e.g., between about 1-10 ⁇ , e.g., between about 2-10 ⁇ , e.g., between about 3-10 ⁇ , e.g., between about 4-10 ⁇ , e.g., between about 4-6 ⁇ , e.g., about 5 ⁇ ,
- SB 202190 is provided at a concentration range of between about 0.1 ⁇ to about 50 ⁇ , e.g., from about 0.5 ⁇ to about 50 ⁇ , e.g., from about 1 ⁇ to about 50 ⁇ , e.g., between about 1-45 ⁇ , e.g., between about 1-40 ⁇ , e.g., between about 1-35 ⁇ , e.g., between about 1-30 ⁇ , e.g., between about 1-25 ⁇ , e.g., between about 1-20 ⁇ , e.g., between about 1- 15 ⁇ , e.g., between about 1-10 ⁇ , e.g., between about 1-9 ⁇ , e.g., between about 1-8 ⁇ , e.g., between about 1-7 ⁇ , e.g., between about 2-7 ⁇ , e.g., between about 3-7 ⁇ , e.g., between about 4-7 ⁇ , e.g.
- BIRB796 is provided at a concentration range of between about 0.05 to about 30 ⁇ , e.g., from about 0.1 to about 30 ⁇ , e.g., between about 0.2-30 ⁇ , e.g., between about 0.2-25 ⁇ , e.g., between about 0.2-20 ⁇ , e.g., between about 0.2-15 ⁇ , e.g., between about 0.2-10 ⁇ , e.g., between about 0.2-8 ⁇ , e.g., between about 0.2-6 ⁇ , e.g., between about 0.5-6 ⁇ , e.g., between about 0.5-5 ⁇ , e.g., between about 0.5-4 ⁇ , e.g., between about 0.5-3 ⁇ , e.g., between about 0.5-2 ⁇ , e.g., between about 1-3 ⁇ , e.g., between about 1- 2.5 ⁇ , e.g., about 2 ⁇ .
- JNK refers to the mitogen-activated protein kinase 8 (MAPK8) protein set forth by GenBank Accession Nos. NP_620637.1 (isoform alpha2) (SEQ ID NO:46), NP_620635.1 (isoform beta2) (SEQ ID NO:47), NP_620634.1 (isoform betal) (SEQ ID NO:48), NP_002741.1 (isoform alphal) (SEQ ID NO:49) which are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development.
- JNK inhibitor refers to any molecule capable of inhibiting the activity of JNK as determined by phosphorylation of JNK family member protein by western blot analysis.
- JNK inhibitors include SP600125 (TOCRIS - Cat no. 1496), AEG3482 (AXONMEDCHEM- AXON 1291), and BIRB796 (AXONMEDCHEM - Axon 1358).
- SP600125 is provided at a concentration range of between about 0.5-100 ⁇ , e.g., from about 1 ⁇ to about 100 ⁇ , e.g., between about 1-90 ⁇ , e.g., between about 1-80 ⁇ , e.g., between about 1- 70 ⁇ , e.g., between about 1-60 ⁇ , e.g., between about 1-55 ⁇ , e.g., between about 1-50 ⁇ , e.g., between about 1-45 ⁇ , e.g., between about 1-40 ⁇ , e.g., between about 1-35 ⁇ , e.g., between about 1-30 ⁇ , e.g., between about 1-25 ⁇ , e.g., between about 1-20 ⁇ , e.g., between about 1-15 ⁇ , e.g., between about 1-10 ⁇ , e.g., between about 2-10 ⁇ , e.g., between about 3-10 ⁇ ,
- PKC protein kinase C
- protein kinase C inhibitor refers to any molecule capable of inhibiting the activity of protein kinase C as determined by reducing the levels of phosphorylated versus non phosphorylated PKC isoforms.
- a non-limiting example of a protein kinase C inhibitor is Go6983 (CAS 133053- 19-7), a potent, cell-permeable, reversible, and ATP-competitive inhibitor of protein kinase C (PKC) with a broad spectrum protein kinase C (PKC) inhibitor (IC50 values are 7, 7, 6, 10, 60 and 20000 nM for PKCa, PKCp, PKCy, PKC5, ⁇ and ⁇ respectively).
- Go6983 is available from various suppliers such as Calbiochem (Catalogue number 365251-500UG), and TOCRIS (Catalogue number 2285).
- Go6983 is provided at a concentration range of between about 0.5- 100 ⁇ , e.g., from about 1 ⁇ to about 100 ⁇ , e.g., between about 1-90 ⁇ , e.g., between about 1-80 ⁇ , e.g., between about 1- 70 ⁇ , e.g., between about 1-60 ⁇ , e.g., between about 1-55 ⁇ , e.g., between about 1-50 ⁇ , e.g., between about 1-45 ⁇ , e.g., between about 1-40 ⁇ , e.g., between about 1-35 ⁇ , e.g., between about 1-30 ⁇ , e.g., between about 1-25 ⁇ , e.g., between about 1-20 ⁇ , e.g., between about 1- 15 ⁇ , e.g., between about 1-10 ⁇ , e.g., between about 2-10 ⁇ , e.g., between about 3-10 ⁇ ,
- fibroblast growth factor receptor refers to FGFR 1 , FGFR2 and FGFR3.
- FGFR inhibitor refers to a molecule capable of inhibiting FGFR expression and/or activity level as determined by levels of phosphorylated FGFRI, 2, and 3.
- Non-limiting examples of FGFR inhibitors include PD173074 and SU5401. According to some embodiments of the invention, the FGFR inhibitor (FGFRi) is
- PD173074 and is provided in a concentration range between about 0.01-40 ⁇ , e.g., between about 0.02-40 ⁇ , e.g., between about 0.05-40 ⁇ , e.g., between, about 0.1-40 ⁇ , about 0.5-40 ⁇ , about 1-40 ⁇ , e.g., about 2-40 ⁇ , about 5-40 ⁇ , about 10-40 ⁇ , e.g., between about 0.05-5 ⁇ , e.g., about 0.1-5 ⁇ .
- the FGFR inhibitor (FGFRi) is SU5401 and is provided at a concentration range of about 0.1-40 ⁇ , e.g., about 0.5-40 ⁇ , about 1-40 ⁇ , e.g., about 2-40 ⁇ , about 5-40 ⁇ , about 10-40 ⁇ .
- transforming growth factor receptor refers to TGF- ⁇ type I receptor ALK5, type I activin/nodal receptor ALK4 and type I nodal receptor ALK7.
- TGFR inhibitor refers to a molecule capable of inhibiting TGFR expression and/or activity level as determined by phosphorylated ALK4, 5 and 7.
- Non-limiting examples of TGFR inhibitors include SB431542 and A 83-01 small molecule compound.
- the TGFR inhibitor is provided at a concentration range of about 0.1-30 ⁇ , e.g., about 1-30 ⁇ , e.g., 5-25 ⁇ , e.g., 5-10 ⁇ , e.g., 0.1-5 ⁇ , e.g., 0.2-4 ⁇ , e.g., 0.5-3 ⁇ .
- the culture medium further comprises a ROCK inhibitor.
- ROCK2 serine/threonine kinase activity
- cytokinesis smooth muscle contraction
- actin stress fibers and focal adhesions the formation of actin stress fibers and focal adhesions
- activation of the c-fos serum response element ROCK2; SEQ ID NO:51
- ROCK inhibitor refers to any molecule capable of inhibiting the activity of ROCK as determined by inhibition of ROCK phosphorylation levels (detected by western blot analysis).
- ROCK inhibitors include Y27632 (TOCRIS,
- Y27632 is provided at a concentration range of between about 0.1-100 ⁇ , e.g., from about 0.1 ⁇ to about 90 ⁇ , e.g., between about 0.1-85 ⁇ , e.g., between about 0.1-80 ⁇ , e.g., between about 0.1-70 ⁇ , e.g., between about 0.1-60 ⁇ , e.g., between about 0.1-55 ⁇ , e.g., between about 0.1-50 ⁇ , e.g., between about 0.1-45 ⁇ , e.g., between about 0.1-40 ⁇ , e.g., between about 0.1-35 ⁇ , e.g., between about 0.1-30 ⁇ , e.g., between about 0.1-25 ⁇ , e.g., between about 1-20 ⁇ , e.g., between about 1-15 ⁇ , e.g., between about 1-10 ⁇ , e.g., between
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a protein kinase C inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) further comprises a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- a protein kinase C inhibitor a protein kinase C inhibitor
- FGFRi fibroblast growth factor receptor inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, and a transforming growth factor receptor inhibitor (TGFRi) further comprises a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- a protein kinase C inhibitor a protein kinase C inhibitor
- TGFRi transforming growth factor receptor inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi) further comprises a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- a protein kinase C inhibitor a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi)
- FGFRi fibroblast growth factor receptor inhibitor
- TGFRi transforming growth factor receptor inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor further comprises a ROCK inhibitor.
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i, a protein kinase C inhibitor and a fibroblast growth factor receptor (FGFR) inhibitor further comprises a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- TGF i a protein kinase C inhibitor
- FGFR fibroblast growth factor receptor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i) further comprises a ROCK inhibitor.
- the culture medium further comprises a protein kinase C inhibitor.
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i) further comprises a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor-beta 1
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF), transforming growth factor-beta 1 (TGF i) and a ROCK inhibitor further comprises a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor-beta 1
- ROCK inhibitor further comprises a protein kinase C inhibitor.
- the culture medium further comprises a factor selected from the group consisting of: bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- FGFRi fibroblast growth factor receptor
- TGFRi transforming growth factor receptor inhibitor
- Kenpaullone BayK8644
- Bixl294 stem cell factor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- FGFRi fibroblast growth factor receptor
- TGFRi transforming growth factor receptor inhibitor
- Kenpaullone BayK8644
- Bixl294 stem cell factor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor and a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- TGFRi transforming growth factor receptor inhibitor
- Kenpaullone transforming growth factor receptor inhibitor
- Bixl294 Bixl294
- SCF stem cell factor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor and a transforming growth factor receptor inhibitor (TGFRi) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- FGFRi fibroblast growth factor receptor
- Kenpaullone BayK8644
- Bixl294 transforming growth factor receptor inhibitor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- Forskolin Kenpaullone
- BayK8644 Bixl294
- SCF stem cell factor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- FGFRi fibroblast growth factor receptor
- TGFRi transforming growth factor receptor inhibitor
- Kenpaullone BayK8644
- Bixl294 stem cell factor
- the culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 insulin-like growth factor 1
- FGFRi fibroblast growth factor receptor inhibitor
- TGFRi transforming growth factor receptor inhibitor
- Kenpaullone BayK8644
- Bixl294 Bixl294
- SCF stem cell factor
- the culture medium further comprises ascorbic acid.
- ascorbic acid or “Vitamin C” which is interchangeably used herein, refers to L-ascorbic acid 2-phosphate.
- Ascorbic acid can be obtained from e.g., Sigma (Catalogue number A8960).
- the concentration of ascorbic acid to be used with the medium of some embodiments of the invention can be about 1-300 ⁇ g/ml, e.g., about 50 ⁇ g/ml.
- the culture medium further comprises oleic Acid.
- oleic Acid can be used instead of ALBUMAX® (Life Technologies) or together with ALBUMAX®.
- the culture medium further comprises Linoleic Acid.
- Linoleic Acid can be used instead of ALBUMAX® (Life Technologies) or together with ALBUMAX®.
- the culture medium further comprises Pipecolic Acid.
- pipecolic acid can be used instead of ALBUMAX® (Life Technologies) or together with ALBUMAX®.
- the Oleic Acid (01257, Sigma Aldrich) can be used at a concentration of about 1-200 ⁇ g/ml, e.g., about 10 ⁇ g/ml in the culture medium.
- the Oleic Acid [O1008 Sigma
- Aldrich dissolved in DMSO
- DMSO DMSO
- the Pipecolic Acid [P2519 Sigma Aldrich, dissolved in DMSO), can be used at a concentration of 1-200 ⁇ g/ml e.g., about 10 ⁇ g/ml in the culture medium.
- the oleic Acid-Albumin (O3008 Sigma Aldrich) can be used at a concentration of about 1-200 ⁇ g/ml, e.g., about 10 ⁇ g/ml in the culture medium.
- the medium comprises Linoleic/Oleic/ Albumin supplement (L9655 Sigma Aldrich) at a concentration of about 1-200 ⁇ g/ml, e.g., about 10 ⁇ g/ml in the culture medium.
- Linoleic/Oleic/ Albumin supplement L9655 Sigma Aldrich
- a non-limiting example of a culture medium which can be used to maintain (and induce to naive state) pluripotent stem cells in a naive state include: leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i), and one or more of the following components:
- IGFII range 0.1-100 ng/ml final concentration
- IGF1 insulin-like growth factor 1 (somatomedin C)] (range 0.1-100 ng/ml final concentration);
- BMP signaling inhibitor examples include, but are not limited to: LDN193189 (AXON 1509 - 0.01-20 microM final concentration), K02288 (Axon 2189;
- NOTCH signaling inhibitors examples include, but are not limited to the following gamma secretase inhibitors: DAPT (Axon Medchem 1484 - 0.05-50 microM final concentration), LY2886721 hydrochloride (Axon Medchem 1964 - 0.05-50 microM final concentration)], DBZ (Axon Medchem - Axon 1488- 0.05-50 microM final concentration);
- Sonic Hedgehog pathway (SHH) inhibitors include, but are not limited to the following: GANT61 (SigmaAldrich - 0.05-50 microM final concentration), RU-SKI 43 (Axon Medchem - Axon 2035 - 0.05-50 microM final concentration)];
- ERK5 inhibitors (BIX02189 Axon 1809; range 0.1-100 microM final concentration);
- ROCK inhibitor [Y27632 (AXON 1683) - 0.05-100 microM final];
- FGF signaling inhibitor Non-limiting examples of FGFR inhibitors include
- TGFR inhibitors include SB431542 and A 83-01 small molecule compound (As used herein the term "TGFR inhibitor (or TGFRi)" refers to a molecule capable of inhibiting TGFR expression and/or activity level as determined by phosphorylated ALK4, 5 and 7).
- the culture medium of the invention is defined by any one of conditions 1-5, and 7-17 as described in Tables 3-5 in the Examples section which follows.
- the culture medium further comprises an MBD3 inhibitor.
- MBD3 refers to the Methyl-CpG-binding domain 3 protein set forth by GenBank Accession No. NP_003917.1 (SEQ ID NO:7) having the co-repressor and chromatin remodeling functional activity.
- MBD3 inhibitor refers to any agent (e.g., a molecule) capable of downregulating the expression level and/or activity of MBD3, and/or capable of interfering between the interaction of MBD3 with OCT4, and/or MBD3 with SOX2, and/or MBD3 and KLF4 and/or MBD3 and C-Myc, and/or inhibiting the binding of MBD3 to the nucleosome remodeling and deacetylase (NuRD).
- NuRD nucleosome remodeling and deacetylase
- Downregulation of MBD3 can be effected on the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation [e.g., RNA silencing agents (e.g., antisense, siRNA, shRNA, micro-RNA), Ribozyme and DNAzyme], or on the protein level using e.g., an antibody (e.g., a neutralizing antibody), an antagonist, e.g., small molecules which inhibit MBD3 activity or ability to directly interact with any of the reprogramming factors (Oct4, Sox2, Klf4or c-Myc), enzymes that cleave the polypeptide and the like.
- RNA silencing agents e.g., antisense, siRNA, shRNA, micro-RNA
- DNAzyme e.g., DNAzyme
- an antibody e.g., a neutralizing antibody
- an antagonist e.g., small molecules which inhibit MBD3 activity or ability to
- Non-limiting examples of MBD3 inhibitors include siRNA directed against MBD3 mRNA, such as those provided from Invitrogen, mBD3HSS 147581(3_RNAI) (Invitrogen): AGGUCAAGGGCAAGCCCGACCUGAA (SEQ ID NO:52); and MBD3HSS 147581(3_RNAI) (Invitrogen): UUCAGGUCGGGCUUGCCCUUGACCU (SEQ ID NO:53).
- Another suitable siRNA directed against MBD3 mRNA which can be used is the commercially available MBD3 Stealth siRNAs that include HSS 147580 and HSS 147581 components (Life TechniologiesTM, catalogue number 1299001) that were found efficient for MBD3 knockdown in human cells.
- inhibiting the binding of Mbd3 to the NuRD complex is performed using a chromodomain helicase DNA binding protein 4 (CHD4) inhibitor.
- CHD4 chromodomain helicase DNA binding protein 4
- Non-limiting examples of CHD4 inhibitors include the human CHD4 siRNA, such as the CHD4 stealth siRNA HSS 101850 available from Life technologiesTM, which was found to efficiently knockdown CHD4 in human cells.
- Mbd3 to the NuRD complex is performed using a P66 alpha coiled-coil (P66a-CC) domain.
- P66a-CC P66 alpha coiled-coil
- the peptide of the P66a-CC (SEQ ID NO: 114) can be added to the medium as is, or can be recombinantly expressed from a vector encoding the P66a-CC sequence (e.g., a vector which comprises the nucleotide sequence set forth in SEQ ID NO: 113).
- inhibiting Mbd3 expression is performed using a protein kinase C (PKC) inhibitor (e.g., using the agents and molecules as described above).
- PLC protein kinase C
- the medium further comprises an agent which increases expression of endogenous ERAS and/or a recombinant ERAS.
- the MBD3 inhibitor is provided in an amount sufficient to downregulate the expression level of the MBD3 RNA and/or protein in the cell by at least about 30%, e.g., at least about 35%, e.g., at least about 40%, e.g., at least about 45%, e.g., at least about 50%, e.g., at least about 55%, e.g., at least about 60%, e.g., at least about 65%, e.g., at least about 70%, e.g., at least about 75%, e.g., at least about 80% as compared to the expression level of the MBD3 RNA and/or protein, respectively, in the same cell when incubated and/or cultured under the same (e.g., identical) conditions yet without the MBD3 inhibitor.
- the MBD3 inhibitor is provided in an amount sufficient to downregulate the expression level of the MBD3 RNA and/or protein in the cell by about 30-90%, e.g., about 30-85%, e.g., about 40- 85%, e.g., about 50-85%, e.g., about 60-85%, e.g., about 70-85%, e.g., about 80-85%, e.g., about 85% as compared to the expression level of the MBD3 RNA and/or protein, respectively, in the same cell when incubated and/or cultured under the same (e.g., identical) conditions yet without the MBD3 inhibitor.
- the expression level of the MBD3 in the cell can be determined by various methods such as real time reverse transcription PCR, Western blot and the like.
- a non- limiting example for such an assay is provided in the Examples section which follows and in Figures 1I-J, demonstrating about 85% inhibition of MBD3 protein level in cells transformed with the MBD3 flox/" construct.
- the culture medium is devoid of serum, e.g., devoid of any animal serum.
- the culture medium is devoid of any animal contaminants, i.e., animal cells, fluid or pathogens (e.g., viruses infecting animal cells), e.g., being xeno-free.
- the culture medium is devoid of human derived serum.
- the culture medium further comprises a serum replacement (i.e., a substitute of serum) such as KNOCKOUTTM Serum Replacement (Gibco-Invitrogen Corporation, Grand Island, NY USA), ALBUMAX®II (Gibco®; Life Technologies - Invitrogen, Catalogue No. 11021-029; Lipid-rich bovine serum albumin for cell culture) or a chemically defined lipid concentrate (Gibco®; Invitrogen, Life Technologies - Invitrogen, Catalogue No. 11905-031).
- a serum replacement i.e., a substitute of serum
- KNOCKOUTTM Serum Replacement Gib Island, NY USA
- ALBUMAX®II Gibco®; Life Technologies - Invitrogen, Catalogue No. 11021-029
- Lipid-rich bovine serum albumin for cell culture Lipid-rich bovine serum albumin for cell culture
- a chemically defined lipid concentrate Gibco®; Invitrogen, Life Technologies - Invitrogen,
- the culture medium further comprises N2 supplement (Gibco®; Life Technologies - Invitrogen, Catalogue No. 17502-048) a chemically defined, serum-free supplement.
- N2 supplement Gibco®; Life Technologies - Invitrogen, Catalogue No. 17502-048
- a chemically defined, serum-free supplement for a 500 ml of culture medium 5 ml of the N2 mix (Invitrogen) can be added.
- the following materials can be added to a 500 ml culture medium: Recombinant Insulin (Sigma 1-1882) at a 12.5 microg/ml ⁇ g/ml) final concentration; Apo-Transferrin (Sigma T-1147) at a 500 ⁇ g/ml final concentration; Progesterone (Sigma- P8783) at a 0.02 ⁇ g/ml final concentration; Putrescine (Sigma- P5780) at a 16 ⁇ g/ml final concentration; and 5 microL ( ⁇ ) of 3 mM stock of Sodium Selenite (Sigma - S5261) are added per 500 ml culture medium (e.g., the WIS-NHSM).
- the KNOCKOUTTM Serum Replacement is provided at a concentration of at least 0.5%, e.g., in the range of about 0.5%-25%, e.g., about 5%, about 10%, about 15%, about 20% or about 25%.
- the ALB UMAXTM is provided at a concentration of at least 0.01%, e.g., in the range of about 0.01%-10%, e.g., about 0.1%, about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9% or about 10%, e.g., 1%.
- the defined lipid concentrate is provided at a concentration of at least about 0.1%, e.g., in the range of 0.1-5%, e.g., about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 2%, about 3%, about 4%, about 5%, e.g., 1%.
- the culture medium comprises the N2 supplement (e.g., 5 ml N2 per 500 ml of culture medium) and the defined lipid concentrate (5 ml defined lipid concentrate per 500 ml medium).
- N2 supplement e.g., 5 ml N2 per 500 ml of culture medium
- defined lipid concentrate 5 ml defined lipid concentrate per 500 ml medium
- the culture medium comprises the N2 supplement (e.g., 5 ml N2 per 500 ml of culture medium) and ALBUMAX®II (e.g., 1% Albumax®II; Gibco®; Life Technologies - Invitrogen).
- N2 supplement e.g., 5 ml N2 per 500 ml of culture medium
- ALBUMAX®II e.g., 1% Albumax®II; Gibco®; Life Technologies - Invitrogen.
- the culture medium can further include antibiotics (e.g., PEN-STREP), L-glutamine, NEAA (non-essential amino acids).
- antibiotics e.g., PEN-STREP
- L-glutamine e.g., L-glutamine
- NEAA non-essential amino acids
- the culture medium comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 5 ml defined lipid concentrate per 500 ml medium, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), and JNKi (SP600125, about 5-10 ⁇ ).
- N2 supplement e.g., about 5 ml N2 per 500 ml of culture medium
- LIF about 20 ng/ml
- bFGF about 8 ng/ml
- TGF l about 1 ng/ml
- ERKl/2i about 1 ⁇ of PD0325901
- GSK3bi CHIR99021, about 3 ⁇
- the culture medium comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 1-2% Albumax®II, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), and JNKi (SP600125, 5-about 10 ⁇ ).
- N2 supplement e.g., about 5 ml N2 per 500 ml of culture medium
- Albumax®II e.g., about 5 ml N2 per 500 ml of culture medium
- LIF about 20 ng/ml
- bFGF about 8 ng/ml
- TGF l about 1 ng/ml
- ERKl/2i about 1 ⁇ of
- the culture medium comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 15% Kockout SR (Gibco), LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), JNKi (SP600125, about 5-10 ⁇ ).
- N2 supplement e.g., about 5 ml N2 per 500 ml of culture medium
- Kockout SR Gibco
- LIF about 20 ng/ml
- bFGF about 8 ng/ml
- TGF l about 1 ng/ml
- ERKl/2i about 1 ⁇ of PD0325901
- GSK3bi CHIR990
- a cell culture comprising cells and the culture medium of some embodiments of the invention.
- the cells can be any cells, e.g., prokaryotic or eukaryotic cells, e.g., primate cells, e.g., mammalian cells, e.g., human cells.
- prokaryotic or eukaryotic cells e.g., primate cells, e.g., mammalian cells, e.g., human cells.
- primate cells e.g., mammalian cells, e.g., human cells.
- the cells can be somatic cells, stem cells, primed pluripotent stem cells, and/or naive pluripotent stem cells.
- the culture medium is capable of maintaining naive pluripotent stem cell in an undifferentiated state for at least 2 passages, e.g., for at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 passages.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, wherein:
- the PSC is a primate (e.g., mammalian, e.g., human) PSC.
- the conditions comprise the culture medium of some embodiments of the invention.
- the conditions comprise growing the cells in the presence of 1-20% oxygen (0 2 ) and 5% C0 2 .
- the conditions comprise hypoxia.
- Hypoxic conditions can be induced in the presence of less than 10% 0 2 (oxygen) in the growth environment.
- the growth environment e.g., tissue culture incubator
- the growth environment can include about 37°C, 5% C0 2 , and hypoxia (less than 10% 0 2 in the air).
- the conditions comprise a culture medium which comprises an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF), transforming growth factor beta 1 (TGF i), a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor beta 1
- PKC protein kinase C
- the conditions comprise a culture medium which comprises an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor, a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
- TGFR transforming growth factor receptor
- FGFR fibroblast growth factor receptor
- PKC protein kinase C
- the STAT3 activator is selected from the group consisting of LIF, IL6 and EGF.
- the STAT3 activator is selected from the group consisting of LIF, and IL6.
- the STAT3 activator is LIF.
- the culture medium further comprising at least one additional agent selected from the group consisting of: insulinlike growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, KenpauUone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGF1 insulinlike growth factor 1
- IGFII insulin-like growth factor II
- BMP bone morphogenetic protein
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor Forskolin, KenpauUone, BayK8644, Bixl294, and stem cell factor (SCF).
- the culture medium further comprising at least one additional agent selected from the group consisting of: insulinlike growth factor 1 (IGF1), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, KenpauUone, BayK8644, Bixl294, and stem cell factor (SCF).
- IGF1 insulinlike growth factor 1
- IGFII insulin-like growth factor II
- BMP4 bone morphogenetic protein 4
- SHH Sonic Hedgehog pathway
- ERK5 inhibitor forskolin
- KenpauUone KenpauUone
- BayK8644 BayK8644
- Bixl294 Bixl294
- SCF stem cell factor
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the PKC inhibitor.
- the culture medium further comprising FGFR inhibitor.
- the culture medium further comprising TGFR inhibitor.
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the TGF i and the protein kinase C inhibitor.
- the culture medium further comprising an FGFR inhibitor.
- the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the bFGF and the TGFpl.
- the culture medium further comprising a ROCK inhibitor.
- the culture medium further comprising a protein kinase C inhibitor.
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
- the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
- BMP bone morphogenetic protein
- TGFR transforming growth factor receptor
- the culture medium further comprising a Sonic Hedgehog pathway (SHH) inhibitor.
- SHH Sonic Hedgehog pathway
- the STAT3 activator comprises the LIF and wherein the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
- the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
- FGFR fibroblast growth factor receptor
- the culture medium further comprises an agent selected from the group consisting of insulin-like growth factor II (IGFII), stem cell factor (SCF) and transforming growth factor beta 1 (TGF i).
- IGFII insulin-like growth factor II
- SCF stem cell factor
- TGF i transforming growth factor beta 1
- the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
- the culture medium further comprising a FGFR inhibitor (FGFRi).
- FGFRi FGFR inhibitor
- the culture medium further comprising a TGFR inhibitor (TGFRi).
- the conditions comprise a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a FGFR inhibitor (FGFRi).
- the conditions comprise a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a TGFRi.
- the conditions comprise a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a FGFR inhibitor and a TGFRi.
- the conditions comprise a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF 1 and a protein kinase C inhibitor.
- the conditions comprise a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor further comprising FGFR inhibitor (FGFRi).
- FGFRi FGFR inhibitor
- the conditions comprise a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, bFGF and TGF l.
- the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- p38 inhibitor a p38 inhibitor
- JNK inhibitor a protein kinase C inhibitor
- the medium further comprises an FGFR inhibitor.
- the medium further comprises a TGFR inhibitor.
- the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF i and a protein kinase C inhibitor.
- the medium further comprises FGFR inhibitor.
- the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- LIF leukemia inhibitor factor
- ERKl/2 inhibitor an ERKl/2 inhibitor
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- JNK inhibitor basic fibroblast growth factor
- TGF i transforming growth factor-beta 1
- the medium further comprises a ROCK inhibitor.
- the medium further comprises a protein kinase C inhibitor.
- the medium further comprises a factor selected from the group consisting of: bone morphogenetic protein 4 (BMP4), IGF1, Forskolin, FGFR inhibitor, TGFR inhibitor Kenpaullone, BayK8644, Bixl294, and stem cell factor (SCF).
- BMP4 bone morphogenetic protein 4
- IGF1 Forskolin
- FGFR inhibitor FGFR inhibitor
- TGFR inhibitor Kenpaullone
- BayK8644 TGFR inhibitor Kenpaullone
- Bixl294 stem cell factor
- the medium further comprises an ascorbic acid.
- the medium further comprises an oleic Acid.
- the medium further comprises a Linoleic Acid.
- the culture medium being devoid of animal serum (e.g., devoid of bovine serum, mouse serum, being xeno-free, devoid of animal contaminants).
- animal serum e.g., devoid of bovine serum, mouse serum, being xeno-free, devoid of animal contaminants.
- the culture medium further comprises serum replacement.
- the culture medium further comprises an MBD3 inhibitor.
- the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERKl/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- the culture medium further comprises a ROCK inhibitor.
- the culture medium further comprises an MBD3 inhibitor.
- the non-naive PSC is selected from the group consisting of a primed PSC, a blastocyst, an induced pluripotent stem cell (a primed iPSC) and a somatic cell.
- non-naive PSC is a primed PSC (e.g., a blastocyst, an embryonic stem cell, an embryonic germ cell, or an induced pluripotent stem cell) there is no need for exogenous expression of the Oct4, Sox2, Klf4 and c-Myc, nor for the addition of isolated Oct4, Sox2, Klf4 and/or c-Myc factors to the medium.
- a primed PSC e.g., a blastocyst, an embryonic stem cell, an embryonic germ cell, or an induced pluripotent stem cell
- the medium when the non-naive PSC is a primed PSC, a blastocyst, or an induced pluripotent stem cell (a primed iPSC) the medium does not include the Oct4, Sox2, Klf4 and/or c-Myc factors.
- the non-naive PSC is a primed PSC, a blastocyst, or an induced pluripotent stem cell (a primed iPSC)
- the cells are not genetically modified to express the Oct4, Sox2, Klf4 and/or c-Myc factors.
- the method further comprising subjecting the somatic cell to de-differentiation conditions, to thereby obtain an induced pluripotent stem cell.
- de-differentiation conditions comprise exogenously expressing within the somatic cell at least two growth factors selected from the group consisting of OCT4 [GenBank Accession Nos. NP_002692.2 (SEQ ID NO:54) and NM 002701.4 (SEQ ID NO:55)], SOX2 [GenBank Accession Nos. NP_003097.1 (SEQ ID NO:56) and NM_003106.3 (SEQ ID NO:57)], KLF4 [GenBank Accession Nos. NP_004226.3 (SEQ ID NO:58) and NM_004235.4 (SEQ ID NO:59)] and c-Myc [GenBank Accession Nos. NP_002458.2 (SEQ ID NO:60) and NM_002467.4 (SEQ ID NO:61)].
- OCT4 GenBank Accession Nos. NP_002692.2 (SEQ ID NO:54) and NM 002701.4 (SEQ ID NO:55)
- SOX2 GeneBank Acces
- exogenously expressing refers to expressing a heterologous nucleic acid sequence which may not be naturally expressed within the cell or which overexpression in the cell is desired.
- the exogenous polynucleotide may be introduced into the cell in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule.
- RNA ribonucleic acid
- exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence of the cell.
- endogenous refers to any polynucleotide or polypeptide which is present and/or naturally expressed within the cell.
- de-differentiation conditions comprise expressing within the somatic cell Klf4 and Oct4.
- de-differentiation conditions comprise expressing within the somatic cell Oct4, Sox2 and Klf4.
- de-differentiation conditions comprise expressing within the somatic cell Oct4, Klf4 and cMyc.
- expressing the growth factors is performed using DNA transfection of the growth factors.
- expressing the growth factors is performed using RNA transfection of the growth factors.
- RNA transfections into mammalian cells are known in the art and include those described for example in (Warren et al. 2010) which is fully incorporated herein by reference in its entirety.
- the cells are cultured in a medium and being serially passaged. It should be noted that culturing the naive PSC involves replacing the culture medium with a "fresh" medium (of identical composition) every 24-48 hours, and passaging each culture dish (e.g., a plate) to 2 or 3 culture dishes (e.g., plates) every 3-5 days.
- a "fresh" medium of identical composition
- the culture dishes are washed [e.g., with phosphate buffered saline (PBS)] and the cells are subjected to enzymatic dissociation from the culture dish, e.g., using trypsinization (0.25% or 0.05% Try sin + EDTA), e.g., until single cells or cell clumps are separated from each other.
- PBS phosphate buffered saline
- trypsinization 0.25% or 0.05% Try sin + EDTA
- the culture conditions uncovered by the present inventors enables maintenance of human PSCs such as human iPSCs in the naive PSC state without the need of further exogenous expression of the Oct4, Sox2, Klf4 and/or c-Myc factors.
- exogenous expression of the growth factors is effected for a limited time, such as for no more than 10 days in culture, e.g., for no more than 1 passage.
- the naive iPSCs are generated from the somatic cells, they are further being cultured in the culture medium of some embodiments of the invention (e.g., the WIS-NHSM medium) without exogenous expression of the Oct4, Sox2, Klf4 and/or c-Myc factors by the naive iPSCs, and without addition of the isolated Oct4, Sox2, Klf4 and/or c-Myc factors to the culture medium.
- the culture medium of some embodiments of the invention e.g., the WIS-NHSM medium
- isolated... factors refers to factors which are recombinantly expressed from an expression vector in a host cell (e.g., a bacteria), being biochemically synthesized, or being isolated from a biological sample (e.g., serum or cells).
- a host cell e.g., a bacteria
- a biological sample e.g., serum or cells
- the method of some embodiments of the invention can be used to improve generation of iPSCs from somatic cells as compared to generation of iPSC from somatic cells using expression of the Oct4, Sox2, Klf4 and c-Myc factors in somatic cells without further inhibition of the Mbd3 expression.
- the method is effected using a medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF), transforming growth factor-beta 1 (TGF i), and an MBD3 inhibitor, and optionally also a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERK1/2 ERK1/2
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor-beta 1
- MBD3 inhibitor optionally also a ROCK inhibitor.
- the method results in at least about 30%, e.g., at least about 40%, at least about 50%, e.g., at least about 60%, at least about 70%, e.g., at least about 80%, at least about 90%, e.g., at least about 95%, at least about 99%, e.g., 100% more iPSCs as compared to the yield of the iPSCs obtained when the Oct4, Sox2, Klf4 and c-Myc are expressed using DNA transfection in the somatic cell without further inhibition of the Mbd3 expression.
- the growth factors e.g., at least two of the Oct4, Sox2, Klf4 and c-Myc
- the method is effected using a medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF), transforming growth factor-beta 1 (TGF i), and an MBD3 inhibitor, and optionally also a ROCK inhibitor.
- LIF leukemia inhibitor factor
- ERK1/2 ERK1/2
- GSK3b inhibitor a GSK3b inhibitor
- a p38 inhibitor a JNK inhibitor
- bFGF basic fibroblast growth factor
- TGF i transforming growth factor-beta 1
- MBD3 inhibitor optionally also a ROCK inhibitor.
- the method results in at least about 5%, e.g., at least about 10%, at least about 20%, e.g., at least about 30%, at least about 40%, e.g., at least about 50%, at least about 60%, e.g., at least about 75%, at least about 99%, e.g., 100% more iPSCs as compared to the yield of the iPSCs obtained when the Oct4, Sox2, Klf4 and c-Myc are expressed using RNA transfection in the somatic cell without further inhibition of the Mbd3 expression.
- the growth factors e.g., at least two of the Oct4, Sox2, Klf4 and c-Myc
- the method of some embodiments of the invention employs 1-4 rounds of RNA transfection in order to achieve de-differentiation of human somatic cells, and thus is far more efficient and time consuming.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- the culture medium further comprises FGFR inhibitor.
- the culture medium further comprises TGFR inhibitor.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- the culture medium further comprises FGFR inhibitor.
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- a method of generating a naive pluripotent stem cell comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- TFE3 transcription factor E3
- a culture medium which comprises KO- DMEM, N2 supplement (Gibco), defined lipid concentrate (Gibco), LIF, bFGF, TGF l, ERK1/2 inhibitor, GSK3b inhibitor, p38 inhibitor, JNK inhibitor, and an MBD3 inhibitor wherein the conditions which comprise a culture medium which comprises KO- DMEM, N2 supplement (Gibco), defined lipid concentrate (Gibco), LIF, bFGF, TGF l, ERK1/2 inhibitor, GSK3b inhibitor, p38 inhibitor, JNK inhibitor, and an MBD3 inhibitor,
- the method of generating a naive pluripotent stem cell comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 5 ml defined lipid concentrate per 500 ml medium, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), and JNKi (SP600125, about 5-10 ⁇ ), wherein:
- the method of generating a naive pluripotent stem cell comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 1-2% Albumax®II, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), and JNKi (SP600125, about 5-10 ⁇ ), wherein:
- the method of generating a naive pluripotent stem cell comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., 5 ml N2 per 500 ml of culture medium) with about 15% Kockout SR (Gibco), LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), JNKi (SP600125, about 5-10 ⁇ ), wherein:
- the method of generating a naive pluripotent stem cell comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 5 ml defined lipid concentrate per 500 ml medium, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), JNKi (SP600125, about 5-10 ⁇ ) and an MBD3 inhibitor, wherein:
- the method of generating a naive pluripotent stem cell comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 1-2% Albumax®II, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), JNKi (SP600125, about 5-10 ⁇ ), and an MBD3 inhibitor, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST)
- the method of generating a naive pluripotent stem cell comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 15% Kockout SR (Gibco), LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF l (about 1 ng/ml), ERKl/2i (about 1 ⁇ of PD0325901), GSK3bi (CHIR99021, about 3 ⁇ ), p38i (SB203580, about 5 ⁇ ), JNKi (SP600125, about 5-10 ⁇ ), and an MBD3 inhibitor, wherein:
- a method of improving generation of induced pluripotent stem cells (iPSCs) from a somatic cell comprising:
- inhibiting the binding of the Mbd3 to the NuRD complex is performed using a chromodomain helicase DNA binding protein 4 (CHD4) inhibitor.
- CHD4 chromodomain helicase DNA binding protein 4
- inhibiting the binding of the Mbd3 to the NuRD complex is performed using a P66 alpha coiled-coil domain.
- inhibiting the Mbd3 expression is performed using a protein kinase C (PKC) inhibitor.
- PLC protein kinase C
- the method further comprising exogenously expressing ES cell expressed Ras (ERAS) coding sequence (e.g., SEQ ID NO: 109) or activating endogenous expression of the ERAS in the somatic cell.
- ERAS ES cell expressed Ras
- activating endogenous expression of ERAS is performed by removing the premature poly adenylation sites of the endogenous ERAS gene (SEQ ID NO: 108), e.g., in A-l, A2 or A-3 boxed sequences in Figure 3 by Kameda et al. Stem Cells 2005;23: 1535-1540; which is fully incorporated herein by reference in its entirety.
- SEQ ID NO: 108 the premature poly adenylation sites of the endogenous ERAS gene
- expressing is effected for at least 48 hours such that the inhibiting the Mbd3 is effected to 10-30% of a level of the Mbd3 prior to the expressing.
- expressing is effected for about 48 hours and the inhibiting is effected after the about 48 hours.
- the iPSC is a murine iPSC.
- the method further comprising culturing the murine iPSC in a medium which comprises LIF, an ERKl/2 inhibitor, and a GSK3b inhibitor.
- the method further comprising:
- a culture medium which comprises LIF, an ERKl/2 inhibitor, a GSK3b inhibitor, a P38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF i).
- step (c) is performed following about 48 hours from the beginning of expression as recited in step (a).
- the medium further comprises a ROCK inhibitor.
- expressing is performed using DNA transfection of the growth factors.
- expressing is performed using
- expressing is performed using protein transfection of the growth factors.
- an isolated naive pluripotent stem cell obtainable by the method of some embodiments of the invention.
- the naive pluripotent stem cell comprising:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- a method of generating differentiated cells comprising subjecting the naive pluripotent stem cells generated according to the method of some embodiments of the invention to differentiating conditions, thereby generating the differentiated cells.
- the naive PSCs of some embodiments of the invention can be used to isolate lineage specific cells.
- the phrase "isolating lineage specific cells” refers to the enrichment of a mixed population of cells in a culture with cells predominantly displaying at least one characteristic associated with a specific lineage phenotype. It will be appreciated that all cell lineages are derived from the three embryonic germ layers. Thus, for example, hepatocytes and pancreatic cells are derived from the embryonic endoderm, osseous, cartilaginous, elastic, fibrous connective tissues, yachts, myocardial cells, bone marrow cells, vascular cells (namely endothelial and smooth muscle cells), and hematopoietic cells are differentiated from embryonic mesoderm and neural, retina and epidermal cells are derived from the embryonic ectoderm.
- Lineage specific cells can be obtained by directly inducing the expanded, undifferentiated naive PSCs to culturing conditions suitable for the differentiation of specific cell lineage.
- EBs of some embodiments of the invention are cultured for 5-12 days in tissue culture dishes including DMEM/F-12 medium with 5 mg/ml insulin, 50 mg/ml transferrin, 30 nM selenium chloride, and 5 mg/ml fibronectin (Its medium, Okabe, S. et al., 1996, Mech. Dev. 59: 89-102).
- the resultant neural precursors can be further transplanted to generate neural cells in vivo (Bristle, O. et al., 1997. In vzYro-generated neural precursors participate in mammalian brain development. Proc. Natl. Acad. Sci. USA. 94: 14809-14814). It will be appreciated that prior to their transplantation, the neural precursors are trypsinized and triturated to single-cell suspensions in the presence of 0.1 % DNase.
- EBs of some embodiments of the invention can differentiate to oligodendrocytes and myelinate cells by culturing the cells in modified SATO medium, i.e., DMEM with bovine serum albumin (BSA), pyruvate, progesterone, putrescine, thyroxine, triiodothyronine, insulin, transferrin, sodium selenite, amino acids, neurotrophin 3, ciliary neurotrophic factor and Hepes (Bottenstein, J. E. & Sato, G. H., 1979, Proc. Natl. Acad. Sci. USA 76, 514-517; Raff, M. C, Miller, R.
- modified SATO medium i.e., DMEM with bovine serum albumin (BSA), pyruvate, progesterone, putrescine, thyroxine, triiodothyronine, insulin, transferrin, sodium selenite, amino acids, neurotrophin 3, ciliary
- EBs are dissociated using 0.25 % Trypsin/EDTA (5 min at 37 °C) and triturated to single cell suspensions. Suspended cells are plated in flasks containing SATO medium supplemented with 5 % equine serum and 5 % fetal calf serum (FCS). Following 4 days in culture, the flasks are gently shaken to suspend loosely adhering cells (primarily oligodendrocytes), while astrocytes are remained adhering to the flasks and further producing conditioned medium. Primary oligodendrocytes are transferred to new flasks containing SATO medium for additional two days.
- FCS fetal calf serum
- oligospheres are either partially dissociated and resuspended in SATO medium for cell transplantation, or completely dissociated and a plated in an oligosphere-conditioned medium which is derived from the previous shaking step [Liu, S. et al., (2000). Embryonic stem cells differentiate into oligodendrocytes and myelinate in culture and after spinal cord transplantation. Proc. Natl. Acad. Sci. USA. 97: 6126-6131].
- two- week-old EBs of some embodiments of the invention are transferred to tissue culture dishes including DMEM medium supplemented with 10 % FCS, 2 mM L-glutamine, 100 units/ml penicillin, 100 mg/ml streptomycin, 20 % (v/v) WEHI-3 cell-conditioned medium and 50 ng/ml recombinant rat stem cell factor (rrSCF, Tsai, M. et al., 2000.
- rrSCF recombinant rat stem cell factor
- hemato-lymphoid cells from the EBs of some embodiments of the invention 2-3 days-old EBs are transferred to gas-permeable culture dishes in the presence of 7.5 % C0 2 and 5 % 0 2 using an incubator with adjustable oxygen content. Following 15 days of differentiation, cells are harvested and dissociated by gentle digestion with Collagenase (0.1 unit/mg) and Dispase (0.8 unit/mg), both are available from F. Hoffman-La Roche Ltd, Basel, Switzerland. CD45-positive cells are isolated using anti-CD45 monoclonal antibody (mAb) Ml/9.3.4.
- mAb monoclonal antibody
- the isolated CD45-positive cells can be further enriched using a single passage over a MACS column (Miltenyi).
- EBs are complex structures
- differentiation of EBs into specific differentiated cells, tissue or organ may require isolation of lineage specific cells from the EBs.
- Such isolation may be effected by sorting of cells of the EBs via fluorescence activated cell sorter (FACS) or mechanical separation of cells, tissues and/or tissue-like structures contained within the EBs.
- FACS fluorescence activated cell sorter
- EBs are disaggregated using a solution of Trypsin and EDTA (0.025 % and 0.01 %, respectively), washed with 5 % fetal bovine serum (FBS) in phosphate buffered saline (PBS) and incubated for 30 min on ice with fluorescently-labeled antibodies directed against cell surface antigens characteristics to a specific cell lineage.
- FBS fetal bovine serum
- PBS phosphate buffered saline
- endothelial cells are isolated by attaching an antibody directed against the platelet endothelial cell adhesion molecule- 1 (PECAM1) such as the fluorescently-labeled PECAM1 antibodies (30884X) available from PharMingen (PharMingen, Becton Dickinson Bio Sciences, San Jose, CA, USA) as described in Levenberg, S. et al., (Endothelial cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. USA. 2002. 99: 4391-4396).
- PECAM1 platelet endothelial cell adhesion molecule- 1
- Hematopoietic cells are isolated using fluorescently-labeled antibodies such as CD34-FITC, CD45-PE, CD31- PE, CD38-PE, CD90-FITC, CD117-PE, CD15-FITC, class I-FITC, all of which IgGl are available from PharMingen, CD133/1-PE (IgGl) (available from Miltenyi Biotec, Auburn, CA), and glycophorin A-PE (IgGl), available from Immunotech (Miami, FL). Live cells (i.e., without fixation) are analyzed on a FACScan (Becton Dickinson Bio Sciences) by using propidium iodide to exclude dead cells with either the PC-LYSIS or the CELLQUEST software.
- fluorescently-labeled antibodies such as CD34-FITC, CD45-PE, CD31- PE, CD38-PE, CD90-FITC, CD117-PE, CD15-FITC, class I-FITC, all of which IgGl are
- isolated cells can be further enriched using magnetically-labeled second antibodies and magnetic separation columns (MACS, Miltenyi) as described by Kaufman, D.S. et al., (Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. USA. 2001, 98: 10716-10721).
- MCS magnetically-labeled second antibodies and magnetic separation columns
- Dissociated cells are then resuspended in a differentiation KB medium (85 mM KCI, 30 mM K 2 HP0 4 , 5 mM MgS0 4 , 1 mM EGTA, 5 mM creatine, 20 mM glucose, 2 mM Na 2 ATP, 5 mM pyruvate, and 20 mM taurine, buffered to pH 7.2, Maltsev et al., Circ. Res. 75:233, 1994) and incubated at 37 °C for 15-30 min. Following dissociation cells are seeded into chamber slides and cultured in the differentiation medium to generate single cardiomyocytes capable of beating.
- a differentiation KB medium 85 mM KCI, 30 mM K 2 HP0 4 , 5 mM MgS0 4 , 1 mM EGTA, 5 mM creatine, 20 mM glucose, 2 mM Na 2 ATP, 5 mM pyruvate, and 20 mM tau
- the culturing conditions suitable for the differentiation and expansion of the isolated lineage specific cells include various tissue culture medium, growth factors, antibiotic, amino acids and the like and it is within the capability of one skilled in the art to determine which conditions should be applied in order to expand and differentiate particular cell types and/or cell lineages [reviewed in Fijnvandraat AC, et al., Cardiovasc Res. 2003; 58: 303-12; Sachinidis A, et al., Cardiovasc Res. 2003; 58: 278-91; Stavridis MP and Smith AG, 2003; Biochem Soc Trans. 31(Pt 1): 45-9].
- EBs of the invention can be used to generate lineage- specific cell lines which are capable of unlimited expansion in culture.
- Cell lines of some embodiments of the invention can be produced by immortalizing the EB-derived cells by methods known in the art, including, for example, expressing a telomerase gene in the cells (Wei, W. et al., 2003. Mol Cell Biol. 23 : 2859-2870) or co-culturing the cells with NIH 3T3 hph-HOXl 1 retroviral producer cells (Hawley, R.G. et al., 1994. Oncogene 9: 1-12). Following are non-limiting examples of culturing conditions which are suitable for differentiating and/or expanding lineage specific cells from the naive PSCs of some embodiments of the invention. It should be noted that for inducing differentiation of the naive PSCs into differentiated cells, the medium which was used to maintain the cells in the naive undifferentiated and pluripotent state should be replaced with the appropriate differentiation medium.
- Mesenchymal stromal cells which are CD73-positive and SSEA-4-negative can be generated from naive PSCs by mechanically increasing the fraction of fibroblast-like differentiated cells formed in cultures of naive hPSCs, essentially as described in Trivedi P and Hematti P. Exp Hematol. 2008, 36(3):350-9. Briefly, to induce differentiation of hESC the intervals between medium changes are increased to 3-5 days, and the cells at the periphery of the naive PSCs colonies become spindle-shaped fibroblast-looking cells. After 9-10 days under these conditions when about 40-50% of the cells in the culture acquire the fibroblast-looking appearance, the undifferentiated portions of naive PSCs colonies are physically removed and the remaining differentiated cells are passaged to new culture plates under the same conditions.
- the cells can be co-cultured with the mouse stromal cell lines PA6 or MS5, or can be cultured with a combination of stromal cell-derived factor 1 (SDF-1/CXCL12), pleiotrophin (PTN), insulin-like growth factor 2 (IGF2) and ephrin B l (EFNB 1) essentially as described in Vazin T, et al., PLoS One. 2009 Aug 12;4(8):e6606; and in Elkabetz Y., et al., Genes Dev. 2008 January 15; 22: 152-165.
- SDF-1/CXCL12 stromal cell-derived factor 1
- PTN pleiotrophin
- IGF2 insulin-like growth factor 2
- EFNB 1 ephrin B l
- naive hPSCs can be genetically modified to express the transcription factor Lmxla (e.g., using a lentiviral vector with the PGK promoter and Lmxla) essentially as described in Friling S., et al., Proc Natl Acad Sci U S A. 2009, 106: 7613-7618.
- the naive PSCs can be cultured in the presence of a commercially available cell culture medium (Small Airway Growth Medium; Cambrex, College Park, MD), or alternatively, in the presence of a conditioned medium collected from a pneumocyte cell line (e.g., the A549 human lung adenocarcinoma cell line) as described in Rippon HJ., et al., Proc Am Thorac Soc. 2008; 5: 717-722.
- a commercially available cell culture medium Mall Airway Growth Medium; Cambrex, College Park, MD
- a conditioned medium collected from a pneumocyte cell line e.g., the A549 human lung adenocarcinoma cell line
- the pluripotent stem cells can be cultured for about 5 days in the presence of a serum replacement medium supplemented with TGF-b inhibitor (SB431542, Tocris; e.g., 10 nM) and Noggin (R&D; e.g., 500 ng/ml), following which the cells are cultured with increasing amounts (e.g., 25 %, 50 %, 75 %, changed every two days) of N2 medium (Li XJ., et al., Nat Biotechnol. 2005, 23:215-21) in the presence of 500 ng/niL Noggin, essentially as described in Chambers SM., et al., Nat Biotechnol. 2009, 27: 275-280.
- TGF-b inhibitor SB431542, Tocris; e.g., 10 nM
- R&D Noggin
- N2 medium Li XJ., et al., Nat Biotechnol. 2005, 23:215-21
- the invention contemplates the use of cells, tissues and organs generated from the naive pluripotent stem cells of the invention using any differentiation protocol known in the art.
- the invention envisages the use of the expanded and/or differentiated lineage- specific cells or cell lines of some embodiments of the invention for treating a disorder requiring cell replacement therapy.
- diseases presently expected to be treatable by therapeutic transplantation of PSC or PSC-derived cells include Parkinson's disease, cardiac infarcts, juvenile-onset diabetes mellitus, and leukemia (Gearhart J. Science 1998, 282: 1061; Rossant and Nagy, Nature Biotech. 1999, 17:23).
- oligodendrocyte precursors can be used to treat myelin disorders (Repair of myelin disease: Strategies and progress in animal models. Molecular Medicine Today. 1997. pp. 554-561), chondrocytes or mesenchymal cells can be used in treatment of bone and cartilage defects (U.S. Pat. No. 4,642,120) and cells of the epithelial lineage can be used in skin regeneration of a wound or burn (U.S. Pat. No. 5,716,411).
- PSC-derived cells are preferably manipulated to over-express the mutated gene prior to their administration to the individual. It will be appreciated that for other disorders, the PSC-derived cells should be manipulated to exclude certain genes.
- Over-expression or exclusion of genes can be effected using knock-in and/or knock-out constructs [see for example, Fukushige, S. and Ikeda, J. E.: Trapping of mammalian promoters by Cre-lox site-specific recombination. DNA Res 3 (1996) 73- 50; Bedell, M. A., Jerkins, N. A. and Copeland, N. G.: Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice. Genes and Development 11 (1997) 1-11; Bermingham, J. J., Scherer, S. S., O'Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L. and Rosenfeld, M. G.: Tst-l/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 10 (1996) 1751-62].
- the lineage specific cells of some embodiments of the invention can also be utilized to prepare a cDNA library.
- mRNA is prepared by standard techniques from the lineage specific cells and is further reverse transcribed to form cDNA.
- the cDNA preparation can be subtracted with nucleotides from embryonic fibroblasts and other cells of undesired specificity, to produce a subtracted cDNA library by techniques known in the art.
- the lineage specific cells of some embodiments of the invention can be used to screen for factors (such as small molecule drugs, peptides, polynucleotides, and the like) or conditions (such as culture conditions or manipulation) that affect the differentiation of lineage precursor to terminally differentiated cells.
- factors such as small molecule drugs, peptides, polynucleotides, and the like
- conditions such as culture conditions or manipulation
- growth affecting substances, toxins or potential differentiation factors can be tested by their addition to the culture medium.
- a method of generating a primordial germ cell comprising culturing primate naive pluripotent stem cells in a culture medium selected capable of inducing the primate naive pluripotent stem cells into primordial germ cell, wherein the culture medium comprises a Rho kinase (ROCK) inhibitor and bone morphogenetic protein 4 (BMP4), thereby generating the primordial germ cell.
- a Rho kinase (ROCK) inhibitor and bone morphogenetic protein 4 (BMP4)
- the primate naive pluripotent stem cell comprises:
- XIST X-inactive specific transcript
- TFE3 transcription factor E3
- the primordial germ cell is characterized by CD61 (intergrin beta 3) positive expression pattern.
- the primordial germ cell is characterized by CD61 + /SSEA4 + expression pattern (expression signature).
- the culture medium selected capable of inducing the primate naive pluripotent stem cells into primordial germ cell further comprises at least one agent selected from the group consisting of: leukemia inhibitory factor (LIF), Stem Cell Factor (SCF) and Epidermal Growth Factor (EGF).
- LIF leukemia inhibitory factor
- SCF Stem Cell Factor
- EGF Epidermal Growth Factor
- an isolated population of primate primordial germ cells comprising primate primordial germ cells generated according to the method of some embodiments of the invention.
- the isolated population of primate primordial germ cells comprising at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 99%, e.g., 100% of primordial germ cells characterized by CD61 + /SSEA4 + expression pattern.
- primordial germ cells of some embodiments of the invention can be injected into adult human testis or ovary to complete their maturation and generate sperm or eggs.
- a method of treating a subject in need thereof comprising administering the primordial germ cells of some embodiments of the invention to a gonad tissue of the subject, thereby treating the subject in need thereof.
- subject refers to a mammal, e.g., a primate, preferably a human being at any age which suffer from the pathology.
- treating refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology.
- pathology disease, disorder or condition
- Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
- the subject suffers from infertility.
- kits comprising the primate primordial germ cells of some embodiments of the invention and a medicament for treating infertility.
- the kit may also include appropriate buffers and preservatives for improving the shelf-life of the kit.
- the kit may include appropriate instructions for use and labels indicating FDA approval for use in treating a subject, such as treating infertility in the subject.
- a method of generating a chimeric animal comprising introducing the isolated primate (e.g., human) naive PSC of some embodiments of the invention, or the primordial germ cells of some embodiments of the invention into a pre-implantation embryo of a host animal, thereby generating the chimeric animal.
- the method further comprising allowing the chimeric animal to grow in vivo or ex vivo.
- the isolated naive pluripotent stem cells or the primordial germ cells are introduced into the pre-implantation embryo they are likely to form a normal embryo.
- chimeric animal refers to an animal comprising cells of at least two genetically distinct individuals.
- pre-implantation embryo refers to an embryo at an 8- cell stage, 16- cell stage embryo, early morula, late morula, early blastocyst, and/or a late blastocyst.
- the chimeric animal can be composed of cells of two different individuals belonging to two different species, or to the same species.
- the isolated naive PSC or the primordial germ cell is allogeneic to the host animal.
- alloegeneic refers to at least two genetically different individuals of the same species.
- the isolated naive PSC or the primordial germ cell is xenogeneic to the host animal.
- xenogeneic refers to at least two individuals of different species.
- the host animal is not human.
- introducing the cells is performed in vivo.
- introducing the cells is performed in vitro or ex vivo via direct injection or aggregation with the developing host embryo.
- the morula comprises at least
- the morula comprises no more than 128 cells.
- the host animal is a primate, e.g., a mammal.
- the host animal is mouse.
- the host animal is pig.
- the host animal is monkey.
- the host animal is chimpanzee.
- the cells of the chimeric animal can be used for cell therapy.
- the mature differentiated cells e.g., hematopoietic stem cells, liver hepatocytes, insulin producing Beta cells
- the mature differentiated cells e.g., hematopoietic stem cells, liver hepatocytes, insulin producing Beta cells
- the mature differentiated cells generated in the chimeric animal based on some embodiments of the invention can be used for transplantation in adult humans or for biomedical applications.
- naive PSCs that were used to form the chimeric animal are human cells
- these cells can be further isolated from the formed chimeric animal and used for treating a human subject.
- the method further comprises isolating human-derived (human-originated) cells or tissues from the chimeric animal.
- Non-limiting examples of using such human-originated cells, tissues or organs include cell based therapy, tissue replacement, organ or tissue implantation. Following is a non-limiting description of expression vectors and modes of administering thereof into cells which can be used to express a polypeptide-of-interest (e.g., any of the proteins described hereinabove, e.g., OCT4, c-MYC, SOX2, KLF4, LIF, bFGF, TGF l) in a cell.
- a polypeptide-of-interest e.g., any of the proteins described hereinabove, e.g., OCT4, c-MYC, SOX2, KLF4, LIF, bFGF, TGF l
- a polynucleotide sequence encoding the polypeptide-of-interest is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
- a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
- the nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
- a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
- such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
- the nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
- the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
- Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
- the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
- the other upstream promoter elements determine the rate at which transcription is initiated.
- Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
- CMV cytomegalovirus
- the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Developmental Biology & Embryology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Reproductive Health (AREA)
- Gynecology & Obstetrics (AREA)
- Transplantation (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Endocrinology (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES14727237T ES2831424T3 (es) | 2013-04-23 | 2014-04-23 | Células madre pluripotentes naif aisladas y métodos para generarlas |
| CN201480035892.7A CN105531365A (zh) | 2013-04-23 | 2014-04-23 | 分离的幼稚多能干细胞和产生所述细胞的方法 |
| EP14727237.1A EP2989199B1 (en) | 2013-04-23 | 2014-04-23 | Isolated naive pluripotent stem cells and methods of generating same |
| JP2016509588A JP2016521971A (ja) | 2013-04-23 | 2014-04-23 | 単離ナイーブ型多能性幹細胞およびそれを発生させる方法関連出願本出願は、米国特許法119条第(e)項に基づき、2014年1月29日出願の米国特許仮出願第61/932,935号、2013年9月17日出願の米国特許仮出願第61/878,769号、および2013年4月23日出願の米国特許仮出願第61/814,920号の優先権を主張する。また、本出願は、同時に提出された同出願人による同時係属出願である、YaqubHANNA、NoaNOVERSHTERN、およびYoachRAISによる米国特許出願(発明の名称「単離ナイーブ型多能性幹細胞およびそれを発生させる方法(ISOLATEDNAIVEPLURIPOTENTSTEMCELLSANDMETHODSOFGENERATINGSAME)」)(代理人事件記録簿第58870号)にも関する。上記出願の内容はその全体を参考として本明細書に組み込む。 |
| IL241930A IL241930B (en) | 2013-04-23 | 2015-10-06 | Isolated naive pluripotent stem cells and methods of generating same |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361814920P | 2013-04-23 | 2013-04-23 | |
| US61/814,920 | 2013-04-23 | ||
| US201361878769P | 2013-09-17 | 2013-09-17 | |
| US61/878,769 | 2013-09-17 | ||
| US201461932935P | 2014-01-29 | 2014-01-29 | |
| US61/932,935 | 2014-01-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014174470A1 true WO2014174470A1 (en) | 2014-10-30 |
Family
ID=50842281
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2014/060954 Ceased WO2014174470A1 (en) | 2013-04-23 | 2014-04-23 | Isolated naive pluripotent stem cells and methods of generating same |
Country Status (7)
| Country | Link |
|---|---|
| US (3) | US10920192B2 (OSRAM) |
| EP (1) | EP2989199B1 (OSRAM) |
| JP (1) | JP2016521971A (OSRAM) |
| CN (1) | CN105531365A (OSRAM) |
| ES (1) | ES2831424T3 (OSRAM) |
| IL (1) | IL241930B (OSRAM) |
| WO (1) | WO2014174470A1 (OSRAM) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016016894A1 (en) | 2014-07-30 | 2016-02-04 | Yeda Research And Development Co. Ltd. | Media for culturing pluripotent stem cells |
| WO2016027099A3 (en) * | 2014-08-22 | 2016-04-14 | Cambridge Enterprise Limited | Resetting pluripotent stem cells |
| WO2016079146A1 (en) * | 2014-11-17 | 2016-05-26 | Genome Research Limited | In vitro production of expanded potential stem cells |
| CN106244522A (zh) * | 2016-08-12 | 2016-12-21 | 浙江译美生物科技有限公司 | 一种干细胞培养体系及其培养方法 |
| WO2017002888A1 (ja) * | 2015-06-29 | 2017-01-05 | 国立大学法人京都大学 | 多能性幹細胞から生殖細胞への分化誘導方法 |
| WO2017170849A1 (ja) * | 2016-03-30 | 2017-10-05 | 国立研究開発法人医薬基盤・健康・栄養研究所 | ナイーブ型多能性幹細胞培養用培地および多能性幹細胞の培養方法 |
| KR20180052612A (ko) * | 2015-08-13 | 2018-05-18 | 베이하오 스템 셀 앤 리제너레이티브 메디슨 리서치 인스티튜트 씨오.,엘티디. | 유도 연장 만능 줄기 세포, 이의 제조방법 및 사용 방법 |
| WO2018119213A1 (en) * | 2016-12-23 | 2018-06-28 | StemBios Technologies, Inc. | Use of somatic stem cells for decreasing il-6 level |
| WO2020152686A1 (en) | 2019-01-23 | 2020-07-30 | Yeda Research And Development Co. Ltd. | Culture media for pluripotent stem cells |
| CN112048467A (zh) * | 2020-09-11 | 2020-12-08 | 江苏集萃药康生物科技有限公司 | Ksom-aa培养液在体外培养nod背景鼠胚胎中的应用 |
| US10920192B2 (en) | 2013-04-23 | 2021-02-16 | Yeda Research And Development Co. Ltd. | Isolated naive pluripotent stem cells and methods of generating same |
| WO2021243252A1 (en) * | 2020-05-29 | 2021-12-02 | The Board Of Trustees Of The Leland Stanford Junior University | Generation of primordial germ cells and methods of using the same |
| CN115003795A (zh) * | 2019-11-14 | 2022-09-02 | 岛崎猛夫 | 细胞的重编程方法 |
| WO2023082007A1 (en) * | 2021-11-12 | 2023-05-19 | L'alliance Boviteq Inc. | Derivation of naïve bovine embryonic stem cells |
| US12467917B2 (en) | 2021-03-16 | 2025-11-11 | California Institute Of Technology | Reconstructing human early embryogenesis in vitro with pluripotent stem cells |
| US12618830B2 (en) | 2022-12-13 | 2026-05-05 | California Institute Of Technology | Methods, culture medias and devices for generating embryos in vitro from stem cells |
Families Citing this family (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011503232A (ja) | 2007-11-20 | 2011-01-27 | ザ ブリガム アンド ウィメンズ ホスピタル インコーポレイテッド | 免疫応答の調節 |
| KR102170502B1 (ko) | 2013-12-11 | 2020-10-28 | 리제너론 파마슈티칼스 인코포레이티드 | 게놈의 표적화된 변형을 위한 방법 및 조성물 |
| US20170114323A1 (en) | 2014-06-19 | 2017-04-27 | Whitehead Institute For Biomedical Research | Uses of kinase inhibitors for inducing and maintaining pluripotency |
| CN105441384B (zh) * | 2014-09-26 | 2021-01-05 | 北京大学 | 一种制备动物和人类原始多潜能干细胞的方法,试剂盒及用途 |
| BR112017007770A2 (pt) | 2014-10-15 | 2018-01-16 | Regeneron Pharma | cultura in vitro, população de hipscs, método para modificar um locus-alvo genômico, e, hipsc. |
| US20180071376A1 (en) | 2015-03-23 | 2018-03-15 | The Brigham And Women`S Hospital, Inc. | Tolerogenic nanoparticles for treating diabetes mellitus |
| WO2016169903A1 (en) * | 2015-04-23 | 2016-10-27 | Koninklijke Philips N.V. | Model-based segmentation of an anatomical structure |
| US20180142206A1 (en) * | 2015-05-05 | 2018-05-24 | The J. David Gladstone Institutes, a testamentary trust established under the Will of J. David Glads | Reversion of primed pluripotent stem cells to naive pluripotent stem cells |
| CN108699515A (zh) | 2016-02-24 | 2018-10-23 | 诺和诺德股份有限公司 | 由人多能干细胞衍生的内分泌祖细胞生成功能性β细胞 |
| CA3032972A1 (en) * | 2016-08-19 | 2018-02-22 | Memorial Sloan-Kettering Cancer Center | Methods of differentiating stem cells into endoderm |
| GB201615343D0 (en) * | 2016-09-09 | 2016-10-26 | Zernicka-Goetz Magdalena And Harrison Sarah E M | Methods |
| JP7248571B2 (ja) * | 2016-10-05 | 2023-03-29 | フジフィルム セルラー ダイナミクス,インコーポレイテッド | MeCP2が破壊された誘導多能性幹細胞からの成熟系列の生成 |
| US11697796B2 (en) * | 2017-01-23 | 2023-07-11 | Stemcell Technologies Canada Inc. | Media and methods for enhancing the survival and proliferation of stem cells |
| US10783627B2 (en) * | 2017-03-03 | 2020-09-22 | Case Western Reserve University | Predicting cancer recurrence using local co-occurrence of cell morphology (LoCoM) |
| WO2018209232A1 (en) * | 2017-05-12 | 2018-11-15 | Regents Of The University Of Minnesota | Methods of preparing naive human pluripotent stem cells |
| ES2903187T3 (es) * | 2017-06-13 | 2022-03-31 | Georg August Univ Goettingen Stiftung Oeffentlichen Rechts Univsmedizin | Procedimientos de producción de organoides neuronales de bioingeniería (BENO) y sus usos |
| CN107523540B (zh) * | 2017-06-27 | 2021-02-12 | 香港大学深圳医院 | 一种建立家族遗传性卵巢早衰来源的诱导全能干细胞向原始生殖嵴细胞诱导分化的方法 |
| MX2020005668A (es) | 2017-11-30 | 2020-11-24 | Univ Kyoto | Metodo de cultivo de celulas. |
| CN108707629A (zh) * | 2018-05-28 | 2018-10-26 | 上海海洋大学 | 斑马鱼notch1b基因突变体的制备方法 |
| KR102131921B1 (ko) * | 2018-10-30 | 2020-07-08 | 차의과학대학교 산학협력단 | 줄기 세포의 신경전구세포로의 분화용 조성물, 키트, 및 이를 이용한 방법 |
| CN109355300B (zh) * | 2018-11-26 | 2022-01-28 | 成都中医药大学 | 黄连sdir转录因子在提高植物抗旱中的应用 |
| WO2021015228A1 (ja) * | 2019-07-25 | 2021-01-28 | 富士フイルム株式会社 | 特定の分化細胞の製造方法 |
| WO2021020267A1 (ja) * | 2019-07-26 | 2021-02-04 | 富士フイルム株式会社 | ナイーブ型多能性幹細胞の増殖能亢進用培地および多能性幹細胞の製造方法 |
| CN110592014A (zh) * | 2019-08-14 | 2019-12-20 | 广东美赛尔细胞生物科技有限公司 | 一种在nk细胞治疗中免辐照体外体内持续去除饲养细胞的方法 |
| CN110564674B (zh) * | 2019-09-29 | 2021-05-11 | 广东工业大学 | 一种干细胞铺底工作液及其应用 |
| CN110646335A (zh) * | 2019-09-29 | 2020-01-03 | 广东工业大学 | 一种封闭液及其应用 |
| US20230220331A1 (en) * | 2020-03-24 | 2023-07-13 | Jichi Medical University | Temporary treatment medium, treatment kit, embryogenesis arrest inhibitor, embryogenesis arrest inhibitory method, developmental engineering product preparation method, transplantation method, therapeutic method, and developmental engineering product |
| CN111487399B (zh) * | 2020-03-26 | 2021-09-17 | 湖南师范大学 | 一种蛋白分子标记在鱼类生殖细胞发育研究中的应用 |
| TWI761837B (zh) * | 2020-05-20 | 2022-04-21 | 國立中央大學 | 通用人類誘導多能性幹細胞及其生成方法 |
| JP2023531963A (ja) * | 2020-06-22 | 2023-07-26 | ライフ テクノロジーズ コーポレーション | 多能性細胞懸濁物を培養するための方法及び組成物 |
| US20230250394A1 (en) * | 2020-06-24 | 2023-08-10 | Syracuse University | Generation of perinatal-like mesenchymal stem cells from human induced pluripotent stem cells |
| CN111650327B (zh) * | 2020-07-16 | 2023-06-02 | 扬州大学 | 一种基于非标定量蛋白质组学技术寻找如皋黄鸡不同细胞或组织间差异表达蛋白的方法 |
| US20230407245A1 (en) * | 2020-11-11 | 2023-12-21 | Bgi Shenzhen Group Holdings Co., Limited | Media and methods for establishing and maintaining early embryo-like cells |
| WO2022114188A1 (ja) * | 2020-11-30 | 2022-06-02 | 国立大学法人京都大学 | 二層性胚盤モデルおよびその製造方法 |
| CN112831461B (zh) * | 2021-02-26 | 2023-08-08 | 澳门大学 | 一种诱导干细胞分化成中胚层谱系或滋养细胞谱系的方法及药物 |
| CN114164258B (zh) * | 2021-12-22 | 2022-08-19 | 北京泽辉辰星生物科技有限公司 | 一种多能性基因表达水平检验方法 |
| WO2023173370A1 (en) * | 2022-03-17 | 2023-09-21 | Guangzhou Institutes Of Biomedicine And Health, Chinese Academy Of Sciences | Media and methods for producing human cells and tissues from teratoma, organoids and embryoid bodies |
| CN114651787A (zh) * | 2022-04-21 | 2022-06-24 | 贵州医科大学附属医院 | 用于构建小鼠视神经特异性脱髓鞘模型的小鼠的构建方法及其应用 |
| CN117431258B (zh) * | 2023-12-20 | 2024-06-28 | 上海元戊医学技术有限公司 | 使用含有Tet1基因的重编程因子诱导人体细胞重编程的方法 |
Citations (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3791932A (en) | 1971-02-10 | 1974-02-12 | Akzona Inc | Process for the demonstration and determination of reaction components having specific binding affinity for each other |
| US3839153A (en) | 1970-12-28 | 1974-10-01 | Akzona Inc | Process for the detection and determination of specific binding proteins and their corresponding bindable substances |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| US3879262A (en) | 1972-05-11 | 1975-04-22 | Akzona Inc | Detection and determination of haptens |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4642120A (en) | 1983-03-23 | 1987-02-10 | Ramot University Authority For Applied Research And Industrial Development Ltd. | Repair of cartilage and bones |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| US5716411A (en) | 1994-04-19 | 1998-02-10 | Brigham & Womens Hospital | Method of skin regeneration using a collagen-glycosaminoglycan matrix and cultured epithelial autograft |
| WO1998043679A1 (en) * | 1997-03-31 | 1998-10-08 | The Johns Hopkins University School Of Medicine | Human embryonic germ cell line and methods of use |
| US5843780A (en) | 1995-01-20 | 1998-12-01 | Wisconsin Alumni Research Foundation | Primate embryonic stem cells |
| US5932447A (en) | 1994-05-17 | 1999-08-03 | Bristol-Myers Squibb Company | Cloning and expression of a gene encoding bryodin 1 from Bryonia dioica |
| US6090622A (en) | 1997-03-31 | 2000-07-18 | The Johns Hopkins School Of Medicine | Human embryonic pluripotent germ cells |
| US20030022367A1 (en) | 2001-07-12 | 2003-01-30 | Chunhui Xu | Cardiomyocyte precursors from human embryonic stem cells |
| WO2006040763A2 (en) | 2004-10-12 | 2006-04-20 | Technion Research & Development Foundation Ltd. | Isolated primate embryonic cells and methods of generating and using same |
| WO2010077955A1 (en) * | 2008-12-17 | 2010-07-08 | The Scripps Research Institute | Generation and maintenance of stem cells |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060194315A1 (en) | 2003-03-31 | 2006-08-31 | Condie Brian G | Compositions and methods for the control, differentiaton and/or manipulation of pluripotent cells through a gamma-secretase signaling pathway |
| JP5680850B2 (ja) | 2006-03-30 | 2015-03-04 | ザ・ユニバーシティ・コート・オブ・ザ・ユニバーシティ・オブ・エディンバラThe University Court of the University of Edinburgh | キナーゼインヒビターを含む培養培地およびその使用 |
| CN105861443A (zh) | 2007-04-07 | 2016-08-17 | 怀特黑德生物医学研究所 | 体细胞重编程 |
| EP2090649A1 (en) | 2008-02-13 | 2009-08-19 | Fondazione Telethon | Method for reprogramming differentiated cells |
| WO2010124290A2 (en) * | 2009-04-24 | 2010-10-28 | Whitehead Institute For Biomedical Research | Compositions and methods for deriving or culturing pluripotent cells |
| US20130273649A1 (en) | 2012-04-13 | 2013-10-17 | University Of Southern California | Culture medium for pluripotent stem cells |
| CN105531365A (zh) | 2013-04-23 | 2016-04-27 | 耶达研究及发展有限公司 | 分离的幼稚多能干细胞和产生所述细胞的方法 |
| CN108064274A (zh) | 2014-07-30 | 2018-05-22 | 耶达研究及发展有限公司 | 用于培养多能干细胞的培养基 |
| US10745670B2 (en) | 2014-11-17 | 2020-08-18 | Genome Research Limited | In vitro production of expanded potential stem cells |
| US10246679B2 (en) | 2015-03-02 | 2019-04-02 | The University Of Tokyo | Method for producing pluripotent stem cell having improved chimera forming ability from primed pluripotent stem cell, and composition and combination therefor |
-
2014
- 2014-04-23 CN CN201480035892.7A patent/CN105531365A/zh active Pending
- 2014-04-23 ES ES14727237T patent/ES2831424T3/es active Active
- 2014-04-23 EP EP14727237.1A patent/EP2989199B1/en active Active
- 2014-04-23 US US14/259,997 patent/US10920192B2/en active Active
- 2014-04-23 WO PCT/IB2014/060954 patent/WO2014174470A1/en not_active Ceased
- 2014-04-23 JP JP2016509588A patent/JP2016521971A/ja active Pending
-
2015
- 2015-10-06 IL IL241930A patent/IL241930B/en active IP Right Grant
-
2020
- 2020-12-10 US US17/117,157 patent/US12570957B2/en active Active
-
2025
- 2025-08-19 US US19/303,417 patent/US20260028583A1/en active Pending
Patent Citations (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3839153A (en) | 1970-12-28 | 1974-10-01 | Akzona Inc | Process for the detection and determination of specific binding proteins and their corresponding bindable substances |
| US3791932A (en) | 1971-02-10 | 1974-02-12 | Akzona Inc | Process for the demonstration and determination of reaction components having specific binding affinity for each other |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| US3879262A (en) | 1972-05-11 | 1975-04-22 | Akzona Inc | Detection and determination of haptens |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US4642120A (en) | 1983-03-23 | 1987-02-10 | Ramot University Authority For Applied Research And Industrial Development Ltd. | Repair of cartilage and bones |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683202B1 (OSRAM) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| US5487992A (en) | 1989-08-22 | 1996-01-30 | University Of Utah Research Foundation | Cells and non-human organisms containing predetermined genomic modifications and positive-negative selection methods and vectors for making same |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| US5716411A (en) | 1994-04-19 | 1998-02-10 | Brigham & Womens Hospital | Method of skin regeneration using a collagen-glycosaminoglycan matrix and cultured epithelial autograft |
| US5932447A (en) | 1994-05-17 | 1999-08-03 | Bristol-Myers Squibb Company | Cloning and expression of a gene encoding bryodin 1 from Bryonia dioica |
| US5843780A (en) | 1995-01-20 | 1998-12-01 | Wisconsin Alumni Research Foundation | Primate embryonic stem cells |
| WO1998043679A1 (en) * | 1997-03-31 | 1998-10-08 | The Johns Hopkins University School Of Medicine | Human embryonic germ cell line and methods of use |
| US6090622A (en) | 1997-03-31 | 2000-07-18 | The Johns Hopkins School Of Medicine | Human embryonic pluripotent germ cells |
| US20030022367A1 (en) | 2001-07-12 | 2003-01-30 | Chunhui Xu | Cardiomyocyte precursors from human embryonic stem cells |
| WO2006040763A2 (en) | 2004-10-12 | 2006-04-20 | Technion Research & Development Foundation Ltd. | Isolated primate embryonic cells and methods of generating and using same |
| WO2010077955A1 (en) * | 2008-12-17 | 2010-07-08 | The Scripps Research Institute | Generation and maintenance of stem cells |
Non-Patent Citations (306)
| Title |
|---|
| "Enhancers and Eukaryotic Expression", 1983, COLD SPRING HARBOR PRESS, COLD SPRING HARBOR |
| "Immobilized Cells and Enzymes", 1986, IRL PRESS |
| "Methods in Enzymology", vol. 1-317, ACADEMIC PRESS |
| "PCR Protocols: A Guide To Methods And Applications", 1990, ACADEMIC PRESS |
| "Repair of myelin disease: Strategies and progress in animal models", MOLECULAR MEDICINE TODAY, 1997, pages 554 - 561 |
| "Vectors: A Survey of Molecular Cloning Vectors and Their Uses", 1988, BUTTERWORTHS |
| ACAMPORA, D. ET AL., DEVELOPMENT, vol. 124, 1997, pages 3639 - 50 |
| AGUILERA, C. ET AL., NATURE, vol. 469, 2011, pages 231 - 235 |
| AHN K S ET AL: "Production of human CD59-transgenic pigs by embryonic germ cell nuclear transfer", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 400, no. 4, 1 October 2010 (2010-10-01), pages 667 - 672, XP027356570, ISSN: 0006-291X, [retrieved on 20100908], DOI: 10.1016/J.BBRC.2010.08.125 * |
| ALEJANDRO DE LOS ANGELES ET AL: "Accessing nave human pluripotency", CURRENT OPINION IN GENETICS & DEVELOPMENT, vol. 22, no. 3, 29 March 2012 (2012-03-29), pages 272 - 282, XP028493568, ISSN: 0959-437X, [retrieved on 20120306], DOI: 10.1016/J.GDE.2012.03.001 * |
| ALTSCHUL, S. F. ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 402 |
| ANG Y.-S. ET AL., CELL, vol. 145, 2011, pages 183 - 197 |
| ANG, Y.-S. ET AL., CELL, vol. 145, 2011, pages 183 - 197 |
| ANG, Y.-S.; TSAI, S.-Y.; LEE, D.-F.; MONK, J.; SU, J.; RATNAKUMAR, K; DING, J.; GE, Y.; DARR, H.; CHANG, B. ET AL.: "Wdr5 mediates self-renewal and reprogramming via the embryonic stem cell core transcriptional network", CELL, vol. 145, 2011, pages 183 - 197, XP028194587, DOI: doi:10.1016/j.cell.2011.03.003 |
| AOI T ET AL.: "Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells", SCIENCE, 14 February 2008 (2008-02-14) |
| ARCE, G. R.: "Nonlinear Signal Processing: A Statistical Approach - Gonzalo R. Arce - Google Books", 2005 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS |
| AUSUBEL, R. M.,: "Current Protocols in Molecular Biology", vol. I-III, 1994 |
| BAO, S. ET AL., NATURE, vol. 461, 2009, pages 1292 - 1295 |
| BEDELL, M. A.; JERKINS, N. A.; COPELAND, N. G.: "Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice", GENES AND DEVELOPMENT, vol. 11, 1997, pages 1 - 11 |
| BEDELL, VM ET AL., NATURE, vol. 491, 2012, pages 114 - 8 |
| BENJAMINI, Y.; HOCHBERG, Y, JOURNAL OF THE ROYAL STATISTICAL SOCIETY SERIES B (METHODOLOGICAL, vol. 57, 1995, pages 289 - 300 |
| BEN-YOSEF, D. ET AL., STEM CELLS AND DEVELOPMENT, vol. 21, 2012, pages 363 - 372 |
| BEN-YOSEF, D. ET AL.: "Female Sex Bias in Human Embryonic Stem Cell Lines", STEM CELLS AND DEVELOPMENT, vol. 21, 2012, pages 363 - 372 |
| BERMINGHAM, J. J.; SCHERER, S. S; O'CONNELL, S; ARROYO, E.; KALLA, K. A.; POWELL, F. L.; ROSENFELD, M. G.: "Tst-l/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration.", GENES DEV, vol. 10, 1996, pages 1751 - 62 |
| BERNSTEIN, B. E. ET AL., CELL, vol. 125, 2006, pages 315 - 326 |
| BETSCHINGER, J. ET AL., CELL, vol. 153, 2013, pages 335 - 347 |
| BIRREN ET AL.: "Genome Analysis: A Laboratory Manual Series", vol. 1-4, 1998, COLD SPRING HARBOR LABORATORY PRESS |
| BITTER ET AL., METHODS IN ENZYMOL., vol. 153, 1987, pages 516 - 544 |
| BLECHER-GONEN, R. ET AL., NAT PROTOC., vol. 8, no. 3, 21 February 2013 (2013-02-21), pages 539 - 54 |
| BLECHER-GONEN, R. ET AL., NAT. PROTOC., vol. 8, 2013, pages 539 - 54 |
| BOIANI, M.; KEHLER, J.; SCHOLER, H. R., METHODS IN MOLECULAR BIOLOGY, vol. 254, 2004, pages 001 - 034 |
| BOLCH, G.; GREINER, S.; DE MEER, H.; TRIVEDI, K. S.: "Queueing networks and Markov chains: modeling and performance evaluation with computer science applications", 2006, WILEY |
| BONGSO ET AL., HUM REPROD, vol. 4, 1989, pages 706 |
| BOOTH ET AL., IMMUNOL. LETT., vol. 19, 1988, pages 65 - 70 |
| BOTTENSTEIN, J. E.; SATO, G. H., PROC. NATL. ACAD. SCI. USA, vol. 76, 1979, pages 514 - 517 |
| BOYER, L. A. ET AL., CELL, vol. 122, no. 6, 2005, pages 947 - 56 |
| BRISSON ET AL., NATURE, vol. 310, 1984, pages 511 - 514 |
| BRISTLE, O. ET AL.: "In vitro-generated neural precursors participate in mammalian brain development.", PROC. NATL. ACAD. SCI. USA., vol. 94, 1997, pages 14809 - 14814 |
| BROGLI ET AL., SCIENCE, vol. 224, 1984, pages 838 - 843 |
| BUECKER, C. ET AL., CELL STEM CELL, vol. 6, 2010, pages 535 - 546 |
| BUGANIM, Y. ET AL., CELL, vol. 150, 2012, pages 1209 - 1222 |
| BUGANIM, Y. ET AL.: "Single-cell expression analyses during cellular reprogramming reveal an early stochastic and a late hierarchic phase", CELL, vol. 150, 2012, pages 1209 - 1222, XP028938733, DOI: doi:10.1016/j.cell.2012.08.023 |
| CELLIS, J. E.,: "Cell Biology: A Laboratory Handbook", vol. I-III, 1994 |
| CHAMBERS SM. ET AL., NAT BIOTECHNOL., vol. 27, 2009, pages 275 - 280 |
| CHANG ET AL.: "Somatic Gene Therapy", 1995, CRC PRESS |
| CHAPPELL, J. ET AL., GENES DEV., vol. 27, 2013, pages 725 - 733 |
| CHEN, G. ET AL.: "Chemically defined conditions for human iPSC derivation and culture", NAT. METHODS, vol. 8, 2011, pages 424 - 429, XP055092759, DOI: doi:10.1038/nmeth.1593 |
| CHIA, N.-Y. ET AL., NATURE, vol. 468, 2010, pages 316 - 320 |
| CHIA, N.-Y. ET AL.: "A genome-wide RNAi screen reveals determinants of human embryonic stem cell identity", NATURE, vol. 468, 2010, pages 316 - 320, XP055031299, DOI: doi:10.1038/nature09531 |
| CHRISTOPHER J. LENGNER ET AL: "Derivation of Pre-X Inactivation Human Embryonic Stem Cells under Physiological Oxygen Concentrations", CELL, vol. 141, no. 5, 1 May 2010 (2010-05-01), pages 872 - 883, XP055075377, ISSN: 0092-8674, DOI: 10.1016/j.cell.2010.04.010 * |
| CHU, L.-F. ET AL., CURR. BIOL., vol. 21, 2011, pages 1759 - 1765 |
| CHUNG ET AL., CELL STEM CELL, vol. 2, no. 2, 7 February 2008 (2008-02-07), pages 113 - 117 |
| COLIGAN J. E.,: "Current Protocols in Immunology", vol. I-III, 1994 |
| CORUZZI ET AL., EMBO J., vol. 3, 1984, pages 1671 - 1680 |
| COSTA Y. ET AL.: "NANOG-dependent function of TET1 and TET2 in establishment of pluripotency", NATURE, vol. 495, 21 March 2013 (2013-03-21), pages 370 - 374, XP055256020, DOI: doi:10.1038/nature11925 |
| CURR. TOP. DEV. BIOL., vol. 38, 1998, pages 133 |
| DAVIES JC: "New therapeutic approaches for cystic fibrosis lung disease", J. R. SOC. MED., vol. 95, no. 41, 2002, pages 58 - 67, XP055067050 |
| DE LOS ANGELES A. ET AL., CURR. OPIN. GENET. DEV., vol. 22, 2012, pages 272 - 282 |
| DE LOS ANGELES ET AL., CURR. OPIN. GENET. DEV., vol. 22, 2012, pages 272 - 282 |
| DE LOS ANGELES, A. ET AL., DEV., vol. 22, 2012, pages 272 - 282 |
| DE LOS ANGELES, A.; LOH, Y.-H.; TESAR, P.J.; DALEY, G.Q.: "Accessing naive human pluripotency", CURR. OPIN. GENET. DEV., vol. 22, 2012, pages 272 - 282, XP028493568, DOI: doi:10.1016/j.gde.2012.03.001 |
| DIMOS JT ET AL., SCIENCE, vol. 321, 2008, pages 1218 - 1221 |
| DOEGE, C. A. ET AL., NATURE, vol. 488, 2012, pages 652 - 655 |
| DOETSCHMAN ET AL., DEV BIOL., vol. 127, 1988, pages 224 - 7 |
| DUFFY K.R, SCIENCE, vol. 335, 2012, pages 338 - 344 |
| DUFFY, K. R. ET AL., SCIENCE, vol. 335, 2012, pages 338 - 344 |
| DUFFY, K. R. ET AL.: "Activation-Induced B Cell Fates Are Selected by Intracellular Stochastic Competition", SCIENCE, vol. 335, 2012, pages 338 - 344 |
| DURCOVA-HILLS, G.; TANG, F.; DOODY, G.; TOOZE, R.; SURANI, M.A.: "Reprogramming primordial germ cells into pluripotent stem cells", PLOS ONE, vol. 3, 2008, pages E3531 |
| DURCOVA-HILLS, G.; TANG, F; DOODY, G.; TOOZE, R.; SURANI, M. A.: "Reprogramming primordial germ cells into pluripotent stem cells", PLOS ONE, vol. 3, 2008, pages E3531 |
| EDEN, E. ET AL., BMC BIOINFORMATICS, vol. 10, 2009, pages 48 |
| EGUIZABAL C ET AL: "Generation of primordial germ cells from pluripotent stem cells", DIFFERENTIATION, SPRINGER VERLAG, DE, vol. 78, no. 2-3, 1 September 2009 (2009-09-01), pages 116 - 123, XP026601254, ISSN: 0301-4681, [retrieved on 20090815], DOI: 10.1016/J.DIFF.2009.07.001 * |
| ELKABETZ Y. ET AL., GENES DEV., vol. 22, 15 January 2008 (2008-01-15), pages 152 - 165 |
| EVANS MJ; KAUFMAN M: "Pluripotential cells grown directly from normal mouse embryos", CANCER SURV., vol. 2, 1983, pages 185 - 208 |
| FICZ G ET AL., CELL STEM CELL, vol. 13, no. 3, 11 July 2013 (2013-07-11), pages 351 - 9 |
| FIDALGO, M. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 109, 2012, pages 16202 - 16207 |
| FIDALGO, M. ET AL.: "Zfp281 mediates Nanog autorepression through recruitment of the NuRD complex and inhibits somatic cell reprogramming", PROC. NATL. ACAD. SCI. U.S.A., vol. 109, 2012, pages 16202 - 16207 |
| FIDALGO, M.; FAIOLA, F; PEREIRA, C.-F.; DING, J.; SAUNDERS, A.; GINGOLD, J.; SCHANIEL, C.; LEMISCHKA, I.R.; SILVA, J.C.R.; WANG, J: "Zfp281 mediates Nanog autorepression through recruitment of the NuRD complex and inhibits somatic cell reprogramming.", PROC. NATL. ACAD. SCI. U.S.A., vol. 109, 2012, pages 16202 - 16207 |
| FIJNVANDRAAT AC ET AL., CARDIOVASC RES., vol. 58, 2003, pages 303 - 12 |
| FRESHNEY, R. I.,: "Animal Cell Culture", 1986 |
| FRILING S. ET AL., PROC NATL ACAD SCI U S A., vol. 106, 2009, pages 7613 - 7618 |
| FUKUSHIGE, S.; IKEDA, J. E.: "Trapping of mammalian promoters by Cre-lox site-specific recombination", DNA RES, vol. 3, 1996, pages 73 - 50 |
| GAFNI 0; WEINBERGER L; MANSOUR AA; MANOR YS; CHOMSKY E; BEN-YOSEF D; KALMA Y; VIUKOV S; MAZA I; ZVIRAN A, NATURE, vol. 504, no. 7479, 30 October 2013 (2013-10-30), pages 282 - 6 |
| GAFNI ET AL., NATURE, vol. 504, no. 7479, 30 October 2013 (2013-10-30), pages 282 - 6 |
| GAIT, M. J.,: "Oligonucleotide Synthesis", 1984 |
| GARDELLA ET AL., J. BIOL. CHEM., vol. 265, 1990, pages 15854 - 15859 |
| GARDNER ET AL., FERTIL. STERIL., vol. 69, 1998, pages 84 |
| GEARHART J., SCIENCE, vol. 282, 1998, pages 1061 |
| GILBOA, BIOTECHNIQUES, vol. 4, no. 6, 1986, pages 504 - 512 |
| GILES ET AL., MOL REPROD DEV., vol. 36, 1993, pages 130 - 8 |
| GNANAPRAGASAM ET AL.: "p66a-MBD2 coiled-coil interaction and recruitment of Mi-2 are critical for globin gene silencing by the MBD2-NuRD complex", PROC. NATL. ACAD. SCI., vol. 108, 2011, pages 7487 - 7492 |
| GRAVES; MOREADITH, MOL REPROD DEV., vol. 36, 1993, pages 424 - 33 |
| GREBER, B. ET AL., CELL STEM CELL, vol. 6, 2010, pages 215 - 226 |
| GUENTHER, M. G. ET AL., CELL STEM CELL, vol. 7, 2010, pages 249 - 257 |
| GÜNTHER, K ET AL., NUCLEIC ACIDS RES., vol. 41, 2013, pages 3010 - 3021 |
| GURLEY ET AL., MOL. CELL. BIOL., vol. 6, 1986, pages 559 - 565 |
| HAMES, B. D., AND HIGGINS S. J.,: "Nucleic Acid Hybridization", 1985 |
| HAMES, B. D., AND HIGGINS S. J.,: "Transcription and Translation", 1984 |
| HAN, J. ET AL., NATURE, vol. 463, 2010, pages 1096 - 1100 |
| HANNA ET AL., CELL, vol. 143, 2010, pages 508 - 525 |
| HANNA ET AL., NATURE, 2009 |
| HANNA J. ET AL., CELL, vol. 143, pages 508 - 525 |
| HANNA, J ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 107, 2010, pages 9222 - 9227 |
| HANNA, J. ET AL., CELL STEM CELL, vol. 4, 2009, pages 513 - 524 |
| HANNA, J. ET AL., NATURE, vol. 462, 2009, pages 595 - 601 |
| HANNA, J. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 107, 2010, pages 9222 - 9227 |
| HANNA, J. ET AL., PROC. NATL. ACAD. SCI. U.SA, vol. 107, 2010, pages 9222 - 9227 |
| HANNA, J. ET AL.: "Direct cell reprogramming is a stochastic process amenable to acceleration", NATURE, vol. 462, 2009, pages 595 - 601, XP055014858, DOI: doi:10.1038/nature08592 |
| HANNA, J. ET AL.: "Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs", PROC. NATL. ACAD. SCI. U.S.A., vol. 107, 2010, pages 9222 - 9227, XP055054545, DOI: doi:10.1073/pnas.1004584107 |
| HANNA, J. H. ET AL., CELL, vol. 143, 2010, pages 508 - 525 |
| HANNA, J.; CHENG, A.W.; SAHA, K.; KIM, J.; LENGNER, C.J.; SOLDNER, F.; CASSADY, J.P.; MUFFAT, J.; CAREY, B.W.; JAENISCH, R.: "Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs", PROC. NATL. ACAD. SCI. U.S.A., vol. 107, 2010, pages 922 - 9227, XP055054545, DOI: doi:10.1073/pnas.1004584107 |
| HANNA, J.; MARKOULAKI, S.; MITALIPOVA, M.; CHENG, A.W.; CASSADY, J.P.; STAERK, J.; CAREY, B.W.; LENGNER, C.J.; FOREMAN, R.; LOVE,: "Metastable pluripotent states in NOD-mouse-derived ESCs", CELL STEM CELL, vol. 4, 2009, pages 513 - 524, XP055074812, DOI: doi:10.1016/j.stem.2009.04.015 |
| HANNA, J.H.: "The STATs on naive iPSC reprogramming", CELL STEM CELL, vol. 7, 2010, pages 274 - 276 |
| HANNA, J.H.; SAHA, K.; JAENISCH, R: "Pluripotency and cellular reprogramming: facts, hypotheses, unresolved issues", CELL, vol. 143, 2010, pages 508 - 525, XP055075144, DOI: doi:10.1016/j.cell.2010.10.008 |
| HANNA, J; SAHA, K.; PANDO, B.; VAN ZON, J.; LENGNER, C.J.; CREYGHTON, M.P.; VAN OUDENAARDEN, A.; JAENISCH, R.: "Direct cell reprogramming is a stochastic process amenable to acceleration", NATURE, vol. 462, 2009, pages 595 - 601, XP055014858, DOI: doi:10.1038/nature08592 |
| HANNA, NATURE, 2009 |
| HAWLEY, R.G. ET AL., ONCOGENE, vol. 9, 1994, pages 1 - 12 |
| HOCKEMEYER D ET AL., NAT BIOTECHNOL., vol. 29, no. 8, 7 July 2011 (2011-07-07), pages 731 - 4 |
| HOCKEMEYER D ET AL.: "A drug-inducible system for direct reprogramming of human somatic cells to pluripotency", CELL STEM CELL, vol. 3, 2008, pages 346 - 353, XP008148052, DOI: doi:10.1016/j.stem.2008.08.014 |
| HOCKEMEYER, D. ET AL., CELL STEM CELL, vol. 3, 2008, pages 346 - 353 |
| HOCKEMEYER, D. ET AL., NAT BIOTECHNOL, vol. 29, 2011, pages 731 - 734 |
| HOCKEMEYER, D.; WANG, H.; KIANI, S.; LAI, C.S.; GAO, Q.; CASSADY, J.P.; COST, G.J.; ZHANG, L.; SANTIAGO, Y.; MILLER, J.C. ET AL.: "Genetic engineering of human pluripotent cells using TALE nucleases", NAT BIOTECHNOL, vol. 29, 2011, pages 731 - 734, XP055018244, DOI: doi:10.1038/nbt.1927 |
| HONGYAN ZHOU; SHILI WU ET AL.: "Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins", CELL STEM CELL, vol. 4, no. 6, 5 June 2009 (2009-06-05), pages 581 |
| IH PARK; ZHAO R; WEST JA ET AL.: "Reprogramming of human somatic cells to pluripotency with defined factors", NATURE, vol. 451, 2008, pages 141 - 146, XP008153589, DOI: doi:10.1038/nature06534 |
| IRIZARRY, R. A. ET AL., BIOSTATISTICS, vol. 4, 2003, pages 249 - 64 |
| J. HANNA ET AL: "Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 107, no. 20, 18 May 2010 (2010-05-18), pages 9222 - 9227, XP055054545, ISSN: 0027-8424, DOI: 10.1073/pnas.1004584107 * |
| JACOB H. HANNA ET AL: "Pluripotency and Cellular Reprogramming: Facts, Hypotheses, Unresolved Issues", CELL, vol. 143, no. 4, 1 November 2010 (2010-11-01), pages 508 - 525, XP055074652, ISSN: 0092-8674, DOI: 10.1016/j.cell.2010.10.008 * |
| JAMES, D.; NOGGLE, S. A.; SWIGUT, T.; BRIVANLOU, A. H.: "Contribution of human embryonic stem cells to mouse blastocysts", DEV. BIOL., vol. 295, 2006, pages 90 - 102, XP027433384, DOI: doi:10.1016/j.ydbio.2006.03.026 |
| JULATON ET AL., HUM MOL GENET., vol. 20, no. 11, 1 June 2011 (2011-06-01), pages 2238 - 50 |
| K TAKAHASHI; TANABE K; OHNUKI M ET AL.: "Induction of pluripotent stem cells from adult human fibroblasts by defined factors", CELL, vol. 131, 2007, pages 861 - 872, XP008155962, DOI: doi:10.1016/j.cell.2007.11.019 |
| KAJI, K. ET AL., DEVELOPMENT, vol. 134, 2007, pages 1123 - 1132 |
| KAJI, K. ET AL., NAT CELL BIOL, vol. 8, 2006, pages 285 - 292 |
| KAJI, K. ET AL., NAT CELL, vol. 8, 2006, pages 285 - 292 |
| KAJI, K., NICHOLS, J.; HENDRICH, B.: "Mbd3, a component of the NuRD co-repressor complex, is required for development of pluripotent cells", DEVELOPMENT, vol. 134, 2007, pages 1123 - 1132 |
| KAJI, K.; CABALLERO, I.M.; MACLEOD, R.; NICHOLS, J.; WILSON, V.A.; HENDRICH, B.: "The NuRD component Mbd3 is required for pluripotency of embryonic stem cells", NAT CELL BIOL, vol. 8, 2006, pages 285 - 292 |
| KAMEDA ET AL., STEM CELLS, vol. 23, 2005, pages 1535 - 1540 |
| KAMEDA T; THOMSON JA, STEM CELLS, vol. 23, 2005, pages 1535 - 40 |
| KAMEDA, T.; THOMSON, J., STEM CELLS, vol. 23, 2005, pages 1535 - 1540 |
| KATSUHIKO HAYASHI ET AL: "Reconstitution of the Mouse Germ Cell Specification Pathway in Culture by Pluripotent Stem Cells", CELL, CELL PRESS, US, vol. 146, no. 4, 28 June 2011 (2011-06-28), pages 519 - 532, XP028383021, ISSN: 0092-8674, [retrieved on 20110716], DOI: 10.1016/J.CELL.2011.06.052 * |
| KAUFMAN, D.S. ET AL.: "Hematopoietic colony-forming cells derived from human embryonic stem cells", PROC. NATL. ACAD. SCI. USA., vol. 98, 2001, pages 10716 - 10721, XP002308712, DOI: doi:10.1073/pnas.191362598 |
| KAWAKAMI T ET AL., LANCET, vol. 363, no. 9402, 3 January 2004 (2004-01-03), pages 40 - 2 |
| KIM, J. B. ET AL., NATURE, vol. 461, 2009, pages 649 - 653 |
| KIM, J. ET AL., CELL, vol. 132, no. 6, 2008, pages 1049 - 61 |
| KNOLL, A. H., ANNU. REV. EARTH PLANET. SCI., vol. 39, 2011, pages 217 - 239 |
| LANGMEAD, B. ET AL., GENOME BIOL., vol. 10, no. 3, 2009, pages R25 |
| LANGMEAD, B.; TRAPNELL, C.; POP, M.; SALZBERG, S. L.: "Ultrafast and memory-efficient alignment of short DNA sequences to the human genome", GENOME BIOL., 2009 |
| LANNACCONE ET AL., DEV BIOL., vol. 163, 1994, pages 288 - 92 |
| LE GUEZENNEC, X. ET AL., MOL. CELL. BIOL., vol. 26, 2006, pages 843 - 851 |
| LEITCH, H. G. ET AL.: "Embryonic germ cells from mice and rats exhibit properties consistent with a generic pluripotent ground state", DEVELOPMENT, vol. 137, 2010, pages 2279 - 2287 |
| LEITCH, H. G. ET AL.: "Naive pluripotency is associated with global DNA hypomethylation", NAT. STRUCT. MOL. BIOL., vol. 20, 2013, pages 311 - 316 |
| LENGNER CJ ET AL.: "Derivation of pre-x inactivation human embryonic stem cell line in physiological oxygen conditions", CELL, vol. 141, no. 5, 28 May 2010 (2010-05-28), pages 872 - 83 |
| LENGNER, C. J. ET AL., CELL, vol. 141, 2010, pages 872 - 883 |
| LENGNER, C.J.; GIMELBRANT, A.A.; ERWIN, J.A.; CHENG, A.W.; GUENTHER, M.G.; WELSTEAD, G.G.; ALAGAPPAN, R.; FRAMPTON, G.M.; XU, P.;: "Derivation of pre-X inactivation human embryonic stem cells under physiological oxygen concentrations", CELL, vol. 141, 2010, pages 872 - 883, XP055075377, DOI: doi:10.1016/j.cell.2010.04.010 |
| LENGNER, CELL, vol. 141, 2010, pages 872 - 883 |
| LEVENBERG, S. ET AL.: "Endothelial cells derived from human embryonic stem cells", PROC. NATL. ACAD. SCI. USA., vol. 99, 2002, pages 4391 - 4396, XP002980825, DOI: doi:10.1073/pnas.032074999 |
| LI XJ. ET AL., NAT BIOTECHNOL., vol. 23, 2005, pages 215 - 21 |
| LI, W. ET AL., CELL STEM CELL, vol. 4, 2009, pages 16 - 19 |
| LI, W.; WEI, W.; ZHU, S.; ZHU, J.; SHI, Y.; LIN, T.; HAO, E.; HAYEK, A.; DENG, H.; DING, S.: "Generation of rat and human induced pluripotent stem cells by combining genetic reprogramming and chemical inhibitors", CELL STEM CELL, vol. 4, 2009, pages 16 - 19, XP009139066, DOI: doi:10.1016/j.stem.2008.11.014 |
| LIANG CY ET AL., ARCH VIROL., vol. 149, 2004, pages 51 - 60 |
| LIAO, B. Y., MOLECULAR BIOLOGY AND EVOLUTION, vol. 23, 2005, pages 530 - 540 |
| LIU, S. ET AL.: "Embryonic stem cells differentiate into oligodendrocytes and myelinate in culture and after spinal cord transplantation", PROC. NATL. ACAD. SCI. USA., vol. 97, 2000, pages 6126 - 6131, XP002938504, DOI: doi:10.1073/pnas.97.11.6126 |
| LOH, YH. ET AL., NAT GENET, vol. 38, 2006, pages 431 - 440 |
| LUO M. ET AL., STEM CELLS, 26 March 2013 (2013-03-26) |
| LUO, M. ET AL.: "NuRD Blocks ReprogAramming of Mouse Somatic Cells into Pluripotent Stem Cells", STEM CELLS, 2013 |
| MAEKAWA, M. ET AL., NATURE, vol. 474, 2011, pages 225 - 229 |
| MALTSEV ET AL., CIRC. RES., vol. 75, 1994, pages 233 |
| MANSOUR ET AL., NATURE, vol. 488, 2012, pages 409 - 413 |
| MANSOUR, A. A ET AL., NATURE, vol. 488, 2012, pages 409 - 413 |
| MANSOUR, A. A. ET AL., NATURE, vol. 488, 2012, pages 409 - 413 |
| MANSOUR, A.A. ET AL., NATURE, vol. 488, 2012, pages 409 - 413 |
| MANSOUR, A.A.; GAFNI, O.; WEINBERGER, L.; ZVIRAN, A.; AYYASH, M.; RAIS, Y.; KRUPALNIK, V.; ZERBIB, M.; AMANN-ZALCENSTEIN, D.; MAZA: "The H3K27 demethylase Utx regulates somatic and germ cell epigenetic reprogramming", NATURE, vol. 488, 2012, pages 409 - 413 |
| MANSOUR, AA ET AL., NATURE, vol. 488, 2012, pages 409 - 413 |
| MARINO ET AL.: "Mutants in the mouse NuRD/Mi2 component p66 are embryonic lethal", PLOS ONE, vol. 2, no. 6, 2007, pages E519 |
| MARKS, H. ET AL., CELL, vol. 149, 2012, pages 590 - 604 |
| MARKS, H. ET AL.: "The transcriptional and epigenomic foundations of ground state pluripotency", CELL, vol. 149, 2012, pages 590 - 604, XP028420453, DOI: doi:10.1016/j.cell.2012.03.026 |
| MARKS, H.; KALKAN, T.; MENAFRA, R.; DENISSOV, S.; JONES, K.; HOFEMEISTER, H.; NICHOLS, J.; KRANZ, A.; FRANCIS STEWART, A.; SMITH,: "The transcriptional and epigenomic foundations of ground state pluripotency", CELL, vol. 149, 2012, pages 590 - 604, XP028420453, DOI: doi:10.1016/j.cell.2012.03.026 |
| MARSHAK ET AL.: "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", 1996, CSHL PRESS |
| MASTERSON, KR ET AL., DEV BIOL., vol. 371, no. 2, 2012, pages 146 - 55 |
| MEISSNER, A. ET AL.: "Genome-scale DNA methylation maps of pluripotent and differentiated cells", NATURE, vol. 454, 2008, pages 766 - 770 |
| MEKHOUBAD, S. ET AL., CELL STEM CELL, vol. 10, 2012, pages 595 - 609 |
| MIKKELSEN, T. S. ET AL., NATURE, vol. 448, 2007, pages 553 - 560 |
| MIKKELSEN, T. S. ET AL., NATURE, vol. 454, 2008, pages 49 - 55 |
| MIKKELSEN, T.S; HANNA, J.; ZHANG, X.; KU, M.; WERNIG, M.; SCHORDERET, P.; BERNSTEIN, B.E.; JAENISCH, R; LANDER, E.S.; MEISSNER, A.: "Dissecting direct reprogramming through integrative genomic analysis", NATURE, vol. 454, 2008, pages 49 - 55, XP002564354, DOI: doi:10.1038/nature07056 |
| MISHELL AND SHIIGI: "Selected Methods in Cellular Immunology", 1980, W. H. FREEMAN AND CO. |
| MITALIPOVA ET AL., CLONING, vol. 3, 2001, pages 59 - 67 |
| NIAKAN KK ET AL., DEV. BIOL., vol. 375, 2013, pages 54 - 64 |
| NICHOLS, J.; SMITH, A., CELL STEM CELL, vol. 4, 2009, pages 487 - 492 |
| NICHOLS, J.; SMITH, A.: "Pluripotency in the embryo and in culture", COLD SPRING HARB PERSPECT BIOL, vol. 4, 2012, pages A008128 |
| NIWA, H. ET AL., NATURE, vol. 460, 2009, pages 118 - 122 |
| NOTARIANNI ET AL., J REPROD FERTIL, vol. 43, 1991, pages 255 - 60 |
| OAKLEY, D. H., CELL, vol. 144, 2011, pages 439 - 452 |
| OHAD GAFNI ET AL: "Derivation of novel human ground state naive pluripotent stem cells", NATURE, vol. 504, no. 7479, 30 October 2013 (2013-10-30), pages 282 - 286, XP055128176, ISSN: 0028-0836, DOI: 10.1038/nature12745 * |
| OKABE, S. ET AL., MECH. DEV., vol. 59, 1996, pages 89 - 102 |
| OKAMOTO, I. ET AL., NATURE, vol. 472, no. 7343, 2011, pages 370 - 4 |
| OKAMOTO, I.; PATRAT, C.; THÉPOT, D.; PEYNOT, N.; FAUQUE, P.; DANIEL, N.; DIABANGOUAYA, P.; WOLF, J.-P.; RENARD, J.-P.; DURANTHON,: "Eutherian mammals use diverse strategies to initiate X-chromosome inactivation during development", NATURE, 2011, pages 1 - 7 |
| O'LEARY, T. ET AL., NAT BIOTECHNOL, vol. 30, 2012, pages 278 - 282 |
| ONDER, T.T.; KARA, N.; CHERRY, A.; SINHA, A.U.; ZHU, N.; BERNT, K.M.; CAHAN, P.; MARCARCI, B.O.; UNTERNAEHRER, J.; GUPTA, P.B. ET: "Chromatin-modifying enzymes as modulators of reprogramming", NATURE, vol. 483, 2012, pages 598 - 602, XP055107800, DOI: doi:10.1038/nature10953 |
| ORKIN, S.H.; HOCHEDLINGER, K.: "Chromatin Connections to Pluripotency and Cellular Reprogramming", CELL, vol. 145, 2011, pages 835 - 850, XP028377925, DOI: doi:10.1016/j.cell.2011.05.019 |
| PABLO BERMEJO-ALVAREZ ET AL: "Solving the "X" in Embryos and Stem Cells", STEM CELLS AND DEVELOPMENT, vol. 21, no. 8, 20 May 2012 (2012-05-20), pages 1215 - 1224, XP055128368, ISSN: 1547-3287, DOI: 10.1089/scd.2011.0685 * |
| PAPP, B.; PLATH, K., CELL, vol. 152, 2013, pages 1324 - 1343 |
| PARK TAE SUB ET AL: "Derivation of Primordial Germ Cells from Human Embryonic and Induced Pluripotent Stem Cells Is Significantly Improved by Coculture with Human Fetal Gonadal Cells", STEM CELLS (MIAMISBURG), vol. 27, no. 4, 2009, pages 783 - 795, XP002730074, ISSN: 1066-5099 * |
| PERBAL, B.: "A Practical Guide to Molecular Cloning", 1984 |
| PERBAL: "A Practical Guide to Molecular Cloning", 1988, JOHN WILEY & SONS |
| POLO, J. M. ET AL., CELL, vol. 151, 2012, pages 1617 - 1632 |
| POLO, J. M. ET AL.: "A Molecular Roadmap of Reprogramming Somatic Cells into iPS Cells", CELL, vol. 151, 2012, pages 1617 - 1632, XP055282865, DOI: doi:10.1016/j.cell.2012.11.039 |
| POLO, J.M.; ANDERSSEN, E.; WALSH, R.M.; SCHWARZ, B.A.; NEFZGER, C.M.; LIM, S.M; BORKENT, M.; APOSTOLOU, E.; ALAEI, S.; CLOUTIER, J: "A Molecular Roadmap of Reprogramming Somatic Cells into iPS Cells", CELL, vol. 151, 2012, pages 1617 - 1632, XP055282865, DOI: doi:10.1016/j.cell.2012.11.039 |
| POTOCNIK, A.J. ET AL.: "Immunology Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells", PROC. NATL. ACAD. SCI. USA., vol. 94, 1997, pages 10295 - 10300 |
| PRIBLUDA, A. ET AL., NAT BIOTECHNOL, vol. 30, 2012, pages 247 - 249 |
| PRIBLUDA, A.; HANNA, J. H., NAT BIOTECHNOL, vol. 30, 2012, pages 247 - 249 |
| PRIBLUDA, A.; HANNA, J.H.: "Tracing the genesis of human embryonic stem cells", NAT BIOTECHNOL, vol. 30, 2012, pages 247 - 249 |
| PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 7844 |
| RAD, R. ET AL., PROC NATL ACAD SCI U S A., vol. 108, no. 45, 2011, pages 18283 - 8 |
| RADA-IGLESIAS, A. ET AL., NATURE, vol. 470, 2011, pages 279 - 283 |
| RAFF, M. C.; MILLER, R. H.; NOBLE, M., NATURE, vol. 303, 1983, pages 390 - 396 |
| RAIS Y ET AL.: "Deterministic direct reprogramming of somatic cells to pluripotency", NATURE, vol. 502, no. 7469, 18 September 2013 (2013-09-18), pages 65 - 70, XP055128319, DOI: doi:10.1038/nature12587 |
| RAIS Y. ET AL., NATURE, vol. 502, no. 7469, 18 September 2013 (2013-09-18), pages 65 - 70 |
| RAJENDRAN, G. ET AL.: "Inhibition of protein kinase C signaling maintains rat embryonic stem cell pluripotency", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 288, 2013, pages 24351 - 24362, XP055227822, DOI: doi:10.1074/jbc.M113.455725 |
| REYNOLDS, N. ET AL., CELL STEM CELL, vol. 10, 2012, pages 583 - 594 |
| REYNOLDS, N., DEVELOPMENT, vol. 140, 2013, pages 505 - 512 |
| REYNOLDS, N.; STROUBOULIS, J.; BEHRENS, A.; BERTONE, P.; HENDRICH, B.: "NuRD suppresses pluripotency gene expression to promote transcriptional heterogeneity and lineage commitment.", CELL STEM CELL, vol. 10, 2012, pages 583 - 594, XP028481932, DOI: doi:10.1016/j.stem.2012.02.020 |
| RICHARD BEHRINGER; MARINA GERTSENSTEIN; KRISTINA VINTERSTEN NAGY; ANDRAS NAGY: "A Laboratory Manual, Fourth Edition.", article "Manipulating the Mouse Embryo" |
| RIPPON HJ. ET AL., PROC AM THORAC SOC., vol. 5, 2008, pages 717 - 722 |
| ROBINSON, J. T. ET AL., NAT BIOTECHNOL, vol. 29, 2011, pages 24 - 26 |
| ROKAS, A., ANNUAL REVIEW OF GENETICS, vol. 42, 2008, pages 235 - 251 |
| ROODE, M ET AL., DEV. BIOL., vol. 361, 2012, pages 358 - 363 |
| ROODE, M. ET AL., DEV. BIOL., vol. 361, 2012, pages 358 - 363 |
| ROODE, M.; BLAIR, K.; SNELL, P.; ELDER, K.; MARCHANT, S.; SMITH, A.; NICHOLS, J.: "Human hypoblast formation is not dependent on FGF signalling", DEV. BIOL., vol. 361, 2012, pages 358 - 363, XP028350561, DOI: doi:10.1016/j.ydbio.2011.10.030 |
| ROSSANT; NAGY, NATURE BIOTECH., vol. 17, 1999, pages 23 |
| RYAN M. WALSH; KONRAD HOCHEDLINGER, PROC NATL ACAD SCI U S A., vol. 110, no. 39, 24 September 2013 (2013-09-24), pages 15514 - 5 |
| SACHINIDIS A ET AL., CARDIOVASC RES., vol. 58, 2003, pages 278 - 91 |
| SAMBROOK ET AL.: "Molecular Cloning: A laboratory Manual", 1989 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRINGS HARBOR LABORATORY |
| SANDOE, J. ET AL., NATURE PUBLISHING GROUP, vol. 16, 2013, pages 780 - 789 |
| SCIENCE, vol. 282, 1998, pages 1145 |
| SHAMBLOTT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 13726 |
| SHAPIRO, S. S.; WILK, M. B.: "An analysis of variance test for normality (complete samples", BIOMETRIKA, vol. 52, 1965, pages 591 |
| SIBSON, R.: "SLINK: An optimally efficient algorithm for the single-link cluster method", THE COMPUTER JOURNAL, vol. 16, 1973, pages 30 - 34 |
| SILVA, J. ET AL., CELL, vol. 138, 2009, pages 722 - 737 |
| SILVA, J.; NICHOLS, J.; THEUNISSEN, T.W.; GUO, G.; VAN OOSTEN, A.L.; BARRANDON, O.; WRAY, J.; YAMANAKA, S.; CHAMBERS, I.; SMITH, A: "Nanog is the gateway to the pluripotent ground state", CELL, vol. 138, 2009, pages 722 - 737, XP008158163, DOI: doi:10.1016/j.cell.2009.07.039 |
| SMIRNOV, N. JSTOR: "The Annals of Mathematical Statistics", vol. 19, June 1948, pages: 279 - 281 |
| SMITH, Z. D. ET AL., NAT. BIOTECHNOL, vol. 28, 2010, pages 521 - 526 |
| SMITH, Z. D. ET AL., NATURE, vol. 484, 2012, pages 339 - 344 |
| SMITH, Z. D.; NACHMAN, I.; REGEV, A.; MEISSNER, A.: "Dynamic single-cell imaging of direct reprogramming reveals an early specifying event", NAT BIOTECHNOL, vol. 28, 2010, pages 521 - 526 |
| SMITH, Z.D.; NACHMAN, I.; REGEV, A.; MEISSNER, A.: "Dynamic single-cell imaging of direct reprogramming reveals an early specifying event", NAT BIOTECHNOL, vol. 28, 2010, pages 521 - 526 |
| SOLDNER F ET AL.: "Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors", CELL, vol. 136, 2009, pages 964 - 977, XP002552497, DOI: doi:10.1016/j.cell.2009.02.013 |
| SOMMER, C. A ET AL.: "Induced pluripotent stem cell generation using a single lentiviral stem cell cassette", STEM CELLS, vol. 27, 2009, pages 543 - 549, XP002546066, DOI: doi:10.1634/STEMCELLS.2008-1075 |
| SOMMER, C. A. ET AL.: "Induced pluripotent stem cell generation using a single lentiviral stem cell cassette", STEM CELLS, vol. 27, 2009, pages 543 - 549, XP002546066, DOI: doi:10.1634/STEMCELLS.2008-1075 |
| SOUFI, A.; DONAHUE, G.; ZARET, K.S.: "Facilitators and Impediments of the Pluripotency Reprogramming Factors' Initial Engagement with the Genome", CELL, 2012, pages 1 - 11 |
| SRIDHARAN, R. ET AL., CELL, vol. 36, 2009, pages 364 - 77 |
| SRIDHARAN, R. ET AL., CELL, vol. 36, no. 2, 2009, pages 364 - 77 |
| SRIDHARAN, R.; TCHIEU, J.; MASON, M.J.; YACHECHKO, R.: "ScienceDirect.com - Cell - Role of the Murine Reprogramming Factors in the Induction of Pluripotency", CELL, 2009 |
| STADTFELD, M. ET AL., NATURE, vol. 465, 2010, pages 175 - 181 |
| STAVRIDIS MP; SMITH AG, BIOCHEM SOC TRANS., vol. 31, 2003, pages 45 - 9 |
| STITES ET AL.: "Basic and Clinical Immunology", 1994, APPLETON & LANGE |
| STUDIER ET AL., METHODS IN ENZYMOL., vol. 185, 1990, pages 60 - 89 |
| SZKLARCZYK, D. ET AL.: "The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored", NUCLEIC ACIDS RES., vol. 39, 2010, pages D561 - D568 |
| TACHIBANA, M.; SPARMAN, M.; RAMSEY, C.; MA, H.; LEE, H. S.: "Generation of Chimeric Rhesus Monkeys", CELL, vol. 148, 2012, pages 285 - 295, XP055459089, DOI: doi:10.1016/j.cell.2011.12.007 |
| TADA, M. ET AL., CURRENT BIOLOGY, vol. 11, 2001, pages 1553 - 1558 |
| TAKAHASHI, K.; MITSUI, K.; YAMANAKA, S., NATURE, vol. 423, 2003, pages 541 - 545 |
| TAKAHASHI, K.; YAMANAKA, S., CELL, vol. 126, 2006, pages 663 - 676 |
| TAKAHASHI, K.; YAMANAKA, S.: "Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors", CELL, vol. 126, 2006, pages 663 - 676 |
| TAKAMATSU ET AL., EMBO J., vol. 6, 1987, pages 307 - 311 |
| TAKASHI SADO ET AL., DEVELOPMENTAL DYNAMICS, vol. 205, 1996, pages 421 - 434 |
| TESAR, P.J.; CHENOWETH, J.G.; BROOK, F.A.; DAVIES, T.J.; EVANS, E.P.; MACK, D.L.; GARDNER, R.L.; MCKAY, R.D.G.: "New cell lines from mouse epiblast share defining features with human embryonic stem cells", NATURE, vol. 448, 2007, pages 196 - 199, XP008135572, DOI: doi:10.1038/nature05972 |
| THOMSON ET AL., BIOL REPROD., vol. 55, 1996, pages 254 - 9 |
| THOMSON ET AL., PROC NATL ACAD SCI USA., vol. 92, 1995, pages 7844 - 8 |
| THOMSON JA ET AL., SCIENCE, vol. 282, 1998, pages 1145 - 7 |
| TIWARI, V.K.; STADLER, M.B.; WIRBELAUER, C.; PARO, R.; SCHÜBELER, D.; BEISEL, C.: "A chromatin-modifying function of JNK during stem cell differentiation", NAT GENET, 2011 |
| TIWARI, VK ET AL., NAT GENET, vol. 44, no. 1, 2011, pages 94 - 100 |
| TOMODA, K ET AL., CELL STEM CELL, vol. 11, 2012, pages 91 - 99 |
| TOMODA, K.; TAKAHASHI, K.; LEUNG, K.; OKADA, A.; NARITA, M.; YAMADA, N.A.; EILERTSON, K.E.; TSANG, P.; BABA, S.; WHITE, M.P. ET AL: "Derivation conditions impact x-inactivation status in female human induced pluripotent stem cells", CELL STEM CELL, vol. 11, 2012, pages 91 - 99, XP028400408, DOI: doi:10.1016/j.stem.2012.05.019 |
| TONKINSON ET AL., CANCER INVESTIGATION, vol. 14, no. 1, 1996, pages 54 - 65 |
| TRIVEDI P; HEMATTI P, EXP HEMATOL., vol. 36, no. 3, 2008, pages 350 - 9 |
| TSAI, H. H.; BOURQUE, G; LUFKIN, T.: "In silico tandem affinity purification refines an Oct4 interaction list", STEM CELL RESEARCH THER., vol. 2, 2011, pages 26, XP021104534, DOI: doi:10.1186/scrt67 |
| TSAI, M. ET AL.: "In vivo immunological function of mast cells derived from embryonic stem cells: An approach for the rapid analysis of even embryonic lethal mutations in adult mice in vivo", PROC NATL ACAD SCI USA., vol. 97, 2000, pages 9186 - 9190 |
| URBACH, A. ET AL., STEM CELL, vol. 6, 2010, pages 407 - 411 |
| URBACH, A.; BAR-NUR, O.; DALEY, G. Q.; BENVENISTY, N.: "Brief Report", STEM CELL, vol. 6, 2010, pages 407 - 411 |
| VASSENA, R. ET AL., DEVELOPMENT, vol. 138, 2011, pages 3699 - 3709 |
| VASSENA, R. ET AL.: "Waves of early transcriptional activation and pluripotency program initiation during human preimplantation development", DEVELOPMENT, vol. 138, 2011, pages 3699 - 3709 |
| VAZIN T ET AL., PLOS ONE, vol. 4, no. 8, 12 August 2009 (2009-08-12), pages E6606 |
| VEGA ET AL.: "Gene Targeting", 1995, CRC PRESS |
| WALAVALKAR: "Unique features of the anti-parallel, heterodimeric coiled-coil interaction benveen methyl-cytosine-binding domain 2 (MBD2) homologues and GATA zinc finger domain containing 2A (GATAD2A\P66a)", J. BIOL. CHEM., vol. 288, 2013, pages 3419 - 3427, XP055236750, DOI: doi:10.1074/jbc.M112.431346 |
| WARE CAROL B ET AL: "Derivation of naive human embryonic stem cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 111, no. 12, March 2014 (2014-03-01), pages 4484 - 4489, XP002727154, ISSN: 0027-8424 * |
| WARREN, L.; EBINA, W.; MANDAL, P.K.; SMITH, Z.D.; MEISSNER, A; DALEY, G.Q.: "ScienceDirect.com - Cell Stem Cell - Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic Modified mRNA", CELL STEM CELL, 2010 |
| WATANABE, K. ET AL.: "A ROCK inhibitor permits survival of dissociated human embryonic stem cells", NAT BIOTECHNOL, vol. 25, 2007, pages 681 - 686, XP002478043, DOI: doi:10.1038/nbt1310 |
| WATSON ET AL.: "Recombinant DNA", SCIENTIFIC AMERICAN BOOKS, NEW YORK |
| WEI, W. ET AL., MOL CELL BIOL., vol. 23, 2003, pages 2859 - 2870 |
| WEISSBACH; WEISSBACH: "Methods for Plant Molecular Biology", 1988, ACADEMIC PRESS, pages: 421 - 463 |
| WERNIG, M.; LENGNER, C.J.; HANNA, J.; LODATO, M.A.; STEINE, E.; FOREMAN, R; STAERK, J.; MARKOULAKI, S.; JAENISCH, R.: "A drug-inducible transgenic system for direct reprogramming of multiple somatic cell types", NAT BIOTECHNOL, vol. 26, 2008, pages 916 - 924, XP008148061, DOI: doi:10.1038/nbt1483 |
| WHEELER, REPROD FERTIL DEV., vol. 6, 1994, pages 563 - 8 |
| WILKINSON, D. J.: "Stochastic modelling for quantitative description of heterogeneous biological systems", NAT REV GENET, vol. 10, 2009, pages 122 - 133 |
| XU Y. ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 288, 2013, pages 9767 - 9778 |
| XU, Y ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 107, 2010, pages 8129 - 8134 |
| Y. ZHANG ET AL: "Small molecules, big roles - the chemical manipulation of stem cell fate and somatic cell reprogramming", JOURNAL OF CELL SCIENCE, vol. 125, no. 23, 1 December 2012 (2012-12-01), pages 5609 - 5620, XP055112620, ISSN: 0021-9533, DOI: 10.1242/jcs.096032 * |
| YAMANAKA S, CELL STEM CELL, vol. 1, no. 1, 2007, pages 39 - 49 |
| YANG HUI ET AL., CELL, vol. 154, 12 September 2013 (2013-09-12), pages 1370 - 1379 |
| YEOM, Y. I. ET AL.: "Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells", DEVELOPMENT, vol. 122, no. 3, 1996, pages 881 - 94 |
| YING YING ET AL: "Induction of primordial germ cells from pluripotent epiblast", THE SCIENTIFIC WORLD, THE SCIENTIFICWORLD LTD, GB, vol. 2, 26 March 2002 (2002-03-26), pages 801 - 810, XP009097195, ISSN: 1532-2246 * |
| YING, Q.-L. ET AL., CELL, vol. 115, 2003, pages 281 - 292 |
| YING, Q.-L. ET AL., NATURE, vol. 453, 2008, pages 519 - 523 |
| YING, Q.-L. ET AL.: "The ground state of embryonic stem cell self-renewal", NATURE, vol. 453, 2008, pages 519 - 523, XP055033153, DOI: doi:10.1038/nature06968 |
| YING, Q.-L.; WRAY, J.; NICHOLS, J.; BATLLE-MORERA, L.; DOBLE, B.; WOODGETT, J.; COHEN, P.; SMITH, A.: "The ground state of embryonic stem cell self-renewal", NATURE, vol. 453, 2008, pages 51 - 523, XP055033153, DOI: doi:10.1038/nature06968 |
| ZHANG, Y. ET AL., GENOME BIOL., vol. 9, no. 9, 2008, pages R137 |
| ZHANG, Y., GENOME BIOL., vol. 9, no. 9, 2008, pages R137 |
| ZHU, D; FANG, J.; LI, Y.; ZHANG, J.: "Mbd3, a Component of NuRD/Mi-2 Complex, Helps Maintain Pluripotency of Mouse Embryonic Stem Cells by Repressing Trophectoderm Differentiation", PLOS ONE, vol. 4, 2009, pages E7684 |
| ZWAKA, T. P: "Stem cells: Troublesome memories", NATURE, vol. 467, 2010, pages 280 - 1 |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12570957B2 (en) | 2013-04-23 | 2026-03-10 | Yeda Research And Development Co. Ltd. | Isolated naive pluripotent stem cells and methods of generating same |
| US10920192B2 (en) | 2013-04-23 | 2021-02-16 | Yeda Research And Development Co. Ltd. | Isolated naive pluripotent stem cells and methods of generating same |
| US11920164B2 (en) | 2014-07-30 | 2024-03-05 | Yeda Research And Development Co. Ltd. | Media for culturing naive human pluripotent stem cells |
| WO2016016894A1 (en) | 2014-07-30 | 2016-02-04 | Yeda Research And Development Co. Ltd. | Media for culturing pluripotent stem cells |
| WO2016027099A3 (en) * | 2014-08-22 | 2016-04-14 | Cambridge Enterprise Limited | Resetting pluripotent stem cells |
| US10894948B2 (en) | 2014-08-22 | 2021-01-19 | Cambridge Enterprise Limited | Resetting pluripotent stem cells |
| US10745670B2 (en) | 2014-11-17 | 2020-08-18 | Genome Research Limited | In vitro production of expanded potential stem cells |
| WO2016079146A1 (en) * | 2014-11-17 | 2016-05-26 | Genome Research Limited | In vitro production of expanded potential stem cells |
| US11913018B2 (en) | 2014-11-17 | 2024-02-27 | Genome Research Limited | In vitro production of expanded potential stem cells |
| JP7089298B2 (ja) | 2015-06-29 | 2022-06-22 | 国立大学法人京都大学 | 多能性幹細胞から生殖細胞への分化誘導方法 |
| JP2021003109A (ja) * | 2015-06-29 | 2021-01-14 | 国立大学法人京都大学 | 多能性幹細胞から生殖細胞への分化誘導方法 |
| US10563171B2 (en) | 2015-06-29 | 2020-02-18 | Kyoto University | Method for inducing differentiation of pluripotent stem cells into germ cells |
| WO2017002888A1 (ja) * | 2015-06-29 | 2017-01-05 | 国立大学法人京都大学 | 多能性幹細胞から生殖細胞への分化誘導方法 |
| JPWO2017002888A1 (ja) * | 2015-06-29 | 2018-04-19 | 国立大学法人京都大学 | 多能性幹細胞から生殖細胞への分化誘導方法 |
| KR20180052612A (ko) * | 2015-08-13 | 2018-05-18 | 베이하오 스템 셀 앤 리제너레이티브 메디슨 리서치 인스티튜트 씨오.,엘티디. | 유도 연장 만능 줄기 세포, 이의 제조방법 및 사용 방법 |
| US11028369B2 (en) | 2015-08-13 | 2021-06-08 | Beihao Stem Cell And Regenerative Medicine Research Institute Co., Ltd. | Induced extended pluripotent stem cells, method of making and using |
| JP2018527024A (ja) * | 2015-08-13 | 2018-09-20 | 北昊干細胞与再生医学研究院有限公司Beihao Stem Cell And Regenerative Medicine Research Institute Co., Ltd. | 誘導された拡張された多能性幹細胞、作製方法および使用方法 |
| KR102142364B1 (ko) | 2015-08-13 | 2020-08-07 | 베이하오 스템 셀 앤 리제너레이티브 메디슨 리서치 인스티 튜트 씨오.,엘티디. | 유도 연장 만능 줄기 세포, 이의 제조방법 및 사용 방법 |
| JPWO2017170849A1 (ja) * | 2016-03-30 | 2019-05-16 | 協和発酵バイオ株式会社 | ナイーブ型多能性幹細胞培養用培地および多能性幹細胞の培養方法 |
| WO2017170849A1 (ja) * | 2016-03-30 | 2017-10-05 | 国立研究開発法人医薬基盤・健康・栄養研究所 | ナイーブ型多能性幹細胞培養用培地および多能性幹細胞の培養方法 |
| CN106244522A (zh) * | 2016-08-12 | 2016-12-21 | 浙江译美生物科技有限公司 | 一种干细胞培养体系及其培养方法 |
| WO2018119213A1 (en) * | 2016-12-23 | 2018-06-28 | StemBios Technologies, Inc. | Use of somatic stem cells for decreasing il-6 level |
| WO2020152686A1 (en) | 2019-01-23 | 2020-07-30 | Yeda Research And Development Co. Ltd. | Culture media for pluripotent stem cells |
| CN115003795A (zh) * | 2019-11-14 | 2022-09-02 | 岛崎猛夫 | 细胞的重编程方法 |
| WO2021243252A1 (en) * | 2020-05-29 | 2021-12-02 | The Board Of Trustees Of The Leland Stanford Junior University | Generation of primordial germ cells and methods of using the same |
| CN112048467A (zh) * | 2020-09-11 | 2020-12-08 | 江苏集萃药康生物科技有限公司 | Ksom-aa培养液在体外培养nod背景鼠胚胎中的应用 |
| US12467917B2 (en) | 2021-03-16 | 2025-11-11 | California Institute Of Technology | Reconstructing human early embryogenesis in vitro with pluripotent stem cells |
| WO2023082007A1 (en) * | 2021-11-12 | 2023-05-19 | L'alliance Boviteq Inc. | Derivation of naïve bovine embryonic stem cells |
| US12618830B2 (en) | 2022-12-13 | 2026-05-05 | California Institute Of Technology | Methods, culture medias and devices for generating embryos in vitro from stem cells |
Also Published As
| Publication number | Publication date |
|---|---|
| US10920192B2 (en) | 2021-02-16 |
| IL241930B (en) | 2020-06-30 |
| US20260028583A1 (en) | 2026-01-29 |
| ES2831424T3 (es) | 2021-06-08 |
| JP2016521971A (ja) | 2016-07-28 |
| EP2989199A1 (en) | 2016-03-02 |
| EP2989199B1 (en) | 2020-08-12 |
| CN105531365A (zh) | 2016-04-27 |
| US20140315301A1 (en) | 2014-10-23 |
| US20210253998A1 (en) | 2021-08-19 |
| US12570957B2 (en) | 2026-03-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12570957B2 (en) | Isolated naive pluripotent stem cells and methods of generating same | |
| US20240318144A1 (en) | Media for culturing naive human pluripotent stem cells | |
| Gafni et al. | Derivation of novel human ground state naive pluripotent stem cells | |
| Sakai et al. | Induction of the germ cell fate from pluripotent stem cells in cynomolgus monkeys | |
| US10894948B2 (en) | Resetting pluripotent stem cells | |
| JP7307481B2 (ja) | 始原生殖細胞/始原生殖細胞様細胞の維持増幅及び分化誘導方法 | |
| CN105051188A (zh) | 新颖方法 | |
| Mo et al. | Generation and characterization of bat-induced pluripotent stem cells | |
| WO2016005985A2 (en) | Method for reprogramming cells | |
| EP2501803B1 (en) | Methods of enhancing pluripotentcy | |
| WO2016171625A1 (en) | Targeting telomerase for cell therapy | |
| Bayerl | Defining the Molecular and Functional Foundations of Novel Human Naive Pluripotent Stem Cells | |
| Aizawa | Characterization of in vitro systems to generate oocytes and substitutes of sperm from pluripotent stem cells | |
| Luo et al. | Offspring Production of Ovarian Organoids Derived from Spermatogonial Stem Cells by Chromatin Architecture Reorganization | |
| Tobias | Phenotypic and Metabolic Plasticity In Canine Cellular Reprogramming | |
| Parenti | Making mammalian stem cells: Identifying and overcoming reprogramming barriers | |
| Mass | List of Abbreviation | |
| Rezende | Functional characterization of the stem cell biomarker Rex1 (Zpf42) in mouse embryonic stem cells, and in transgenic mouse models | |
| Wong | Role of Sox2 in postimplantation epiblast pluripotency | |
| Mahaddalkar | Reprogramming hierarchy in mouse liver cell subpopulations depends on cell intrinsic factors including BAF complex members | |
| Maherali | Reprogramming cells to pluripotency by defined factors | |
| HK1235830A1 (en) | Media for culturing pluripotent stem cells | |
| HK1235830B (en) | Media for culturing pluripotent stem cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201480035892.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14727237 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 241930 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2016509588 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014727237 Country of ref document: EP |