WO2014142356A1 - Agent thérapeutique pour la sclérodermie - Google Patents

Agent thérapeutique pour la sclérodermie Download PDF

Info

Publication number
WO2014142356A1
WO2014142356A1 PCT/JP2014/057936 JP2014057936W WO2014142356A1 WO 2014142356 A1 WO2014142356 A1 WO 2014142356A1 JP 2014057936 W JP2014057936 W JP 2014057936W WO 2014142356 A1 WO2014142356 A1 WO 2014142356A1
Authority
WO
WIPO (PCT)
Prior art keywords
frβ
seq
protein
base sequence
polynucleotide
Prior art date
Application number
PCT/JP2014/057936
Other languages
English (en)
Japanese (ja)
Inventor
隆美 松山
花 李
拓 永井
Original Assignee
国立大学法人鹿児島大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人鹿児島大学 filed Critical 国立大学法人鹿児島大学
Priority to JP2015505618A priority Critical patent/JPWO2014142356A1/ja
Publication of WO2014142356A1 publication Critical patent/WO2014142356A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6817—Toxins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/20—Dermatological disorders

Definitions

  • the present invention relates to a therapeutic agent for scleroderma comprising, as an active ingredient, a complex comprising, for example, an antibody against folate receptor ⁇ and a cytotoxin or cytotoxic agent.
  • Scleroderma is a collagen disease, a chronic disease of unknown cause that causes lesions in various parts of the skin and body characterized by fibrosis.
  • the pathophysiology of scleroderma includes fibroblast activation (accumulation of extracellular matrix such as collagen), vascular disorders and immune abnormalities (autoantibodies).
  • fibroblast activation accumulation of extracellular matrix such as collagen
  • autoantibodies immune abnormalities
  • Activated macrophages are cells that invade first in the early stage of fibrosis, and are presumed to secrete factors such as TGF- ⁇ , CTGF, and PDGF and play an important role in the fibrosis process of scleroderma (non- Patent Documents 1 and 2).
  • corticosteroids are commonly used for early patients and immunosuppressive drugs are commonly used for pulmonary symptoms.
  • the therapeutic methods under study are directed to suppressing cytokines such as interleukin-2 and TGF- ⁇ . For example, it has been reported that treatment with an anti-TGF- ⁇ antibody showed a significant therapeutic effect (Non-patent Document 3).
  • FR ⁇ folate receptor ⁇
  • the present inventors also provide a recombinant consisting of a fusion protein in which the heavy chain variable region (VH) of anti-FR ⁇ antibody and Pseudomonas aeruginosa toxin (PE) are linked, and the light chain variable region (VL) of anti-FR ⁇ antibody.
  • VH heavy chain variable region
  • PE Pseudomonas aeruginosa toxin
  • VL light chain variable region
  • an object of the present invention is to provide a novel therapeutic agent for scleroderma.
  • the present invention includes the following.
  • a therapeutic agent for scleroderma comprising, as an active ingredient, a complex in which an antibody that binds to folate receptor ⁇ (FR ⁇ ) and a cytotoxin or cytotoxic agent are conjugated.
  • the scleroderma therapeutic agent according to (1), wherein the complex is a recombinant immunotoxin.
  • the scleroderma therapeutic agent according to (1) or (2), wherein the antibody is a chimeric antibody, a humanized antibody or a human antibody.
  • any of (1) to (4), wherein the antibody is raised against a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or a partial peptide consisting of 7 or more consecutive amino acids.
  • a therapeutic agent for scleroderma according to 1. Any of (1) to (4), wherein the antibody is raised against a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a partial peptide consisting of 7 or more consecutive amino acids. 1.
  • a therapeutic agent for scleroderma according to 1. The therapeutic agent for scleroderma according to any one of (1) to (6), wherein the antibody is a monoclonal antibody, a polyclonal antibody, an antibody fragment thereof, or a recombinant antibody.
  • the antibody is a heavy chain (H chain) variable region and / or a light chain (L chain) variable region of either an anti-human folate receptor ⁇ mouse monoclonal antibody or an anti-mouse folate receptor ⁇ rat monoclonal antibody.
  • the therapeutic agent for scleroderma according to any one of (1) to (7), comprising an amino acid sequence comprising at least one complementarity determining region (CDR) in each amino acid sequence.
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in the following (a), (b), (c) or (d):
  • the therapeutic agent for scleroderma according to any one of (1) to (8), comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 3; (B) a polynucleotide encoding a protein having a biological activity that binds to FR ⁇ , including deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 3; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 3 and having biological activity binding to FR ⁇ ; (D) A polynucleotide encoding a protein having a biological activity that hybridizes with a base sequence complementary to
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma according to any one of (1) to (8), comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 4; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 4 and having biological activity binding to FR ⁇ ; (D) A polynucleotide encoding a protein having a biological activity that hybridize
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in the following (a), (b), (c) or (d):
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 5; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 5; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the base sequence shown in SEQ ID NO: 5 and having biological activity binding to FR ⁇ ; (D) A polynucleotide encoding a protein having a biological activity that hybridizes with a base sequence complementary to the base sequence shown in
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 6; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 6; (C) a polynucleotide encoding a protein having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6 and binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with a base sequence complementary to the base sequence shown in
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 7; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 7; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 7 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with a base sequence complementary to the base
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma according to any one of (1) to (8), comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 8; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 8; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 8 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridize
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 9; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 9; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 9 and having biological activity binding to FR ⁇ ; (D) A polynucleotide encoding a protein having a biological activity that hybridizes with a base sequence complementary to the base
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for scleroderma comprising an amino acid sequence comprising (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 10; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 10; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the base sequence shown in SEQ ID NO: 10 and binding to FR ⁇ ; (D) A polynucleotide encoding a protein having a biological activity that hybridizes with a base sequence complementary to the base sequence shown in SEQ ID NO
  • the cytotoxins include Pseudomonas aeruginosa exotoxin, ricin A chain, deglycosylated ricin A chain, ribosome inactivating protein (a riboin inactivating protein (a riboin inactivating protein) protein, alpha-sarcin, gelonin, aspergillin, restrictocin, ribonuclease, epodophyllotoxin, and diphtheria Selected from the group ( ) - scleroderma treatment agent as claimed in any one of (16).
  • an antibody that binds to a label and that binds to the folate receptor ⁇ (FR ⁇ ) defined in any one of (1) to (19) or a conjugate of the antibody and a cytotoxin or cytotoxic agent A diagnostic agent for scleroderma including the body.
  • This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2013-054090 which is the basis of the priority of the present application.
  • FIG. 1 is a graph showing skin infiltration of (A) CD68 positive macrophages and (B) FR ⁇ positive macrophages by bleomycin in a scleroderma model mouse.
  • the vertical axis of the graph represents the number of macrophages (cells / HPF).
  • FIG. 2 is an immunohistologically stained image showing infiltration of (A) CD68 positive macrophages and (B) FR ⁇ positive macrophages into the skin by bleomycin in a scleroderma model mouse.
  • FIG. 1 is a graph showing skin infiltration of (A) CD68 positive macrophages and (B) FR ⁇ positive macrophages by bleomycin in a scleroderma model mouse.
  • FIG. 2 is an immunohistologically stained image showing infiltration of (A) CD68 positive macrophages and (B) FR ⁇ positive macrophages into the skin by bleomycin in a scleroderma model mouse.
  • FIG. 3 is a graph showing the measurement results of transforming growth factor- ⁇ (TGF- ⁇ ) mRNA and connective tissue growth factor (CTGF) mRNA one week after treatment with a recombinant anti-FR ⁇ immunotoxin in a scleroderma model mouse. It is.
  • FIG. 4 is an immunohistologically stained image showing the expression of TGF- ⁇ 1 in CD68 positive macrophages and FR ⁇ positive macrophages in the skin of a scleroderma model mouse.
  • TGF- ⁇ transforming growth factor- ⁇
  • CTGF connective tissue growth factor
  • FIG. 5 is a graph showing the number (%) of TGF- ⁇ 1 positive cells in CD68 positive macrophages and FR ⁇ positive macrophages in the skin of scleroderma model mice.
  • FIG. 6 is a graph showing skin infiltration of (A) CD68-positive macrophages and (B) FR ⁇ -positive macrophages after 4 weeks of treatment with a recombinant anti-FR ⁇ immunotoxin in a scleroderma model mouse.
  • the vertical axis of the graph represents the number of macrophages (cells / HPF).
  • FIG. 7 is an immunohistologically stained image showing infiltration of CD68 positive macrophages and FR ⁇ positive macrophages into the skin 4 weeks after treatment with recombinant anti-FR ⁇ immunotoxin in a scleroderma model mouse.
  • FIG. 8 shows (A) the amount of collagen in skin through hydroxyproline analysis (vertical axis: hydroxyproline amount ( ⁇ g / area)) after 4 weeks of treatment with a recombinant anti-FR ⁇ immunotoxin in a scleroderma model mouse, B) It is a graph which shows the result of having measured the skin thickness (vertical axis: skin thickness (mm)) of the mouse
  • FIG. 9 is a photomicrograph of the skin thickness observed under a microscope 4 weeks after treatment with recombinant anti-FR ⁇ immunotoxin in a scleroderma model mouse.
  • FIG. 10 is a photomicrograph of the skin thickness observed under a microscope 4 weeks after treatment with recombinant anti-FR ⁇ immunotoxin in a scleroderma model mouse.
  • the scleroderma therapeutic agent according to the present invention is characterized by containing, as an active ingredient, a complex conjugated with an antibody that binds to folate receptor ⁇ (FR ⁇ ) and a cytotoxin or cytotoxic agent. It can selectively cause cell death of FR ⁇ -expressing macrophages and suppress skin fibrosis associated with the progression of scleroderma.
  • FR ⁇ folate receptor ⁇
  • cytotoxin or cytotoxic agent a cytotoxin or cytotoxic agent.
  • the scleroderma therapeutic agent according to the present invention can also be referred to as a skin fibrosis inhibitor.
  • FR ⁇ is a cell surface of a macrophage (hereinafter also referred to as scleroderma-related macrophage) localized in a lesion (ie, fibrotic cell) of scleroderma. Is a receptor protein expressed in FR ⁇ is not expressed or expressed at very low levels in macrophages in normal tissues and peripheral blood. Mammals include primates including humans, domestic animals such as cattle, pigs, horses, goats and sheep, and pet animals such as dogs and cats. A preferred mammal is a human.
  • an “antibody that binds to folate receptor ⁇ (FR ⁇ )” is an antibody that can recognize and bind to the FR ⁇ protein, and as described below, the antibody comprises:
  • the antibody may be an intact antibody, or an antibody fragment or a synthetic antibody (eg, a recombinant antibody, a bispecific antibody, a chimeric antibody, a humanized antibody, etc.) as long as it has binding affinity with scleroderma-related macrophages ).
  • These antibodies also make it possible to bind to both scleroderma-associated macrophages and the fibrotic cells when cells fibrotic due to scleroderma express FR ⁇ on their surface.
  • preferred antibodies are human antibodies or humanized antibodies.
  • cytotoxin or “cytotoxic agent” refers to any substance capable of killing or damaging scleroderma-associated macrophages and, optionally, fibrotic cells.
  • the complex as an active ingredient of the scleroderma therapeutic agent according to the present invention includes an antibody that binds to FR ⁇ as a molecular target expressed on the surface of a scleroderma-related macrophage, and the macrophage (and optionally, It is basically composed of a cytotoxin or cytotoxic agent that causes cell death of fibrotic cells).
  • cell death means cell death, killing or damage, and is caused by a cytotoxin or cytotoxic agent.
  • Cytotoxins are proteins called so-called toxins, whereas cytotoxic agents are low molecular weight chemotherapeutic agents, the former include toxins from microorganisms, especially bacteria, whereas the latter , Alkylating agents, antimetabolites, antibiotics, molecular targeted drugs, plant alkaloids, hormonal agents and the like.
  • the complex in the present invention comprises the above antibody and cytotoxin, these components can take the form of a fusion protein.
  • the cytotoxin can be preferably bound to the C-terminus of the antibody protein via a linker (for example, a peptide) as necessary.
  • the complex in the present invention comprises the antibody and the cytotoxic agent
  • these components can be bound covalently or non-covalently via a functional group for binding.
  • 1.1 Antibody In the present invention, the above antibody specifically binds to FR ⁇ of scleroderma-associated macrophages.
  • “specific” means that the antibody binds to FR ⁇ of the macrophage by an immunological reaction, but does not substantially bind to FR ⁇ or a protein other than a protein having 80% or more sequence identity. Means that.
  • the above-mentioned antibody has FR ⁇ which is one of the isoforms of FR (for example, human FR ⁇ has about 70% amino acid sequence identity with human FR ⁇ (Japanese Patent Publication No. 2008-500025)). It is desirable not to combine.
  • the antibody that can be used in the present invention is the whole antibody molecule or a fragment thereof that can bind to the antigen FR ⁇ protein or a partial peptide thereof.
  • the partial peptide has 5 or more, preferably 7 or more, more preferably 8 or more consecutive amino acids.
  • an antigenic epitope or antigenic determinant consists of about 5 to about 10 amino acids and has a continuous amino acid sequence or a discontinuous amino acid sequence.
  • the antibody in the present invention may be any of a monoclonal antibody, a polyclonal antibody, a human antibody, or an antibody fragment thereof as long as it binds to FR ⁇ , and preferably binds specifically.
  • the antibodies in the present invention may be of any immunoglobulin (Ig) class (IgA, IgG, IgE, IgD, IgM, etc.) and subclass (IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, etc.).
  • the light chain of the immunoglobulin may be either ⁇ or ⁇ .
  • the antibody fragment in the present invention is, for example, Fab, Fab ′, F (ab ′) 2 , Fv, heavy chain monomer or dimer, light chain monomer or dimer, dimer composed of one heavy chain and one light chain, and the like.
  • fragment production methods are known in the art, and can be obtained, for example, by digesting antibody molecules with proteases such as papain and pepsin, or by known genetic engineering techniques.
  • the antibody in the present invention may also be a recombinant antibody, a chimeric antibody, a humanized antibody or the like. Recombinant antibodies include, for example, single chain antibodies (scFv), bispecific antibodies and the like.
  • Bispecific antibodies refer to antibodies having two different binding specificities, and include, for example, diabody, ScDb (single chain diabody), dsFv-dsFv, etc. (Ryutaro Asano, Biochemistry 77 (12) 1497-1500, 2005).
  • a method for producing an antibody for use in the present invention will be described in detail according to the description in International Publication No. 2010/098503.
  • a protein to be used as an immunogen (antigen) that is, an FR ⁇ protein or a partial peptide thereof is first prepared.
  • the partial peptide has a sequence consisting of 5 or more, preferably 7 or more consecutive amino acids.
  • the origin of the FR ⁇ protein that can be used as an immunogen is not particularly limited as long as it can induce an antibody that can specifically bind to the target FR ⁇ .
  • mammals such as humans and mice can be used.
  • An FR ⁇ protein derived from an animal or a partial peptide thereof is used as an immunogen.
  • the human FR ⁇ protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a partial peptide thereof, or the mouse FR ⁇ protein consisting of the amino acid sequence shown in SEQ ID NO: 2 or a partial peptide thereof can be used as the immunogen.
  • the immunogen it is particularly preferred to use human FR ⁇ protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a partial peptide thereof.
  • the FR ⁇ protein or a partial peptide thereof can be prepared by a technique known in the art, for example, a solid phase peptide synthesis method, based on the amino acid sequence information (for example, SEQ ID NO: 1) of FR ⁇ .
  • the sequence information of FR ⁇ derived from other mammals including humans is available from, for example, GenBank (NCBI, USA), EMBL (EBI, Europe) and the like.
  • FR ⁇ protein or a partial peptide thereof can be produced using a genetic recombination technique.
  • a DNA sequence encoding FR ⁇ protein is linked to an appropriate protein production vector, introduced into a host so that the target FR ⁇ protein or a partial peptide thereof can be expressed, and FR ⁇ protein or The partial peptide can be produced.
  • This technique is well known to those skilled in the art, and a person skilled in the art can appropriately select the vector, host cell, transformation method, culture method, and target protein purification method employed in this case.
  • gene recombination methods see, for example, Sambrook et al., Molecular Cloning A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989), Ausubel et al., Current Protocols in Mol 19 be able to.
  • the antibody used in the present invention can be produced using the FR ⁇ protein prepared as described above or a partial peptide thereof as an immunogen.
  • an antibody used in the present invention can be produced using an expression vector incorporating a DNA encoding a target FR ⁇ protein or a partial peptide thereof, or a mammalian cell expressing the protein or a partial peptide thereof as an immunogen. Also good.
  • Polyclonal antibodies can be produced by immunizing mammals such as rabbits, rats, mice, etc. with the immunogen prepared as described above to obtain antisera.
  • the above immunogen is administered intravenously, subcutaneously or intraperitoneally to a mammal together with an adjuvant for enhancing immunogenicity as necessary.
  • the adjuvant commercially available complete Freund's adjuvant, incomplete Freund's adjuvant, aluminum hydroxide, alum, muramyl peptide (a kind of bacterial cell wall-related peptide) and the like can be used. Thereafter, immunization is performed 1 to 7 times at intervals of several days to several weeks, and after 1 to 7 days from the last immunization day, the antibody titer is measured by enzyme immunoassay such as ELISA, etc. Blood is collected on the day indicated to obtain antiserum. The antiserum thus obtained may be used as it is, or may be used after being purified once or several times on a column on which FR ⁇ protein or a partial peptide thereof is immobilized.
  • Monoclonal antibodies that can be used in the present invention can be prepared as follows. That is, a hybridoma is prepared from antibody-producing cells (for example, spleen-derived lymphocyte cells, lymphoid cells, etc.) obtained from a mammal immunized as described above and myeloma cells having no autoantibody-producing ability. It can be produced by selecting a clone that produces a monoclonal antibody that is cloned and shows specific affinity for the antigen used for immunization. Hybridoma production methods are well known in the art, and can be performed, for example, according to the method of Kohler and Milstein et al. (Nature (1975) 256: 495-96).
  • a mouse-mouse hybridoma clone 36b shown in Reference Example 1 below obtained by fusing a spleen cell of a mouse immunized with a human FR ⁇ -expressing cell and a mouse myeloma cell or Examples include monoclonal antibodies produced by clone 94b.
  • a rat-rat hybridoma shown in Reference Example 1 below obtained by fusing a rat spleen cell immunized with a mouse FR ⁇ -expressing cell and a rat myeloma cell. The monoclonal antibody etc.
  • the present invention includes a gene encoding an antibody containing an H chain or L chain of a monoclonal antibody produced by the hybridoma produced by the hybridoma as described above.
  • These nucleic acids can be obtained from hybridomas by ordinary genetic engineering techniques, and their base sequences can also be determined by known base sequencing methods.
  • the base sequences of the H chain variable region gene and L chain variable region gene of the monoclonal antibody produced by the mouse-mouse hybridoma clone 36b cell are shown in SEQ ID NOs: 3 and 4, respectively, and the monoclonal product produced by the mouse-mouse hybridoma clone 94b cell
  • the nucleotide sequences of the H chain variable region gene and L chain variable region gene of the antibody are shown in SEQ ID NOs: 5 and 6, respectively.
  • the nucleotide sequences of the H chain variable region gene and L chain variable region gene of the monoclonal antibody produced by rat-rat hybridoma clone CL5 are represented by SEQ ID NOs: 7 and 8, respectively, and rat-rat hybridoma clone CL10 is produced.
  • the nucleotide sequences of the H chain variable region gene and L chain variable region gene of the monoclonal antibody are shown in SEQ ID NOs: 9 and 10, respectively.
  • the present invention relates to the heavy chain variable region genes (for example, SEQ ID NOs: 3, 5, 7, and 9) and L chain variable region genes (for example, SEQ ID NOs: 4, 6, and 8) of monoclonal antibodies produced by the hybridomas prepared as described above.
  • mutants include the following.
  • the term “several” used in the context of heavy chain and light chain variable region genes refers to 1 to 20, preferably 1 to 15, more preferably 1 to 10.
  • “substantially identical” used in the context of the heavy chain and light chain variable region genes refers to the heavy chain variable region gene of a monoclonal antibody produced by the hybridoma prepared as described above (for example, SEQ ID NO: 3 5, 7, 9), light chain variable region genes (eg, SEQ ID NOs: 4, 6, 8, 10) and at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95% , 96%, 97%, 98% or 99% identity.
  • the determination of percent identity between two sequences is described, for example, in Carlin and Altshur as modified in Karlin and Altschul (1993) (Proc. Natl. Acad. Sci. USA 90: 5873-5877). (1990) (Proc. Natl. Acad. Sci. USA 87: 2264). This type of algorithm is described in Altshur et al. (1990) J. MoI. Mol. Biol. 215: 403 incorporated into NBLAST and XBLAST programs.
  • Gapped BLAST may be used.
  • PSI-BLAST can be used to perform an iterated search that detects distant associations between molecules.
  • BLAST, Gapped BLAST, and PSI-BLAST programs the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used (see http://www.ncbi.nlm.nih.gov.). ).
  • Other preferred examples of algorithms that can be used for sequence comparison are, for example, the algorithm of Myers and Miller (1988), CABIOS 4: 11-17.
  • washing conditions include conditions such as continuous washing at room temperature with a solution containing 2 ⁇ SSC and 0.1% SDS, and a 1 ⁇ SSC solution and a 0.2 ⁇ SSC solution.
  • the combinations of the above conditions are exemplary, and those skilled in the art will understand the above or other factors that determine the stringency of hybridization (for example, hybridization probe concentration, length and GC content, hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.
  • “equivalent” means that biological activities such as binding specificity and binding affinity for the FR ⁇ antigen are substantially the same.
  • the term may include a case where the activity is substantially the same, and the term “same quality” as used herein means that the nature of the activity such as specific binding to the FR ⁇ antigen is the same, or physiological A property, pharmacological property, or biological property is the same.
  • stringent conditions in these hybridizations are described in, for example, Sambrook et al. (Above), Ausubel et al. (Above), etc., and these conditions may be used in the present invention.
  • the mutants may be naturally occurring or artificially introduced with mutations. Artificial mutation can be introduced by a conventional method using, for example, site-specific mutagenesis (Proc Natl Acad Sci USA., 1984 81: 5652; Sambrook et al.
  • a recombinant antibody can also be produced using a gene recombination technique.
  • a gene encoding a monoclonal antibody is cloned from the prepared hybridoma, and incorporated into an appropriate vector, which is, for example, a mammalian cell line such as Chinese hamster ovary (CHO) cell, Escherichia coli, yeast cell, insect cell, It can be introduced into a host such as a plant cell to produce a recombinant antibody in the host (PJ Delves., ANTIBODY PROSECTION TECHNIQUE TECHNIQUES., 1997 WILEY, P.
  • CHO Chinese hamster ovary
  • human antibody-producing animals such as mice and cows lacking the endogenous antibody gene and carrying the human antibody gene are also known, so when using such animals
  • fully human antibodies that bind to human FR ⁇ can be obtained (for example, International Publication WO96 / 9634096, WO96 / 33735, WO98 / 24893, etc.).
  • hybridomas prepared from antibody-producing cells (for example, B cells) and myeloma cells of the animal are cultured in vitro, monoclonal antibodies can also be produced by the method described above.
  • the hybridoma is grown, maintained and stored according to various conditions such as the characteristics of the cell type to be cultured, the purpose of the test research and the culture method, and used to produce a monoclonal antibody in the culture supernatant. It is possible to carry out using any nutrient medium prepared from any known nutrient medium or basal medium.
  • the produced monoclonal antibody is appropriately combined with methods well known in the art, such as chromatography using a protein A or protein G column, ion exchange chromatography, hydrophobic chromatography, ammonium sulfate precipitation, gel filtration, affinity chromatography, etc. Can be purified.
  • the antibodies that can be used in the present invention can also be chimeric antibodies.
  • Chimeric antibodies are described, for example, in Morrison et al. , 1984, Proc. Natl. Acad. Sci. 81: 6851-6855; Neuberger et al. , 1984, Nature, 312: 604-608; Takeda et al. , 1985, Nature, 314: 452-454. In these techniques, genes from mouse antibody molecules with appropriate antigen specificity are spliced with genes from human antibody molecules with appropriate biological activity.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species. Examples of the chimeric antibody include an antibody having an H chain and / or L chain variable region of an anti-FR ⁇ mouse or rat monoclonal antibody and an immunoglobulin constant region derived from another mammal.
  • a part of a variable region including a variable region or a hypervariable region derived from, for example, a mouse or rat monoclonal antibody, a human immunoglobulin constant region, or a part of a human immunoglobulin variable region and a constant region, And, for example, a “humanized antibody”.
  • the mouse-derived antibody region is preferably less than about 10%.
  • the humanized antibody is, for example, at least one complementarity determining region (CDR1, 2) in the amino acid sequence of the heavy chain variable region and / or the light chain variable region of an anti-human FR ⁇ mouse monoclonal antibody (or anti-mouse FR ⁇ rat monoclonal antibody).
  • an amino acid sequence comprising 3 More specifically, the following antibodies can be exemplified.
  • An amino acid comprising at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in the following (a), (b), (c) or (d) Antibodies containing sequences: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 6; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 6; (C) a polynucleotide encoding a protein having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6 and binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with a base sequence complementary to the base sequence shown in SEQ ID NO: 6 under stringent conditions and binds to FR ⁇ .
  • CDR complementar
  • a suitable human acceptor antibody sequence for the mouse donor sequence can be identified by computer comparison of the amino acid sequence of the mouse variable region with the H or L chain sequence of a known human antibody.
  • a variable domain from a human antibody whose framework sequence exhibits high sequence identity with the framework regions of the murine light chain variable region and the heavy chain variable region is a Kabat that utilizes NCBI BLAST (USA) using the murine framework sequence.
  • an acceptor sequence that shares 80% or more, preferably 90% or more of the sequence identity with the mouse donor sequence can be selected.
  • suitable human acceptor antibody sequences can be identified. Based on the nucleotide sequences encoding the human acceptor antibody H chain and L chain sequences thus identified, recombination is performed so that a part of the variable region is replaced with that of the mouse antibody.
  • a humanized antibody can be cloned and produced by incorporating the DNA encoding the obtained human / mouse chimeric H chain and L chain into an expression vector and transforming it into an appropriate host cell.
  • the chimeric antibody and humanized antibody as described above have an advantage that antigenicity can be reduced when applied to humans.
  • Antibodies used in the present invention are also described, for example, in US Pat. No.
  • the single chain antibody used in the present invention is, for example, the above-described monoclonal antibody heavy chain variable region (for example, SEQ ID NO: 3, 5, 7, 9) and L chain variable region gene (for example, SEQ ID NO: 4, 6, 8, 10).
  • cytotoxin that can be used in the present invention is any cytotoxin that can be used for the purpose of inducing cell death of scleroderma-associated macrophages, such as Pseudomonas aeruginosa exotoxin, ricin.
  • a chain (ricin A chain), deglycosylated ricin A chain (deglycosylated ricin A chain), ribosome inactivating protein, alpha-sarcin (alpha-sarcin), geronin (gerlinin) ), Strictricin, ribonuclease, epodophylloxin (epidophyll) lotoxin), diphtheria toxin (diphtheria toxin), and the like.
  • a Pseudomonas aeruginosa exotoxin such as PE38.
  • the cytotoxic agent that can be used in the present invention can be appropriately selected from alkylating agents, antimetabolites, antibiotics, molecular target drugs, plant alkaloids, hormone agents, and the like.
  • Such cytotoxic agents are preferably those that can kill scleroderma-associated macrophages.
  • a cytotoxic agent capable of inducing the death of fibrotic cells can be used.
  • the recombinant immunotoxin in the present invention is a chimeric molecule in which the antibody that binds to a target (ie, FR ⁇ protein) is conjugated to a cytotoxin or a subunit thereof.
  • cytotoxins derived from plants and bacteria, cytotoxins of human origin, and synthetic cytotoxins can be used.
  • Conjugation of an antibody and a cytotoxin can be performed as follows. That is, by using a reactive group (for example, amino group, carboxyl group, hydroxyl group, etc.) in an antibody molecule and bringing the antibody into contact with a cytotoxin having a functional group capable of reacting with the reactive group, a recombinant immunogen is contacted.
  • a reactive group for example, amino group, carboxyl group, hydroxyl group, etc.
  • Toxins can be obtained.
  • Either a heavy chain fragment or a light chain fragment is made as a fusion protein with a cytotoxin, and a single chain antibody or a double chain antibody is formed via SH bond together with the other fragment not fused with the cytotoxin.
  • Recombinant protein may be produced by forming it.
  • the binding of the H chain fragment and the L chain fragment via the SH bond can be achieved by exposing the mercapto group (-SH group) with a reducing agent such as ⁇ -mercaptoethanol or dithiothreitol and then mixing the two together.
  • a reducing agent such as ⁇ -mercaptoethanol or dithiothreitol
  • a recombinant immunotoxin which is a recombinant immunotoxin of a monoclonal antibody produced by the mouse-mouse hybridoma clone 36b cell or clone 94b and Pseudomonas aeruginosa exotoxin.
  • a mouse-mouse hybridoma clone 36b and a Pseudomonas aeruginosa exotoxin recombinant immunotoxin are, for example, a single chain or a double chain consisting of a heavy chain consisting of the polypeptide shown in SEQ ID NO: 11 and a light chain consisting of the polypeptide shown in SEQ ID NO: 12. This is a chain antibody.
  • a recombinant immunotoxin of a monoclonal antibody produced by the mouse-mouse hybridoma clone 94b and Pseudomonas aeruginosa exotoxin is, for example, an H chain composed of the polypeptide shown in SEQ ID NO: 13 and an L chain composed of the polypeptide shown in SEQ ID NO: 14. Single-chain or double-chain antibody.
  • Another example of the complex used in the present invention is a conjugate of an antibody that binds to FR ⁇ and a cytotoxic agent.
  • a cytotoxic agent can be bound to the constant region of the antibody, preferably the C-terminal side.
  • Binding is the NH of the antibody protein 2 It can be carried out by using a group, an SH group, an OH group, a COOH group, etc., and chemically binding this to a cytotoxic agent having a reactive functional group, for example, via a hydrocarbon linker.
  • Therapeutic agent The complex thus prepared can target FR ⁇ that is highly expressed specifically in scleroderma-related macrophages, induce cell death of scleroderma-related macrophages, and suppress skin fibrosis.
  • the complex such as recombinant immunotoxin in the present invention is a complex that can be used for therapeutic purposes such as missile therapy and has a therapeutic effect on scleroderma.
  • the complex in the present invention is formulated as a scleroderma therapeutic agent containing this as an active ingredient. That is, the therapeutic agent for scleroderma according to the present invention contains a therapeutically effective amount of the complex.
  • therapeutically effective amount refers to an amount that can give a therapeutic effect for a given symptom or usage, and the sex, age, weight, severity of the disease to which the scleroderma therapeutic agent is applied, It varies according to various factors such as administration route.
  • a 60 kg adult may contain as a therapeutically effective amount an amount of the complex of the present invention administered in an amount of 200 ⁇ g or more, preferably 500 ⁇ g or more per day.
  • the scleroderma therapeutic agent according to the present invention includes physiologically acceptable pharmaceutical additives such as diluents, preservatives, solubilizers, emulsifiers, adjuvants, antioxidants, isotonic agents in addition to the complex.
  • physiologically acceptable pharmaceutical additives such as diluents, preservatives, solubilizers, emulsifiers, adjuvants, antioxidants, isotonic agents in addition to the complex.
  • an agent, an excipient and a carrier can be included. It may also be a mixture with other drugs effective for the treatment of scleroderma. Examples of such drugs include anti-TGF- ⁇ antibody, immunoglobulin, prostaglandin E1, and the like.
  • the therapeutic agent for scleroderma according to the present invention can be formulated for oral administration or parenteral administration (ie, intravenous or intramuscular administration) by injection, for example, bolus injection or continuous infusion.
  • injectable formulations may be presented in unit dosage form, for example in ampoules or multi-dose containers, with the addition of preservatives.
  • the therapeutic agent for scleroderma according to the present invention may be a lyophilized powder for reconstitution before use with a suitable vehicle such as sterile pyrogen-free water.
  • a suitable vehicle such as sterile pyrogen-free water.
  • the therapeutic agent for scleroderma according to the present invention may be directly brought into contact with the affected area of the patient.
  • the subject to which the scleroderma therapeutic agent according to the present invention is applied is not particularly limited, and patients suffering from scleroderma (particularly patients suffering from early scleroderma), patients treating scleroderma, etc. Any of these may be used.
  • the subject is not limited to a human but may be a mammal other than a human. Examples of mammals other than humans include humans, mice, rats, monkeys, rabbits, dogs, cats and the like.
  • the present invention also relates to a method for treating scleroderma comprising administering to the scleroderma patient a therapeutically effective amount of the above-mentioned complex or scleroderma therapeutic agent.
  • a method for treating scleroderma comprising administering to the scleroderma patient a therapeutically effective amount of the above-mentioned complex or scleroderma therapeutic agent.
  • a skin tissue sample derived from a subject is treated with the antibody or complex (labeled with a label such as a fluorophore, a dye, a radioisotope, etc.) described in Section 1 above ( Scleroderma diagnostic agent), or non-labeled antibody or complex), and the presence or absence of scleroderma with the presence of FR ⁇ -expressing scleroderma-related macrophages or the infiltration of the macrophages into the skin as an index, and A method for measuring (testing) the risk of having the disease is provided.
  • the antibody or complex label such as a fluorophore, a dye, a radioisotope, etc.
  • a skin tissue sample derived from a subject is treated with the above-mentioned antibody or complex (an antibody or complex labeled with a fluorophore, a dye, a radioisotope, etc. (scleroderma diagnostic agent), or an unlabeled antibody. Or a complex) to determine whether FR ⁇ -expressing macrophages are present in the skin tissue or whether FR ⁇ -expressing macrophages are infiltrating into the skin tissue, and a negative control (for example, a skin tissue sample of a healthy person) ), The presence of scleroderma can be examined when FR ⁇ -expressing macrophages are significantly present or infiltrated into the skin tissue.
  • the present invention provides a skin tissue sample derived from a subject who has undergone or has undergone scleroderma treatment, and an antibody or complex (an antibody labeled with a label such as a fluorophore, a dye, a radioisotope, or the like)
  • an antibody or complex an antibody labeled with a label such as a fluorophore, a dye, a radioisotope, or the like
  • the term “determining” means a means for presenting information or data of test results to a doctor, not intended for a doctor's judgment, that is, medical practice, and assisting the doctor's judgment. To do. Thus, the term “determining” can be replaced with terms such as “measuring”, “inspecting”, “determining” or “assessing”.
  • the present invention further provides a scleroderma diagnostic agent or a scleroderma diagnostic kit for use in the measurement or determination method and the like.
  • the scleroderma diagnostic agent or scleroderma diagnostic kit can contain the above antibody or complex, or a complex in which a label is further bound to the above antibody or complex.
  • the label examples include a fluorophore (for example, GFP), a dye, and a radioisotope (for example, 18 F-FDG) and the like.
  • Detection of FR ⁇ -expressing macrophages with the above antibody or complex can be performed by ELISA, fluorescent antibody method, radioimmunoassay, sandwich method, tissue staining method and the like.
  • an antibody for example, peroxidase, alkaline phosphatase, etc.
  • a fluorophore for example, FITC, tetramethylrhodamine, Texas red, etc.
  • a dye a radioactive isotope or the like is used.
  • the antibody or complex bound to the macrophages is detected.
  • the binding of the label includes a chemical binding method, a binding method using a biotin- (strept) avidin system, and the like.
  • a pharmaceutically acceptable radionuclide or luminescent substance is labeled on the above-mentioned antibody or complex, the antibody or complex is administered to a subject, and diagnostic imaging techniques such as PET / CT are used. Images can then be taken to determine or examine the presence of FR ⁇ -expressing scleroderma-related macrophages or skin infiltration.
  • the scleroderma diagnosis kit includes, in addition to the above-mentioned (labeled or unlabeled) antibody or complex, or a contrast agent containing them, a buffer for use in measurement, a labeled secondary antibody, etc. And instructions for use describing the measurement procedure. Reagents are sealed in separate containers.
  • Reagents are sealed in separate containers.
  • rheumatoid synovium or Balb / c mouse liver cDNA was separately added to Bioneer PCR premix (Bioneer), and a sense primer adjusted to 10 pmoles (human rheumatic synovium: agaagacatgggtctggaatggatg (SEQ ID NO: 15); Mouse liver: tctagaaaagacatgggcctggaaaagag (SEQ ID NO: 16)) and antisense primer (human rheumatoid synovium: gactgaactcaggcaaggccagagagtt (SEQ ID NO: 17); By performing 30 cycles of PCR at 72 ° C for 60 seconds and then reacting at 72 ° C for 5 minutes, Amplified mouse FR ⁇ .
  • the amplified FR ⁇ gene PCR product was ligated to the plasmid PCR2.1-TOPO (Invitrogen). Specifically, 1 ⁇ L of NaCl solution, 1.5 ⁇ l of sterilized distilled water and 1 ⁇ L of vector plasmid (PCR2.1-TOPO) were added to 2.5 ⁇ l of PCR product, and incubated at room temperature for 5 minutes, 2 ⁇ L of which was E. coli (TOP10F ′) In addition to this, the mixture was reacted in ice for 30 minutes, heat-treated at 42 ° C. for 30 seconds, allowed to stand in ice for 2 minutes, added with 250 ⁇ L of SOC medium, and then cultured in a shaker at 37 ° C. for 1 hour.
  • PCR2.1-TOPO E. coli
  • the cells were plated on LB medium and cultured overnight at 37 ° C.
  • cultivation the white colony extract
  • Plasmid purification was performed with Qiagen plasmid purification kit (Qiagen).
  • Qiagen Qiagen plasmid purification kit
  • the incorporated FR ⁇ gene is treated with the restriction enzyme EcoRI and then developed into agarose electrophoresis. After confirming the FR ⁇ gene product of about 0.8 kb (782 bp), the site is excised, and the extraction of the gene product is performed using the Qiagen PCR purification kit.
  • 1x10 7 Sense primers human rheumatoid synovium: agaagacatgggtctgagaatggagtg (SEQ ID NO: 15); mouse liver: tctagaaaagacatgaggagggaggaggaggaggaggaggaggaggaggaggaggaggagtgaggaggaggaggagtgaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggagg
  • FR ⁇ expressing mouse B300-19 cells or rat RBL2H3 cells 7 The mixture was mixed with Freund's complete adjuvant, and immunized intraperitoneally at three sites in the tail of Balb / C mice (for anti-human FR ⁇ monoclonal antibody) or Whister Kyoto rats (for anti-mouse FR ⁇ monoclonal antibody). This immunization was repeated 2 to 4 times.
  • Monoclonal antibodies were prepared according to the method of Koler (Kohler & Milstein, Nature (1975) 256: 495-96). That is, spleen or iliac lymph nodes were taken out and dissociated into single cells. The dissociated cells are fused with myeloma-derived cells (NS-1) to prepare hybridomas, cultured in a HAT selective medium, and the antibody secreted in the culture supernatant is compared with the FR ⁇ -expressing cells. Sorting was performed by reactivity. The obtained hybridoma was cloned by limiting dilution culture adjusted to 1 cell per well of a 96-well plate. Cloned cells were selected based on reactivity with FR ⁇ -expressing cells.
  • 1x10 cloned hybridomas 7 The ascites was adjusted by administration into nude mice, and the monoclonal antibody was purified with Protein G column (GE Bioscience). The isotype of purified mouse and rat monoclonal antibodies was determined using an isotyping ELISA kit (Pharmingen). As a result, two IgG2a type clone 36b and IgG1 type 94b were obtained as anti-human FR ⁇ mouse monoclonal antibodies, and two IgG2a type CL5 and CL10 were obtained as anti-mouse FR ⁇ rat monoclonal antibodies. The reactivity of each antibody to the antigen was analyzed by flow cytometry.
  • VH and VL heavy chain gene variable region (VH) and light chain gene variable region (VL) genes of anti-human FR ⁇ mouse monoclonal antibody and anti-mouse FR ⁇ rat monoclonal antibody
  • Mouse hybridoma clones 36b and 94b were 1 ⁇ 10 7 Each was individually prepared, and cDNA was synthesized with cDNA synthesis kit (Invitrogen).
  • VH and VL genes were determined by PCR using Ig-Prime Kit. PCR conditions were performed according to the attached instructions. That is, PCR was performed at 94 ° C. for 60 seconds, 50 ° C. for 60 seconds, and 72 ° C. for 120 seconds, and then reacted at 72 ° C.
  • VH and VL PCR products were ligated to plasmid PCR2.1-TOPO (Invitrogen) and introduced into E. coli (TOP10F ′).
  • the plasmid was purified from the introduced E. coli, and the VH and VL base sequences of 36b and 94b were determined.
  • the nucleotide sequence was subjected to PCR using the BigDye Terminator V3.1 cycle sequencing kit (ABI), and the PCR product was analyzed with ABI 310 DNA sequencer. 1 ⁇ 10 rat hybridoma clones CL5 and CL10 7 Each was individually prepared, and cDNA was synthesized with cDNA synthesis kit (Invitrogen).
  • VH and VL genes were amplified by PCR using Ig-Prime Kit and a primer designed for rat VH amplification (caccatggagtttattttgag (SEQ ID NO: 19)).
  • the amplified VH and VL PCR products were ligated to plasmid PCR2.1-TOPO (Invitrogen) and introduced into E. coli (TOP10F ′).
  • TOP10F ′ E. coli
  • the plasmid was purified from E. coli and the VH and VL base sequences were determined.
  • the nucleotide sequence was subjected to PCR using BigDye Terminator V3.1 cycle sequencing kit (ABI) and analyzed with ABI 310 DNA sequencer. 1-2.
  • a primer designed to mutate the 63rd amino acid glycine (base sequence ggc) of the immunoglobulin heavy chain gene variable region (VH) of the anti-human FR ⁇ mouse monoclonal antibody 94b to cysteine (base sequence tgt) was prepared (sense primer) : Cagaggcctgaactattgtctggagtggattggaag (SEQ ID NO: 20), antisense primer: cttccatatccactccagaactgttcggccctctg (SEQ ID NO: 21)), quick change site-directed strain Mutagenesis treatment was performed on 1-TOPO 94bVH.
  • the DNA after the reaction was introduced into Escherichia coli XL1-Blue and selectively cultured in an LB medium containing 0.1 mg / mL ampicillin.
  • the plasmid of the selected transformant was purified by QIAprep spin Miniprep KIT (Qiagen).
  • the base sequence was determined with the Big Dye Terminator v3.1 cycle sequencing kit (ABI) and the ABI310 sequencer, and it was confirmed that the 63rd glycine was mutated to cysteine (base sequence tgt).
  • Each annealing primer has NdeI, which is a restriction enzyme. By cloning at this site, a protein having atg as a start codon can be expressed. In addition, a HindIII site is inserted into the other annealing primer, and by cloning at this site, it is possible to express a fusion protein in which the VH and PE genes are bound.
  • the PCR product is purified, the restriction enzymes NdeI (New England Biolabs) and HindIII (New England Biolabs) are added to the purified product, the reaction is performed, and the gel is developed using QIAquick gel extraction kit (Qiagen).
  • the DNA of the desired size was recovered from.
  • pRK79PE38 treated with the same restriction enzyme as the mutation-introduced VH treated with the restriction enzyme was added, and ligation reaction between VH and pRK79PE38 was performed using Ligation High (Toyobo). After completion of the ligation reaction, the gene was introduced into E.
  • coli TOP10F ′ (Invitrogen), and a transformant was selected in an LB medium containing 0.1 mg / mL ampicillin.
  • the plasmid pRK79-VHPE of the selected transformant was purified by QIAprep spin Miniprep KIT (Qiagen). Furthermore, the base sequence was determined using the Big Dye Terminator v3.1 cycle sequencing kit (ABI) and the ABI310 sequencer, and it was confirmed that the base sequence of the mutagenized VH was linked to the PE38 base sequence of the pRK79 vector.
  • a primer designed to mutate the 125th amino acid of the immunoglobulin light chain gene variable region (VL) of the anti-human FR ⁇ mouse monoclonal antibody 94b to cysteine (base sequence tgt) was prepared (sense primer: taagaaggagataatagataggacatgtgtgagtcacatc (SEQ ID NO: 28).
  • This primer contains the base catatg that can be cleaved by the restriction enzyme NdeI, so that the protein can be expressed with atg as the start codon by cloning at this site); antisense primer: gctttgttagcaggccgaattccttttttattcccgtctgtgcccaaccgacc 29 ) (This primer contains the 125th amino acid. Stain mutated to (tgt), are designed as throughout Subsequently restriction enzymes EcoRI cleavable base gaattc comes codon tag)).
  • a primer designed to mutate the 125th amino acid of the immunoglobulin light chain gene variable region (VL) of the anti-mouse FR ⁇ rat monoclonal antibody CL10 to cysteine (base sequence tgt) was prepared (atacatatggacatgtgcatccccatctcccatcc (SEQ ID NO: 30). And gctttgttagcagccgaattccttattgatttttccagctttgggtcccaacaaccgaacgt (SEQ ID NO: 31)).
  • PCR of pCR2.1-TOPO-94bVL plasmid was performed using these primer combinations and pfu DNA polymerase (Stratagene). In this reaction, PCR was performed at 94 ° C. for 20 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 60 seconds, and then reacted at 72 ° C. for 5 minutes. Next, the PCR product is purified, the restriction enzymes NdeI (New England Biolabs) and EcoRI (New England Biolabs) are added to the purified product, the reaction is performed, and the gel is developed using QIAquick gel extraction kit (Qiagen). The DNA of the desired size was recovered from.
  • NdeI New England Biolabs
  • EcoRI New England Biolabs
  • pRK79PE38 treated with the same restriction enzyme as that of the mutation-introduced VL treated with restriction enzyme was added, and ligation reaction between VH and pRK79PE38 was performed using Ligation High (Toyobo).
  • the gene was introduced into E. coli TOP10F ′ (Invitrogen), and a transformant was selected in an LB medium containing 0.1 mg / mL ampicillin.
  • the plasmid pRK79-VLPE of the selected transformant was purified by QIAprep spin Miniprep KIT (Qiagen).
  • the base sequence was determined with the Big Dye Terminator v3.1 cycle sequencing kit (ABI) and the ABI310 sequencer, and the 125 amino acids of the mutagenized VL were mutated to cysteine, and the start codon tag was placed. confirmed.
  • coli into which the gene was introduced was carried out by culturing at 37 ° C. for 15 to 18 hours in an LB medium containing 0.1 mg / mL ampicillin. After completion of the selection, Escherichia coli was cultured in a 1000 mL super broth medium at 37 ° C. until reaching 1.0-1.5 at a visible absorbance of 600 nm. After culturing, IPTG (isopropyl-beta-D-thio-galactopyranoside) was added to the medium to a final concentration of 1 mM, and further cultured at 37 ° C. for 90 minutes.
  • IPTG isopropyl-beta-D-thio-galactopyranoside
  • Escherichia coli was collected by centrifugation, and suspended in 200 mL using 50 mM Tris buffer (pH 7.4, containing 20 mM EDTA). After the suspension, egg white lysozyme was added to a final concentration of 0.2 mg / mL and reacted at room temperature for 1 hour to destroy E. coli. After destruction, the precipitate was collected by centrifugation at 20,000 ⁇ g.
  • the precipitate was further suspended in 50 mM Tris buffer (pH 7.4, containing 2.5% Triton X-100, 0.5 M NaCl, 20 mM EDTA) to 200 mL, and egg white lysozyme was added to a final concentration of 0.2 mg / mL. And allowed to react at room temperature for 1 hour. After completion of the reaction, the mixture was centrifuged at 20,000 ⁇ g to collect the precipitate. The precipitate was further suspended in 200 mL with 50 mM Tris buffer (pH 7.4, containing 2.5% Triton X-100, 0.5 M NaCl, 20 mM EDTA), mixed well, and centrifuged at 20,000 ⁇ g.
  • 50 mM Tris buffer pH 7.4, containing 2.5% Triton X-100, 0.5 M NaCl, 20 mM EDTA
  • VHPE 0.5 mL of VHPE and 0.25 mL of VL were mixed, dithiothreitol (DTT) was added to a final concentration of 10 mg / mL, and reduction treatment was performed at room temperature for 4 hours. After the treatment, it was dissolved in 75 mL of 0.1 M Tris buffer (pH 8.0, containing 0.5 M arginine, 0.9 mM oxidized glutathione, 2 mM EDTA). By leaving this solution at 10 ° C. for 40 hours, VH and VL were combined.
  • DTT dithiothreitol
  • the mixture was concentrated to 5 mL with a 10,000-centrifugal centrifugal concentrator (Centricon 10, Amicon), and further diluted with 50 mL of Tris buffer (pH 7.4, containing 0.1 M urea, 1 mM EDTA). This diluted solution was used as a starting material for purification of recombinant immunotoxin.
  • Tris buffer pH 7.4, containing 1 mM EDTA
  • the adsorbed recombinant immunotoxin was eluted with Tris buffer (pH 7.4, containing 0.3 M NaCl, 1 mM EDTA).
  • the eluted sample was dialyzed with Tris buffer (containing pH 7.4, 1 mM EDTA), and further purified with an ion exchange column POROS HQ (POROS). That is, by adsorbing the dialyzed purified substance at a flow rate of 10 mL / min, washing with Tris buffer (containing pH 7.4, 1 mM EDTA), and setting a NaCl gradient from 0 M to 1.0 M in the buffer. Recombinant type immunotoxin was eluted.
  • TSK300SW Tosoh gel filtration chromatography.
  • endotoxin in the TSK300SW column was removed by washing with 75% disinfecting ethanol for 48 hours.
  • it was washed with distilled water for injection in Japanese Pharmacopoeia, and then the TSK300SW column was equilibrated with Japanese Pharmacopoeia physiological saline.
  • recombinant type immunotoxin was administered, and the eluate from the column was collected at a flow rate of 0.25 mL / min.
  • SDS-PAGE polyacrylamide electrophoresis containing sodium dodecyl sulfate
  • SDS-PAGE polyacrylamide electrophoresis containing sodium dodecyl sulfate
  • SDS sodium dodecyl sulfate
  • SDS sodium dodecyl sulfate
  • An aqueous solution containing 130 mM glycine and 25 mM Tris was used. Each sample was adjusted with 100 mM Tris buffer pH 6.5 containing SDS at a final concentration of 0.1%, and boiled for 5 minutes.
  • 100 ⁇ l of the sterile bleomycin solution was subcutaneously injected daily into the right skin of the mouse, and 100 ⁇ l of phosphate buffer as a control group was subcutaneously injected daily into the left skin of the same mouse. All injections were made at a defined site around 8-9 mm in diameter. This experiment was divided into two sets. In one set, three mice were sacrificed 3 days, 1 week, 2 weeks and 4 weeks after bleomycin injection, and macrophage infiltration into bleomycin-injected skin and control skin was examined. In another set, treatment with the recombinant anti-FR ⁇ immunotoxin prepared in Reference Example 1 by intravenous injection from the day after the start of bleomycin injection was performed in combination.
  • Recombinant anti-FR ⁇ immunotoxin used in this example is an anti-mouse FR ⁇ anti-mouse FR ⁇ rat monoclonal antibody CL10-derived immunoglobulin heavy chain variable region (VH) and Pseudomonas aeruginosa exotoxin (PE38) linked to anti-mouse FR ⁇ . It is a double-chain Fv anti-FR ⁇ immunotoxin comprising an immunoglobulin light chain variable region (VL) derived from rat monoclonal antibody CL10.
  • VH immunoglobulin heavy chain variable region
  • PE38 Pseudomonas aeruginosa exotoxin
  • TGF- ⁇ transforming growth factor- ⁇
  • CGF connective tissue growth factor
  • mice were sacrificed and the central site skin of the bleomycin injection was taken with a biopsy 5 mm diameter Thelma punch. Subsequently, in order to observe the anti-fibrotic effect of the recombinant anti-FR ⁇ immunotoxin, 30 mice were randomly divided into three groups, and the recombinant anti-FR ⁇ immunogen in an amount of 0.25 mg / kg / 100 ⁇ l / mouse in one group.
  • Toxin was injected into the tail vein, and another set of control VHPE lacking the FR ⁇ binding site (VH chain lacking antibody binding and Pseudomonas aeruginosa toxin) was injected into the tail vein in an amount of 0.25 mg / kg / 100 ⁇ l / mouse. In another set, 100 ⁇ l of phosphate buffer was injected into the tail vein. The administration of subcutaneous injection of bleomycin was carried out once every 3 days from the next day for 2 weeks for a total of 5 times, followed by 2 weeks after administration of bleomycin alone, that is, 4 weeks later, to examine the antifibrotic effect. In addition, all the above-mentioned experiments were conducted as duplicate experiments.
  • TOYOBO RNase Inhibitor
  • Each total RNA sample obtained was adjusted so that the total RNA amount was 800 ng and the volume was 7 ⁇ l, and used for reverse transcription PCR.
  • reverse transcription PCR RNA was denatured by first incubating at 65 ° C. for 5 minutes and then rapidly cooling on ice.
  • CTGF probe sequence-GCCCTGCCCTAGCTGCCTACCGACT SEQ ID NO: 32
  • Glyceraldehyde-3-phosphate dehydrogenase Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe sequence-GGTGTGAACGGATTTGGCCGATTTG (SEQ ID NO: 33)
  • TGF- ⁇ 1 probe sequence-CTATTGCCTTCAGCTCCCAGAGAAG SEQ ID NO: 34.
  • One sample of the control skin of the control group was used as a reference gene, diluted at a ratio of 1, 1/2, 1/4, and 1/8 and reacted to prepare a standard curve. For all measurements, duplicate wells were placed and averaged.
  • the measurement result is a relative quantification expressed as a ratio to the reference target gene, with the GAPDH gene used as an endogenous control, corrected for the ratio of the same sample as the target gene.
  • the sections were then washed with phosphate buffer and incubated with non-serum protein block reagent (Dako) for 1 hour at room temperature to suppress nonspecific reactions.
  • Rat anti-mouse CD68 (macrophage marker) or rat anti-mouse FR ⁇ as a primary antibody was reacted with the sections at a concentration of 5 ⁇ g / ml for 1 hour at room temperature.
  • a peroxidase-labeled anti-rat secondary antibody manufactured by Nichirei
  • P-dimethylaminobenzaldehyde is melted in a ratio of 30% peroxide acid (60% solution) in 70% Methylcellosolve.
  • the sample was reacted at 60 ° C. for 20 minutes, and then the absorbance at 550 nM was measured with a microplate reader.
  • the absorbances of L-4-hydroxyproline 12.5 ⁇ g / ml, 25 ⁇ g / ml, 50 ⁇ g / ml, 100 ⁇ g / ml and 200 ⁇ g / ml standards were also measured.
  • a standard curve was created from the absorbance of L-4-hydroxyproline to determine the amount of hydroxyproline in the target sample.
  • TGF- ⁇ transforming growth factor- ⁇
  • CTGF connective tissue growth factor
  • FIG. 4 is an immunohistologically stained image showing the expression of TGF- ⁇ 1 in CD68 positive macrophages and FR ⁇ positive macrophages in the skin of a scleroderma model mouse.
  • FIGS. 5 is a graph showing the number (%) of TGF- ⁇ 1 positive cells in CD68 positive macrophages and FR ⁇ positive macrophages in scleroderma model mouse skin. As shown in FIGS. 4 and 5, the ratio of TGF- ⁇ 1 expression in FR ⁇ -positive macrophages was significantly higher than the ratio of TGF- ⁇ 1 expression in CD68-positive macrophages.
  • (2) Changes in skin macrophages after treatment The results are shown in FIGS. In the skin samples after 4 weeks, the number of CD68 positive macrophages and FR ⁇ positive macrophages in the group treated with the recombinant anti-FR ⁇ immunotoxin was significantly reduced.
  • Antifibrotic effect The results are shown in FIGS.
  • Recombinant anti-FR ⁇ immunotoxin showed the same therapeutic effect as the anti-TGF- ⁇ antibody in reports on conventional scleroderma treatment.
  • Recombinant anti-FR ⁇ immunotoxin has the following advantages over anti-TGF- ⁇ antibody.
  • the intranasal route of administration has advantages such as less antibody production against the toxin and direct arrival in the lung
  • the suppression of skin fibrosis was effective in the venous route.
  • the organ fibrosis mechanism involves cells that are inherent to the organ, the fibrosis mechanism is different in various organs. For example, if a drug effective for pulmonary fibrosis suppresses fibrosis of the skin Is not limited. Therefore, in this Example, the fact that the recombinant anti-FR ⁇ immunotoxin was effective in suppressing skin fibrosis indicates that a new skin fibrosis inhibitor is provided.
  • a novel therapeutic agent for scleroderma is provided.
  • the therapeutic agent for scleroderma according to the present invention can bring about a therapeutic effect on scleroderma by selectively inducing cell death or cytotoxicity of FR ⁇ -expressing macrophages involved in skin fibrosis. All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Rehabilitation Therapy (AREA)
  • Rheumatology (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un nouvel agent thérapeutique pour la sclérodermie et concerne spécifiquement un agent thérapeutique pour la sclérodermie contenant comme principe actif un conjugué dans lequel une cytotoxine ou un agent cytotoxique et un anticorps qui se lie au récepteur β du folate (FRβ) sont conjugués.
PCT/JP2014/057936 2013-03-15 2014-03-14 Agent thérapeutique pour la sclérodermie WO2014142356A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2015505618A JPWO2014142356A1 (ja) 2013-03-15 2014-03-14 強皮症治療剤

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2013054090 2013-03-15
JP2013-054090 2013-03-15

Publications (1)

Publication Number Publication Date
WO2014142356A1 true WO2014142356A1 (fr) 2014-09-18

Family

ID=51536999

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2014/057936 WO2014142356A1 (fr) 2013-03-15 2014-03-14 Agent thérapeutique pour la sclérodermie

Country Status (2)

Country Link
JP (1) JPWO2014142356A1 (fr)
WO (1) WO2014142356A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004530678A (ja) * 2001-05-02 2004-10-07 パーデュー・リサーチ・ファウンデーション マクロファージが仲介する疾患の治療および診断
WO2010098503A1 (fr) * 2009-02-27 2010-09-02 国立大学法人鹿児島大学 Agent thérapeutique pour pneumonie interstitielle
WO2012033987A2 (fr) * 2010-09-09 2012-03-15 Purdue Research Foundation Anticorps anti-récepteur bêta de folate humain et leurs procédés d'utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004530678A (ja) * 2001-05-02 2004-10-07 パーデュー・リサーチ・ファウンデーション マクロファージが仲介する疾患の治療および診断
WO2010098503A1 (fr) * 2009-02-27 2010-09-02 国立大学法人鹿児島大学 Agent thérapeutique pour pneumonie interstitielle
WO2012033987A2 (fr) * 2010-09-09 2012-03-15 Purdue Research Foundation Anticorps anti-récepteur bêta de folate humain et leurs procédés d'utilisation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LI HUA ET AL.: "The effectiveness of a recombinant immunotoxin against folate receptor in bleomycin-induced experimental scleroderma", DAI 57 KAI JAPAN COLLEGE OF RHEUMATOLOGY SOKAI·GAKUJUTSU SHUKAI·DAI 22 KAI KOKUSAI RHEUMATOLOGY SYMPOSIUM PROGRAM· SHOROKUSHU, 19 March 2013 (2013-03-19), pages 305 *

Also Published As

Publication number Publication date
JPWO2014142356A1 (ja) 2017-02-16

Similar Documents

Publication Publication Date Title
JP6326137B2 (ja) 抗ｈｅｒ２抗体及びその結合体
WO2019024911A1 (fr) Conjugué anticorps anti-b7h3-médicament et son utilisation médicale
JP6233933B2 (ja) 葉酸リセプターα及びβを認識する抗体
CN111471106A (zh) 人源抗转甲状腺素蛋白抗体、多核苷酸、载体及其应用
KR20200079561A (ko) Ror1 암을 치료하고 전이를 저해하는데 이용을 위한 항체와 백신
KR20230098606A (ko) 인터루킨 36r을 표적으로 하는 항체 및 이의 제조 방법과 용도
CN112794911B (zh) 人源化抗叶酸受体1抗体及其应用
CN113045659B (zh) 抗cd73人源化抗体
JP5881085B2 (ja) 膵臓癌の治療用及び診断用の組成物
JP5544626B2 (ja) 間質性肺炎治療剤
JP2024516581A (ja) 抗ヒトｃｄ７３抗体およびその適用
CN110606892B (zh) 一种高亲和力高生物活性的lag-3抗体及其应用
JP2010077026A (ja) がん関連マクロファージを標的とした固形がん治療剤
US20220275077A1 (en) Il-38-specific antibodies
JP5896568B2 (ja) 動脈硬化又は動脈硬化性疾患の治療剤、及び動脈硬化又は動脈硬化性疾患の診断薬
WO2014142356A1 (fr) Agent thérapeutique pour la sclérodermie
US11970546B2 (en) Antibody specific for Mucin-1 and methods of use thereof
TWI843105B (zh) 抗her2 抗體藥物偶聯物在治療尿路上皮癌中的用途
JP2018511306A (ja) 治療
JP5822407B2 (ja) 軟骨・骨破壊抑制剤
TW202323289A (zh) 抗生長激素抗體
JP2014091687A (ja) 軟骨又は骨の破壊の診断薬

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14765597

Country of ref document: EP

Kind code of ref document: A1

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2015505618

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14765597

Country of ref document: EP

Kind code of ref document: A1