WO2010098503A1 - Agent thérapeutique pour pneumonie interstitielle - Google Patents

Agent thérapeutique pour pneumonie interstitielle Download PDF

Info

Publication number
WO2010098503A1
WO2010098503A1 PCT/JP2010/053591 JP2010053591W WO2010098503A1 WO 2010098503 A1 WO2010098503 A1 WO 2010098503A1 JP 2010053591 W JP2010053591 W JP 2010053591W WO 2010098503 A1 WO2010098503 A1 WO 2010098503A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
frβ
antibody
protein
polynucleotide
Prior art date
Application number
PCT/JP2010/053591
Other languages
English (en)
Japanese (ja)
Inventor
松山隆美
永井拓
田中将志
Original Assignee
国立大学法人鹿児島大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人鹿児島大学 filed Critical 国立大学法人鹿児島大学
Priority to JP2011501697A priority Critical patent/JP5544626B2/ja
Publication of WO2010098503A1 publication Critical patent/WO2010098503A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6817—Toxins
    • A61K47/6829—Bacterial toxins, e.g. diphteria toxins or Pseudomonas exotoxin A
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a novel therapeutic agent for interstitial pneumonia, more specifically, a therapeutic agent for interstitial pneumonia containing an antibody against folate receptor ⁇ as an active ingredient.
  • Interstitial pneumonia is a general term for diseases in which the interstitial lung is inflamed.
  • idiopathic interstitial pneumonia is a specific disease affecting about 20 people per 100,000 population, and the life expectancy is 2.5 to 5 years.
  • causes of short life expectancy include the lack of definitive therapy.
  • tissue fibrosis associated with prolonged inflammation is prominent, and thus suppression of fibrosis is considered to be directly linked to treatment of the disease.
  • Increased macrophages are observed clinically in fibrotic tissue of interstitial pneumonia.
  • suppression of protein factor (MCP1) that induces macrophages into inflamed tissues and cytokines secreted by macrophages alleviate the symptoms of interstitial pneumonia.
  • Non-patent Document 1 administration of an anti-CD11 antibody that attacks macrophages themselves can also suppress fibrosis and relieve disease states.
  • Non-patent Document 1 targeting macrophages that secrete a wide range of proteins (cytokines) that promote interstitial pneumonia is considered effective for the treatment of the disease.
  • cytokines proteins
  • the antibody reported in Non-Patent Document 1 also recognizes CD11 expressed in normal tissues and macrophages in blood, the risk of side effects such as infectious diseases cannot be ruled out. It is unsuitable.
  • an object of the present invention is to provide a novel therapeutic agent for interstitial pneumonia with reduced risk of side effects.
  • Folate receptor ⁇ (FR ⁇ ) is expressed at high levels on the cell surface of macrophages associated with inflammation, particularly macrophages localized in rheumatoid arthritis and malignant brain tumors, while not expressed in normal tissues or peripheral blood or It is known to be expressed at very low levels (Nagayoshi R et al., Arthritis Rheum. 2005 Sep; 52 (9): 2666-75; Nagai T et al., Arthritis Rheum.
  • FR ⁇ expression is strongly expressed in macrophages in tissues in which fibrosis is progressing in an interstitial pneumonia model using mice. Accordingly, the present inventors made a recombinant type immunotoxin for anti-mouse FR ⁇ and examined the therapeutic effect in the same model.
  • a therapeutic agent for interstitial pneumonia comprising, as an active ingredient, a complex in which an antibody that binds to folate receptor ⁇ (FR ⁇ ) and a cytotoxin or cytotoxic agent are conjugated.
  • FR ⁇ folate receptor ⁇
  • cytotoxin or cytotoxic agent conjugated.
  • the therapeutic agent for interstitial pneumonia as described in (1) or (2) above, wherein the complex is a recombinant immunotoxin.
  • the antibody is a heavy chain (H chain) variable region and / or a light chain (L chain) variable region of either an anti-human folate receptor ⁇ mouse monoclonal antibody or an anti-mouse folate receptor ⁇ rat monoclonal antibody.
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (8) above, comprising an amino acid sequence comprising at least one complementarity determining region (CDR) in each amino acid sequence.
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 3; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 3; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the base sequence shown in SEQ ID NO: 3 and having
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4; (B) a polynucleotide encoding a protein having a biological activity that binds to FR ⁇ , including deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 4; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the base sequence shown in SEQ ID NO: 4 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with the
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in the following (a), (b), (c) or (d):
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 5; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 5; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the base sequence shown in SEQ ID NO: 5 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with the
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 6; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 6; (C) a polynucleotide encoding a protein having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6 and binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with the
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 7; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 7; (C) a polynucleotide encoding a protein having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 7 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridize
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 8; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 8; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the base sequence shown in SEQ ID NO: 8 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with the base
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the heavy chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 9; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 9; (C) a polynucleotide encoding a protein having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 9 and having biological activity binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridize
  • the antibody comprises at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in (a), (b), (c) or (d) below:
  • CDR complementarity determining region
  • the therapeutic agent for interstitial pneumonia according to any one of (1) to (9) above, comprising an amino acid sequence comprising: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 10; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 10; (C) a polynucleotide encoding a protein having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 10 and binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with the
  • the cytotoxins include Pseudomonas aeruginosa exotoxin ricin A chain, deglycosylated ricin A chain, ribosome inactivating protein (me riboin inactivating protein (a riboin inactivating protein) ), Alpha-sarcin, gelonin, aspergillin, restrictocin, ribonuclease, epodophyllotoxin, and diphtheriatoxin diphtheriatoxin Selected from the above ( ) Interstitial pneumonia therapeutic agent of any one of - (17).
  • the complex is a single-chain or double-chain antibody comprising an H chain consisting of the polypeptide shown in SEQ ID NO: 11 and an L chain consisting of the polypeptide shown in SEQ ID NO: 12, (18) The therapeutic agent for interstitial pneumonia according to any one of (18).
  • the complex is a single-chain or double-chain antibody comprising an H chain composed of the polypeptide represented by SEQ ID NO: 13 and an L chain composed of the polypeptide represented by SEQ ID NO: 14, (18) The therapeutic agent for interstitial pneumonia according to any one of (18).
  • a diagnostic agent for interstitial pneumonia comprising an antibody that binds to folate receptor ⁇ (FR ⁇ ).
  • FIG. 1 shows immunohistological staining of a lung region using an anti-mouse FR ⁇ mouse monoclonal antibody in a patient specimen diagnosed as interstitial pneumonia (upper figure) and a bleomycin-treated mouse interstitial pneumonia model (lower figure). Indicates. Cells recognized by the FR ⁇ antibody are colored red.
  • FIG. 2 shows that administration of the recombinant immunotoxin of the present invention improves the survival rate of mice in a bleomycin-administered mouse model.
  • FIG. 3 shows immunohistological staining of the lung region after administration of the recombinant immunotoxin of the present invention or a placebo (deficient in binding to FR ⁇ ) in a bleomycin-administered mouse model.
  • FIG. 4 shows tumor necrosis factor (TNF) - ⁇ , CC in the lung after administration of the recombinant immunotoxin or placebo (deficient in binding to FR ⁇ ) of the present invention in a bleomycin-induced pulmonary fibrosis mouse model.
  • the immunohistochemical staining (upper figure) of the chemokine ligand (CCL) 2 or CCL12 producing cell and the count (lower figure) of the cell are shown.
  • the therapeutic agent for interstitial pneumonia of the present invention is characterized by comprising as an active ingredient a complex in which an antibody that binds to folate receptor ⁇ (FR ⁇ ) and a cytotoxin or cytotoxic agent are conjugated. It can selectively cause cell death of expressed macrophages and suppress lung fibrosis associated with the progression of interstitial pneumonia.
  • folate receptor ⁇ or “FR ⁇ ” refers to cells of macrophages (hereinafter also referred to as interstitial pneumonia-related macrophages) that are localized in lesions (ie, fibrotic cells) of interstitial pneumonia. It is a receptor protein expressed on the surface.
  • FR ⁇ is not expressed or expressed at very low levels in macrophages in normal tissues and peripheral blood. Mammals include primates including humans, livestock animals such as cows, pigs, horses, goats and sheep, and pet animals such as dogs and cats. A preferred mammal is a human.
  • an “antibody that binds to folate receptor ⁇ (FR ⁇ )” is an antibody that can recognize and bind to the FR ⁇ protein, and as described below, the antibody comprises: It may be an intact antibody or an antibody fragment or a synthetic antibody (eg, recombinant antibody, bispecific antibody, chimeric antibody, humanized antibody) as long as it has binding affinity with interstitial pneumonia-related macrophages Etc.).
  • the complex as an active ingredient of the therapeutic agent of the present invention comprises an antibody that binds to FR ⁇ as a molecular target expressed on the surface of interstitial pneumonia-related macrophages, and the macrophages (and optionally fibrotic cells).
  • cytotoxin or cytotoxic agent that causes cell death.
  • cell death means cell death, killing or damage, and is caused by a cytotoxin or cytotoxic agent.
  • Cytotoxins are proteins called so-called toxins, whereas cytotoxic agents are low molecular weight chemotherapeutic agents, the former include toxins from microorganisms, especially bacteria, whereas the latter , Alkylating agents, antimetabolites, antibiotics, molecular targeted drugs, plant alkaloids, hormonal agents and the like.
  • the complex of the present invention comprises the above antibody and cytotoxin, these components can take the form of a fusion protein.
  • the cytotoxin can be preferably bound to the C-terminus of the antibody protein via a linker (for example, a peptide) as necessary.
  • a linker for example, a peptide
  • these components can be bound by a covalent bond or a non-covalent bond via a functional group for binding.
  • the antibody specifically binds to FR ⁇ of interstitial pneumonia-related macrophages.
  • “specific” means that the antibody binds to FR ⁇ of the macrophage by an immunological reaction, but does not substantially bind to FR ⁇ or a protein other than a protein having 80% or more sequence identity. Means that.
  • the above antibody does not bind to FR ⁇ , which is one of the isoforms of FR (for example, human FR ⁇ has about 70% amino acid sequence identity with human FR ⁇ (Special Table 2008-500025)). It is desirable.
  • the antibody that can be used in the present invention is the whole antibody molecule or a fragment thereof that can bind to the antigen FR ⁇ protein or a partial peptide thereof.
  • the partial peptide has 5 or more, preferably 7 or more, more preferably 8 or more consecutive amino acids.
  • an antigenic epitope or antigenic determinant consists of about 5 to about 10 amino acids and has a continuous amino acid sequence or a discontinuous amino acid sequence.
  • the antibody of the present invention may be a monoclonal antibody, a polyclonal antibody, a human antibody, or an antibody fragment thereof as long as it binds to FR ⁇ , and preferably binds specifically.
  • the antibodies of the present invention may also be of any immunoglobulin (Ig) class (such as IgA, IgG, IgE, IgD, IgM) and subclass (such as IgG1, IgG2, IgG3, IgG4, IgA1, IgA2).
  • the light chain of the immunoglobulin may be either ⁇ or ⁇ .
  • the antibody fragment of the present invention includes, for example, Fab, Fab ′, F (ab ′) 2 , Fv, heavy chain monomer or dimer, light chain monomer or dimer, dimer consisting of one heavy chain and one light chain, and the like.
  • fragment production methods are known in the art, and can be obtained, for example, by digesting antibody molecules with proteases such as papain and pepsin, or by known genetic engineering techniques.
  • the antibodies of the present invention may also be recombinant antibodies, chimeric antibodies, humanized antibodies and the like. Recombinant antibodies include, for example, single chain antibodies (scFv), bispecific antibodies and the like.
  • Bispecific antibodies refer to antibodies having two different binding specificities, and include, for example, diabody, ScDb (single chain diabody), dsFv-dsFv, etc. (Ryutaro Asano, Biochemistry 77 (12) 1497-1500, 2005).
  • a method for producing an antibody for use in the present invention will be described in detail.
  • a protein to be used as an immunogen (antigen) that is, FR ⁇ protein or a partial peptide thereof is first prepared.
  • the partial peptide has a sequence consisting of 5 or more, preferably 7 or more consecutive amino acids.
  • the origin of the FR ⁇ protein that can be used as an immunogen is not particularly limited as long as it can induce an antibody that can specifically bind to the target FR ⁇ .
  • mammals such as humans and mice can be used.
  • An FR ⁇ protein derived from an animal or a partial peptide thereof is used as an immunogen.
  • the human FR ⁇ protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a partial peptide thereof, or the mouse FR ⁇ protein consisting of the amino acid sequence shown in SEQ ID NO: 2 or a partial peptide thereof can be used as the immunogen.
  • the immunogen it is particularly preferable to use human FR ⁇ protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a partial peptide thereof.
  • FR ⁇ protein or a partial peptide thereof can be prepared by a technique known in the art, for example, a solid phase peptide synthesis method, based on the amino acid sequence information (for example, SEQ ID NO: 1) of FR ⁇ .
  • the sequence information of FR ⁇ derived from other mammals including humans is available from, for example, GenBank (NCBI, USA), EMBL (EBI, Europe) and the like.
  • FR ⁇ protein or a partial peptide thereof can be produced using a genetic recombination technique.
  • a DNA sequence encoding FR ⁇ protein is linked to an appropriate protein production vector, introduced into a host so that the target FR ⁇ protein or a partial peptide thereof can be expressed, and FR ⁇ protein or The partial peptide can be produced.
  • This technique is well known to those skilled in the art, and a person skilled in the art can appropriately select the vector, host cell, transformation method, culture method, and target protein purification method employed in this case.
  • gene recombination techniques see, for example, Sambrook et al., Molecular Cloning A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989), Ausubel et al., Current Protocols in Mol. be able to.
  • the antibody of the present invention can be produced using the FR ⁇ protein prepared as described above or a partial peptide thereof as an immunogen.
  • the antibody of the present invention may be produced using an expression vector incorporating a DNA encoding a target FR ⁇ protein or a partial peptide thereof, or a mammalian cell expressing the protein or a partial peptide thereof as an immunogen.
  • the polyclonal antibody of the present invention can be produced by immunizing a mammal such as a rabbit, rat, or mouse with the immunogen prepared as described above to obtain antiserum.
  • the above immunogen is administered intravenously, subcutaneously or intraperitoneally to a mammal together with an adjuvant for enhancing immunogenicity as necessary.
  • the adjuvant commercially available complete Freund's adjuvant, incomplete Freund's adjuvant, aluminum hydroxide, alum, muramyl peptide (a kind of bacterial cell wall-related peptide) and the like can be used. Thereafter, immunization is performed 1 to 7 times at intervals of several days to several weeks, and after 1 to 7 days from the last immunization, the antibody titer is measured by enzyme immunoassay such as ELISA, etc. Blood is collected on the day indicated to obtain antiserum. The antiserum thus obtained may be used as it is, or may be used after being purified once or several times on a column on which FR ⁇ protein or a partial peptide thereof is immobilized.
  • Monoclonal antibodies that can be used in the present invention can be prepared as follows. That is, a hybridoma is prepared from antibody-producing cells (eg, spleen-derived lymphocyte cells, lymphoid cells, etc.) obtained from a mammal immunized as described above and myeloma cells having no autoantibody-producing ability, and the hybridoma is cloned. And a clone that produces a monoclonal antibody exhibiting a specific affinity for the antigen used for immunization can be selected. Such hybridoma production methods are well known in the art, and can be performed, for example, according to the method of Kohler and Milstein et al. (Nature (1975) 256: 495-96).
  • antibody-producing cells eg, spleen-derived lymphocyte cells, lymphoid cells, etc.
  • monoclonal antibodies of the present invention include monoclonal antibodies produced by mouse-mouse hybridoma clone 36b or clone 94b obtained by fusing spleen cells of mice immunized with human FR ⁇ -expressing cells and mouse myeloma cells, etc. Can be mentioned. Further, as another example of the monoclonal antibody of the present invention, rat-rat hybridoma clone CL5 or clone CL10 obtained by fusing spleen cells of runts immunized with mouse FR ⁇ -expressing cells and rat myeloma cells is produced. A monoclonal antibody etc. can be mentioned.
  • the present invention includes a gene encoding an antibody containing an H chain or L chain of a monoclonal antibody produced by the hybridoma produced by the hybridoma as described above.
  • These nucleic acids can be obtained from hybridomas by ordinary genetic engineering techniques, and their base sequences can also be determined by known base sequencing methods.
  • the base sequences of the H chain variable region gene and L chain variable region gene of the monoclonal antibody produced by the mouse-mouse hybridoma clone 36b cell are shown in SEQ ID NOs: 3 and 4, respectively, and the monoclonal product produced by the mouse-mouse hybridoma clone 94b cell
  • the nucleotide sequences of the H chain variable region gene and L chain variable region gene of the antibody are shown in SEQ ID NOs: 5 and 6, respectively.
  • the nucleotide sequences of the H chain variable region gene and L chain variable region gene of the monoclonal antibody produced by rat-rat hybridoma clone CL5 are represented by SEQ ID NOs: 7 and 8, respectively, and rat-rat hybridoma clone CL10 is produced.
  • the nucleotide sequences of the H chain variable region gene and L chain variable region gene of the monoclonal antibody are shown in SEQ ID NOs: 9 and 10, respectively.
  • the present invention relates to the heavy chain variable region genes (for example, SEQ ID NOs: 3, 5, 7, and 9) and L chain variable region genes (for example, SEQ ID NOs: 4, 6, and 8) of monoclonal antibodies produced by the hybridomas prepared as described above.
  • mutants include the following.
  • the term “several” used in the context of the H chain and L chain variable region genes of the present invention refers to 1-20, preferably 1-15, more preferably 1-10.
  • the “substantially identical” used in the context of the heavy chain and light chain variable region genes of the present invention means the heavy chain variable region gene of a monoclonal antibody produced by the hybridoma prepared as described above (for example, SEQ ID NO: 3, 5, 7, 9), light chain variable region genes (eg, SEQ ID NOs: 4, 6, 8, 10) and at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95%, Means having 96%, 97%, 98% or 99% identity.
  • the determination of percent identity between two sequences is described, for example, in Carlin and Altshur as modified in Karlin and Altschul (1993) (Proc. Natl. Acad. Sci. USA 90: 5873-5877). (1990) (Proc. Natl. Acad. Sci. USA 87: 2264). This type of algorithm is described in Altshur et al. (1990) J. MoI. Mol. Biol. 215: 403 incorporated into NBLAST and XBLAST programs.
  • Gapped BLAST may be used.
  • PSI-BLAST can be used to perform an iterated search that detects distant associations between molecules.
  • BLAST, Gapped BLAST, and PSI-BLAST programs the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used (see http://www.ncbi.nlm.nih.gov.). ).
  • Other preferred examples of algorithms that can be used for sequence comparison are, for example, the algorithm of Myers and Miller (1988), CABIOS 4: 11-17.
  • washing conditions include conditions such as continuous washing at room temperature with a solution containing 2 ⁇ SSC and 0.1% SDS, and a 1 ⁇ SSC solution and a 0.2 ⁇ SSC solution.
  • the combinations of the above conditions are exemplary, and those skilled in the art will understand the above or other factors that determine the stringency of hybridization (for example, hybridization probe concentration, length and GC content, hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.
  • “equivalent” means that biological activities such as binding specificity and binding affinity for the FR ⁇ antigen are substantially the same.
  • the term may include a case where the activity is substantially the same, and the term “same quality” as used herein means that the nature of the activity such as specific binding to the FR ⁇ antigen is the same, or physiological A property, pharmacological property, or biological property is the same.
  • stringent conditions in these hybridizations are described in, for example, Sambrook et al. (Above), Ausubel et al. (Above), etc., and these conditions may be used in the present invention.
  • the mutants may be naturally occurring or artificially introduced with mutations. Artificial mutation can be introduced by a conventional method using, for example, site-specific mutagenesis (Proc Natl Acad Sci USA., 1984 81: 5652; Sambrook et al.
  • a recombinant antibody can also be produced using a gene recombination technique.
  • a gene encoding a monoclonal antibody is cloned from the prepared hybridoma, and incorporated into an appropriate vector, which is, for example, a mammalian cell line such as Chinese hamster ovary (CHO) cell, Escherichia coli, yeast cell, insect cell, It can be introduced into a host such as a plant cell to produce a recombinant antibody in the host (PJ Delves., ANTIBODY PROSECTION TECHNIQUE TECHNIQUES., 1997 WILEY, P.
  • CHO Chinese hamster ovary
  • transgenic mice cows, goats, sheep or pigs in which the gene of the target antibody is incorporated into the endogenous gene using transgenic animal production technology are prepared and immunized with the FR ⁇ protein or a partial peptide thereof as an antigen. It is also possible to obtain a large amount of antibody derived from the antibody gene from blood, milk, etc. of the transgenic animal.
  • human antibody-producing animals such as mice and cows lacking the endogenous antibody gene and carrying the human antibody gene are also known, so when using such animals A fully human antibody that binds to human FR ⁇ can be obtained (for example, International Publication WO 96/9634096, WO 96/33735, WO 98/24893, etc.).
  • monoclonal antibodies can also be produced by the method described above.
  • the hybridoma is grown, maintained and stored according to various conditions such as the characteristics of the cell type to be cultured, the purpose of the test research and the culture method, and used to produce a monoclonal antibody in the culture supernatant. It is possible to carry out using any nutrient medium prepared from any known nutrient medium or basal medium.
  • the produced monoclonal antibody is appropriately combined with methods well known in the art, such as chromatography using a protein A or protein G column, ion exchange chromatography, hydrophobic chromatography, ammonium sulfate precipitation, gel filtration, affinity chromatography, etc. Can be purified.
  • the antibodies that can be used in the present invention can also be chimeric antibodies.
  • the chimeric antibody of the present invention is described in, for example, Morrison et al. , 1984, Proc. Natl. Acad. Sci. 81: 6851-6855; Neuberger et al. , 1984, Nature, 312: 604-608; Takeda et al. , 1985, Nature, 314: 452-454.
  • genes from mouse antibody molecules with appropriate antigen specificity are spliced with genes from human antibody molecules with appropriate biological activity.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species.
  • the chimeric antibody examples include an antibody having an H chain and / or L chain variable region of an anti-FR ⁇ mouse or rat monoclonal antibody and an immunoglobulin constant region derived from another mammal.
  • a part of a variable region including a variable region or a hypervariable region derived from, for example, a mouse or rat monoclonal antibody, a human immunoglobulin constant region, or a part of a human immunoglobulin variable region and a constant region,
  • a “humanized antibody” In the case of a humanized antibody, the mouse-derived antibody region is preferably less than about 10%.
  • the humanized antibody is, for example, at least one complementarity determining region (CDR1, 2) in the amino acid sequence of the heavy chain variable region and / or the light chain variable region of an anti-human FR ⁇ mouse monoclonal antibody (or anti-mouse FR ⁇ rat monoclonal antibody). And an amino acid sequence comprising 3). More specifically, the following antibodies can be exemplified.
  • CDR complementarity determining
  • CDR complementarity
  • CDR complementarity determining
  • An amino acid comprising at least one complementarity determining region (CDR) in the amino acid sequence of the light chain variable region encoded by the polynucleotide shown in the following (a), (b), (c) or (d) Antibodies containing sequences: (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 6; (B) a polynucleotide encoding a protein having a biological activity of binding to FR ⁇ , comprising deletion, substitution, addition or insertion of one to several bases in the base sequence shown in SEQ ID NO: 6; (C) a polynucleotide encoding a protein having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6 and binding to FR ⁇ ; (D) A polynucleotide that encodes a protein having a biological activity that hybridizes with the base sequence shown in SEQ ID NO: 6 under stringent conditions and binds to FR ⁇ .
  • CDR complementarity
  • CDR complementarity determining
  • CDR complement
  • CDR complementarity
  • Suitable human acceptor antibody sequences for the mouse donor sequence can be identified by computer comparison of the amino acid sequence of the mouse variable region with the known human antibody heavy or light chain sequences.
  • a variable domain from a human antibody whose framework sequence exhibits high sequence identity with the framework regions of the murine light chain variable region and the heavy chain variable region is Kabat using NCBI BLAST (USA) using the murine framework sequence.
  • an acceptor sequence that shares 80% or more, preferably 90% or more of the sequence identity with the mouse donor sequence can be selected.
  • suitable human acceptor antibody sequences can be identified.
  • a humanized antibody can be cloned and produced by incorporating the DNA encoding the obtained human / mouse chimeric H chain and L chain into an expression vector and transforming it into an appropriate host cell.
  • the chimeric antibody and humanized antibody as described above have an advantage that antigenicity can be reduced when applied to humans.
  • the antibodies of the invention are also described, for example, in US Pat. No. 4,946,778; Bird, 1988, Science 242: 423-426; Huston et al. , 1988, Proc. Natl. Acad. Sci.
  • the single chain antibody of the present invention includes, for example, the heavy chain variable region (eg, SEQ ID NO: 3, 5, 7, 9) and L chain variable region gene (eg, SEQ ID NO: 4, 6, 8, 10) of the monoclonal antibody of the present invention.
  • the H chain fragment and the L chain fragment are respectively prepared according to a conventional method, and the H chain fragment and the L chain fragment of the Fv region are linked by amino acid crosslinking to obtain a single chain polypeptide. can do.
  • Cytotoxins or cytotoxic agents A cytotoxin that can be used in the present invention is any cytotoxin that can be used to induce cell death of interstitial pneumonia-related macrophages, such as Pseudomonas aeruginosa exotoxin, Ricin A chain, deglycosylated ricin A chain, ribosome inactivating protein, alpha-sarcin, gelonin, gelonin aspergillin, strictricin, ribonuclease, epodophyllotoxin Illotoxin), diphtheria toxin and the like.
  • interstitial pneumonia-related macrophages such as Pseudomonas aeruginosa exotoxin, Ricin A chain, deglycosylated ricin A chain, ribosome inactivating protein, alpha-sarcin, gelonin, gelonin aspergillin, strictricin, ribonuclease, epodo
  • the cytotoxic agent that can be used in the present invention can be appropriately selected from alkylating agents, antimetabolites, antibiotics, molecular target drugs, plant alkaloids, hormone agents, and the like.
  • a cytotoxic agent is preferably one that can kill interstitial pneumonia-related macrophages.
  • a cytotoxic agent capable of inducing the death of fibrotic cells can be used.
  • the antibody of the present invention or a partial peptide thereof produced as described above is conjugated with a cytotoxin.
  • the recombinant immunotoxin according to the present invention is a chimeric molecule in which the above-mentioned antibody of the present invention that binds to a target (ie, FR ⁇ protein) is conjugated to a cytotoxin or a subunit thereof.
  • cytotoxins derived from plants and bacteria, cytotoxins of human origin, and synthetic cytotoxins can be used.
  • the conjugate of the antibody of the present invention and cytotoxin can be performed as follows. That is, by utilizing a reactive group (for example, amino group, carboxyl group, hydroxyl group, etc.) in an antibody molecule and contacting the antibody with a cytotoxin having a functional group capable of reacting with the reactive group, the present invention Recombinant immunotoxin can be obtained.
  • a reactive group for example, amino group, carboxyl group, hydroxyl group, etc.
  • the heavy chain variable region genes SEQ ID NOs: 3, 5, 7, 9
  • L chain variable region genes SEQ ID NOs: 4, 6, 8, 10.
  • genetic engineering techniques To produce either a heavy chain fragment or a light chain fragment as a fusion protein with a cytotoxin, together with the other fragment that is not fused with the cytotoxin, via a SH bond, a single chain antibody or a double chain
  • the recombinant protein of the present invention may be produced by forming an antibody.
  • the binding of the H chain fragment and the L chain fragment via the SH bond can be achieved by exposing the mercapto group (-SH group) with a reducing agent such as ⁇ -mercaptoethanol or dithiothreitol and then mixing the two together. it can.
  • a reducing agent such as ⁇ -mercaptoethanol or dithiothreitol
  • An example of the recombinant immunotoxin of the present invention is a recombinant immunotoxin, which is a recombinant immunotoxin of a monoclonal antibody produced by the mouse-mouse hybridoma clone 36b cell or clone 94b and Pseudomonas aeruginosa exotoxin.
  • the mouse-mouse hybridoma clone 36b and the Pseudomonas aeruginosa exotoxin recombinant immunotoxin are, for example, a single chain or a double chain consisting of a heavy chain consisting of the polypeptide shown in SEQ ID NO: 11 and a light chain consisting of the polypeptide shown in SEQ ID NO: 12. This is a chain antibody.
  • a recombinant immunotoxin of a monoclonal antibody produced by the mouse-mouse hybridoma clone 94b and Pseudomonas aeruginosa exotoxin is an H chain composed of the polypeptide shown in SEQ ID NO: 13 and an L chain composed of the polypeptide shown in SEQ ID NO: 14.
  • Single-chain or double-chain antibody is another example of the complex of the present invention.
  • Another example of the complex of the present invention is a conjugate of an antibody that binds to FR ⁇ described above and a cytotoxic agent.
  • a cytotoxic agent can be bound to the constant region of the antibody, preferably the C-terminal side. The binding is the NH of the antibody protein.
  • the complex of the present invention targets FR ⁇ that is specifically expressed in interstitial pneumonia-related macrophages, induces cell death of interstitial pneumonia-related macrophages, and suppresses lung fibrosis (See Example 4 below and FIGS. 2 and 3).
  • the complex of the present invention such as a recombinant immunotoxin, is a complex that can be used for therapeutic purposes such as missile therapy, and has a therapeutic effect on interstitial pneumonia.
  • the complex of the present invention targets FR ⁇ that is specifically highly expressed in interstitial pneumonia, it has the advantage that it has little effect on normal cells and has a low risk of side effects.
  • the complex of the present invention is formulated as a therapeutic agent for interstitial pneumonia containing this as an active ingredient. That is, the therapeutic agent for interstitial pneumonia of the present invention contains a therapeutically effective amount of the complex.
  • therapeutically effective amount refers to the amount that can give a therapeutic effect for a given symptom or usage, and the sex, age, weight, severity of disease of the subject to which the therapeutic agent for interstitial pneumonia is applied It varies depending on various factors such as administration route.
  • a 60 kg adult may contain as a therapeutically effective amount an amount of the complex of the present invention administered in an amount of 200 ⁇ g or more, preferably 500 ⁇ g or more per day.
  • the therapeutic agent for interstitial pneumonia of the present invention includes physiologically acceptable pharmaceutical additives such as diluents, preservatives, solubilizers, emulsifiers, adjuvants, antioxidants in addition to the complex of the present invention. , One or more of isotonic agents, excipients and carriers. It may also be a mixture with other drugs effective for the treatment of interstitial pneumonia.
  • the therapeutic agent for interstitial pneumonia of the present invention can be formulated for oral administration or parenteral administration (ie, intravenous or intramuscular administration) by injection, for example, bolus injection or continuous infusion. Injectable formulations may be presented in unit dosage form, for example in ampoules or multi-dose containers, with the addition of preservatives. Alternatively, the therapeutic agent for interstitial pneumonia of the present invention may be a lyophilized powder for reconstitution before use with a suitable vehicle, such as sterile pyrogen-free water.
  • a suitable vehicle such as sterile pyrogen-free water.
  • the route of administration may be the oral route, as well as intravenous, intramuscular, subcutaneous and intraperitoneal injection.
  • the therapeutic agent for interstitial pneumonia of the present invention may be directly brought into contact with the affected area of the patient.
  • the therapeutic agent for interstitial pneumonia of the present invention may be used for the treatment of any interstitial pneumonia as long as FR ⁇ -expressing macrophages are involved in the pathogenesis thereof, such as idiopathic interstitial pneumonia, It is useful for collagen diseases in which pulmonary fibrosis has been observed, pulmonary fibrosis induced by radiation and drugs during cancer treatment, and the like.
  • the subject to which the therapeutic agent for interstitial pneumonia of the present invention is applied is not particularly limited, and healthy subjects, patients suffering from interstitial pneumonia, patients treating interstitial pneumonia, prevention of interstitial pneumonia Any of the healthy persons who are considering the above may be used.
  • the subject is not limited to a human but may be a mammal other than a human. Examples of mammals other than humans include humans, mice, rats, monkeys, rabbits, dogs, cats and the like. 3. Diagnosis of interstitial pneumonia
  • the antibody or fragment thereof of the present invention described in section 1.1 above may be used to diagnose interstitial pneumonia, for example, the presence or absence of interstitial pneumonia and the risk of having the disease. it can.
  • FR ⁇ derived from the disease in a sample is immunologically analyzed using the antibody of the present invention or a fragment thereof. Detection or measurement.
  • the method of the present invention can be performed based on any technique as long as it is an assay using an antibody (ie, an immunological assay). Therefore, FR ⁇ can be detected using the antibody of the present invention or a fragment thereof as an antibody used in the assay.
  • FR ⁇ can be detected by using immunohistochemical staining, immunoassays such as enzyme immunoassays (ELISA and EIA), immunofluorescence assays, radioimmunoassays (RIA) or Western blotting.
  • the sample to be tested by the method of the present invention is not particularly limited as long as it is a biological sample that may contain FR ⁇ derived from interstitial pneumonia. Examples of samples include cell or organ extracts, tissue sections, lung lavage fluid, biopsy and the like.
  • the abundance of FR ⁇ measured by using the antibody or fragment thereof of the present invention is particularly useful as an indicator of the risk of interstitial pneumonia.
  • the antibodies and fragments thereof described herein can be used to quantitatively or qualitatively detect FR ⁇ .
  • the antibodies (or fragments thereof) of the invention can be further used histologically, for example for in situ detection of FR ⁇ .
  • In situ detection can be performed by removing a histological sample, for example, a paraffin-embedded tissue section (such as a surgical specimen) from a subject and applying the labeled antibody of the present invention thereto.
  • Immunoassays for FR ⁇ typically involve incubating a sample from the subject under investigation in the presence of a detectably labeled antibody of the present invention, and any of a number of techniques well known in the art.
  • detecting bound antibody can be measured according to a well-known method. One skilled in the art can determine effective and optimal assay conditions for each measurement by using routine experimentation.
  • the method of the present invention is preferably used in combination with other interstitial pneumonia diagnostic techniques.
  • FR ⁇ may be expressed on the cell surface of microphages localized in lesion sites such as rheumatoid arthritis and malignant tumors in addition to interstitial pneumonia, it is used in combination with other diagnostic methods.
  • Other interstitial pneumonia diagnostic methods that can be used in the method of the present invention include blood tests, X-rays, joint fluid, pleural effusion, ascites, biopsy, lung lavage fluid, and the like.
  • Example 1 Production of anti-human FR ⁇ mouse monoclonal antibody and anti-mouse FR ⁇ rat monoclonal antibody [Preparation of FR ⁇ -expressing cells as antigen] After extracting total RNA from the rheumatoid arthritis synovium or Balb / c mouse liver using Trizol (GibcoBRL) and cDNA synthesis kit (Invitrogen) according to the attached instructions, cDNA was synthesized using SuperScript plasmid System (Invitrogen) according to the attached instructions. .
  • rheumatoid synovium or Balb / c mouse liver cDNA was separately added to Bioneer PCR premix (Bioneer), and the sense was adjusted to 10 pmol (human rheumatoid synovium: agaagagacatgggtctggaatggatg (SEQ ID NO: 15); mouse Liver: tctagaaaagacatggcctggaaaagag (SEQ ID NO: 16)) and antisense primer (human rheumatoid synovium: gactgaactcaggcaaggaccccagagtt (SEQ ID NO: 17); mouse liver: cccacaactggatagagact (58 ° C, sec.
  • the amplified FR ⁇ gene PCR product was ligated to the plasmid PCR2.1-TOPO (Invitrogen). That is, 1 ⁇ L of NaCl solution, 1.5 ⁇ l of sterile distilled water and 1 ⁇ L of vector plasmid (PCR2.1-TOPO) were added to 2.5 ⁇ l of PCR product and incubated at room temperature for 5 minutes, 2 ⁇ L of which was transferred to E. coli (TOP10F ′). In addition, after 30 minutes of reaction in ice, the mixture was heat-treated at 42 ° C.
  • the site is excised, and the extraction of the gene product is performed using the Qiagen PCR purification kit. Purified with (Qiagen). Next, it is mixed with the vector for mammalian cell expression pER-BOS (Mizushima et al. PEF-BOS, a powerful mammalian expression vector. Nucleic Acid Res. 1990; 18 (17): 5322) that has been subjected to EcoRI treatment in advance, and s4g. Ligation was performed using (Roshe). Gene transfer of the ligation product into E. coli (TOP10F ') and confirmation of the FR ⁇ gene were performed in the same manner as described above.
  • a vector containing human FR ⁇ was introduced into mouse B300-19 cells, and a vector containing mouse FR ⁇ was introduced into rat RBL2H3 cells. That is, 1x10 in advance 5 1 ⁇ g of FR ⁇ vector mixed with 20 ⁇ L of Lipofectamine (GibcoBRL) was added to each of the prepared cells for gene transfer. Since the transfected B300-19 mouse cells and rat RBL2H3 cells acquire resistance to the antibiotic G418, the transfected cells were selectively cultured in a medium containing G418 at a concentration of 1 mg / mL. Confirmation of the introduction of the FR ⁇ gene into the transfected cells was performed by PCR.
  • 1x10 7 Sense human rheumatoid synovium: agaagacatgggtctgagaatggagtg (SEQ ID NO: 15); mouse liver: tctagaaaagacatgaggaggagggaggaggaggaggagggaggagggaggagggagggagggagtgaccgagtgaccgagggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggaggagg
  • an anti-sense primer human rheumatoid synovium: gactgaactcaggccagagggaggccagagtt (SEQ ID NO: 17); mouse liver: cccacaactggataggaact (SEQ ID NO: 18)
  • Bioneer PCR premix Bioneer
  • FR ⁇ -expressing mouse B300-19 cells or rat RBL2H3 cells 1 ⁇ 10 7
  • the mixture was mixed with Freund's complete adjuvant, and immunized intraperitoneally at three locations in the tail of Balb / C mice (for anti-human FR ⁇ monoclonal antibody) or Whister Kyoto rats (for anti-mouse FR ⁇ monoclonal antibody). This immunization was repeated 2 to 4 times.
  • Monoclonal antibodies were prepared according to the method of Koler (Kohler & Milstein, Nature (1975) 256: 495-96).
  • spleen or iliac lymph nodes were taken out and dissociated into single cells.
  • the dissociated cells are fused with myeloma-derived cells (NS-1) to prepare hybridomas, cultured in a HAT selective medium, and the antibody secreted in the culture supernatant is compared with the FR ⁇ -expressing cells. Sorting was performed by reactivity.
  • the obtained hybridoma was cloned by limiting dilution culture adjusted to 1 cell per well of a 96-well plate. Cloned cells were selected based on reactivity with FR ⁇ -expressing cells.
  • 1x10 cloned hybridomas 7 The ascites was adjusted by administration into nude mice, and the monoclonal antibody was purified with Protein G column (GE Bioscience). The isotype of purified mouse and rat monoclonal antibodies was determined using an isotyping ELISA kit (Pharmingen). As a result, two IgG2a type clone 36b and IgG1 type 94b were obtained as anti-human FR ⁇ mouse monoclonal antibodies, and two IgG2a type CL5 and CL10 were obtained as anti-mouse FR ⁇ rat monoclonal antibodies. The reactivity of each antibody to the antigen was analyzed by flow cytometry.
  • VH and VL heavy chain gene variable region (VH) and light chain gene variable region (VL) genes of anti-human FR ⁇ mouse monoclonal antibody and anti-mouse FR ⁇ rat monoclonal antibody
  • VH and VL genes were determined by PCR using Ig-Prime Kit. PCR conditions were performed according to the attached instructions. That is, PCR was performed at 94 ° C. for 60 seconds, 50 ° C. for 60 seconds, and 72 ° C. for 120 seconds, and then reacted at 72 ° C.
  • VH and VL PCR products were ligated into plasmid PCR2.1-TOPO (Invitrogen) and introduced into E. coli (TOP10F ').
  • the plasmid was purified from the introduced E. coli, and the VH and VL base sequences of 36b and 94b were determined.
  • the nucleotide sequence was subjected to PCR using BigDye Terminator V3.1 cycle sequencing kit (ABI), and the PCR product was analyzed with ABI310 DNA sequencer.
  • Rat hybridoma clones CL5 and CL10 are 1x10 7 Each was individually prepared, and cDNA was synthesized with cDNA synthesis kit (Invitrogen).
  • VH and VL genes were amplified by PCR using Ig-Prime Kit and a primer designed for rat VH amplification (caccatggagtttattttgag (SEQ ID NO: 19)).
  • Amplified VH and VL PCR products were ligated into plasmid PCR2.1-TOPO (Invitrogen) and introduced into E. coli (TOP10F ').
  • TOP10F ' E. coli
  • the plasmid was purified from E. coli and the nucleotide sequences of VH and VL were determined. The nucleotide sequence was subjected to PCR using BigDye Terminator V3.1 cycle sequencing kit (ABI) and analyzed with ABI 310 DNA sequencer.
  • Example 2 Immunohistochemical detection of FR ⁇ positive macrophages in human interstitial pneumonia and mouse bleomycin interstitial pneumonia models
  • Immunohistochemical staining of human interstitial pneumonia tissue A paraffin-embedded block of human idiopathic interstitial pneumonia tissue fixed with formalin was sliced at 2 ⁇ m to prepare a tissue specimen. The obtained specimen was washed with paraffin with xylene and ethanol, further immersed in an antigen recovery solution (Diva Decloker, Biocare Medical Inc.), and treated at 121 ° C. for 15 minutes. The specimen after antigen recovery was subjected to blocking of nonspecific adsorption of immunohistochemical staining with 10% human serum containing 3% bovine serum albumin.
  • an anti-human FR ⁇ mouse monoclonal antibody (94b) or an anti-human CD68 mouse monoclonal antibody (clone name: PG-M1, Dako Japan) adjusted to 5 to 10 ⁇ g / mL was used and reacted at room temperature for 1 hour.
  • the mixture was washed with a phosphate buffer, and a secondary antibody reaction (anti-mouse IgG, MAX-PO, Nichirei) was performed.
  • washing was performed with an excess amount of phosphate buffer, and FR ⁇ positive cells were developed using NOVA RED (Vector).
  • the obtained specimen was fixed with acetone and then washed with pure water to remove the compound. After washing, the endogenous peroxidase was inactivated with 0.3% hydrogen peroxide, and then the next antibody reaction was pretreated with 10% normal mouse serum containing 5% bovine serum albumin. It was.
  • an anti-mouse FR ⁇ rat monoclonal antibody (CL10 or CL5) adjusted to 5-10 ⁇ g / mL was used and reacted at room temperature for 1 hour. After completion of the reaction, the mixture was washed with a phosphate buffer, and a secondary antibody reaction (MAX-PO for mouse tissue, Nichirei) was performed.
  • Example 3 Production of recombinant immunotoxins [Introduction of cysteine mutation into immunoglobulin heavy chain gene variable region (VH)]
  • a primer designed to mutate the 63rd amino acid glycine (base sequence ggc) of the immunoglobulin heavy chain gene variable region (VH) of the anti-human FR ⁇ mouse monoclonal antibody 94b to cysteine (base sequence tgt) was prepared (sense: Cagaggcctgaactattgtctggagtggattggaag (SEQ ID NO: 20), antisense: cttccatccactccactacgtgtcggccctctg (SEQ ID NO: 21)), and quick change Mutagenesis treatment was performed.
  • the DNA after the reaction was introduced into E. coli XL1-Blue and selectively cultured in an LB medium containing 0.1 mg / mL ampicillin.
  • the plasmid of the selected transformant was purified by QIAprep spin Miniprep KIT (Qiagen). Further, the base sequence was determined with Big Dye Terminator v3.1 cycle sequencing kit (ABI) and ABI310 sequencer, and it was confirmed that the 63rd glycine was mutated to cysteine (base sequence tgt).
  • Each annealing primer has NdeI, which is a restriction enzyme. By cloning at this site, a protein having atg as a start codon can be expressed. In addition, a HindIII site is inserted into the other annealing primer, and by cloning at this site, it is possible to express a fusion protein in which the VH and PE genes are bound.
  • PCR of pCR2.1-TOPO-94bVH and pCR2.1-TOPO-CL10VH plasmids into which mutations were introduced using a combination of these primers and pfu DNA polymerase (Stratagene) was performed. In this reaction, PCR was performed at 94 ° C. for 20 seconds, 55 ° C.
  • the PCR product is purified, the restriction enzymes NdeI (New England Biolabs) and HindIII (New England Biolabs) are added to the purified product, the reaction is performed, the gel is developed using QIAquick gel extraction kit (Qiagen).
  • the DNA of the desired size was recovered from.
  • pRK79PE38 treated with the same restriction enzyme as that of the mutation-introduced VH treated with the restriction enzyme was added, and ligation reaction between VH and pRK79PE38 was performed using Ligation High (Toyobo). After completion of the ligation reaction, the gene was introduced into E.
  • the plasmid pRK79-VHPE of the selected transformant was purified by QIAprep spin Miniprep KIT (Qiagen). Furthermore, the base sequence was determined with the Big Dye Terminator v3.1 cycle sequencing kit (ABI) and the ABI310 sequencer, and it was confirmed that the base sequence of the mutagenized VH was linked to the PE38 base sequence of the pRK79 vector.
  • a primer designed to mutate the 125th amino acid of the immunoglobulin light chain gene variable region (VL) of the anti-human FR ⁇ mouse monoclonal antibody 94b to cysteine (base sequence tgt) was prepared (sense: taagaaggagataatacatatgcattgtggtcacatac (SEQ ID NO: 28).
  • PCR of pCR2.1-TOPO-94bVL plasmid was performed using a combination of these primers and pfu DNA polymerase (Stratagene). In this reaction, PCR was performed at 94 ° C. for 20 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 60 seconds, and then reacted at 72 ° C. for 5 minutes. Next, the PCR product is purified, the restriction enzymes NdeI (New England Biolabs) and EcoRI (New England Biolabs) are added to the purified product, the reaction is performed, and the gel is developed using QIAquick gel extraction kit (Qiagen). The DNA of the desired size was recovered from.
  • NdeI New England Biolabs
  • EcoRI New England Biolabs
  • pRK79PE38 treated with the same restriction enzyme as that of the mutation-introduced VL treated with the restriction enzyme was added, and ligation reaction between VH and pRK79PE38 was performed using Ligation High (Toyobo).
  • the gene was introduced into E. coli TOP10F '(Invitrogen), and transformants were selected on an LB medium containing 0.1 mg / mL ampicillin.
  • the plasmid pRK79-VLPE of the selected transformant was purified by QIAprep spin Miniprep KIT (Qiagen).
  • the base sequence was determined with the Big Dye Terminator v3.1 cycle sequencing kit (ABI) and the ABI310 sequencer, and the 125 amino acids of the mutagenesis VL were mutated to cysteine, and the start codon tag was placed. confirmed.
  • the plasmids pRK79-94bVHPE and pRK79-CL10VHPE incorporating the mutation-introduced VH and the plasmids pRK79-VL94b and pRK79-VLCL10 incorporating the mutation-introduced VL were adjusted to 50 ng and introduced into E. coli BL21 (DE3) for protein expression. Selection of E.
  • coli into which the gene was introduced was carried out by culturing at 37 ° C. for 15 to 18 hours in an LB medium containing 0.1 mg / mL ampicillin. After completion of the selection, Escherichia coli was cultured in 1000 mL of super broth medium at 37 ° C. until reaching 1.0 to 1.5 at a visible absorbance of 600 nm. After culturing, IPTG (isopropyl-beta-D-thio-galactopyranoside) was added to the medium to a final concentration of 1 mM, and further cultured at 37 ° C. for 90 minutes.
  • IPTG isopropyl-beta-D-thio-galactopyranoside
  • Escherichia coli was recovered by centrifugation, and suspended in 200 mL using 50 mM Tris buffer (pH 7.4, containing 20 mM EDTA). After the suspension, egg white lysozyme was added to a final concentration of 0.2 mg / mL and reacted at room temperature for 1 hour to destroy E. coli. After destruction, the precipitate was collected by centrifugation at 20,000 ⁇ g.
  • the precipitate was further suspended in 50 mM Tris buffer (pH 7.4, containing 2.5% Triton X-100, 0.5 M NaCl, 20 mM EDTA) to 200 mL, and the egg white lysozyme was added to a final concentration of 0.2 mg / mL. And allowed to react at room temperature for 1 hour. After completion of the reaction, the mixture was centrifuged at 20,000 ⁇ g to collect the precipitate. The precipitate was further suspended in 200 mM with 50 mM Tris buffer (pH 7.4, containing 2.5% Triton X-100, 0.5 M NaCl, 20 mM EDTA), mixed well, and centrifuged at 20,000 ⁇ g.
  • 50 mM Tris buffer pH 7.4, containing 2.5% Triton X-100, 0.5 M NaCl, 20 mM EDTA
  • VHPE 0.5 mL of VHPE and 0.25 mL of VL were mixed, dithiothreitol (DTT) was added to a final concentration of 10 mg / mL, and reduction treatment was performed at room temperature for 4 hours. After the treatment, it was dissolved in 75 mL of 0.1 M Tris buffer (containing pH 8.0, 0.5 M arginine, 0.9 mM oxidized glutathione, 2 mM EDTA). By leaving this solution at 10 ° C. for 40 hours, VH and VL were combined.
  • DTT dithiothreitol
  • the solution was concentrated to 5 mL using a centrifugal concentrator (Centricon 10, Amicon) having a molecular weight of 10,000, and further diluted with 50 mL of Tris buffer (containing pH 7.4, 0.1 M urea, 1 mM EDTA).
  • Tris buffer containing pH 7.4, 0.1 M urea, 1 mM EDTA.
  • This diluted solution was used as a starting material for purification of recombinant immunotoxin.
  • Tris buffer containing pH 7.4, 0.1 M urea, 1 mM EDTA
  • the adsorbed recombinant type immunotoxin was eluted with Tris buffer (pH 7.4, containing 0.3 M NaCl, 1 mM EDTA).
  • Tris buffer pH 7.4, 1 mM EDTA
  • POROS ion exchange column
  • TSK300SW Tosoh gel filtration chromatography.
  • endotoxin in the TSK300SW column was removed by washing with 75% disinfecting ethanol for 48 hours.
  • it was washed with distilled water for injection in Japanese Pharmacopoeia, and then the TSK300SW column was equilibrated with Japanese Pharmacopoeia physiological saline.
  • recombinant type immunotoxin was administered, and the eluate from the column was collected at a flow rate of 0.25 mL / min.
  • SDS-PAGE polyacrylamide electrophoresis containing sodium dodecyl sulfate
  • SDS-PAGE polyacrylamide electrophoresis containing sodium dodecyl sulfate
  • SDS sodium dodecyl sulfate
  • SDS sodium dodecyl sulfate
  • An aqueous solution containing 130 mM glycine and 25 mM Tris was used. Each sample was adjusted with 100 mM Tris buffer pH 6.5 containing SDS at a final concentration of 0.1%, and boiled for 5 minutes.
  • Example 4 Verification of therapeutic effect of interstitial pneumonia by recombinant immunotoxin C57BL / 6J male mice were subjected to exhalation anesthesia at 8-12 weeks of age, and bleomycin adjusted to 4.5 Unit / kg / 0.1 mL was administered intratracheally to produce an interstitial pneumonia model.
  • the recombinant immunotoxin prepared in Example 3 was used (immunotoxin administration group), and as a control, a placebo that lacked the binding property to FR ⁇ (PE38 and anti-mouse FR ⁇ rat monoclonal antibody CL10). Of VH) (placebo-administered group). Fifteen mice were assigned to each of the immunotoxin administration group and the placebo administration group. Recombinant immunotoxin equivalent to 3 ⁇ g or placebo was administered intranasally at intervals of 2 days from day 3 to day 15 after bleomycin administration.
  • FIG. 3 shows an example of the results of immunohistochemical staining of lung tissues of the immunotoxin administration group and the placebo administration group.
  • Example 5 Validation of the effects of recombinant immunotoxins on the frequency of tumor necrosis factor (TNF) - ⁇ , CC chemokine ligand (CCL) 2 and CCL12 producing cells in the lungs of mice with bleomycin-induced pulmonary fibrosis It is known that cytokines such as TNF- ⁇ , CCL2, and CCL12 produced by macrophages show fibrotic activity.
  • TNF tumor necrosis factor
  • CCL chemokine ligand
  • a placebo that lacks the binding property to FR ⁇ (a fusion protein of PE38 and VH of anti-mouse FR ⁇ rat monoclonal antibody CL10) was used (placebo administration group).
  • Recombinant immunotoxin equivalent to 3 ⁇ g or placebo was administered intranasally at intervals of 2 days from day 3 to day 15 after bleomycin administration.
  • the mice were euthanized, both lungs were excised to prepare frozen tissue specimens, and histochemical analysis was performed in the same manner as in Example 2 above.
  • TNF- ⁇ , CCL2 or CCL12-producing cells were counted using NIS-Elements image analysis software (Nikon). The results are shown in FIG. In FIG. 4, the upper figure shows TNF- ⁇ producing cells (panels A, D and G, respectively) and CCL2 producing cells (panels, respectively) in healthy mice (normal), placebo-administered group and immunotoxin-administered group.
  • a therapeutic agent for interstitial pneumonia with a reduced risk of side effects is provided.
  • the therapeutic agent for interstitial pneumonia of the present invention can bring about the therapeutic effect of interstitial pneumonia by selectively inducing cell death or cytotoxicity of FR ⁇ -expressing macrophages involved in lung fibrosis. All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pulmonology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention porte sur un nouvel agent thérapeutique pour la pneumonie interstitielle, réduisant le risque d'effets secondaires néfastes. L'invention porte spécifiquement sur un agent thérapeutique pour la pneumonie interstitielle comprenant, en tant qu'ingrédient actif, un complexe produit par conjugaison d'un anticorps capable de se lier au récepteur β du folate (FRβ) avec une cytotoxine ou un agent cytotoxique.
PCT/JP2010/053591 2009-02-27 2010-02-26 Agent thérapeutique pour pneumonie interstitielle WO2010098503A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2011501697A JP5544626B2 (ja) 2009-02-27 2010-02-26 間質性肺炎治療剤

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2009-046826 2009-02-27
JP2009046826 2009-02-27

Publications (1)

Publication Number Publication Date
WO2010098503A1 true WO2010098503A1 (fr) 2010-09-02

Family

ID=42665697

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/053591 WO2010098503A1 (fr) 2009-02-27 2010-02-26 Agent thérapeutique pour pneumonie interstitielle

Country Status (2)

Country Link
JP (1) JP5544626B2 (fr)
WO (1) WO2010098503A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012063955A1 (fr) * 2010-11-08 2012-05-18 国立大学法人鹿児島大学 Agent thérapeutique destiné à l'artériosclérose ou à des troubles artérioscléreux et agent de diagnostic de l'artériosclérose ou de troubles artérioscléreux
WO2013027658A1 (fr) * 2011-08-22 2013-02-28 国立大学法人鹿児島大学 Suppresseur de destruction de cartilage/os
EP2687231A1 (fr) * 2011-03-18 2014-01-22 Kagoshima University Composition pour le traitement et le diagnostic du cancer du pancréas
WO2014142356A1 (fr) * 2013-03-15 2014-09-18 国立大学法人鹿児島大学 Agent thérapeutique pour la sclérodermie

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005103250A1 (fr) * 2004-04-26 2005-11-03 Takami Matsuyama MÉDICAMENT THÉRAPEUTIQUE CONTENANT UN ANTICORPS MONOCLONAL ANTI RÉCEPTEUR BÉTA DE FOLATE (FR-β)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102382088A (zh) * 2004-06-28 2012-03-21 因赛特公司 作为趋化因子受体调节剂的3-氨基环戊烷甲酰胺类

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005103250A1 (fr) * 2004-04-26 2005-11-03 Takami Matsuyama MÉDICAMENT THÉRAPEUTIQUE CONTENANT UN ANTICORPS MONOCLONAL ANTI RÉCEPTEUR BÉTA DE FOLATE (FR-β)

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
MICHIO DAIKOKU ET AL.: "Ko Allergy Zai, Tranilast no Hai Sen'isho ni Taisuru Yokusei Sayo", GIFU DAIGAKU IGAKUBU KIYO, vol. 40, no. 6, 1992, pages 816 - 830 *
R. NAGAYOSHI ET AL.: "Effectiveness of Anti-Folate Receptor Antibody Conjugated With Truncated Pseudomonas Exotoxin in the Targeting of Rheumatoid Arthritis Synovial Macrophages", ARTHRITIS & RHEUMATISM, vol. 52, no. 9, 2005, pages 2666 - 2675 *
T. NAGAI ET AL.: "In Vitro and In Vivo Efficacy of a Recombinant Immunotoxin Against Folate Receptor beta on the Activation and Proliferation of Rheumatoid Arthritis Synovial Cells", ARTHRITIS & RHEUMATISM, vol. 54, no. 10, 2006, pages 3126 - 3134 *
T. NAGAI ET AL.: "Yosan Juyotai Beta Yosei Macrophage o Hyoteki to shita Immune toxin no Bleomycin Yuhatsu Mouse Hai Sen'isho ni Taisuru Chiryo Koka no Kento", JAPANESE SOCIETY FOR IMMUNOLOGY SOKAI. GAKUJUTSU SHUKAI KIROKU, vol. 39, 10 November 2009 (2009-11-10), pages 209 - 3-F-W53-1-O/P *
W. XIA ET AL.: "A functional folate receptor is induced during macrophage activation and can be used to target drugs to activated macrophages", BLOOD, vol. 113, no. 2, 8 January 2009 (2009-01-08), pages 438 - 446 *
X. Y. ZHANG ET AL.: "Antisense Oligonucleotides to NF-kB Improve Survival in Bleomycin-induced Pneumopathy of the Mouse", AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE, vol. 162, 2000, pages 1561 - 1568 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012063955A1 (fr) * 2010-11-08 2012-05-18 国立大学法人鹿児島大学 Agent thérapeutique destiné à l'artériosclérose ou à des troubles artérioscléreux et agent de diagnostic de l'artériosclérose ou de troubles artérioscléreux
JP5896568B2 (ja) * 2010-11-08 2016-03-30 国立大学法人 鹿児島大学 動脈硬化又は動脈硬化性疾患の治療剤、及び動脈硬化又は動脈硬化性疾患の診断薬
EP2687231A1 (fr) * 2011-03-18 2014-01-22 Kagoshima University Composition pour le traitement et le diagnostic du cancer du pancréas
EP2687231A4 (fr) * 2011-03-18 2014-10-22 Univ Kagoshima Composition pour le traitement et le diagnostic du cancer du pancréas
WO2013027658A1 (fr) * 2011-08-22 2013-02-28 国立大学法人鹿児島大学 Suppresseur de destruction de cartilage/os
WO2014142356A1 (fr) * 2013-03-15 2014-09-18 国立大学法人鹿児島大学 Agent thérapeutique pour la sclérodermie

Also Published As

Publication number Publication date
JPWO2010098503A1 (ja) 2012-09-06
JP5544626B2 (ja) 2014-07-09

Similar Documents

Publication Publication Date Title
US11845792B2 (en) Epitope specific antibodies that bind cell surface GRP78 and their use for cancer detection
CN109152798B (zh) 特异于糖基化的pd-1的抗体及其使用方法
US9447180B2 (en) Methods of treating a tauopathy
JP6326137B2 (ja) 抗ｈｅｒ２抗体及びその結合体
JP6233933B2 (ja) 葉酸リセプターα及びβを認識する抗体
KR20200079561A (ko) Ror1 암을 치료하고 전이를 저해하는데 이용을 위한 항체와 백신
JP2007306933A (ja) 特異的結合タンパク質およびその使用
TWI745670B (zh) 抗cd27抗體、其抗原結合片段及其醫藥用途
US20160017034A1 (en) Composition for treatment and diagnosis of pancreatic cancer
JP5544626B2 (ja) 間質性肺炎治療剤
CN112794911B (zh) 人源化抗叶酸受体1抗体及其应用
CN113045659B (zh) 抗cd73人源化抗体
CN110606892B (zh) 一种高亲和力高生物活性的lag-3抗体及其应用
JP2010077026A (ja) がん関連マクロファージを標的とした固形がん治療剤
US20220275077A1 (en) Il-38-specific antibodies
JP5896568B2 (ja) 動脈硬化又は動脈硬化性疾患の治療剤、及び動脈硬化又は動脈硬化性疾患の診断薬
WO2014142356A1 (fr) Agent thérapeutique pour la sclérodermie
AU2022246948A9 (en) Il-38-specific antibodies
CN116209765A (zh) 经修饰抗体及其制备方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10746373

Country of ref document: EP

Kind code of ref document: A1

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2011501697

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10746373

Country of ref document: EP

Kind code of ref document: A1