WO2014061914A1 - 전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신 - Google Patents

전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신 Download PDF

Info

Publication number
WO2014061914A1
WO2014061914A1 PCT/KR2013/007944 KR2013007944W WO2014061914A1 WO 2014061914 A1 WO2014061914 A1 WO 2014061914A1 KR 2013007944 W KR2013007944 W KR 2013007944W WO 2014061914 A1 WO2014061914 A1 WO 2014061914A1
Authority
WO
WIPO (PCT)
Prior art keywords
vaccine
virus
infectious bronchitis
ibv
bronchitis virus
Prior art date
Application number
PCT/KR2013/007944
Other languages
English (en)
French (fr)
Inventor
송창선
이중복
임태현
최인수
박승용
Original Assignee
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 건국대학교 산학협력단 filed Critical 건국대학교 산학협력단
Priority to KR1020157009648A priority Critical patent/KR101757752B1/ko
Publication of WO2014061914A1 publication Critical patent/WO2014061914A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5252—Virus inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to infectious bronchitis virus K40 / 09 strain and infectious bronchitis vaccine using same, and more particularly to infectious bronchitis virus K40 / 09 strain isolated from domestic field farms and infectious bronchitis vaccine using the same.
  • IB Infectious bronchitis
  • IBV IB virus
  • IB does not have a high mortality rate when infected, but has a high morbidity rate and causes a wide variety of productivity declines such as coughing, runny nose, lowering of birth rate, lowering of egg laying rate with poor external and internal dizziness, as well as chronic mortality due to respiratory sequelae accompanied by coliform Causing huge economic damage to the poultry industry worldwide.
  • IBV is an RNA virus belonging to the corona virus, similar to the influenza virus, and has a characteristic of easily changing the gene constituting the virus particle. Therefore, a wide variety of IBV serotypes have been reported and reported worldwide, and it is estimated that there will be dozens of species including the mutated mutant virus in each serotype. As with various serotypes, virus-sensitive organs and pathogenics vary as well as different serotypes by region and country. And these serotypes are not well cross-reaction or cross-immunity is accompanied with a lot of difficulties in the prevention and control of the disease.
  • IB which is currently in vogue in Korea, is accompanied by respiratory type IB and respiratory tract, which mainly cause severe respiratory and spawning depression, but can be classified into two types, nephritis and renal type IB with more severe spawning depression.
  • the first IB in Korea was reported in 1986, and the virus was continuously invaded until the late 1990s, and it can be effectively controlled by live and deadly poisoned oil vaccines made with Massachusetts type IBV (H120, Ma5). It was. At the time, the damage caused by IB infection was mainly caused by respiratory symptoms and spawning damage accompanied by malformed eggs.However, since 1990, various cases of spawning losses have been reported in laying hens and breeders despite the nationwide use of vaccines. In the growing chicks, about 10% mortality, along with severe depression, uterine inversion, diarrhea, urinary acid deposition, and nephritis have been reported, causing severe local damage.
  • Kidney-type IB-deck oil vaccines are effective in preventing spawning caused by renal IB infection, a major domestic epidemic strain, and have also been effective in preventing spawning caused by respiratory type IB infection.
  • kidney IBV QXIBV strain
  • cross-immunity was low, and the incidence of reaching the spawning peak was increased even after inoculation with the dead venom vaccine prepared with domestic kidney IBV strain (KM91 strain).
  • KM91 strain domestic kidney IBV strain
  • Korean Patent Publication No. 1020120006164 relates to Newcastle disease virus vaccine and Newcastle disease virus vaccine including the same, which can prevent ND (Newcastle disease), a malignant infectious disease of chicken, and more particularly from domestic poultry ducks.
  • ND Newcastle disease
  • Phylogenetic analysis based on the isolated and nucleic acid sequencing of the virus F protein describes Newcastle disease virus vaccines belonging to genotype d (Id) of genotype I of class 1 and Newcastle disease virus vaccines comprising the same And
  • Korean Patent Publication No. 1020120024493 relates to Newcastle Disease Virus and a vaccine for Newcastle Disease Virus comprising the same, and specifically, an amino acid having a gene of at least 96% homology with the amino acid sequence shown in SEQ ID NO: 1
  • Description of the present invention relates to a Newcastle disease virus and a vaccine comprising the same, an antibody specifically recognizing the same, a composition for diagnosing Newcastle disease virus comprising the antibody, and a method and kit for providing information regarding the diagnosis of Newcastle disease virus. It is.
  • the present invention has been made in view of the above necessity, and an object of the present invention is to provide an IBV outdoor isolate for the production of an effective vaccine against various types of mutant IBV that is popular in Korea.
  • Another object of the present invention is to attenuate the pathogenicity of the IBV outdoor isolate, to provide an IBV apothecary for the production of an effective vaccine against IBV.
  • Another object of the present invention is to provide an effective vaccine against IBV using the IBV outdoor isolate and attenuated strain.
  • the present invention provides infectious bronchitis virus K40 / 09 strain deposited with accession number KCTC 11937BP.
  • the virus of the present invention was deposited on May 23, 2011 with accession number KCTC 11937BP to the Korea Institute of Bioscience and Biotechnology, Yuseong-gu, Daejeon, Korea.
  • the virus is preferably an infectious bronchitis virus isolated from domestic poultry, but is not limited thereto.
  • the isolation method of the virus of the present invention can be isolated from diseased algae, in particular from the respiratory tract of poultry or excreta excreted by such algae. It should not be excluded that other organs may be used as starting materials for the isolation of the virus of the invention.
  • the present invention provides a vaccine for protecting poultry against clinical symptoms caused by infectious bronchitis virus infection, comprising the infectious bronchitis virus of the present invention and a pharmaceutically acceptable carrier or diluent.
  • Infectious bronchitis virus of the present invention may be included in a vaccine in an inactivated form. If the infectious bronchitis virus is in an inactivated form, the nature of the infectious bronchitis virus causing the above-mentioned diseases is completely lost.
  • Vaccines of the invention can be prepared according to conventional methods commonly used, for example, for commercially inactivated infectious bronchitis virus vaccines. Preparation of veterinary vaccine compositions is particularly described in "Handbunch der Schutzimpfungen in der Tier Kunststofftechnik” (ed. Mays, A. et al., Verlag Paul Parey, Berlin und Hamburg, Germany, 1984) and "Vaccines or Veterinary Applications” (ed. Peters, AR). Et al., Butterworth-Heinemann Ltd, 1993 .
  • the substrate susceptible to infection is inoculated with the infectious bronchitis virus of the present invention in a live form and propagated until the virus replicates at a predetermined infectious titer or antigen content (mass).
  • the infectious bronchitis virus bearing the substance can then be harvested and formulated into a pharmaceutical composition with prophylactic activity.
  • All substrates that can be used for replication of the infectious bronchitis virus as defined above can be used to produce a vaccine according to the invention if necessary after the infectious bronchitis virus adapts to the substrate.
  • the infectious bronchitis virus material may be collected by conventional methods.
  • the present invention also provides a vaccine comprising an infectious bronchitis virus in an inactivated form against an infectious bronchitis infection.
  • the main advantage of inactivated vaccines is that long levels of high levels of protective antibodies persist. This property makes inactivated vaccines particularly suitable for breeder vaccination.
  • the purpose of inactivating the harvested virus after the propagation step is to prevent the regeneration of the virus. In general, this can be done by chemical or physical means. Chemical inactivation can be performed, for example, by treating the virus with enzymes, formaldehyde, ⁇ -propiolactone, ethylene-imine or derivatives thereof. If necessary, the deactivated compound is later neutralized. Formaldehyde inactivated material may be neutralized with, for example, thiosulfate. Physical inactivation may preferably be carried out by irradiating the virus with sufficient energy, for example UV light. If necessary, the pH can be adjusted to a value of about 7 after treatment .
  • Vaccines containing the inactivated infectious bronchitis virus may comprise one or more of the aforementioned pharmaceutically acceptable carriers or diluents suitable for this purpose, for example.
  • the inactivated vaccine of the present invention comprises one or more compounds with adjuvant activity.
  • Suitable compounds or compositions for this purpose include vegetable oils such as aluminum hydroxide, -phosphate, -oxide, mineral oil, vitamin E acetate, and oil-in-water or water-in-oil emulsions based on saponins.
  • Inactivated vaccines are usually administered parenterally, ie intramuscularly or subcutaneously.
  • the vaccine of the present invention comprises, as an active ingredient, an infectious bronchitis virus in an effective amount, that is, in an amount that immunizes an infectious bronchitis virus substance that will induce immunity in an vaccinated bird or their offspring against an attack by an toxic virus (antigen administration).
  • an infectious bronchitis virus in an effective amount, that is, in an amount that immunizes an infectious bronchitis virus substance that will induce immunity in an vaccinated bird or their offspring against an attack by an toxic virus (antigen administration).
  • Immunity is defined herein to induce a significantly higher level of protection in avian populations after vaccination compared to the non-vaccinated group.
  • the inactivated vaccine of the present invention can be administered with an antigen equivalent to a dose of 10 4 -10 10 TCID 50 per bird.
  • the infectious bronchitis virus vaccine of the present invention can be used effectively in chickens, but other poultry such as turkey, guinea fowl and quail can also be vaccinated effectively.
  • Chickens include edible chickens, cloned cattle, and laying eggs.
  • the age of the animals receiving the live or inactivated vaccine according to the present invention is the same as the age of the animals receiving the commercially available inactivated infectious bronchitis virus vaccine.
  • Vaccination of parental livestock such as breeders of edible chickens, can be performed with the live, attenuated or inactivated vaccine of the present invention, or a combination of both.
  • the advantages of this type of vaccine program include the direct protection of one day old offspring provided by antibodies from the maternal line that are delivered vertically to the offspring.
  • a typical breeder's vaccination program involves inoculating a six week old breeder with a live, weakened vaccine followed by an inactivated vaccine at 14-18 weeks of age.
  • live vaccines may be given two doses with inactivated vaccines at 10-12 weeks of age and 16-18 weeks of age.
  • the present invention also encompasses vaccine combinations comprising one or more vaccine components of other pathogens infected with poultry in addition to the infectious bronchitis virus of the present invention.
  • the vaccine component in the vaccine combination is a live, attenuated or inactivated form of the pathogen infected with the poultry.
  • the present invention provides a vaccine combination in which all vaccine components are in an inactivated form.
  • Vaccine combinations include influenza virus, avian reovirus, infectious bursal disease virus (IBDV), fowl adenovirus (FAdV), and hypoglycaemia syndrome (egg drop syndrome 76 'virus, EDS 76). It is preferred to include one or more (inactivated) vaccine strains of virus and turkey rhinotracheitis virus (TRTV).
  • IBDV infectious bursal disease virus
  • FAdV fowl adenovirus
  • TRTV turkey rhinotracheitis virus
  • the present invention after treatment with formalin treatment of intestinal urea solution containing the IBV of claim 1 cultured in SPF oocytes, or inactivation of the urea membrane fluid or binary ethylenimine (Binary ethylenimine)
  • a method for producing a deadly infected vaccine of infectious bronchitis virus K40 / 09 strain deposited with accession number KCTC 11937BP comprising the step of inactivating.
  • the murine vaccine is produced using the mutant IBV K40 / 09 strains that are popular in outdoor farms in Korea, and the safety and efficacy of the produced vaccine are compared with existing commercially available IBV killed virus vaccines to make the vaccine available in Korea. Developed.
  • Figure 2 is the result of expressing the S1 protein (RT-PCR) through reverse transcription polymerase chain reaction.
  • FIG. 3 is a diagram illustrating a gene group of viruses through a phylogenetic method.
  • Figure 4-6 shows the virus propagated in the intestinal urea of the gynecological eggs by reverse transcription polymerase chain reaction (RT-PCR) Avian influenza virus (AIV) (forward primer sequence AGCAAAAGCAGGTAG, reverse primer The sequencing AGTAGAAACAAGGTAGTTTTT) and Newcastle disease (NDV) (forward frigo and nucleotide sequences GCTGATCATGAGGTTACCTC, reverse frigo and sequencing AGTCGGAGGATGTTGGCAGC) do not proliferate (FIGS.
  • AIV forward primer sequence AGCAAAAGCAGGTAG, reverse primer The sequencing AGTAGAAACAAGGTAGTTTTT)
  • Newcastle disease Newcastle disease
  • the protective immunity effect was evaluated as having a protective effect if the virus was not re-isolated by re-isolating the challenge virus from the kidney and organ 5 days after challenge.
  • Table 1 is a table showing the results of immunogenicity evaluation test for domestic variants of IBV K40 / 09 strains of existing poisoning vaccine.
  • IBV field isolates Separation of IBV field isolates was performed after aseptic sampling of organs or kidneys of suspected IB infection, 20% emulsion with sterile PBS, centrifugation at 3,000 rpm for 20 minutes, and supernatant taken to infiltrate the 10-day-old SPF oviduct. After inoculation and incubation at 37 ° C. for 72 hours, the intestinal ureum fluid is collected aseptically. The collected urea fluid was finally confirmed whether IBV was present in urea fluid according to the method of Song et al. (Avian Diseases, 42, 92-100, 1998) (FIG. 1).
  • RT- PCR reverse transcription polymerase chain reaction
  • the homology of the IBV S1 protein genes showed 85% lower homology with QXIBV, a new pandemic strain, in the KM91 strain, but a new strain of K40 / 09 strains in the open air. It was confirmed that it showed about 90% homology with the other two serotypes of IBV strains (KM91 and QXIBV strains).
  • Table 2 is a comparative analysis of S1 protein gene homology with the domestic isolates.
  • SEQ ID NO: 1 shows the gene sequence of the S1 protein of the strain.
  • RT-PCR Reverse transcriptase polymerase chain reaction
  • Urinary fluid obtained from organs suspected of IB infection or chick embryos inoculated with kidney emulsions was used as a master seed to prepare two seeded virus stocks.
  • the virus content of Seed virus stock was found to be 10 8.0 EID 50 / ml as a result of calculating 50% Egg infectious dose (EID 50 ).
  • the inactivation of the IBV K40 / 09 strain was treated with intestinal urea solution containing IBV cultured in SPF oocytes after adding 0.2% formalin for 15 hours at 37 ° C. and then inactivating at 4 ° C. for one week, The solution is treated with 0.01M BEI (Binary ethylenimine) and inactivated at 37 ° C. for 3 hours or 0.2% B-PL in the intestinal fluid.
  • BEI Binary ethylenimine
  • This test is to inoculate 1 ml (2dose) of 15 dead 3-4 weeks old SPF chicken thigh muscles in the laboratory to test the safety of IBV K40 / 09 strain deadly vaccine.
  • the clinical symptoms, weight gain and mortality were examined for 3 weeks after inoculation, and the number of gross lesions at the 3, 4, and 5 weeks was examined to determine the formation of gross lesions at the site of inoculation.
  • Significant analysis was performed using the Student's t-test and the mortality by One-tailed Fisher's test.
  • the final immunogenicity test results are shown in Tables 3 and 4 below.
  • Table 3 shows the clinical symptoms and mortality findings of the three-week-old SPF inoculation system after IBV K40 / 09 weekly deadly-vaccinated vaccine.
  • Test vaccine Test system pass Granulomatous formation by age after vaccination C) 3 weeks 4 Weeks 5 Weeks Vaccination group 15 0/5 0/5 0/5 Control 15 0/5 0/5 0/5
  • Table 4 shows the results of the weight change and granulomatous formation of the three-week-old SPF inoculation system after the IBV K40 / 09 strain of dead venom vaccine.
  • Infection titer of IBV was measured using SPF embryonated eggs. Specifically, 10 7 EID 50 / ml virus solution diluted 10 steps with PBS buffer solution inoculated 0.1ml per egg into the intestinal ureum of 10-day-old SPF eggs, and then put in 37 °C incubation period and incubated for 48 hours and 72 hours. . At least five eggs per dilution were inoculated and incubated for 48 hours and 72 hours, followed by real-time polymerase chain reaction. Among them, infection titers of culture time with high virus proliferation rate were measured.
  • the infection titer of the virus was expressed as the inverse of the dilution of virus fluid infecting 50% of the egg embryos (Embryo infective dose, hereinafter referred to as "EID50”), and was calculated according to Reed &Muench's method (Reed LJ, Muench). H., American J Hyg, 1938, 27, 493-497).
  • Table 5 is a table of the results of proliferation culture titers.
  • Pathogenicity experiments were performed on chickens of IBV K40 / 09 weeks in 1-day-old SPF chicks. Ten chicks of 1-day-old chick were used per virus group, and 10 4.5 EID 50 virus per chick was challenged with eye drop, and clinical symptoms and mortality were observed for 14 days. As a control, 10 days old SPF chicks were used to inoculate PBS buffer solution in the same manner, and mortality and virus re-separation were performed.
  • Table 6 shows the results of pathogenic and viral reisolation in 1-day-old chicks of IBV K40 / 09.
  • Table 7 is a table of the minimum immunogenicity of Zadok oil vaccine prepared with K40 / 09 vaccine strain.
  • IBV K40 / 09 was vaccinated to three-week-old SPF chickens as host animals, with the exception of the control group, with IBV 10 3.5 EID 50 per chick and three weeks after vaccination, representing the major domestic and overseas major IBV genetic groups. Seven IBVs were challenged by instillation of 10 4.5 EID 50 per chick. Controls were also challenged with the same virus in the same manner. After 5 days of inoculation, all surviving chickens were euthanized, and autopsies were collected aseptically. Virus isolation tests from organs were carried out by the inoculation method according to the above. Protective efficacy in chickens was assessed by IBV re-separation rate in organs and kidneys of chickens.
  • Table 8 shows the results of the cross-protection experiments for domestic and overseas epidemic IBV challenge in IBV K40 / 09 vaccine chicks.
  • Table 9 shows the results of the cross-protection experiments for domestic and foreign pandemic IBV challenge in IBV H120 strain vaccine chickens.
  • Table 10 is a cross-protective test results table for domestic and overseas pandemic IBV challenge in IBV K2 main vaccine chicken.
  • Tables 8 to 10 of the present invention utilizes isolated viruses (K40 / 09 and other recombinant viruses) to confirm a wide range of immunogenicity, such as domestic epidemic respiratory malformation, renal infectious bronchitis virus and foreign epidemic infectious bronchitis virus.
  • Vaccine strains were selected by using cross-branching virus to confirm cross-protection ability (Table 8).
  • the cross-protection ability of the infectious bronchitis vaccine and K40 / 09, the vaccine strain of the present invention was compared to verify the applicability as a vaccine strain (Table 9, Table 10).
  • the test for assaying the cross-protective ability of the IBV vaccine of the present invention was carried out as follows. According to the test schedule, the vaccine was administered in 3 drops of 10 3.5 EID 50 per head to 3 week old SPF chickens. Three weeks after vaccination, 7 genotypes of IBV, currently popular in Korea and abroad, were challenged with eye drop of 10 4.5 EID 50 virus per chicken. Five days after challenge, organs and kidneys were harvested and the challenge virus was re-isolated from these organs to assess the cross-protective capacity of the vaccine. As a result, IBV K40 / 09 strains showed higher levels of cross-protection than conventional vaccines.
  • IBV K40 / 09 strain showed high cross-immunogenicity against 7 IBVs that are popular in Korea and abroad.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 전염성기관지염 바이러스 K40/09주 및 이를 이용한 전염성 기관지염 백신에 관한 것으로, 더욱 상세하게는 국내 야외농장에서 분리한 전염성기관지염 바이러스 K40/09주 및 이를 이용한 전염성 기관지염 백신에 관한 것이다.

Description

전염성기관지염 바이러스 Ｋ40/09주 및 이를 이용한 전염성 기관지염 백신
본 발명은 전염성기관지염 바이러스 K40/09주 및 이를 이용한 전염성 기관지염 백신에 관한 것으로, 더욱 상세하게는 국내 야외농장에서 분리한 전염성기관지염 바이러스 K40/09주 및 이를 이용한 전염성 기관지염 백신에 관한 것이다.
전염성기관지염 (Infectious bronchitis: 이하 'IB'라 함)은 IB 바이러스 (Infectious bronchitis virus : 이하 'IBV'라 함)에 의해서 발생되는 전파력이 매우 빠른 닭의 급성 전염병이다. IB는 감염 시 폐사율은 높지 않으나 이환율이 높고 기침, 콧물, 증체율 저하, 외부 및 내부 난질저하를 동반하는 산란율 저하를 유발 할 뿐만 아니라 호흡기 후유증으로 대장균증이 수반되어 만성 폐사가 지속되는 등 매우 다양한 생산성 저하를 유발하여 전세계적으로 양계산업에 막대한 경제적 피해를 입히고 있다.
IBV는 코로나 바이러스에 속하는 RNA 바이러스로서 인플루엔자 바이러스와 유사하게 바이러스 입자를 구성하는 유전자가 쉽게 변이 되는 특성이 있다. 따라서 현재 전세계적으로 매우 다양한 혈청형의 IBV들이 분리 보고되고 있으며, 이들 각 혈청형에서 변이된 변이형 바이러스까지 포함하면 그 종류는 수십 종에 이를 것으로 추정되고 있다. 다양한 혈청형만큼이나 바이러스의 감수성 장기 및 병원성이 다양하며 지역별 및 국가별로 유행하는 혈청형이 서로 다른 것 또한 특징이다. 그리고 이들 혈청형들 간에는 상호 교차반응이나 교차 면역이 잘되지 않아 질병의 예방과 통제에 많은 어려움이 수반되고 있다.
현재 국내에서 유행하고 있는 IB는 심한 호흡기와 산란저하를 주로 유발하는 호흡기형 IB와 호흡기를 동반하나 신장염과 산란저하가 더 심한 신장형 IB 등 크게 2가지 타입으로 구분할 수 있다.
국내의 IB 발생은 1986년도에 보고된 것이 최초이며 1990년도 후반까지 지속적으로 호흡기형의 바이러스가 유행하였고, 메사츄세스형 IBV (H120, Ma5)로 제조된 생독 및 사독 오일 백신으로 효과적인 통제가 가능하였다. 당시 IB 감염으로 인한 피해는 호흡기 증상 유발 및 기형란을 동반하는 산란저하 피해가 주류를 이루었으나, 1990년도 이후 전국적인 백신 사용에도 불구하고 산란계나 종계에서 다양한 산란저하 피해사례가 속출되었으며, 육계의 경우 육성중인 병아리에서 10% 내외의 폐사와 함께 심한 침울, 우모 역립, 설사, 신장의 요산침착, 신장염 등을 수반하는 신장형 IB 가 발생되어 지금까지 지역적으로 심한 피해를 유발하고 있는 실정이다.
광범위한 백신 접종에도 불구하고 IB로 인한 피해가 지속되고 그 원인이 신장형 IB임이 밝혀진 이후 국내 주 유행주인 신장형 IBV의 효과적인 예방을 위하여 1997년에 KM91주를 이용한 IB 사독오일백신을 개발하여 산업화를 완료하였고, 현재 국내에서 사용되고 있다.
신장형 IB 사독오일백신은 국내 주 유행주인 신장형 IB 감염으로 인한 산란저하 방지에 효과적일 뿐만 아니라 호흡기형 IB 감염에 의한 산란저하도 효과적으로 막아왔으나, 2000년도 초반부터 중국으로부터 유래된 새로운 혈청형의 신장형 IBV (QXIBV 주)에 대해서는 교차면역능이 떨어져 국내 신장형 IBV (KM91주)로 제조된 사독백신을 접종하였는데도 산란피크에 도달하지 못하는 경우가 증가하게 되었고, 실험실 내 실험에서 기존 사독백신 후 새로운 혈청형의 IBV를 공격접종한 결과 산란율에 영향을 미치는 것을 확인할 수 있었다(도 1).
또한 2005년도부터 국내에서 새로운 변이형 IBV의 발생이 증가하게 되면서 새로운 사독백신 개발의 필요성이 증가하게 되었다.
관련 선행특허로 대한민국 특허공개번호 제1020120006164호는 닭의 악성 전염병인 뉴캣슬병(ND: Newcastle disease)을 예방할 수 있는 뉴캣슬병 바이러스 백신주 및 이를 포함하는 뉴캣슬병 바이러스 백신에 관한 것으로, 보다 상세하게는 국내 가금 오리로부터 분리되고 바이러스 F 단백질의 핵산 염기서열을 기초로 계통분류학적 분석(phylogenetic analysis)에서 class 1의 유전형 I의 유전아형 d (Id)에 속하는 뉴캣슬병 바이러스 백신주 및 이를 포함하는 뉴캣슬병 바이러스 백신에 관한 것이 기재되어 있으며,
다른 관련 선행특허로 대한민국 특허공개번호 제1020120024493호는 뉴캐슬병 바이러스 및 이를 포함하는 뉴캐슬병 바이러스용 백신에 관한 것으로서, 구체적으로는 유전자가 서열번호 1에 나타낸 아미노산 서열 또는 그와 96% 이상 상동성을 가지는 아미노산 서열로 이루어지는 것을 특징으로 하는 뉴캐슬병 바이러스와 이를 포함하는 백신, 이를 특이적으로 인식하는 항체, 상기 항체를 포함하는 뉴캐슬병 바이러스 진단용 조성물, 뉴캐슬병 바이러스의 진단에 관한 정보를 제공하는 방법 및 키트에 관한 것이 기재되어 있다.
본 발명은 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 국내에서 유행중인 다양한 종류의 변이형 IBV에 효과적인 예방 백신 제조를 위한 IBV 야외 분리주를 제공하는 것이다.
본 발명의 다른 목적은 상기 IBV 야외 분리주의 병원성을 약독화시켜 IBV에 효과적인 예방 백신 제조를 위한 IBV 약독주를 제공하는 것이다.
본 발명의 다른 목적은 상기 IBV 야외 분리주 및 약독주를 이용한 IBV에 효과적인 예방 백신을 제공하는 것이다.
상기의 목적을 달성하기 위하여 본 발명은 기탁번호 KCTC 11937BP로 기탁된 전염성기관지염 바이러스 K40/09주를 제공한다.
본 발명의 바이러스는 대한민국 대전시 유성구 소재 한국생명공학연구원 생물자원센터에 기탁번호 KCTC 11937BP로 2011년 5월 23일에 기탁하였다.
본 발명의 일 구현예에 있어서, 상기 바이러스는 국내 가금류로부터 분리한 전염성기관지염 바이러스인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 바이러스의 분리 방법에서 바람직한 출발 물질로서 병에 걸린 조류, 특히 가금류의 호흡기관 또는 이러한 조류에 의해 배설되는 배설물로부터 분리될 수 있다. 기타 기관이 본 발명의 바이러스의 분리를 위한 출발 물질로서 사용될 수 있다는 점이 제외되어서는 안된다.
또 다른 측면에서 본 발명은 전염성기관지염 바이러스 감염에서 야기되는 임상증상에 대한 가금의 보호용 백신을 제공하는데, 본 발명의 전염성기관지염 바이러스 및 약학적 허용 담체나 희석제를 포함한다.
본 발명의 전염성기관지염 바이러스는 불활성화된 형태로서 백신 중에 포함될 수 있다. 만일 전염성기관지염 바이러스가 불활성화된 형태라면, 상기에 전술한 질병을 유도하는 전염성기관지염 바이러스의 성질은 완전히 없어진다.
본 발명의 백신은 예를 들면 시판용 불활성화된 전염성기관지염 바이러스 백신에 흔히 사용되는 통상적인 방법에 따라 준비될 수 있다. 수의학적 백신 조성물의 제조는 특히 "Handbunch der Schutzimpfungen in der Tiermedizin"(편집: Mays,A.등, Verlag Paul Parey, Berlin und Hamburg, Germany, 1984) 및 "Vaccines or Veterinary Applications"(편집: Peters,A.R.등, Butterworth-Heinemann Ltd,1993)에 설명되어 있다.
간단하게 설명하면, 감염되기 쉬운 기질에는 본 발명의 전염성기관지염 바이러스를 살아있는 형태로 접종하고, 바이러스가 소정의 감염 적정농도 또는 항원 함량(질량)으로 복제될 때까지 증식시킨다. 그 후에 물질을 보유한 전염성기관지염 바이러스를 수거하고 예방적 활성을 갖는 약학적 조성물로 제제화할 수 있다.
상기에서 정의된 전염성기관지염 바이러스의 복제에 사용할 수 있는 모든 기질은, 전염성기관지염 바이러스가 기질에 적응한 후 필요하다면, 본 발명에 따른 백신을 생성하는데 사용될 수 있다.
또는 본 발명의 전염성기관지염 바이러스를 배(胚)화된 달걀에서 증식시킨 후, 통상적인 방법으로 전염성기관지염 바이러스 물질을 수거할 수 있다.
또한 본 발명은 전염성기관지염 감염에 대하여 불활성화된 형태의 전염성기관지염 바이러스를 포함하는 백신을 제공한다. 불활성화된 백신의 주된 장점은 높은 레벨의 보호 항체가 장기간 지속된다는 것이다. 이러한 성질로 인해, 불활성화된 백신이 종축 백신접종에 특히 적합하게 된다.
증식 단계 후 수거된 바이러스를 불활성화하는 목적은 바이러스의 재생성을 방지하는 것이다. 일반적으로, 이것은 화학적 또는 물리적 수단으로 수행될 수 있다. 화학적 불화성화는 예를 들어 효소, 포름알데하이드, β-프로피오락톤, 에틸렌-이민 또는 그것의 유도체로 바이러스를 처리함으로써 수행될 수 있다. 필요한 경우, 불활성화된 화합물은 나중에 중화된다. 포름알데히드로 불활성화된 물질은 예를 들어 티오설페이트로 중화될 수 있다. 물리적 불활성화는 에너지가 충분한 방사능, 예를 들면 UV 광을 바이러스에 조사함으로써 바람직하게 수행될 수 있다. 필요한 경우, 처치 후 pH 가 약 7의 값으로 조정될 수 있다.
불활성화된 전염성기관지염 바이러스를 함유하는 백신은 예를 들면 이 목적에 적당한 전술한 약학적 허용 담체 또는 희석제를 하나 이상 포함할 수 있다. 바람직하게는, 본 발명의 불활성화된 백신은 보조적 활성을 갖는 하나 이상의 화합물을 포함한다. 이 목적에 적당한 화합물이나 조성물은 알루미늄 히드록시드, -포스페이트, -옥시드, 광유, 비타민 E 아세테이트와 같은 식물유 및 사포닌을 주성분으로 하는 수중유형 또는 유중수형 유제를 포함한다.
불활성화된 백신은 대개 비경구적으로, 즉 근육내 또는 피하내로 투여된다.
본 발명의 백신은 활성 성분으로서 전염성기관지염 바이러스를 유효량, 즉 독성 바이러스에 의한 공격(항원 투여)에 대항하여 백신 접종된 조류 또는 그들의 자손에서 면역을 유도할 전염성기관지염 바이러스 물질을 면역화시키는 양으로 포함한다. 본원에서 면역은 백신접종되지 않은 군에 비해 백신접종 후 조류 집단에서 상당히 높은 레벨의 보호를 유도하는 것으로 정의된다.
통상적으로, 본 발명의 불활성화된 백신은 조류 1 마리당 104-1010TCID50의 용량과 등가의 항원을 포함하여 투여될 수 있다.
본 발명의 전염성기관지염 바이러스 백신은 닭에 효과적으로 사용될 수 있으나, 칠면조, 기니아 파울(guinea fowl) 및 메추라기와 같은 기타의 가금도 효과적으로 백신으로 접종될 수 있다. 닭은 식용 닭, 복제 가축, 및 알을 낳는 가축을 포함한다.
본 발명에 따른 살아있는 또는 불활성화된 백신을 투여받은 동물의 나이는 현재 시판되는 불활성화된 전염성기관지염 바이러스 백신을 투여받은 동물의 나이와 동일하다. 식용 닭의 종축과 같은 부모 가축의 백신접종은 본 발명의 살아있는 약화된 또는 불활성화된 백신, 또는 양자의 혼합으로 수행될 수 있다. 이런 유형의 면역주사 프로그램의 장점은 수직적으로 새끼에게 전달되는 모계 유래의 항체에 의해 제공된 생후 1일된 자손의 직접적인 보호를 포함한다. 전형적인 종축의 백신접종 프로그램은 생후 6주의 종축에게 살아있는 약화된 백신을 접종한 후 생후 14-18주에 불활성화된 백신을 접종하는 것을 포함한다. 대안적으로, 살아있는 백신을 접종한 후 생후 10-12주에 및 16-18주에 불활성화된 백신으로 2회 접종할 수 있다.
또한, 본 발명은 본 발명의 전염성기관지염 바이러스 외에 가금에 감염되는 기타 병원균의 하나 이상의 백신 성분을 포함하는 백신 조합을 포함한다.
바람직하게는 백신 조합에서 백신 성분은 가금에 감염되는 병원균의 살아있는 약화된 또는 불활성화된 형태이다.
특히, 본 발명은 백신 조합을 제공하며 이 백신 조합의 모든 백신 성분은 불활성화된 형태이다.
백신 조합은 인플루엔자 바이러스, 조류 레오바이러스 (avian reovirus), 전염성 F낭병 바이러스(Infectious bursal disease virus, IBDV), 가금 아데노바이러스 (fowl adenovirus, FAdV), 산란저하증 바이러스 (egg drop syndrome 76' virus, EDS 76' virus) 및 칠면조 비기관지 염 바이러스 (turkey rhinotracheitis virus, TRTV)의 하나 이상의 (불활성화된) 백신 균주를 포함하는 것이 바람직하다.
또 본 발명은 특유병원체 부재군(SPF)종란에서 배양된 제1항의 IBV를 포함하는 장요막강액을 포르말린을 처리한 후 불활화 처리를 하거나, 또는 장요막강액에 이원성 에틸렌이민(Binary ethylenimine)를 처리하여 불활시키는 단계를 포함하는 기탁번호 KCTC 11937BP로 기탁된 전염성기관지염 바이러스 K40/09주의 사독백신 제조방법을 제공한다.
본 발명에서는 국내의 야외농장에서 유행하고 있는 변이형 IBV K40/09주를 이용하여 사독백신을 제작하고, 제작된 백신의 안전성과 효능을 기존 시판 IBV 사독백신과 비교 시험하여 국내 적용 가능한 사독백신을 개발하였다.
본 발명에 의한 전염성 기관지염 바이러스는 기존백신의 단점을 보완한 국내에서 발생하는 새로운 변이형 IB의 효과적 예방을 위한 백신으로서, 국내형 닭 전염성 기관지염의 예방에 크게 기여할 것이다.
도 1은 장 요막강액 내 IBV의 존재여부를 최종 확인한 사진이다.
도 2는 S1 단백질을 역전사 중합효소연쇄반응을 통해 (RT-PCR) 발현시킨 결과이다.
도 3은 계통분석학적 방법을 통해 바이러스의 유전자 그룹을 조사한 그림이다.
도 4-6은 계태아란의 장요막강액에서 증식한 바이러스를 역전사 중합효소연쇄반응 (RT-PCR) 을 통해 확인한 결과 조류 인플루엔자 바이러스 (Avian influenza virus, AIV) (정방향 프라이머 염기서열 AGCAAAAGCAGGTAG, 역방향 프라이머 염기서열 AGTAGAAACAAGGTAGTTTTT)과 뉴캣슬병 바이러스 (Newcastle disease, NDV) (정방향 프라이며 염기서열 GCTGATCATGAGGTTACCTC, 역방향 프라이며 염기서열 AGTCGGAGGATGTTGGCAGC)은 증식하지 않고(도 4 및 5), 전염성 기관지염바이러스에 대해서만 (정방향 프라이며 염기서열 TAGTGACCCTTTTGTGTGCACTAT, 역방향 프라이며 염기서열 GTTTGTAT GTACTCATCTGTAAC) 증식됨을 확인하였다(도 6).
이하, 비한정적인 실시예를 통하여 본 발명을 더욱 상세하게 설명한다. 단 하기 실시예는 본 발명을 설명하기 위하여 예시된 것으로서 본 발명의 범위는 하기 실시예에 의하여 제한되는 것으로 해석되지 아니한다.
실시예 1: 기존 사독백신주의 국내 변이형 IBV K40/09 주에 대한 면역원성 평가시험
본 시험은 기존 사독백신주의 국내 변이형 IBV에 대한 면역원성을 평가하기 위하여 숙주동물인 3주령 SPF 닭에 기존 사독백신주 103.0 EID50/ml를 점안으로 백신 접종하고, 백신접종 3주 후 국내 변이형 IBV K40/09 주로 병아리 1수당 IBV 104.5 EID50씩 점안으로 공격접종한 후 방어면역 효과를 조사하였다.
방어면역 효과는 공격접종 5일 후 신장 및 기관에서 공격접종 바이러스를 재분리하여 바이러스가 재분리되지 않을 경우 방어효과가 있는 것으로 평가하였다.
최종 면역원성 시험결과를 하기 표1에 나타내었다. 실험 결과 기존 사독백신주는 국내 변이형 IBV에 대해 방어효과가 낮게 나타나는 것을 확인하였다 (표 1).
표 1
기존 사독백신주접종 그룹 공격접종 IBV 유전그룹 공격접종 IBV 공격접종 바이러스 재분리 수수/ 공격접종 수수
기관 신장
대조군 백신군 대조군 백신군
1 Korean 2 K40/09 10/10 5/10 10/10 1/10
표 1은 기존 사독백신주의 국내 변이형 IBV K40/09 주에 대한 면역원성 평가시험 결과를 나타낸 표이다.
실시예 2 : 국내 야외농장에서 전염성 기관지염 바이러스 K40/09주 분리 및 불활화
신규한 IBV 야외분리주의 분리 및 동정
IBV 야외 분리주의 분리는 IB 감염 의심계의 기관 또는 신장을 무균적으로 채취한 후 멸균 PBS 로 20%되게 유제하여 3,000rpm에서 20분간 원심분리한 후 상층액을 취하여 10일령의 SPF 종란의 장요막강으로 접종하고 37℃에서 72시간 배양한 후 장요막강액을 무균적으로 채취한다. 채취한 장요막강액은 송 등의 방법 (Avian Diseases, 42, 92-100, 1998)에 준하여 장요막강액내 IBV의 존재여부를 최종 확인하였다 (도 1).
신규한 IBV 야외분리주의 S1 단백질 유전자 분석
또한 IBV 바이러스의 중화 에피토프와 혈청형 특이 에피토프를 포함하고 있어 바이러스의 중화능 및 바이러스의 혈청형 등 바이러스의 타입을 결정하는 중요한 역할을 하는 것으로 알려진 S1 단백질을 역전사 중합효소연쇄반응을 통해 (RT-PCR) (정방향 프라이며 염기서열 TAGTGACCCTTTTGTGTGCACTAT, 역방향 프라이며 염기서열 GTTTGTAT GTACTCATCTGTAAC), 발현시킨 후 (도 2) 국내에서 분리된 IBV 야외 분리주과의 상동성을 비교분석하고(표 2), 계통분석학적 방법을 통해 바이러스의 유전그룹을 조사하였다(도 3). IBV S1 단백질 유전자의 상동성을 비교분석한 결과 기존 사독백신주인 KM91주의 경우 새롭게 유행하는 야외분리주인 QXIBV와 85%의 낮은 상동성을 나타내었으나, 새로 신규한 K40/09주의 경우 야외에서 유행하는 서로 다른 두 혈청형의 IBV주 (KM91와 QXIBV주)와 약 90%의 높은 상동성을 나타냄을 확인하였다.
표 2
IBV 분리주 S1 단백질 유전자 상동성 (%)
KM91 QXIBV
K40/09 93.4 89.6
KM91 100 85
QXIBV 85 100
표 2는 국내 유행하는 분리주와의 S1 단백질 유전자 상동성 비교분석한 표이다.
서열번호 1은 본 균주의 S1단백질의 유전자 서열을 나타낸다.
신규한 IBV 야외분리주 내 기타병원체 부정 시험
계태아란의 장요막강액에서 증식이 가능한 기타 병원체의 존재 유무를 확인하기 위하여 조류 인플루엔자 바이러스 (Avian influenza virus, AIV)의 M 단백질 유전자, 뉴캣슬병 바이러스 (Newcastle disease, NDV)의 F (Fusion) 단백질 유전자 등에 대한 역전사 중합효소연쇄반응 (RT-PCR)을 실시하여 야생오리 분변 내에 뉴캣슬병 바이러스 외에 기타 병원체가 없음을 확인하였다.
신규한 IBV 야외분리주 Seed virus stock의 제작
IB 감염 의심계의 기관 또는 신장 유제액을 접종한 계태아란에서 채취한 요막강액을 Master seed로 사용하여 계태아란에 2회 계대한 Seed virus stock을 제작하였다. Seed virus stock의 바이러스량을 확인하기 위해 반수 계태아란 감염량 (50% Egg infectious dose, EID50)을 산출한 결과 Seed virus stock의 바이러스 함량은 108.0EID50/㎖로 확인되었다.
신규한 IBV 야외분리주를 이용한 사독백신 제작
상기 IBV K40/09 주의 불활화는 SPF종란에서 배양된 IBV를 포함하는 장요막강액을 0.2% 포르말린을 첨가한 후 37℃에서 15시간 처리한 후 4℃에서 1주일간 불활화 처리를 하거나, 장요막강액에 0.01M BEI(Binary ethylenimine)를 처리하여 37℃에서 3시간 또는 장요막강액에 0.2% B-PL을 처리하여 25℃에서 3시간 불활시킴으로써 이루어진다.
실시예 3 : IBV K40/09주 사독백신의 SPF 병아리에 대한 실험실내 안전성 시험
본 시험은 IBV K40/09주 사독백신의 안전성을 시험하기 위하여 실험실내에서 사독백신을 15수의 3~4주령 SPF 닭 대퇴부 근육내에 1㎖ (2dose)씩 접종한다. 접종 후 3주간 임상증상, 증체율 그리고 폐사율을 조사하고 3주, 4주, 5주에 그룹별 5수씩 부검하여 접종부위의 육안적 병변의 형성여부를 조사한다. 시험군간의 증체율은 Student's t-test, 폐사율은 One-tailed Fisher's test로 유의성 분석을 실시하였다. 최종 면역원성 시험결과를 하기 표3과 표4에 나타내었다.
IBV K40/09주 사독백신의 안전성 시험결과 접종군과 대조군 모두 임상증상과 폐사를 보이지 않았다. 또한 접종군과 대조군간 증체율의 유의적 차이가 나타나지 않았으며, 육아종 형성 역시 차이를 보이지 않아 K40/09주 사독백신의 안전성을 확인하였다.
표 3
시험 백신 시험계수수 시험백신 접종 후 임상증상 및 폐사발현 수수 A)
임상증상 폐사
사독백신 접종군 15 0/15† 0/15†
대 조 군 15 0/15 0/15
표 3은 IBV K40/09주 사독백신 접종 후 3주령 SPF 접종계의 임상증상 및 폐사 발현율 조사 결과를 나타낸 표이다.
*A)시험백신을 대퇴부분의 근육내에 1㎖ 접종한 후 3주간 관찰한 임상증상 및 폐사발현 (발현수수/접종수수)
† Student's t-test P-value compared with control group > 0.5
표 4
시험 백신 시험계 수수 백신 접종 후 주령별 육아종형성C)
3주 4주 5주
백신접종군 15 0/5 0/5 0/5
대 조 군 15 0/5 0/5 0/5
표 4는 IBV K40/09주 사독백신 접종 후 3주령 SPF 접종계의 체중변화 및 육아종 형성 조사 결과를 나타낸 표이다.
A) 3종의 시험백신을 3주령 SPF닭의 대퇴부분의 근육내에 1㎖ 접종한 후 3주간 관찰
B)시험백신 접종전과 접종 3주후에 그룹별 평균체중과 표준편차를 측정하여 산출한 체중변화
C)시험백신 접종후 3주, 4주, 5주 후에 그룹별 5수씩 부검하여 접종부위의 육아종 형성여부를 관찰 (육아종 형성수수/접종수수)
† Student's t-test P-value compared with control group > 0.5
실시예 4:증식 배양 및 역가 측정
IBV의 감염 역가 측정은 SPF 발육계란을 사용하여 측정하였다. 구체적으로, PBS 완충용액으로 10단계 희석한 107EID50/ml 바이러스액을 10일령 SPF 종란의 장요막강 내로 계란당 0.1ml씩 접종한 후, 37℃ 부란기에서 넣고 48시간과 72시간 동안 배양하였다. 희석액당 최소 5개 종란에 접종하여 48시간과 72시간 동안 배양한 후, 실시간중합효소연쇄반응을 실시하였고, 그 중 바이러스 증식률이 높은 배양시간의 감염 역가를 측정하였다. 바이러스의 감염 역가는 종란 계태아의 50%를 감염시키는 바이러스액 희석배수의 역수(Embryo infective dose, 이하 "EID50"이라 함)로 표시하였으며, Reed & Muench의 방법에 따라 산출하였다(Reed LJ, Muench H., American J Hyg, 1938, 27, 493-497).
표 5
희석배수 Titer
10-1 108.5EID50/ml
10-2 108.37EID50/ml
10-3 108EID50/ml
10-4 108EID50/ml
표 5는 증식 배양 역가 측정 결과 표이다.
실시예 5:닭에 대한 병원성 측정
1일령 SPF 병아리에서 IBV K40/09주의 닭에 대한 병원성 실험을 실시하였다. 바이러스 군당 1일령 병아리 10수씩 사용하였으며, 병아리 1수당 104.5EID50의 바이러스를 점안 접종법(eye drop)으로 공격접종 한 후, 14일간 임상증상과 폐사율을 관찰하였다. 대조군으로는 1일령 SPF 병아리 10수를 이용하여 PBS 완충용액을 동일한 방법으로 접종하고 폐사율과 바이러스 재분리를 실시하였다.
병원성 실험 결과, IBV K40/09주 인공감염 후 14일째 감염계의 기관(trachea)과 신장(kidney) 조직시료를 채취하여 바이러스 증식 여부를 조사한 결과, 모든 감염계의 기관과 신장에서 바이러스가 재분리되었다 (10/10수).
표 6
감염 바이러스 접종수수 폐사율(%) 바이러스 재분리
기관 신장
K40/09 10 30%(3/10) 10/10 10/10
표 6은 IBV K40/09주의 1일령 병아리에서의 병원성 및 바이러스 재분리 결과 표이다.
실시예 6:IBV K40/09주 사독백신의 최소면역원성 실험
IBV K40/09주 사독백신의 최소면역원성을 실험하기 위하여 불활화 전의 바이러스 역가를 기준으로 각각 104.5, 105.5, 106.5, 107.5EID50/dose 의 항원양을 갖는 사독백신을 제작하였다. 항원량이 다른 각각의 백신을 시험군에 1수분씩 근육접종하고, 3주 후에 시험군과 대조군의 혈액을 채취하였다. 혈청을 56℃에서 30분간 비동화한 후 희석한 중화시험용 바이러스와 동량씩 혼합하여 37℃에서 1시간 중화하였다. 중화 후 5개 이상의 9～11일령 발육계란의 장요막강 내에 0.2 ㎖씩 접종하고 37℃에서 3일간 배양하였다. 접종 3일 후에 장요막강액을 회수하여 송 등의 방법(Avian Diseases, 42, 92-100, 1998)에 준하여 IBV의 존재여부를 확인하여 중화지수를 산출하였다.
백신 접종 3주 후에 시험군과 대조군에서 혈청을 채취한 후 중화지수를 산출하였다. 최소면역원성 시험결과 IB7.V K40/09 백신주로 제작한 사독백신은 106.5EID50/dose 이상의 항원농도에서 면역원성이 형성되는 것을 확인할 수 있었다.
표 7
IBV K40/09 항원량(logEID50/dose) 면역혈청 중화 후 바이러스 역가 (EID50/ml) 혈청중화지수
7.5 4.2 2.5
6.5 4.4 2.3
5.5 5.0 1.3
4.5 5.0 1.3
SPF 혈청 대조군 6.7 -
PBS 대조군 7.1 -
표 7은 K40/09 백신주로 제작한 사독오일백신의 최소면역원성 표이다.
라. IBV K40/09주의 닭에서의 교차 방어능 시험
IBV K40/09주 사독백신의 교차면역원성을 확인하기 위하여 국내 및 해외에서 유행하는 7가지 스트레인에 대한 방어효능을 측정하였다. . IBV K40/09주를 숙주동물인 3주령 SPF 닭에 대조군을 제외하고, 병아리 1수당 IBV 103.5EID50씩 점안으로 백신접종하고, 백신접종 3주 후 국내 및 해외유행 주요 IBV 유전그룹을 대표하는 7종의 IBV로 병아리 1수당 104.5EID50씩 점안으로 공격접종하였다. 대조군들도 동일한 바이러스를 동일한 방법으로 공격 접종하였다. 접종 5일째 생존한 닭을 모두 안락사 시킨 후 부검하여 기관 및 신장 조직시료를 무균적으로 채취하였다. 장기로부터의 바이러스 분리 검사는 상기에 따른 발육계란내 접종법으로 실시하였다. 닭에서의 방어 효능은 닭의 기관 및 신장에서의 IBV 재분리율로 평가하였다.
표 8
Figure PCTKR2013007944-appb-T000001
표 8은 IBV K40/09주 백신 닭에서의 국내 및 해외 유행 IBV 공격접종에 대한 교차방어능 실험 결과 표이다.
표 9
Figure PCTKR2013007944-appb-T000002
표 9는 IBV H120 주 백신 닭에서의 국내 및 해외 유행 IBV 공격접종에 대한 교차방어능 실험 결과 표이다.
표 10
Figure PCTKR2013007944-appb-T000003
표 10은 IBV K2 주 백신 닭에서의 국내 및 해외 유행 IBV 공격접종에 대한 교차방어능 실험 결과 표이다.
본 발명의 표 8 내지 10은 광범위한 면역원성을 확인하기 위하여 분리된 바이러스(K40/09 및 그 외 재조합 바이러스)를 활용하여 국내 유행 호흡기형, 신장형 전염성기관지염 바이러스 및 해외 유행 전염성기관지염 바이러스등 총 7 가지 바이러스를 활용하여 교차방어능을 확인하여 백신주를 선발하였다(표 8). 또한 기사용 중인 전염성기관지염 백신과 본 발명의 백신주인 K40/09의 교차방어능을 비교 분석하여 백신주로써의 활용가능성을 검증하였다(표 9, 및 표 10).
본 발명의 IBV 백신의 교차 방어능을 검정하기 위한 시험은 하기와 같이 실시하였다. 시험 일정에 따라, 백신은 3주령 SPF 닭에 1수당 103.5EID50씩 점안으로 투여하였다. 백신접종 3주 후 현재 국내 및 해외에서 유행하는 7가지 유전자형의 IBV를 닭 1수당 104.5EID50의 바이러스를 점안(eye drop)으로 공격접종하였다. 공격접종 5일 후 기관, 신장을 채취하고 이들 장기로부터 공격접종 바이러스를 재분리하여 백신의 교차 방어능을 평가 하였다. 실험결과 IBV K40/09주는 기존 사용중인 백신들에 비하여 높은 수준의 교차 방어능을 나타내는 것으로 확인되었다.
일반적으로 IBV는 서로 다른 혈청형 혹은 유전형에 대하여 교차 방어능이 상대적으로 낮은 것으로 알려져있다 (Ignjatovi and Sapats, 2000). 하지만 일부 바이러스주들은 서로 다른 혈청형 혹은 유전자형에 대하여 교차 방어능을 나타내는 것이 보고되고 있다. 따라서 광범위한 교차 면역원성을 나타내는 바이러스주를 발굴하여 백신을 제작하는 것이 백신주 선발에 있어 가장 중요하다고 할 수 있다. 본 실험의 결과로 미루어 보아 IBV K40/09주는 국내 및 해외에서 유행하고 있는 7종의 IBV에 대하여 높은 교차 면역원성을 나타내는 것이 확인되어 백신으로써 높은 효능을 나타낼 것으로 보인다.
Figure PCTKR2013007944-appb-I000001

Claims (9)

  1. 기탁번호 KCTC 11937BP로 기탁된 전염성기관지염 바이러스 K40/09주.
  2. 제 1항에 있어서,
    상기 바이러스는 국내 가금류로부터 분리한 전염성기관지염 바이러스.
  3. 제1항의 전염성기관지염 바이러스 및 약학적 허용 담체 또는 희석제를 포함하는 전염성기관지염 바이러스 감염으로부터 유발된 질병에 대한 가금 보호용 백신.
  4. 제 3항에 있어서, 상기 백신은 전염성기관지염 바이러스 유전형 M41, 한국(Korean) I (B4), 한국(Korean) II서브그룹1 (KM91), 한국(Korean) II 서브그룹2 (QX),한국 신형 유전형 클러스터( Korean New genetic cluster) 1,한국 신형 유전형 클러스터2, 및 4/91로 구성된 군으로부터 선택된 하나 이상의 바이러스 종에 효과를 가지는 것을 특징으로 하는 가금 보호용 백신.
  5. 제3항에 있어서,
    상기 전염성기관지염 바이러스가 불활성화된 형태임을 특징으로 하는 백신.
  6. 제3항에 있어서,
    상기 백신이 보조제를 추가로 포함하는 것을 특징으로 하는 백신.
  7. 제3항에 있어서,
    상기 백신이 가금에 감염성이 있는 다른 병원균의 백신성분을 하나 이상 추가로 포함하는 것을 특징으로 하는 백신.
  8. 제1항의 바이러스를 조류에 투여하는 것을 포함하는 가금에서 전염성기관지염 감염으로부터 유발된 질병을 제어하는 방법.
  9. 특유병원체 부재군(SPF)종란에서 배양된 제1항의 IBV를 포함하는 장요막강액을 포르말린을 처리한 후 불활화 처리를 하거나, 또는 장요막강액에 이원성 에틸렌이민(Binary ethylenimine)를 처리하여 불활시키는 단계를 포함하는 기탁번호 KCTC 11937BP로 기탁된 전염성기관지염 바이러스 K40/09주의 사독백신 제조방법.
PCT/KR2013/007944 2012-10-15 2013-09-03 전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신 WO2014061914A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020157009648A KR101757752B1 (ko) 2012-10-15 2013-09-03 전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2012-0114134 2012-10-15
KR20120114134 2012-10-15

Publications (1)

Publication Number Publication Date
WO2014061914A1 true WO2014061914A1 (ko) 2014-04-24

Family

ID=50488435

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/007944 WO2014061914A1 (ko) 2012-10-15 2013-09-03 전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신

Country Status (2)

Country Link
KR (1) KR101757752B1 (ko)
WO (1) WO2014061914A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113122508A (zh) * 2021-03-30 2021-07-16 成都天邦生物制品有限公司 一株鸡传染性支气管炎细胞适应毒及其应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102234834B1 (ko) * 2020-01-29 2021-04-01 주식회사 메디안디노스틱 전염성 기관지염 바이러스의 뉴클레오단백질에 대한 항체 탐지용 단클론항체 및 이의 용도

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030059954A (ko) * 2002-01-04 2003-07-12 학교법인 건국대학교 신규한 닭 전염성 기관지염 바이러스(ｉｂｖ) 및 이를이용한 닭 전염성 기관지염 (ｉｂ) 감염 예방백신
KR20100101217A (ko) * 2009-03-09 2010-09-17 대한민국(관리부서 : 농림수산식품부 국립수의과학검역원) 닭전염성 기관지염 바이러스 및 이를 포함하는 닭전염성 기관지염 백신
KR20100101216A (ko) * 2009-03-09 2010-09-17 대한민국(관리부서 : 농림수산식품부 국립수의과학검역원) 약독화된 닭전염성 기관지염 바이러스 및 이를 포함하는 닭전염성 기관지염 백신

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030059954A (ko) * 2002-01-04 2003-07-12 학교법인 건국대학교 신규한 닭 전염성 기관지염 바이러스(ｉｂｖ) 및 이를이용한 닭 전염성 기관지염 (ｉｂ) 감염 예방백신
KR20100101217A (ko) * 2009-03-09 2010-09-17 대한민국(관리부서 : 농림수산식품부 국립수의과학검역원) 닭전염성 기관지염 바이러스 및 이를 포함하는 닭전염성 기관지염 백신
KR20100101216A (ko) * 2009-03-09 2010-09-17 대한민국(관리부서 : 농림수산식품부 국립수의과학검역원) 약독화된 닭전염성 기관지염 바이러스 및 이를 포함하는 닭전염성 기관지염 백신

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TAE-HYUN LIM ET AL.: "An emerging recombinant cluster ofnephropathogenic strains of avian infectious bronchitis virus in Korea.", INFECTION, GENETICS AND EVOLUTION., vol. 11, no. ISSUE, 2011, pages 678 - 685 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113122508A (zh) * 2021-03-30 2021-07-16 成都天邦生物制品有限公司 一株鸡传染性支气管炎细胞适应毒及其应用

Also Published As

Publication number Publication date
KR101757752B1 (ko) 2017-07-26
KR20150063434A (ko) 2015-06-09

Similar Documents

Publication Publication Date Title
US8277814B2 (en) Avian Astrovirus
WO2021103421A1 (zh) 基因vii型新城疫病毒弱毒株及其应用
KR101564316B1 (ko) 신규한 가금 아데노 바이러스 및 그 백신
US20120251564A1 (en) Reovirus compositions and methods of use
França et al. Nephritis associated with infectious bronchitis virus Cal99 variant in game chickens
KR102243374B1 (ko) 소 코로나바이러스, 소 로타바이러스 및 소 바이러스성설사병바이러스에 대한 백신 조성물
WO2014163257A1 (ko) 신규 전염성 ｆ낭병 바이러스 ｉｂｄ ｋ7주 및 이를 이용한 전염성 ｆ낭병 백신
WO2014061914A1 (ko) 전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신
JP3756219B2 (ja) レオウイルス株２１７７及び該株を含むワクチン
CN114395536B (zh) 一种禽腺病毒4、8和11型三价疫苗及其制备方法和应用
WO2009143332A2 (en) Poultry viral materials and methods related thereto
KR20100101216A (ko) 약독화된 닭전염성 기관지염 바이러스 및 이를 포함하는 닭전염성 기관지염 백신
CN110713987B (zh) 一种重组基因vii型新城疫病毒毒株及其疫苗组合物、制备方法及应用
WO2014208822A1 (ko) 신규한 가금 아데노 바이러스 및 그 백신
KR20200061508A (ko) 약독화된 조류메타뉴모바이러스 주 및 이를 포함하는 백신 조성물
KR101694607B1 (ko) 약독화된 전염성기관지염 바이러스 주 및 이를 이용한 전염성 기관지염 백신
KR101360112B1 (ko) 공기전파가 가능한 신규한 ｈ９ｎ２형 저병원성 조류인플루엔자 바이러스 균주 및 그로부터 유래된 백신
KR100468037B1 (ko) 신규한 닭 전염성 기관지염 바이러스(ｉｂｖ) 및 이를이용한 닭 전염성 기관지염 (ｉｂ) 감염 예방백신
WO2024019579A1 (ko) 닭전염성기관지염바이러스 약독화주 및 이를 포함하는 백신조성물
KR102656435B1 (ko) 신규한 가금 아데노바이러스 및 이를 유효성분으로 포함하는 가금 아데노바이러스 다가백신
KR20120133044A (ko) 전염성기관지염 바이러스 ｋ40/09주 및 이를 이용한 전염성 기관지염 백신
CN114410594B (zh) 一种适应细胞复制增殖的鸡传染性支气管炎病毒及其应用
Behboudi Turkey Rhinotracheitis
KR101258619B1 (ko) 새로운 약독형 유전아형의 뉴캣슬병 바이러스 백신주 및 이를 포함하는 뉴캣슬병 바이러스 백신
Abd El-Ghany Forms of avian reovirus in poultry production: An overview

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13846945

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20157009648

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13846945

Country of ref document: EP

Kind code of ref document: A1