WO2014058104A1 - 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체 - Google Patents

시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체 Download PDF

Info

Publication number
WO2014058104A1
WO2014058104A1 PCT/KR2012/010856 KR2012010856W WO2014058104A1 WO 2014058104 A1 WO2014058104 A1 WO 2014058104A1 KR 2012010856 W KR2012010856 W KR 2012010856W WO 2014058104 A1 WO2014058104 A1 WO 2014058104A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
ugt72e3
plant
transgenic plant
seq
Prior art date
Application number
PCT/KR2012/010856
Other languages
English (en)
French (fr)
Inventor
남재성
권택민
초양
Original Assignee
동아대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020120112763A external-priority patent/KR101399941B1/ko
Priority claimed from KR1020120124906A external-priority patent/KR101399946B1/ko
Application filed by 동아대학교산학협력단 filed Critical 동아대학교산학협력단
Priority to US14/435,445 priority Critical patent/US9644191B2/en
Priority to CN201280065997.8A priority patent/CN104144604B/zh
Publication of WO2014058104A1 publication Critical patent/WO2014058104A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis

Definitions

  • the present invention is a positive enzyme specificity for cinafil alcohol, the recombinant sugar transfer enzyme UGT72E3 / 2 gene, excellent in the ability to synthesize a syringe, positive of the gene involved in the F5H, CHS gene and lignin biosynthetic pathway involved in the phenylpropanoid biosynthetic pathway
  • the present invention relates to a method for producing a transgenic plant with increased production of syringe by a metabolic method using the Myb58 gene, which is a regulatory transcription factor, and a plant according to the present invention.
  • Syringin is a lignin-based glycoside, which is a glycoside of a lignin component, cinapyl alcohol (s type monolignol), which is produced through the synthesis path of phenylpropaneoid, by glycotransferase (UDP-glucose transferase). Is generated.
  • cinapyl alcohol s type monolignol
  • UDP-glucose transferase glycotransferase transferase
  • UGT72E2 and UGT72E3 are reported as glycotransferases that convert monomonolol, such as coniferyl alcohol and sinapyl alcohol, to glycosides preferentially.
  • UGT72E3, a cinafil alcohol-specific glycotransferase required for the production of sirin has excellent substrate specificity for cinafil alcohol, but its application is very limited due to its low sugar translocation activity. Therefore, the development of a new glycotransferase enzyme capable of effectively producing sirin in plants is a challenge that must be solved before mass production and application of the functional secondary metabolite, sirin.
  • leuteroside B is a pharmacological component having excellent mental and physical adaptation efficacy against stress of prickly pear, and is classified as a representative agent of plant origin (Adaptogen).
  • Adaptation is a plant secondary metabolite that increases the nonspecific resistance of the body in response to various stresses without side effects.
  • purely isolated syringes have been reported to show excellent efficacy in treating diabetes and depression, which are the most problematic for the health of modern urban people, and their applicability is being expanded.
  • Korean Laid-Open Patent Publication No. 2004-0004764 discloses 'siginarygacipi extract with protective activity against hepatotoxicity, or a syringin and a syringaresinol-di-o-beta-glu' separated from butanol and butanol fractionation layers.
  • a composition having an antioxidant activity and a hepatotoxic protective activity containing kopyranoside is disclosed
  • Korean Patent Laid-Open Publication No. 1998-0072707 discloses a 'pharmaceutical composition of a syringe with liver function protection', but the present invention
  • the present invention was derived from the above requirements, and in the present invention, a method of domain swapping from UGT72E2 and UGT72E3 genes in order to prepare a new recombinant glycotransferase enzyme with enhanced sugar transfer activity while maintaining strong substrate specificity.
  • Arabidopsis transformants overexpressing the recombinant genes UGT72E2 / 3 and UGT72E3 / 2, respectively, and quantitatively compared the synthetic efficiencies of the syringes. In comparison, it was confirmed that the synthesis of sirin was significantly increased.
  • transformants over-expressing the F5H and HCT genes which regulate critical steps in the regulation of the flow of substrates in the phenylpropanoid synthesis pathway, to increase production of sirin via metabolic pathway regulation in plants, lacking CHS gene function
  • Arabidopsis transformants overexpressing Myb58, a positive regulatory transcription factor of the transformant and lignin synthesis pathway were prepared, respectively, and crosslinked with the transformant overexpressing the recombinant glycotransferase enzyme UGT72E3 / 2.
  • the present invention provides a recombinant sugar transfer enzyme UGT72E3 / 2 protein consisting of the amino acid sequence of SEQ ID NO: 2.
  • the present invention also provides a gene encoding the UGT72E3 / 2 protein.
  • the present invention also provides a recombinant vector comprising a gene encoding the UGT72E3 / 2 protein.
  • the present invention also provides a host cell transformed with the recombinant vector.
  • the present invention provides a method for increasing the synthesis of sirin in a plant compared to the wild type comprising the step of transforming plant cells with the recombinant vector overexpressing the UGT72E3 / 2 gene.
  • the present invention also provides a transgenic plant which is transformed with a recombinant vector comprising a gene encoding the recombinant sugar transfer enzyme UGT72E3 / 2 protein and has increased syringin production compared to wild type.
  • the present invention is transformed with a recombinant vector comprising a gene encoding a recombinant sugar transfer enzyme UGT72E3 / 2 protein and a recombinant vector comprising a gene encoding a furulate 5-hydroxylase (F5H) protein, compared to wild type ( syringin) provides a transgenic plant with increased production.
  • a recombinant vector comprising a gene encoding a recombinant sugar transfer enzyme UGT72E3 / 2 protein and a recombinant vector comprising a gene encoding a furulate 5-hydroxylase (F5H) protein, compared to wild type ( syringin) provides a transgenic plant with increased production.
  • the present invention provides a recombinant vector comprising a gene encoding a recombinant sugar transfer enzyme UGT72E3 / 2 protein, a recombinant vector comprising a gene encoding a furulate 5-hydroxylase (F5H) protein and a gene encoding a Myb58 or Myb63 protein. It is transformed with a recombinant vector containing to provide a transgenic plant with increased production of sirin compared to wild type.
  • UGT72E3 / 2 protein a recombinant vector comprising a gene encoding a furulate 5-hydroxylase (F5H) protein and a gene encoding a Myb58 or Myb63 protein.
  • the present invention is transformed with a recombinant vector comprising a gene encoding the recombinant sugar transfer enzyme UGT72E3 / 2 protein and a recombinant vector comprising a gene encoding a chalcene synthase (CHS) protein to increase the production of sirin compared to the wild type.
  • a recombinant vector comprising a gene encoding the recombinant sugar transfer enzyme UGT72E3 / 2 protein and a recombinant vector comprising a gene encoding a chalcene synthase (CHS) protein to increase the production of sirin compared to the wild type.
  • CHS chalcene synthase
  • the present invention provides a method for producing a transformed plant, which is transformed with a recombinant vector comprising the gene encoding the UGT72E3 / 2 protein and has increased production of sirin compared to wild type.
  • the present invention crosses the UGT72E3 / 2 protein overexpressing transgenic plant and the F5H protein overexpressing transgenic plant to select a transgenic plant overexpressing UGT72E3 / 2 protein and F5H protein at the same time compared to wild type
  • the present invention cross-transforms a transgenic plant that simultaneously overexpresses the UGT72E3 / 2 protein and F5H protein and a transgenic plant that expresses Myb58 or Myb63 protein, thereby simultaneously overexpressing the UGT72E3 / 2 protein, F5H protein and Myb58 or Myb63 protein.
  • a method for producing a transformed plant, the production of which is increased compared to wild-type comprising the step of selecting a plant.
  • the present invention comprises the step of crossing the UGT72E3 / 2 protein overexpressing transgenic plants and plants with knocked-out CHS protein coding gene overexpress the UGT72E3 / 2 protein, and selecting a transgenic plant with suppressed expression of CHS protein It provides a method for producing a transgenic plant with increased production of sirin compared to wild type.
  • the present invention provides a transgenic plant and its seed having increased production of sirin compared to the wild type produced by each of the above methods.
  • the present invention also provides a composition for increasing the synthesis of syringes in a plant containing a recombinant vector comprising a gene encoding a UGT72E3 / 2 protein consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient.
  • Figure 1 compares the primary and secondary structures of Arabidopsis glycotransferases UGT72E2 and UGT72E3.
  • Figure 2 shows the sugar transfer enzymes UGT72B1 (A) and VvGT1 (B) derived from Arabidopsis and grapes, the sugar transferases UGT72E2 and UGT72E3 derived from Arabidopsis, the recombinant sugar transfer enzymes UGT72E2 / 3 and UGT72E3 / 2 produced in the present invention ( The tertiary structure of C) is compared.
  • Figure 3 shows the recombinant vector (A) used in the preparation of the transformant of the present invention, the expression level (B) of the gene transferred to the transformant, the reactivity in the transformant leaves (C) to ultraviolet light.
  • Figure 4 shows quantitative HPLC analysis of coniferin and syringe production in leaves of transformants overexpressing Arabidopsis wild-type and four transgenic genes of UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2, respectively ( Peak of each chromatogram of (C): 1, coniferyl alcohol 4-O-glucoside (coniferin); 2, cinafil alcohol 4-O-glucoside (cyringin); 3, coniferyl alcohol; 4, Cinafil alcohol).
  • FIG. 5 shows quantitative HPLC analysis of coniferin and syringe production in the roots of transformants overexpressing Arabidopsis wild-type and four transgenic genes of UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2, respectively. Peak of each chromatogram of (C): 1, coniferyl alcohol 4-O-glucoside (coniferin); 2, cinafil alcohol 4-O-glucoside (cyringin); 3, coniferyl alcohol; 4, Cinafil alcohol).
  • Figure 6 shows the recombinant sugar transfer enzyme UGT72E3 / 2 nucleotide sequence and amino acid sequence.
  • Figure 7 is a result of comparing the glycotransferase activity present in the Arabidopsis transformant overexpressing the sugar transferase enzymes UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2 genes and protein extracts produced from wild-type leaves, Indirectly measuring the activity of glycotransferase present in the protein extract of each transformant by adding coniferyl alcohol or cinafil alcohol to the plant extract of the plant leaves and measuring coniferin and syringin produced after the reaction for 60 minutes. It is.
  • Coniferin production amount Coniferin production amount
  • Sirin production amount (A) Sirin production amount.
  • Figure 8 shows the phenylpropanoid synthesis pathway for the synthesis of syringes and regulatory sites of the genes used in the present invention.
  • FIG. 10 shows coniferin in a transformant leaf in which various combinations of genes are expressed, including wild type, to investigate the synergistic effects of the HCT, F5H and CHS genes of the glycotransferase UGT72E3 / 2 gene and the phenylpropanoid synthesis pathway.
  • Quantitative HPLC analysis of (A) and Sirin (B) production is shown.
  • (C) Peak 1 of each chromatogram represents coniferyl alcohol 4-O-glucoside (coniferin), and peak 2 represents cinafil alcohol 4-O-glucoside (syringin).
  • FIG. 11 shows coniferin in transformant roots in which various combinations of genes are expressed, including wild type, to investigate the synergistic effects of the HCT, F5H and CHS genes of the glycotransferase UGT72E3 / 2 gene and the phenylpropanoid synthesis pathway.
  • Quantitative HPLC analysis of (A) and Sirin (B) production is shown.
  • (C) Peak 1 of each chromatogram represents coniferyl alcohol 4-O-glucoside (coniferin), and peak 2 represents cinafil alcohol 4-O-glucoside (syringin).
  • FIG. 12 shows synergistic effect of pyramid of transgenic enzyme UGT72E3 / 2 gene, F5H gene of phenylpropanoid synthesis pathway and Myb58 gene, positive regulatory transcription factor of genes involved in lignin synthesis pathway.
  • the quantitative HPLC analysis shows that the production of Coniferin (A) and Sirin (B) increased dramatically.
  • Figure 13 shows the synergistic effect of the accumulation of Myb58 gene, a positive regulatory transcription factor for the glycotransferase UGT72E3 / 2 gene, the F5H gene of the phenylpropanoid synthesis pathway, and the genes involved in the lignin synthesis pathway.
  • HPLC analysis shows that no effect.
  • Peak 1 of each chromatogram represents coniferyl alcohol 4-O-glucoside (coniferin), and peak 2 represents cinafil alcohol 4-O-glucoside (syringin).
  • the present invention provides a recombinant sugar transfer enzyme UGT72E3 / 2 protein consisting of the amino acid sequence of SEQ ID NO: 2.
  • the range of recombinant sugar transfer enzyme UGT72E3 / 2 protein according to the present invention includes a protein having the amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the protein.
  • “Functional equivalent” means at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution, or deletion of the amino acid Is 95% or more of sequence homology, and refers to a protein that exhibits substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 2.
  • “Substantially homogeneous physiological activity” means an increase in the synthesis of syringin in plants.
  • the present invention also provides a recombinant glycotransferase UGT72E3 / 2 Fragments, derivatives and analogues of proteins.
  • fragment refers to a polypeptide that retains a biological function or activity substantially the same as the recombinant sugar transfer enzyme UGT72E3 / 2 polypeptide of the present invention.
  • Fragments, derivatives, and analogs of the present invention comprise (i) polypeptides substituted with one or more conservative or nonconservative amino acid residues (preferably conservative amino acid residues), wherein the substituted amino acid residues are encoded by a genetic code.
  • polypeptide having substituent (s) at one or more amino acid residues or (iii) another compound (a compound capable of extending the half-life of a polypeptide, such as polyethylene glycol)
  • a polypeptide derived from a bound mature polypeptide or (iv) an additional amino acid sequence (eg, a leader sequence, a secretion sequence, a sequence used to purify the polypeptide, a proteinogen sequence or a fusion protein) and It may be a polypeptide derived from said polypeptide bound.
  • additional amino acid sequence eg, a leader sequence, a secretion sequence, a sequence used to purify the polypeptide, a proteinogen sequence or a fusion protein
  • Polynucleotides encoding a mature polypeptide represented by SEQ ID NO: 2 include a coding sequence encoding only a mature polypeptide; Sequences encoding mature polypeptides and various additional coding sequences; Mature polypeptides (and any additional coding sequences) and sequences encoding noncoding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide encoding a polypeptide, or a polynucleotide further comprising additional coding and / or noncoding sequences.
  • the invention also relates to variants of said polynucleotides encoding polypeptides comprising the same amino acid sequence as described herein, or fragments, analogs and derivatives thereof.
  • Polynucleotide variants may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitutional variants, deletional variants and insertional variants.
  • allelic variants are alternatives to polynucleotides, which may include one or more substitutions, deletions, or inserted nucleotides, which do not result in a substantial functional change in the polypeptide encoded by the variant. Do not.
  • the present invention is the recombinant sugar transfer enzyme UGT72E3 / 2 Provide a gene encoding a protein.
  • the gene encoding the recombinant sugar transfer enzyme UGT72E3 / 2 protein according to the present invention was prepared by using a domain swapping method from UGT72E3 and UGT72E2 genes derived from Arabidopsis.
  • domain swapping from UGT72E2 and UGT72E3 genes is performed to maintain a substrate specificity for sinapyl alcohol, such as UGT72E3, and to prepare a new recombinant glycotransferase enzyme with high glycosylation activity, such as UGT72E2.
  • Recombinant genes UGT72E2 / 3 and UGT72E3 / 2 were prepared using the (domain swapping) method.
  • the sugar transfer enzyme UGT72E clade which has been reported to have the ability to transfer sugars to cinnaphil alcohol, a precursor of sirin, or structurally similar coniferyl alcohol, among the more than 100 sugar transfer enzymes of Arabidopsis. Enzymatic properties were investigated.
  • the UGT72E family also has structural features similar to those of ordinary sugar transfer enzymes, with the amino terminal region having a substrate recognition region and the carboxy terminus having an enzymatic active region that transfers sugar from the sugar activated by UDP to the substrate, in particular The carboxy terminal PSPG (Plant Secondary Product Glucosyltransferase) motif has been reported to be important for the activity of glycotransferases derived from plants.
  • the UGT72E family has glycotransferases UGT72E1, UGT72E2, and UGT72E3 with similar sequences.
  • UGT72E2 and UGT72E3 are divided into amino fragments each containing amino acids 1 to 344 at the amino terminus and carboxy fragments containing amino acids from 345 to 481 at the carboxy terminus.
  • the amino fragment contains a region that determines substrate recognition specificity and the carboxy terminus contains a PSPG motif that is important for sugar transfer activity. Substrate specificity is more important than activity in order to efficiently produce sirine in plants, so the amino fragments are made up to about 3/4 of the total, and the carboxy fragments are divided into the minimum size containing the PSPG motif.
  • the recombinant UGT72E3 / 2 gene of the present invention comprises an amino fragment comprising amino acids 1 to 344 of the amino terminus of UGT72E3 and a carboxy fragment comprising amino acids 345 to 481 of the carboxy terminus of UGT72E2.
  • the coding gene was prepared by linking.
  • the gene of the present invention is a recombinant glycotransferase UGT72E3 / 2 It can be DNA or RNA encoding a protein.
  • DNA includes cDNA, genomic DNA or artificial synthetic DNA.
  • DNA can be single stranded or double stranded.
  • DNA may be a coding strand or a non-coding strand.
  • the gene of the present invention may include the nucleotide sequence of SEQ ID NO: 1.
  • homologues of the above nucleotide sequences are included within the scope of the present invention.
  • the gene has a base sequence having a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% with the nucleotide sequence of SEQ ID NO: 1, respectively. It may include.
  • the "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
  • the present invention also relates to a polynucleotide which hybridizes with a sequence having at least 50%, preferably at least 70%, more preferably at least 80% identity with the nucleotide sequence of SEQ ID NO: 1 described above.
  • the present invention particularly relates to polynucleotides that hybridize to the polynucleotides described herein under stringent conditions.
  • stringent conditions include (1) hybridization and washing under 0.2 ⁇ SSC, 0.1% SDS, lower ionic strength such as 60 ° C.
  • hybridizable polynucleotide are identical to the biological function and activity of the mature polypeptide represented by SEQ ID NO: 2.
  • the present invention is also the recombinant sugar transfer enzyme UGT72E3 / 2 Encoding protein A recombinant vector comprising a gene is provided.
  • Recombinant refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
  • Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form.
  • Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.
  • the recombinant plant expression vector of the present invention can be used as a transient expression vector capable of temporarily expressing in a plant into which a foreign gene has been introduced and a plant expression vector capable of permanently expressing a foreign gene in a introduced plant.
  • Binary vectors that can be used in the present invention may be any binary vector containing RB (right border) and LB (left border) of T-DNA capable of transforming plants when present with Ti plasmid of A. tumefaciens .
  • pBI101 Cat #: 6018-1, Clontech, USA
  • pBIN19 Genbank Accession No. U09365
  • pBI121 pCAMBIA vectors, and the like, which are frequently used in the art, may be used.
  • vector is used to refer to DNA fragment (s), nucleic acid molecules that are delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells.
  • carrier is often used interchangeably with “vector”.
  • expression vector refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.
  • Ti-plasmid vectors which, when present in a suitable host such as Agrobacterium tumerfaciens, can transfer part of themselves, the so-called T-region, into plant cells.
  • a suitable host such as Agrobacterium tumerfaciens
  • Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have.
  • Particularly preferred forms of Ti-plasmid vectors are so-called binaries as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Vector.
  • viral vectors such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc.
  • CaMV double stranded plant viruses
  • gemini viruses single stranded viruses
  • it may be selected from an incomplete plant viral vector.
  • the use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.
  • the expression vector preferably comprises one or more selectable markers.
  • the marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, Ampicillin , G418, bleomycin, hygromycin, chloramphenicol There is a gene, but is not limited thereto.
  • the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto.
  • the term “promoter” refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
  • a "plant promoter” is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.
  • the terminator may use a conventional terminator, such as nopalin synthase (NOS), rice ⁇ -amylase RAmy1 A terminator, phaseoline terminator, agro Terminator of the octopine gene of Bacterium tumerfaciens ( Agrobacterium tumefaciens ), but is not limited thereto.
  • NOS nopalin synthase
  • rice ⁇ -amylase RAmy1 A terminator such as rice ⁇ -amylase RAmy1 A terminator, phaseoline terminator, agro Terminator of the octopine gene of Bacterium tumerfaciens ( Agrobacterium tumefaciens ), but is not limited thereto.
  • the present invention also provides a host cell transformed with the recombinant vector.
  • yeast Saccharomyce cerevisiae
  • insect cells human cells
  • human cells e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2) , 3T3, RIN and MDCK cell lines
  • the host cell is preferably a plant cell.
  • the method of transporting the vector of the present invention into the host cell may be performed by injecting the vector into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, gene bombardment, or the like. Can be.
  • the present invention provides a method for increasing the synthesis of sirin in a plant compared to the wild type comprising the step of transforming plant cells with the recombinant vector overexpressing the UGT72E3 / 2 gene.
  • the UGT72E3 / 2 gene may be composed of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
  • the present invention is a transformed plant consisting of the amino acid sequence of SEQ ID NO: 2 is transformed with a recombinant vector comprising a gene encoding the enzyme UGT72E3 / 2 protein transformed plants with increased production of sirin (syringin) compared to wild type to provide.
  • the present invention provides a recombinant vector comprising a gene encoding the recombinant sugar transfer enzyme UGT72E3 / 2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and encoding a F5H (furulate 5-hydroxylase) protein consisting of the amino acid sequence of SEQ ID NO: 4 Transformation with a recombinant vector comprising the gene provides a transgenic plant with increased syringin production compared to the wild type.
  • the present invention provides a recombinant vector comprising a gene encoding the recombinant transfer enzyme UGT72E3 / 2 protein consisting of the amino acid sequence of SEQ ID NO: 2, encoding a F5H (furulate 5-hydroxylase) protein consisting of the amino acid sequence of SEQ ID NO: 4
  • a recombinant vector comprising a gene and a recombinant vector comprising a gene encoding Myb58 protein consisting of the amino acid sequence of SEQ ID NO: 6 is transformed to provide a transgenic plant having increased production of sirin compared to wild type.
  • the present invention provides a recombinant vector comprising a gene encoding the recombinant transfer enzyme UGT72E3 / 2 protein consisting of the amino acid sequence of SEQ ID NO: 2, encoding a F5H (furulate 5-hydroxylase) protein consisting of the amino acid sequence of SEQ ID NO: 4
  • a recombinant vector comprising a gene and a recombinant vector comprising a gene encoding Myb63 protein consisting of the amino acid sequence of SEQ ID NO: 8 is transformed to provide a transgenic plant with increased production of sirin compared to wild type.
  • the present invention provides a recombinant vector comprising a gene encoding the recombinant transfer enzyme UGT72E3 / 2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and a gene encoding a CHS (chalcone synthase) protein consisting of the amino acid sequence of SEQ ID NO: 10 It is transformed with a recombinant vector containing to provide a transgenic plant with increased production of sirin compared to wild type.
  • cinafil alcohol which is a substrate of a syringe
  • UGT72E3 / 2 the process of each step of the syringe synthesis pathway and enzymes were used.
  • HCT hydroxycinamoyl-CoA: shikimate / quinqte hydroxycinamoyl transferase
  • a mutant lacking the chalcene synthase (CHS) gene function was used to reduce the amount of coumarin-CoA exiting the flavonoid pathway in the syringe synthesis pathway.
  • Silencing vectors may be used to knock out the CHS gene, but are not limited thereto.
  • knock-out of the present invention means modifying or removing a specific gene from the base sequence so that it cannot be expressed. Generally, the expression of the gene is downregulated or completely suppressed.
  • step (b) it provides a method for producing a transgenic plant with increased syringin synthesis compared to the wild type comprising the step of regenerating the plant from the transformed plant cell of step (a).
  • step (c) crossing the UGT72E3 / 2 protein overexpressing transgenic plant of step (a) and the F5H protein overexpressing transgenic plant of step (b) to select a transgenic plant that simultaneously overexpresses UGT72E3 / 2 protein and F5H protein It provides a method for producing a transgenic plant with increased production of sirin (syringin) compared to the wild type characterized in that it comprises the step of producing.
  • step (c) crossing the UGT72E3 / 2 protein overexpressing transgenic plant of step (a) and the F5H protein overexpressing transgenic plant of step (b) to select a transgenic plant that simultaneously overexpresses UGT72E3 / 2 protein and F5H protein step;
  • the transgenic plant overexpressing the selected UGT72E3 / 2 protein and the F5H protein simultaneously in step (c) and the Myb58 protein overexpressing transgenic plant in step (d) to cross UGT72E3 / 2 protein, F5H protein and Myb58 It provides a method for producing a transgenic plant with increased production of sirin (syringin) compared to the wild type, characterized in that it comprises the step of selecting a transgenic plant overexpressing the protein at the same time.
  • step (c) crossing the UGT72E3 / 2 protein overexpressing transgenic plant of step (a) and the F5H protein overexpressing transgenic plant of step (b) to select a transgenic plant that simultaneously overexpresses UGT72E3 / 2 protein and F5H protein step;
  • the transgenic plants overexpressing the selected UGT72E3 / 2 protein and the F5H protein simultaneously in step (c) and the Myb63 protein overexpressing transgenic plant of step (d) are crosslinked to UGT72E3 / 2 protein, F5H protein and Myb63 It provides a method for producing a transgenic plant with increased production of sirin (syringin) compared to the wild type, characterized in that it comprises the step of selecting a transgenic plant overexpressing the protein at the same time.
  • step (c) UGT72E3 / 2 protein overexpression of the transgenic plant of step (a) and the plant knocked out of the CHS protein coding gene of step (b) to overexpress the UGT72E3 / 2 protein, the expression of CHS protein is suppressed It provides a method for producing a transgenic plant with increased production of syringin compared to the wild type, characterized in that it comprises the step of selecting a transgenic plant.
  • the plant is preferably increased in the synthesis of the syringe in the leaves or roots, and most preferably in the leaves can be increased in the synthesis of syringe, but is not limited thereto.
  • the method of the present invention comprises transforming plant cells with a recombinant vector according to the present invention, which transformation can be mediated by, for example, Agrobacterium tumefiaciens .
  • the method also includes the step of regenerating the transgenic plant from said transformed plant cell.
  • the method for regenerating the transformed plant from the transformed plant cell may use any method known in the art.
  • Transformed plant cells should be re-differentiated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for numerous different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).
  • Myb58 gene used in the present invention is a transcription factor that positively regulates genes involved in the phenylpropanoid biosynthetic pathway, and Myb63, which is known to perform a similar function, may also generate synergistic effects in the production of syringes.
  • the present invention provides a transgenic plant and its seed having increased production of sirin compared to the wild type produced by each of the above methods.
  • the plant is preferably Arabidopsis, tobacco, eggplant, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard, sweet potato, celery, carrot, buttercup, parsley, Chinese cabbage, cabbage, mud, watermelon, melon, cucumber pumpkin, gourd, strawberry, soybean, mung bean, green beans and peas can be dicotyledonous plants, and most preferably may be Arabidopsis, but is not limited thereto.
  • the present invention also provides a composition for increasing the synthesis of syringe in a plant containing a recombinant vector comprising a gene encoding a UGT72E3 / 2 protein consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient.
  • the composition comprises a recombinant vector comprising a gene encoding a UGT72E3 / 2 protein consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, by transforming the recombinant vector to the plant can increase the plant's syringe synthesis will be.
  • the substrate specificity of coniferyl alcohol, a precursor of sirin is very high.
  • glycotransferases As shown in Arabidopsis and grape-derived glycotransferases UGT72B1 and VvGT1, which have already been well studied in tertiary structure, glycotransferases generally have substrates in the deep, narrowly divided gaps between the amino and carboxy terminal regions. The region that determines the specificity (sugar acceptor) and the region that determines the sugar transition activity (sugar donor) shows the form of neighboring each other (FIGS. 2A and 2B). The third structure of UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2 was predicted using the SWISS-MODEL workspace (FIG. 2C).
  • structural changes around the region that determines substrate specificity and the region that determines sugar transfer activity may be related to the difference in substrate specificity and sugar transfer activity of UGT72E2, UGT72E3, UGT72E2 / 3, and UGT72E3 / 2 glycotransferases.
  • the present inventors have reported the ability to transfer sugars to cinafil alcohol, a precursor of sirin, or structurally similar coniferyl alcohol, among the 100 sugar transfer enzymes of Arabidopsis, the UGT72E clade.
  • the enzymatic properties of were investigated.
  • the UGT72E family also has structural features similar to those of the common sugar transfer enzymes, with the amino terminal region having a substrate recognition region and the carboxy terminus having an enzymatic active region for transferring sugar from the sugar activated by UDP to the substrate.
  • the carboxy terminal PSPG (Plant Secondary Product Glucosyltransferase) motif has been reported to be important for the activity of glycotransferases derived from plants.
  • the UGT72E family has glycotransferases UGT72E1, UGT72E2, and UGT72E3 with similar sequences.
  • the UGT72E2 and UGT72E3 genes were divided into amino fragments containing amino acids 1 to 344 at the amino terminus and carboxy fragments containing amino acids from 345 to 481 terminus at the carboxy terminus.
  • the amino fragment contains a region that determines substrate recognition specificity and the carboxy terminus contains a PSPG motif that is important for sugar transfer activity. Substrate specificity is more important than activity in order to efficiently produce sirine in plants, so the amino fragments are made up to about 3/4 of the total, and the carboxy fragments are divided into the minimum size containing the PSPG motif.
  • the recombinant UGT72E2 / 3 gene used in the present invention encodes an amino fragment comprising amino acids 1 to 344 of the amino terminus of UGT72E2 and a carboxy fragment comprising amino acids 345 to 481 of the carboxy terminus of UGT72E3.
  • the recombinant UGT72E3 / 2 gene was prepared by linking genes, and an amino fragment comprising amino acids 1 to 344 of the amino terminus of UGT72E3 and a carboxy fragment comprising amino acids 345 to 481 of the carboxy terminus of UGT72E2. It was prepared by linking the gene encoding the.
  • the vector encoding the UGT72E2 and UGT72E3 gene isolated from the Arabidopsis and the recombinant UGT72E2 / 3 and UGT72E3 / 2 genes produced in the present invention to produce a binary vector to be controlled by the CaMV35S promoter and super promoter Agrobacterium tumefaciens was transferred to AHA tumefaciens EHA105 and the bacteria were transformed by using the bacteria in planta method (FIG. 3).
  • the transgenes of Arabidopsis-derived UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2 are stable among hygromycin-resistant Arabidopsis transformants. Inserted into the genome was expressed using the RT-PCR method.
  • a UGT72E gene-specific forward primer (5'GGTTGGAGCTCGACGTTGGAAAGCGTC 3 '; SEQ ID NO: 13) and a reverse primer (5'TTAAAGCAGGGCATGCCTGC 3) specific for the 3' UTR region of the vector 'SEQ ID NO: 14) combination was used.
  • the Actin 1 gene which is constantly expressed constantly, was used as a reference gene.
  • the transformant lines with similar expression of UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2 genes were finally identified (FIG. 3B).
  • the conversion of cinafil alcohol to syringin by the activity of sugar transfer enzymes in the leaves reduces the production of sinapyl esters that absorb ultraviolet light in the leaves. Therefore, when the leaves of the transformant with enhanced enzyme activity are exposed to ultraviolet rays, the ultraviolet rays are absorbed by the chloroplasts and have a strong red color. When the production of cinafil esters occurs normally on the leaves, the amount of UV absorption by the chloroplasts is reduced, resulting in a very weak red color (Fig. 3C).
  • monoligol produced by activation of the phenylpropanoid synthesis pathway of the leaves of the genus plants is mostly coniferyl alcohol and is converted to coniferin by a sugar transfer enzyme.
  • coniferyl alcohols are converted to sinapyl alcohol, a precursor of sirin, by enzymatic action, and the conversion to sirin is very low due to the activity of low sugar transfer enzymes.
  • Most cinafil alcohols are converted to cinafil esters, which absorb ultraviolet light and serve to protect the leaves.
  • the base sequence of the new recombinant glycotransferase UGT72E3 / 2 gene and the amino acid sequence of the protein encoding the glycotransferase activity increased 48.7% or more while retaining substrate specificity for cinafil alcohol compared to the known glycotransferase UGT72E3. Is shown in FIG. 6.
  • Example 7 Comparison of activity of glycotransferases present in protein extracts prepared from Arabidopsis transformants and wild type leaves overexpressing glycotransferases UGT72E2, UGT72E3, UGT72E2 / 3 and UGT72E3 / 2
  • UGT72E3 / 2 had high substrate specificity for cinafil alcohol and had high glycemic activity, as shown in the previous results already confirmed in vivo .
  • UGT72E3 / 2 was superior to other glycotransferases in the production rate of sirin by substrate addition (FIG. 7).
  • Metabolic methods were used for each step of the phenylpropanoid synthesis pathway and agonizing enzymes to efficiently supply cinafil alcohol, a substrate of sirin, to transformants overexpressing the recombinant sugar transfer enzyme UGT72E3 / 2.
  • Mutants with defects in the chalcene synthase (CHS) gene were used to reduce the amount of comararyl-CoA exiting the flavonoid pathway in the syringe synthesis pathway.
  • a binary vector was prepared to control the Arabidopsis HCT, F5H and Myb58 gene coding regions by a super promoter, and then introduced the vector into Agrobacterium tumefaciens EHA105, followed by the use of the bacteria.
  • Arabidopsis was transformed by in planta method.
  • the kanamycin (HCT and F5H) or herbicide (Myb58) is used to accumulate the HCT, F5H, and Myb58 genes in a pyramidal manner through a hybrid selection method in a UGT72E3 / 2 overexpressing transformant already prepared with a hygromycin resistance selection marker.
  • Arabidopsis transformants were prepared using resistance selection markers.
  • HCT gene specific forward primer HCT-F (5'-CTGGTTACTTTGGGAATGTGATATTCAC-3 '; SEQ ID NO: 15)
  • F5H gene specific forward primer F5H-F (5') to specifically amplify the gene introduced in RT-PCR analysis -CAGACGAGTTGAAGAATCCGACATCGAG-3 '; SEQ ID NO: 16)
  • Myb58 gene specific forward primer Myb58-F (5'-CAGACGAGTTGAAGAATCCGACATCGAG-3'; SEQ ID NO: 17) were used as reverse primers specific for the 3 'UTR region of the vector.
  • the genus plants produce the following three monoligols (monolignol) through the phenylpropanoid synthesis route.
  • H monolignol with p-coumaryl alcohol, G monolignol with coniferyl alcohol and S monolignol with cinafil alcohol are produced.
  • the concentration of coniferyl alcohol in plant cells is relatively high.
  • Overexpression of the sugar transfer enzyme UGT72E2 converts high concentrations of coniferyl alcohol to coniferin.
  • cinafil alcohol Some concentrations of coniferyl alcohol are converted to cinafil alcohol by the enzymatic action of F5H and Caffeic acid 3-O-methyltransferase (COMT), so the concentration of cinafil alcohol, a precursor of the syringe in plant cells, is very low.
  • metabolic control is required to increase the concentration of cinafil alcohol with the high-efficiency sugar transfer enzyme UGT72E3 / 2.
  • transformants overexpressing HCT and UGT72E3 / 2 or F5H and UGT72E3 / 2 genes were isolated from the F2 generation, respectively, and the obedient lines were secured in the next generation.
  • a defect in the chalcene synthase (CHS) which converts p-coumaryl-CoA into chalcones, is deficient.
  • the present invention provides synergistic effects using pyramids of Myb58 gene, which is a positive regulatory transcription factor of the sugar transfer enzyme UGT72E3 / 2 gene, the F5H gene of the phenylpropanoid synthesis pathway, and the gene involved in the lignin synthesis pathway. Sirin production of transformants by quantitative determination was determined by quantitative HPLC analysis.
  • a transformant overexpressing Myb58 gene a transcription factor that specifically positively regulates the lignin biosynthetic pathway in Arabidopsis. Since the Myb58 gene cannot improve the expression of the F5H gene, it crosses the transformant that overexpresses both the UGT72E3 / 2 and F5H genes to select a transformant line that overexpresses all Myb58, UGT72E3 / 2 and F5H genes in the F2 generation. Obedience was secured in the next generation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 시나필 알콜에 대한 뛰어난 효소 특이성으로 시린진 합성 능력이 우수한 재조합 당전이 효소 UGT72E3/2 유전자, 페닐프로파노이드 생합성 경로에 관여하는 F5H, CHS 유전자 및 리그닌 생합성 경로에 관여하는 유전자의 양성 조절 전사인자인 Myb58 유전자를 이용한 대사공학적 방법으로 시린진 생산이 증가된 형질전환 식물체를 제조하는 방법 및 그에 따른 식물체에 관한 것으로, 본 발명을 통해 약리적으로 응용성이 많은 시린진을 다양한 식물체에서 효과적으로 대량생산할 수 있으므로 식·의학적으로 고부가 가치의 농업생물 소재산업의 발달을 가능하게 할 것으로 기대된다.

Description

시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체
본 발명은 시나필 알콜에 대한 뛰어난 효소 특이성으로 시린진 합성 능력이 우수한 재조합 당전이 효소 UGT72E3/2 유전자, 페닐프로파노이드 생합성 경로에 관여하는 F5H, CHS 유전자 및 리그닌 생합성 경로에 관여하는 유전자의 양성 조절 전사인자인 Myb58 유전자를 이용한 대사공학적 방법으로 시린진 생산이 증가된 형질전환 식물체를 제조하는 방법 및 그에 따른 식물체에 관한 것이다.
시린진(syringin)은 리그닌계 배당체로 페닐프로파노이드 합성경로를 통해서 생성된 리그닌 구성 성분인 시나필 알코올(sinapyl alcohol, s type monolignol)이 당전이 효소(UDP-glucose transferase)에 의해서 배당체가 됨으로써 생성된다. 모델 식물체인 애기장대에는 약 100여 종의 당전이 효소가 있으며 식물호르몬을 비롯한 다양한 화합물의 배당체를 형성함으로써 이들 화합물이 세포 내에서 비활성화되고 액포에 저장되는데 관여하는 것으로 보고되고 있다. 이들 중에서 UGT72E2 및 UGT72E3가 각각 특이적으로 코니페릴 알코올(coniferyl alcohol) 및 시나필 알코올(sinapyl alcohol)과 같은 모노리그놀(monolignol)을 우선적으로 배당체로 전환시키는 당전이 효소로 보고되고 있다. 그러나 시린진 생성에 필요한 시나필 알코올 특이적 당전이 효소인 UGT72E3는 시나필 알코올에 대한 기질 특이성은 우수하나 당전이 활성이 낮아서 그 응용성이 매우 제한적이었다. 따라서 식물체에서 효과적으로 시린진을 생산할 수 있는 새로운 당전이 효소의 개발은 기능성 이차대사산물인 시린진의 대량생산 및 응용에 앞서 먼저 해결되어야 할 난제이다.
또한, 식물체 내에서 페닐프로파노이드 합성 경로를 통해서 시린진을 효과적으로 생산하기 위해서는 시린진의 전구체인 시나필 알코올(sinapyl alcohol)에 대한 기질 특이성이 있으면서 당전이 활성이 강한 당전이 효소 및 식물세포 내에 미량으로 존재하는 시나필 알코올의 함량을 증가시킬 수 있는 대사공학적 기술이 필요하다.
특히 엘류테로사이드 B(시린진)는 가시오가피의 스트레스에 대한 우수한 정신적 육체적 적응력 효능이 있는 약리적 성분으로 식물 유래의 대표적 적응원(Adaptogen)으로 분류되고 있다. 적응원이란 다양한 스트레스에 반응하여 부작용 없이 생체의 비특이성 저항력을 증가시키는 식물 이차대사산물을 일컫는 말이다. 최근에 순수 분리된 시린진이 현대 도시인의 건강에 가장 문제가 되고 있는 당뇨병과 우울증 치료에도 우수한 효능을 보이는 것으로 보고됨으로써 그 응용성이 더욱 확대되고 있다. 그러나 가시오가피의 재배 지역이 제한적이며 재배 지역에 따른 약리성분의 차이가 많아 상업적 이용을 위한 시린진 생산에 필요한 가시오가피의 안정적 공급이 어렵다. 따라서 생명공학 기술을 이용한 식물대사 경로의 조절을 통하여 시린진과 같은 고부가 가치 산물인 식물 이차대사 산물의 안정적 생산기술 개발이 필요하다.
한편, 한국공개특허 제2004-0004764호에는 '간독성에 대한 보호 활성을 갖는 가시오가피 추출물 또는 이로부터 부탄올로 분획한 분획층과 부탄올 분획층에서 분리한 시린진과 시린가레시놀-디-오-베타-글루코피라노사이드를 함유하는 항산화작용과 간독성 보호 활성을 갖는 조성물'이 개시되어 있고, 한국공개특허 제1998-0072707호에는 '간기능보호작용을 가지는 시린진의 약학적 조성물'이 개시되어 있으나, 본 발명의 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체에 대해서는 밝혀진 바가 전혀 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명에서는 기질 특이성은 강하게 유지되면서 당전이 활성이 강화된 새로운 재조합 당전이 효소를 제조하기 위해서 UGT72E2 및 UGT72E3 유전자들로부터 도메인 스와핑(domain swapping) 방법을 이용해서 재조합 유전자 UGT72E2/3와 UGT72E3/2를 각각 과발현하는 애기장대 형질전환체를 제조하였고, 시린진의 합성 효율을 정량적으로 각각 비교한 결과, 새롭게 제조된 재조합 당전이 효소 UGT72E3/2이 야생형에 비해 시린진 합성이 현저히 증가된 것을 확인하였다.
또한, 식물체 내의 대사경로 조절을 통해 시린진의 생산을 증가시키기 위하여 페닐프로파노이드 합성 경로에서 기질들의 흐름 조절에 중요한 단계를 조절하는 F5H 및 HCT 유전자를 과발현하는 형질전환체, CHS 유전자 기능이 결함된 형질전환체 및 리그닌 합성 경로의 양성 조절 전사인자인 Myb58을 과발현하는 애기장대 형질전환체를 각각 제작하였고, 상기 형질전환체와 재조합 당전이 효소 UGT72E3/2를 과발현시킨 형질전환체를 교배시킨 후 시린진의 합성 효율을 정량적으로 비교한 결과, 새롭게 제조된 UGT72E3/2, F5H 및 Myb58 단백질을 동시에 과발현하는 형질전환 식물체에서 시린진의 생산량이 UGT72E3/2 단백질만이 과발현될 때에 비해 10배 이상 증가된 것을 확인함으로써 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 제공한다.
또한, 본 발명은 상기 UGT72E3/2 단백질을 코딩하는 유전자를 제공한다.
또한, 본 발명은 상기 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 제공한다.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.
또한, 본 발명은 상기 재조합 벡터로 식물세포를 형질전환시켜 UGT72E3/2 유전자를 과발현시키는 단계를 포함하는 야생형에 비해 식물체 내의 시린진(syringin) 합성을 증가시키는 방법을 제공한다.
또한, 본 발명은 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터, F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 Myb58 또는 Myb63 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 CHS(chalcone synthase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 상기 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 UGT72E3/2 단백질 과발현 형질전환 식물체와 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하는 야생형에 비해 시린진 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체와 Myb58 또는 Myb63 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질, F5H 단백질 및 Myb58 또는 Myb63 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하는 야생형에 비해 시린진 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 UGT72E3/2 단백질 과발현 형질전환 식물체와 CHS 단백질 코딩 유전자가 녹아웃된 식물체를 교배하여 UGT72E3/2 단백질을 과발현하고, CHS 단백질의 발현이 억제된 형질전환 식물체를 선발하는 단계를 포함하는 야생형에 비해 시린진 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 각각의 방법에 의해 제조된 야생형에 비해 시린진 생산이 증가된 형질전환 식물체 및 이의 종자를 제공한다.
또한, 본 발명은 서열번호 1의 염기서열로 이루어진 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 유효성분으로 함유하는 식물체 내의 시린진 합성 증가용 조성물을 제공한다.
본 발명에 의하면, 최근 현대 도시인의 건강에 가장 문제가 되고 있는 당뇨병과 우울증 치료에 우수한 효능을 보이는 것으로 보고됨으로써 그 응용성이 더욱 확대되고 있는 식물 유래의 시린진을 식물체에서 효과적으로 대량생산할 수 있는 재조합 당전이 효소 UGT72E3/2 단백질의 코딩 유전자 및 식물체 내에서 페닐프로파노이드 합성 경로에 관여하는 F5H, CHS 및 Myb58 유전자 조절을 통한 대사공학적 방법에 의한 시린진의 전구체인 시나필 알콜의 충분한 생산 및 재조합 당전이 효소 UGT72E3/2를 이용한 당전이 활성의 강화에 의한 시너지 효과는 약리적으로 응용성이 많은 시린진을 다양한 식물체에서 효과적으로 대량생산할 수 있는 새로운 방법을 제공함으로써 식·의학적으로 고부가 가치의 농업생물 소재산업의 발달을 가능하게 할 것으로 기대된다.
도 1은 애기장대 당전이 효소 UGT72E2 및 UGT72E3의 1차 및 2차 구조를 비교한 것이다.
도 2는 애기장대와 포도 유래의 당전이 효소 UGT72B1(A) 및 VvGT1(B), 애기장대 유래의 당전이 효소 UGT72E2 및 UGT72E3, 본 발명에서 제조된 재조합 당전이 효소 UGT72E2/3 및 UGT72E3/2(C)의 3차 구조를 비교한 것이다.
도 3은 본 발명의 형질전환체 제조에 이용된 재조합 벡터(A), 형질전환체로 전이된 유전자의 발현 정도(B), 자외선에 대한 형질전환체 잎에서의 반응성(C)을 나타낸 것이다.
도 4는 애기장대 야생형과 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2인 4종의 당전이 유전자를 각각 과발현하는 형질전환체의 잎에서의 코니페린 및 시린진 생성의 정량적 HPLC 분석을 나타낸 것이다((C)의 각 크로마토그램의 피크: 1, 코니페릴 알코올 4-O-글루코시드(코니페린); 2, 시나필 알코올 4-O-글루코시드(시린진); 3, 코니페릴 알코올; 4, 시나필 알코올).
도 5는 애기장대 야생형과 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2인 4종의 당전이 유전자를 각각 과발현하는 형질전환체의 뿌리에서의 코니페린 및 시린진 생성의 정량적 HPLC 분석을 나타낸 것이다((C)의 각 크로마토그램의 피크: 1, 코니페릴 알코올 4-O-글루코시드(코니페린); 2, 시나필 알코올 4-O-글루코시드(시린진); 3, 코니페릴 알코올; 4, 시나필 알코올).
도 6은 재조합 당전이 효소 UGT72E3/2 염기서열과 아미노산 서열을 나타낸 것이다.
도 7은 당전이 효소 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2 유전자를 각각 과발현하는 애기장대 형질전환체 및 야생형 잎에서 제작한 단백질 추출물에 존재하는 당전이 효소 활성을 비교한 결과로서, 형질전환 식물체의 잎의 단백질 추출물에 코니페릴 알코올 또는 시나필알코올을 첨가하고 60분간 반응 후 생성되는 코니페린과 시린진을 측정함으로써 각 형질전환체의 단백질 추출물에 존재하는 당전이 효소의 활성을 간접적으로 측정한 것이다. (A) 코니페린 생성량, (B) 시린진 생성량.
도 8은 시린진 합성을 위한 페닐프로파노이드 합성 경로 및 본 발명에서 사용한 유전자의 조절 부위를 나타낸다.
도 9는 HCT, F5H 및 Myb58 유전자를 각각 과발현하는 애기장대 형질전환체에서 각 유전자의 발현량을 RT-PCR로 확인한 결과이다. 대조구로 액틴2 유전자를 사용하였다.
도 10은 당전이 효소 UGT72E3/2 유전자와 페닐프로파노이드 합성 경로의 HCT, F5H 및 CHS 유전자의 시너지 효과를 조사하기 위해서 야생형을 포함하여 다양한 조합의 유전자가 발현되는 형질전환체 잎에서의 코니페린(A) 및 시린진(B) 생산의 정량적 HPLC 분석을 나타낸다. (C) 각 크로마토그램의 피크 1은 코니페릴 알코올 4-O-글루코시드(코니페린)를 나타내고, 피크 2는 시나필 알코올 4-O-글루코시드(시린진)를 나타낸다.
도 11은 당전이 효소 UGT72E3/2 유전자와 페닐프로파노이드 합성 경로의 HCT, F5H 및 CHS 유전자의 시너지 효과를 조사하기 위해서 야생형을 포함하여 다양한 조합의 유전자가 발현되는 형질전환체 뿌리에서의 코니페린(A) 및 시린진(B) 생산의 정량적 HPLC 분석을 나타낸다. (C) 각 크로마토그램의 피크 1은 코니페릴 알코올 4-O-글루코시드(코니페린)를 나타내고, 피크 2는 시나필 알코올 4-O-글루코시드(시린진)를 나타낸다.
도 12는 당전이 효소 UGT72E3/2 유전자와 페닐프로파노이드 합성 경로의 F5H 유전자 및 리그닌 합성 경로에 관여하는 유전자들의 양성 조절 전사인자인 Myb58 유전자의 피라미딩에 의한 시너지 효과에 의해서 형질전환체 잎에서 코니페린(A) 및 시린진(B) 생산이 획기적으로 증가되는 것을 정량적 HPLC 분석으로 나타낸 결과이다. (C) 각 크로마토그램의 피크 1은 코니페릴 알코올 4-O-글루코시드(코니페린)를 나타내고, 피크 2는 시나필 알코올 4-O-글루코시드(시린진)를 나타낸다.
도 13은 당전이 효소 UGT72E3/2 유전자와 페닐프로파노이드 합성 경로의 F5H 유전자 및 리그닌 합성 경로에 관여하는 유전자들의 양성 조절 전사인자인 Myb58 유전자의 축적에 의한 시너지 효과가 형질전환체의 뿌리에서는 큰 영향을 미치지 않는다는 것을 HPLC 분석으로 나타낸 결과이다. (C) 각 크로마토그램의 피크 1은 코니페릴 알코올 4-O-글루코시드(코니페린)를 나타내고, 피크 2는 시나필 알코올 4-O-글루코시드(시린진)를 나타낸다.
도 14는 UGT72E3/2, F5H 및 Myb58 유전자를 과발현하는 애기장대 형질전환체와 UGT72E3/2와 F5H 유전자를 과발현하는 애기장대 형질전환체 그리고 야생형에서의 페닐프로파노이드 합성 경로에 관여하는 다양한 유전자의 발현량을 RT-PCR로 확인한 결과이다. 대조구로 액틴2 유전자를 사용하였다.
본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 제공한다.
본 발명에 따른 재조합 당전이 효소 UGT72E3/2 단백질의 범위는 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 식물체 내의 시린진(syringin) 합성 증가를 의미한다.
본 발명은 또한 재조합 당전이 효소 UGT72E3/2 단백질의 단편, 유도체 및 유사체(analogues)를 포함한다. 본원에 사용된, 용어 "단편", "유도체" 및 "유사체"는 본 발명의 재조합 당전이 효소 UGT72E3/2 폴리펩티드와 실질적으로 같은 생물학적 기능 또는 활성을 보유하는 폴리펩티드를 말한다. 본 발명의 단편, 유도체 및 유사체는 (i) 하나 이상의 보존적(conservative) 또는 비보존적 아미노산 잔기(바람직하게는 보존적 아미노산 잔기)가 치환된 폴리펩티드(상기 치환된 아미노산 잔기는 유전암호에 의해 암호화될 수도, 되지 않을 수도 있다) 또는 (ii) 하나 이상의 아미노산 잔기에서 치환기(들)를 가지는 폴리펩티드, 또는 (iii) 또 다른 화합물(폴리펩티드의 반감기를 연장할 수 있는 화합물, 예를 들면 폴리에틸렌 글리콜)과 결합된 성숙 폴리펩티드로부터 유래된 폴리펩티드, 또는 (iv) 부가적인 아미노산 서열(예를 들면, 선도 서열, 분비 서열, 상기 폴리펩티드를 정제하는데 사용된 서열, 프로테이노젠(proteinogen) 서열 또는 융합 단백질)과 결합된 상기 폴리펩티드로부터 유래된 폴리펩티드일 수 있다. 본원에 정의된 상기 단편, 유도체 및 유사체는 당업자에 잘 알려져 있다.
서열번호 2로 표시되는 성숙(mature) 폴리펩티드를 암호화하는 폴리뉴클레오티드는 오직 성숙 폴리펩티드만을 암호화하는 코딩 서열; 성숙 폴리펩티드 및 다양한 부가적인 코딩 서열을 암호화하는 서열; 성숙 폴리펩티드(및 임의의 부가적인 코딩 서열) 및 넌코딩 서열을 암호화하는 서열을 포함한다.
용어 "폴리펩티드를 암호화하는 폴리뉴클레오티드"는 폴리펩티드를 암호화하는 폴리뉴클레오티드, 또는 부가적인 코딩 및/또는 넌코딩 서열을 더 포함하는 폴리뉴클레오티드를 말한다.
또한, 본 발명은 본원에 기재된 것과 동일한 아미노산 서열, 또는 이의 단편, 유사체 및 유도체를 포함하는 폴리펩티드를 암호화하는 상기 폴리뉴클레오티드의 변이체에 관한 것이다. 폴리뉴클레오티드 변이체는 자연적으로 발생하는 대립유전자 변이체 또는 비자연적으로 발생하는 변이체일 수 있다. 상기 뉴클레오티드 변이체는 치환 변이체, 결실 변이체 및 삽입 변이체를 포함한다. 당업계에 공지된 바와 같이, 대립유전자 변이체는 폴리뉴클레오티드의 대안(alternative)이며, 이는 하나 이상의 치환, 결실 또는 삽입된 뉴클레오티드를 포함할 수 있으며, 변이체에 의해 암호화된 폴리펩티드에서 실질적인 기능 변화를 초래하지는 않는다.
또한, 본 발명은 상기 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 제공한다.
본 발명에 따른 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자는 애기장대 유래의 UGT72E3 및 UGT72E2 유전자로부터 도메인 스와핑(domain swapping) 방법을 이용해서 제조하였다.
본 발명에서는 시린진 생성율을 증가시키기 위해서 UGT72E3처럼 시나필 알코올(sinapyl alcohol)에 대한 기질 특이성은 유지하고 UGT72E2처럼 당전이 활성이 높은 새로운 재조합 당전이 효소를 제조하기 위해서 UGT72E2 및 UGT72E3 유전자들로부터 도메인 스와핑(domain swapping) 방법을 이용해서 재조합 유전자 UGT72E2/3 및 UGT72E3/2를 제조하였다.
먼저, 애기장대의 100여 개의 당전이 효소들 중에서 시린진의 전구물질인 시나필 알코올 또는 구조적으로 유사한 코니페릴 알코올에 당을 전이할 수 있는 능력이 있다고 보고된 당전이 효소 UGT72E 계통군(clade)의 효소적 특성을 조사하였다. UGT72E 계통군 또한 일반적인 당전이 효소와 비슷한 구조적 특징을 가지고 있는데, 아미노 말단 영역은 기질 인식 영역을 가지며 카르복시 말단은 UDP에 의해서 활성화된 당으로부터 당을 기질에 전이하는 효소적 활성 영역을 가지고 있고, 특히 카르복시 말단의 PSPG(Plant Secondary Product Glucosyltransferase) 모티프가 식물체 유래의 당전이 효소의 활성에 중요한 것으로 보고되고 있다. UGT72E 계통군에는 염기서열이 유사한 당전이 효소 UGT72E1, UGT72E2 및 UGT72E3가 있다.
본 발명에서는 UGT72E2 및 UGT72E3을 각각 아미노 말단의 1번에서 344번까지의 아미노산을 포함하는 아미노 단편과 345번부터 카르복시 말단의 481번까지의 아미노산을 포함하는 카르복시 단편으로 이분하였다. 아미노 단편은 기질인식 특이성을 결정하는 영역을 포함하고 카르복시 말단은 당전이 활성에 중요한 PSPG 모티프를 포함하고 있다. 식물체 내에서 시린진을 효율적으로 생산하기 위해서는 기질 특이성이 당전이 활성보다 중요하므로 정확히 이등분하지 않고 아미노 단편을 전체의 3/4 정도로 크게 하고 카르복시 단편은 PSPG 모티프를 포함하는 최소 크기로 나누었다. 결과적으로, 본 발명의 재조합 UGT72E3/2 유전자는 UGT72E3의 아미노 말단의 1번에서 344번까지의 아미노산을 포함하는 아미노 단편과 UGT72E2의 345번부터 카르복시 말단의 481번까지의 아미노산을 포함하는 카르복시 단편을 코딩하는 유전자를 연결하여 제조하였다.
본 발명의 유전자는 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 DNA 또는 RNA 일 수 있다. DNA는 cDNA, 게놈 DNA 또는 인위적인 합성 DNA를 포함한다. DNA는 단일 가닥 또는 이중 가닥일 수 있다. DNA는 코딩(coding) 가닥 또는 넌코딩(non-coding) 가닥일 수 있다.
바람직하게는, 본 발명의 상기 유전자는 서열번호 1의 염기서열을 포함할 수 있다. 또한, 상기 염기 서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
또한, 본 발명은 상기 기재된 서열번호 1의 염기서열과 적어도 50%, 바람직하게는 적어도 70%, 더욱 바람직하게는 적어도 80%의 동일성을 가지는 서열과 혼성화하는 폴리뉴클레오티드에 관한 것이다. 본 발명은 특히, 스트린전트 조건하에 본원에 기재된 폴리뉴클레오티드에 혼성화하는 폴리뉴클레오티드에 관한 것이다. 본 발명에서, "스트린전트 조건"은 (1) 0.2 × SSC, 0.1% SDS, 60℃와 같은 더 낮은 이온강도 및 더 높은 온도하에서의 혼성화 및 세척; 또는 (2) 50%(v/v) 포름아미드, 0.1% 소혈청/0.1% Ficoll 및 42℃ 등과 같은 변성제의 존재하에 혼성화; 또는 (3) 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 95% 이상의 동일성을 가지는 단지 2개의 서열 사이에서 발생하는 혼성화를 말한다. 게다가, 혼성화가 가능한 폴리뉴클레오티드에 의해 암호화된 폴리펩티드의 생물학적 기능 및 활성은 서열번호 2로 표시되는 성숙 폴리펩티드의 생물학적 기능 및 활성과 동일하다.
본 발명은 또한, 상기 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 제공한다.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로써 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 발명의 재조합 식물 발현 벡터는 외래 유전자를 도입한 식물체 내에서 일시적으로 발현시킬 수 있는 일시적(transient) 발현 벡터 및 외래 유전자를 도입된 식물체에서 영구적으로 발현시킬 수 있는 식물 발현 벡터로 사용할 수 있다.
본 발명에 이용될 수 있는 바이너리 벡터는 A. tumefaciens의 Ti 플라스미드와 함께 존재 시 식물체를 형질전환시킬 수 있는 T-DNA의 RB (right border)과 LB (left border)을 함유하는 어떤 바이너리 벡터도 될 수 있으나, 바람직하게는 당업계에서 자주 사용되는 pBI101(Cat#: 6018-1, Clontech, 미국), pBIN19(Genbank 수탁번호 U09365), pBI121, pCAMBIA 벡터 등을 사용하는 것이 좋다.
용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다. 용어 "발현 벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 진핵세포에서 이용가능한 프로모터, 인핸서, 종결신호 및 폴리아데닐레이션 신호는 공지되어 있다.
식물 발현 벡터의 바람직한 예는 아그로박테리움 투머파시엔스와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리 벡터이다. 본 발명에 따른 유전자를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환 하는 것이 어려울 때 유리할 수 있다.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함한다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신과 같은 제초제 저항성 유전자, 카나마이신, 엠피실린(Ampicillin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현 예에 따른 식물 발현 벡터에서, 프로모터는 CaMV 35S, 액틴, 유비퀴틴, pEMU, MAS 또는 히스톤 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "구성적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 구성적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 구성적 프로모터는 선택 가능성을 제한하지 않는다.
본 발명의 일 구현 예에 따른 식물 발현 벡터에서, 터미네이터는 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α-아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 튜머파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터 등이 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.
본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서, 효모(Saccharomyce cerevisiae), 곤충세포, 사람세포(예컨대, CHO 세포주(Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 및 식물세포 등이 이용될 수 있다. 숙주세포는 바람직하게는 식물세포이다.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은 미세주입법, 칼슘포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법, DEAE-덱스트란 처리법 및 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.
또한, 본 발명은 상기 재조합 벡터로 식물세포를 형질전환시켜 UGT72E3/2 유전자를 과발현시키는 단계를 포함하는 야생형에 비해 식물체 내의 시린진(syringin) 합성을 증가시키는 방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에서, 상기 UGT72E3/2 유전자는 서열번호 1의 염기서열로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터, 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 6의 아미노산 서열로 이루어진 Myb58 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터, 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 8의 아미노산 서열로 이루어진 Myb63 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체를 제공한다.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 10의 아미노산 서열로 이루어진 CHS(chalcone synthase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체를 제공한다.
본 발명에서는 재조합 당전이 효소 UGT72E3/2를 과발현하는 형질전환체에 시린진의 기질인 시나필 알코올을 효율적으로 공급하기 위하여 시린진 합성 경로의 각 단계별 과정 및 작용 효소들을 이용하였는데, 쿠마릴(coumaryl)-CoA의 페닐프로파노이드 합성 경로 진입을 강화하기 위해서 HCT(hydroxycinamoyl-CoA:shikimate/quinqte hydroxycinamoyl transferase) 유전자를 과발현시키고, 코니페릴 알코올로 전환되는 코니페릴 알데하이드의 양을 줄이고 시나필 알코올로의 전환을 촉진하기 위하여 F5H(ferulate 5-hydroxylase) 유전자를 과발현시켰다. 또한, 시린진 합성 경로 중에서 쿠마릴-CoA가 플라보노이드(flavonoid) 경로로 빠져나가는 양을 감소시키기 위해서 CHS(chalcone synthase) 유전자 기능이 결함된 돌연변이체를 사용하였다. 상기 CHS 유전자를 녹아웃(knock-out)시키기 위해 침묵 벡터(silencing vector)를 사용할 수 있으나, 이에 제한되지 않는다.
본 발명의 용어 "녹아웃(knock-out)"은 염기서열 중 특정 유전자가 발현될 수 없도록 이를 변형 또는 제거하는 것을 의미하며 일반적으로 유전자의 발현이 하향조절(downregulation) 또는 완전히 억제(suppression)되는 현상을 말한다.
또한, 본 발명은
(a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및
(b) 상기 (a)단계의 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 야생형에 비해 시린진(syringin) 합성이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은
(a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
(b) 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 F5H 단백질 과발현 형질전환 식물체를 제조하는 단계; 및
(c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은
(a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
(b) 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 F5H 단백질 과발현 형질전환 식물체를 제조하는 단계;
(c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계;
(d) 서열번호 6의 아미노산 서열로 이루어진 Myb58 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 Myb58 단백질 과발현 형질전환 식물체를 제조하는 단계;
(e) 상기 (c)단계의 선발된 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체와 상기 (d)단계의 Myb58 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질, F5H 단백질 및 Myb58 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은
(a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
(b) 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 F5H 단백질 과발현 형질전환 식물체를 제조하는 단계;
(c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계;
(d) 서열번호 8의 아미노산 서열로 이루어진 Myb63 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 Myb63 단백질 과발현 형질전환 식물체를 제조하는 단계;
(e) 상기 (c)단계의 선발된 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체와 상기 (d)단계의 Myb63 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질, F5H 단백질 및 Myb63 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은
(a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
(b) 서열번호 10의 아미노산 서열로 이루어진 CHS(chalcone synthase) 단백질을 코딩하는 유전자가 녹아웃(knock-out)된 식물체를 제조하는 단계; 및
(c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 CHS 단백질 코딩 유전자가 녹아웃된 식물체를 교배하여 UGT72E3/2 단백질을 과발현하고, CHS 단백질의 발현이 억제된 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에서, 상기 식물체는 바람직하게는 잎 또는 뿌리에서 시린진 합성이 증가되고, 가장 바람직하게는 잎에서 시린진 합성이 증가될 수 있으나, 이에 제한되지 않는다.
본 발명의 방법은 본 발명에 따른 재조합 벡터로 식물 세포를 형질전환하는 단계를 포함하는데, 상기 형질전환은 예를 들면, 아그로박테리움 튜머파시엔스(Agrobacterium tumefiaciens)에 의해 매개될 수 있다. 또한, 본 발명의 방법은 상기 형질전환된 식물 세포로부터 형질전환 식물을 재분화하는 단계를 포함한다. 형질전환 식물 세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.
형질전환된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다(Handbook of Plant Cell Culture, 1-5권, 1983-1989 Momillan, N.Y.).
본 발명에서 사용한 Myb58 유전자는 페닐프로파노이드 생합성 경로에 관여하는 유전자들을 양성 조절하는 전사인자로서, 이와 유사 기능을 수행하는 것으로 알려진 Myb63 또한 시린진 생산 과정에서 시너지 효과를 발생할 수 있을 것으로 판단된다.
또한, 본 발명은 상기 각각의 방법에 의해 제조된 야생형에 비해 시린진 생산이 증가된 형질전환 식물체 및 이의 종자를 제공한다.
본 발명의 일 구현 예에 따른 식물체에서, 상기 식물체는 바람직하게는 애기장대, 담배, 가지, 고추, 토마토, 우엉, 쑥갓, 상추, 도라지, 시금치, 근대, 고구마, 샐러리, 당근, 미나리, 파슬리, 배추, 양배추, 갯무, 수박, 참외, 오이 호박, 박, 딸기, 대두, 녹두, 강낭콩 및 완두인 쌍자엽 식물일 수 있고, 가장 바람직하게는 애기장대일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 서열번호 1의 염기서열로 이루어진 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 유효성분으로 함유하는 식물체 내의 시린진(syringin) 합성 증가용 조성물을 제공한다. 상기 조성물은 유효성분으로 서열번호 1의 염기서열로 이루어진 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 포함하며, 상기 재조합 벡터를 식물체에 형질전환시킴으로써 식물체의 시린진 합성을 증가시킬 수 있는 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
본 발명에 사용한 유전자 및 염기서열 정보
본 발명에 사용한 유전자 및 염기서열 정보는 하기 표 1과 같다.
표 1
유전자명 염기서열 번호 아미노산 서열 번호
UGT72E3/2 1 2
F5H 3 4
Myb58 5 6
Myb63 7 8
CHS 9 10
HCT 11 12
실시예 1. 애기장대 당전이 효소 UGT72E2 및 UGT72E3의 1차 및 2차 구조
본 실시예에서는 식물체 내에서 약리적으로 응용성이 많은 시린진 생산에 유용한 새로운 당전이 효소를 개발하기 위해서, 당전이 효율은 매우 우수하나 시린진의 전구체인 코니페릴 알코올(coniferyl alcohol)에 대한 기질 특이성이 약한 UGT72E2와 시나필 알코올(sinapyl alcohol)에 대한 기질 특이성은 우수하나 당전이 효율이 낮은 단점이 있는 UGT72E3 단백질의 1차 및 2차 구조를 SWISS-MODEL workspace를 이용하여 서로 비교하였다(도 1). 두 효소의 장점을 모두 갖춘 새로운 재조합 당전이 효소를 제작하기 위한 도메인 스와핑을 위한 전단계로 당전이 활성에 중요한 PSPG 모티프를 포함하는 카르복시 말단과 기질 특이성을 결정하는 아미노 말단의 1차 및 2차 구조적 차이점들과 도메인 스와핑이 일어나는 부위를 표시하였다
실시예 2. 애기장대 당전이 효소 UGT72E2 및 UGT72E3, 새롭게 제조된 재조합 당전이 효소 UGT72E2/3 및 UGT72E3/2의 3차 구조
이미 3차 구조 연구가 잘 이루진 애기장대와 포도 유래의 당전이 효소 UGT72B1 및 VvGT1에서 나타나는 바와 같이 일반적으로 당전이 효소는 구조적으로 아미노 말단 영역과 카르복시 말단 영역의 경계부분의 깊고 좁게 갈라진 틈에 기질 특이성을 결정하는 영역(sugar acceptor)과 당전이 활성을 결정하는 영역(sugar donor)이 서로 이웃하는 형태를 보인다(도 2A 및 2B). SWISS-MODEL workspace를 이용하여 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2의 3차 구조를 예상하였다(도 2C). 특히 기질 특이성을 결정하는 영역과 당전이 활성을 결정하는 영역 주변의 구조적 변화가 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2 당전이 효소들의 기질 특이성과 당전이 활성의 차이에 관여할 것으로 추정된다.
실시예 3. 형질전환체 생산에 이용된 재조합 벡터, 형질전환체로 전이된 유전자의 발현 정도 및 자외선에 대한 형질전환체의 표현형
본 발명자는 애기장대의 100여 개의 당전이 효소들 중에서 시린진의 전구물질인 시나필 알코올 또는 구조적으로 유사한 코니페릴 알코올에 당을 전이할 수 있는 능력이 있다고 보고된 당전이 효소 UGT72E 계통군(clade)의 효소적 특성을 조사하였다. UGT72E 계통군 또한 일반적인 당전이 효소와 비슷한 구조적 특징을 가지고 있는데, 아미노 말단 영역은 기질인식 영역을 가지며 카르복시 말단은 UDP에 의해서 활성화된 당으로부터 당을 기질에 전이하는 효소적 활성영역을 가지고 있고, 특히 카르복시 말단의 PSPG (Plant Secondary Product Glucosyltransferase) 모티프가 식물체 유래의 당전이 효소의 활성에 중요한 것으로 보고되고 있다. UGT72E 계통군에는 염기서열이 유사한 당전이 효소 UGT72E1, UGT72E2 및 UGT72E3가 있다.
본 발명에서는 UGT72E2 및 UGT72E3 유전자들을 각각 아미노 말단의 1번에서 344번까지의 아미노산을 포함하는 아미노 단편과 345번부터 카르복시 말단의 481번까지의 아미노산을 포함하는 카르복시 단편으로 이분하였다. 아미노 단편은 기질인식 특이성을 결정하는 영역을 포함하고 카르복시 말단은 당전이 활성에 중요한 PSPG 모티프를 포함하고 있다. 식물체 내에서 시린진을 효율적으로 생산하기 위해서는 기질 특이성이 당전이 활성보다 중요하므로 정확히 이등분하지 않고 아미노 단편을 전체의 3/4 정도로 크게 하고 카르복시 단편은 PSPG 모티프를 포함하는 최소 크기로 나누었다.
본 발명에서 사용한 재조합 UGT72E2/3 유전자는 UGT72E2의 아미노 말단의 1번에서 344번까지의 아미노산을 포함하는 아미노 단편과 UGT72E3의 345번부터 카르복시 말단의 481번까지의 아미노산을 포함하는 카르복시 단편을 코딩하는 유전자를 연결하여 제조하였고, 재조합 UGT72E3/2 유전자는 UGT72E3의 아미노 말단의 1번에서 344번까지의 아미노산을 포함하는 아미노 단편과 UGT72E2의 345번부터 카르복시 말단의 481번까지의 아미노산을 포함하는 카르복시 단편을 코딩하는 유전자를 연결하여 제조하였다.
본 발명에서는 애기장대로부터 분리된 UGT72E2 및 UGT72E3 유전자와 본 발명에서 새롭게 제작한 재조합 UGT72E2/3 및 UGT72E3/2 유전자의 코딩 영역을 CaMV35S 프로모터와 수퍼프로모터에 의해 조절되도록 바이너리 벡터를 제작한 후 이 벡터를 아그로박테리움 투머파시엔스(A. tumefaciens) EHA105로 옮긴 다음 이 박테리아를 사용하여 애기장대를 인 플랜타(in planta) 방법으로 형질전환 시켰다(도 3).
형질전환체의 표현형은 도입된 전이유전자의 발현 정도에 의해서 크게 영향을 받으므로 하이그로마이신 저항성 애기장대 형질전환체들 중에서 애기장대 유래의 전이유전자 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2를 안정적으로 유전체에 삽입되어 발현되는 양을 RT-PCR 방법을 이용해서 조사하였다. 이때 도입된 유전자를 특이적 증폭하기 위해서 UGT72E 유전자 특이적 정방향 프라이머(forward primer: 5’GGTTGGAGCTCGACGTTGGAAAGCGTC 3’; 서열번호 13)와 벡터의 3' UTR 영역에 특이적인 역방향 프라이머(reverse primer: 5’TTAAAGCAGGGCATGCCTGC 3’; 서열번호 14) 조합을 이용하였다. RNA의 상대적인 양을 보정하기 위해서 항상 일정하게 발현하는 애기장대의 액틴1 유전자를 참고 유전자로 사용하였다. 조사된 각 유전자 별로 15개의 형질전환체 중에서 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2 유전자의 발현이 비슷한 형질전환체 라인들을 최종 확인하였다(도 3B). 잎에서의 당전이 효소의 활성에 의한 시나필 알코올의 시린진으로의 전환은 잎에서 자외선을 흡수하는 시나필 에스터(sinapyl ester)의 생성을 감소시킨다. 따라서 당전이 효소 활성이 강화된 형질전환체의 잎이 자외선에 노출이 되면 자외선은 주로 엽록체에 의해서 흡수되어 강한 붉은 색을 띤다. 잎에서 시나필 에스터의 생성이 정상적으로 일어나면 엽록체에 의한 자외선 흡수량이 감소되어 매우 약한 붉은 색을 띤다(도 3C).
실시예 4. 형질전환체의 잎에서의 코니페린과 시린진 생성의 정량적 HPLC 분석
일반적으로 속씨 식물의 잎의 페닐프로파노이드 합성경로의 활성화에 의해서 생성되는 모노리그놀(monolignol)은 대부분 코니페릴 알코올(coniferyl alcohol)로 당전이 효소에 의해서 코니페린으로 전환된다. 극히 일부의 코니페릴 알코올이 효소적 작용에 의해서 시린진의 전구물질인 시나필 알코올(sinapyl alcohol)로 전환되고 낮은 당전이 효소의 활성에 의해서 시린진으로의 전환율은 매우 낮다. 대부분의 시나필 알코올은 자외선을 흡수하여 잎을 보호하는 기능을 하는 시나필 에스터로 전환된다. 따라서 코니페릴 알코올에 대한 기질 특이성이 강한 UGT72E2 유전자의 과발현은 코니페린의 생성을 증가시키고 시나필 알코올에 대한 기질 특이성이 강한 UGT72E3 유전자의 과발현은 시린진의 생성을 상대적으로 증가시켰다(도 4A 및 4B). 재조합 유전자 UGT72E3/2 유전자의 과발현은 UGT72E3 유전자의 과발현에 비교해서 잎에서 48.7%의 시린진 생성 증가 효과를 보였다(도 4B 및 4C).
실시예 5. 형질전환체의 뿌리에서의 코니페린 및 시린진 생성의 정량적 HPLC 분석
항상 빛에 노출되어 있는 잎과 달리 식물의 뿌리는 빛에 노출이 되면 빛 신호전달 기작에 의해서 페닐프로파노이드 합성경로에 관여하는 다양한 유전자의 발현이 증가된다. 그 결과 많은 양의 코니페릴 알코올 및 시나필 알코올을 포함하는 모노리그놀의 합성이 증가된다. 같은 조건에서 배양된 야생형 식물체의 잎에선 거의 검출이 되지 않았던 코니페린과 시린진의 생성이 크게 증가 하였으나 여전히 시린진의 생성율은 코니페린의 25% 수준으로 낮았다. 당전이 효소의 활성이 강하고 코니페릴 알코올에 대한 기질 특이성이 강한 UGT72E2 유전자를 과발현하는 형질전환체의 뿌리에 코니페린의 생성이 2배 이상 증가하였으나 시린진의 생성은 크게 변화가 없었다(도 5B 및 5C). 당전이 효소의 활성이 약하고 시나필 알코올에 대한 기질 특이성이 강한 UGT72E3 유전자를 과발현하는 형질전환체의 뿌리에서는 코니페린과 시린진이 야생형과 비슷한 수준으로 생성되었다. 그러나 재조합 유전자 UGT72E3/2 유전자의 과발현이 UGT72E3 유전자의 과발현에 비교해서 뿌리에서 11.2%의 시린진 생성 증가 효과를 보였다(도 5B 및 5C).
실시예 6. 당전이 효소 UGT72E3/2 염기서열과 아미노산 서열
기존에 알려진 당전이 효소 UGT72E3에 비교해서 시나필 알코올에 대한 기질 특이성은 유지하면서 당전이 효소 활성이 48.7% 이상 증가된 새로운 재조합 당전이 효소 UGT72E3/2 유전자의 염기서열과 암호화하고 있는 단백질의 아미노산 서열을 도 6에 나타내었다.
실시예 7. 당전이 효소 UGT72E2, UGT72E3, UGT72E2/3, UGT72E3/2 유전자들을 각각 과발현하는 애기장대 형질전환체 및 야생형 잎에서 제작한 단백질 추출물에 존재하는 당전이 효소들의 활성 비교
일반적으로 속씨식물 잎의 페닐프로파노이드 합성 경로의 활성화에 의해 생성되는 모노리그놀(monolignol)의 대부분은 코니페릴 알코올(coniferyl alcohol)이 코니페린으로 전환되고, 극히 일부의 코니페릴 알코올만이 F5H(furulate 5-hydroxylase), COMT(caffeic acid 3-O-methyltransferase) 및 CAD에 의한 연속적인 효소 작용에 의해서 시린진의 전구물질인 시나필 알코올(sinapyl alcohol)로 전환된다. 따라서 당전이 효소의 활성과 더불어 기질인 시나필 알코올의 공급은 시린진 생산의 중요한 결정요인이다.
당전이 효소들의 활성을 비교하기 위해 당전이 효소 UGT72E2, UGT72E3, UGT72E2/3 및 UGT72E3/2 유전자들을 각각 과발현하는 애기장대 형질전환체 및 야생형 잎에서 제작한 단백질 추출물에 기질로서 코니페릴 알코올 또는 시나필 알코올 1mM 및 UDP-글루코스 5mM을 첨가하고 22℃에서 60분간 반응시켰다. 그 후, 반응액에 2배 부피의 메탄올을 첨가하여 반응을 정지시키고, HPLC를 이용하여 반응 전과 후에 생성된 코니페린 및 시린진을 정량화하였다. 이미 생체 내(in vivo) 조건에서 확인된 선행 결과와 같이 재조합 당전이 효소 UGT72E3/2는 시나필 알코올에 대한 강한 기질 특이성이 있으면서 당전이 활성이 높았다. 특히 UGT72E3/2는 기질 첨가에 따른 시린진의 생성 속도가 다른 당전이 효소에 비해 우수하였다(도 7).
상기 결과는 UGT72E3/2를 과발현하는 형질전환체에 대사공학적 방법으로 시나필 알코올의 공급을 증가시키는 방법을 함께 사용한다면 식물체에서 고효율의 시린진 생성이 가능하다는 것을 나타낸다.
실시예 8. 시린진 합성을 위한 페닐프로파노이드 합성 경로 및 유전자 조절 부위
대사공학적 방법을 이용해서 재조합 당전이 효소 UGT72E3/2를 과발현하는 형질전환체에 시린진의 기질인 시나필 알코올을 효율적으로 공급하기 위하여 페닐프로파노이드 합성 경로의 각 단계별 과정 및 작용 효소들을 이용하였다. 시린진 합성 경로 중에서 쿠마릴(coumaryl)-CoA가 플라보노이드(flavonoid) 경로로 빠져나가는 양을 감소시키기 위해서 CHS(chalcone synthase) 유전자가 결함이 된 돌연변이체를 사용하였다. 또한, 쿠마릴-CoA의 페닐프로파노이드 합성 경로 진입을 강화하기 위해서 HCT(hydroxycinamoyl-CoA:shikimate/quinqte hydroxycinamoyl transferase) 유전자를 과발현시키고, 코니페릴 알코올로 전환되는 코니페릴 알데하이드의 양을 줄이고 시나필 알코올로의 전환을 촉진하기 위하여 F5H(ferulate 5-hydroxylase) 유전자를 과발현시키는 전략을 이용하였다(도 8).
실시예 9. 페닐프로파노이드 합성 경로 조절 유전자 HCT, F5H 및 Myb58 과발현 애기장대 형질전환체 제작 및 각 유전자의 발현량 확인
애기장대의 HCT, F5H 및 Myb58 유전자 코딩 영역을 수퍼프로모터에 의해 조절되도록 바이너리 벡터를 제작한 후, 상기 벡터를 아그로박테리움 투머파시엔스(Agrobacterium tumefaciens) EHA105에 도입한 후에 상기 박테리아를 사용하여 인 플랜타(in planta) 방법으로 애기장대를 형질전환시켰다. 이때 이미 하이그로마이신 저항성 선발 마커로 제작된 UGT72E3/2 과발현 형질전환체에 상기 HCT, F5H 및 Myb58 유전자들을 향후 교배 선발 방식을 통한 피라미드식으로 축적시킬 목적으로 카나마이신(HCT 및 F5H) 또는 제초제(Myb58) 저항성 선발 마커를 이용하여 각각 애기장대 형질전환체를 제작하였다.
형질전환체의 표현형은 도입된 전이 유전자의 발현 정도에 의해 크게 영향을 받기 때문에 선발된 형질전환체 중에서 HCT, F5H 및 Myb58 유전자가 안정적으로 유전체에 삽입되어 발현되는 양을 RT-PCR 방법을 이용하여 확인하였다. RT-PCR 분석시 도입된 유전자를 특이적으로 증폭하기 위해서 HCT 유전자 특이적 정방향 프라이머 HCT-F(5'-CTGGTTACTTTGGGAATGTGATATTCAC-3'; 서열번호 15), F5H 유전자 특이적 정방향 프라이머 F5H-F(5'-CAGACGAGTTGAAGAATCCGACATCGAG-3'; 서열번호 16) 및 Myb58 유전자 특이적 정방향 프라이머 Myb58-F(5'-CAGACGAGTTGAAGAATCCGACATCGAG-3'; 서열번호 17)를 이용하였고, 역방향 프라이머로는 벡터의 3' UTR 영역에 특이적인 프라이머 UTR-R(5'-TTAAAGCAGGGCATGCCTGC-3'; 서열번호 14)을 이용하였다. RNA의 상대적인 양을 보정하기 위해서 항상 일정하게 발현하는 애기장대의 액틴2 유전자를 참고 유전자로 사용하였다. 각각의 유전자당 10개 씩의 형질전환체를 조사하였고, 이 중에서 HCT, F5H 및 Myb58 유전자 발현이 우수한 형질전환체 라인을 최종 확보하였다(도 9). 또한, 애기장대에는 단 하나의 CHS 유전자가 존재하는데, 상기 유전자가 결함되면 씨앗 껍질의 색이 노란색으로 변하게 된다. 이와 같은 표현형의 차이를 이용하여 순종 형질전환체를 분리하였다.
실시예 10. 형질전환체의 잎 및 뿌리에서의 코니페린과 시린진 생성의 정량적 HPLC 분석
속씨식물은 페닐프로파노이드 합성 경로를 통해서 다음과 같은 3종류의 모노리그놀(monolignol)을 생성한다. p-쿠마릴 알코올(coumaryl alcohol)을 이용한 H 모노리그놀, 코니페릴 알코올을 이용한 G 모노리그놀 및 시나필 알코올을 이용한 S 모노리그놀이 생성된다. 그러나 대부분이 G 모노리그놀 형태이므로 식물세포 내의 코니페릴 알코올의 농도가 상대적으로 가장 높다. 당전이 효소 UGT72E2의 과발현은 고농도의 코니페릴 알코올을 코니페린으로 전환시킨다. 일부의 코니페릴 알코올은 F5H 및 COMT(caffeic acid 3-O-methyltransferase)의 효소적 작용에 의해서 시나필 알코올로 전환되기 때문에 식물세포 내의 시린진 전구물질인 시나필 알코올의 농도는 매우 낮다. 식물체 내에서 고효율의 시린진을 생성하기 위해서는 고효율의 당전이 효소 UGT72E3/2와 함께 시나필 알코올의 농도를 높일 수 있는 대사공학적 조절이 필요하다.
당전이 효소 UGT72E3/2 유전자와 페닐프로파노이드의 HCT, F5H 및 CHS 유전자의 시너지 효과 조사를 위하여 형질전환체의 잎과 뿌리에서 코니페린과 시린진 생성의 정량적 HPLC 분석을 수행하였다. 페닐프로파노이드 합성 경로의 중요 단계를 조절하는 HCT 및 F5H 유전자를 과발현하는 형질전환체를 각각 제작하고, 고효율 당전이 유전자 UGT72E3/2를 과발현하는 형질전환체와 교배를 시켰다. 그 후 F2 세대에서 HCT와 UGT72E3/2 또는 F5H와 UGT72E3/2 유전자를 함께 과발현하는 형질전환체를 각각 분리하고, 다음 세대에서 순종 라인을 확보하였다. 또한 페닐프로파노이드 경로의 중요 전구물질인 p-쿠마릴-CoA가 플라보노이드 합성 경로로 빠져나가는 것을 막기 위해서 p-쿠마릴-CoA를 칼콘(chalcone)으로 전환하는 CHS(chalcone synthase)가 결함이 된 돌연변이체와 UGT72E3/2를 과발현하는 형질전환체와 교배를 시키고, F2 세대에서 CHS 유전자가 녹아웃(knock-out)되고 UGT72E3/2 유전자가 과발현된 형질을 함께 가지는 라인을 분리한 후에 다음 세대에서 순종을 확인하였다.
상기 형질전환체의 잎과 뿌리에서 HPLC를 이용한 시린진의 합성 효율을 조사한 결과, UGT72E3/2 유전자만 단독으로 과발현된 형질전환체에 비해 HCT 또는 F5H 유전자의 과발현 그리고 CHS 유전자 기능 결함이 첨가된 식물체 라인의 잎에서 각각 시린진의 합성이 17.3%, 71.3% 및 64.6%씩 증가되는 양상을 나타내었다(도 10).
그러나 뿌리에서는 UGT72E3/2 유전자만 단독으로 과발현된 형질전환체에 비해 UGT72E3/2와 F5H 유전자가 과발현된 형질전환체 라인에서만 시린진 합성이 약간 증가된 것으로 나타났다(도 11).
실시예 11. UGT72E3/2, F5H 및 Myb58 유전자의 피라미딩을 이용한 시너지 효과에 의한 형질전환체의 잎 및 뿌리에서 시린진 생성의 정량적 HPLC 분석
효소공학 방법으로 개발한 시나필 알코올에 대한 특이성이 강한 새로운 당전이 유전자 UGT72E3/2와 페닐프로파노이드 경로 중의 코니페릴 알코올에서 시나필 알코올로의 전환에 관여하는 F5H 유전자의 과발현의 축적은 시린진의 생성율을 크게 증가하는 효과를 나타내었다. 그러나 식물의 뿌리는 빛에 노출이 되면 빛 신호전달 기작에 의해서 페닐프로파노이드 합성 경로에 관여하는 다양한 유전자의 발현이 증가된다. 그 결과 많은 양의 코니페릴 알코올 및 시나필 알코올을 포함하는 모노리그놀의 합성이 증가되기 때문에 야생형 뿌리에서의 시린진 합성량은 잎에 비해 36배 이상 많았다. UGT72E3/2와 F5H 유전자들을 과발현하는 형질전환체의 잎에서 시린진의 생성량이 야생형의 잎에서보다 16배 이상 증가하는 효과를 보였으나 형질전환체의 뿌리에서 생성되는 시린진의 양에 비교하면 여전히 4배 이상 낮았다. 잎에서 시린진의 생산량을 증가시킨다는 것은 뿌리에서와는 달리 식물체의 파괴 없이 대량 재배가 가능한 이점이 있다. 따라서 잎에서도 빛에 노출된 뿌리처럼 페닐프로파노이드 경로에 관여하는 많은 유전자의 발현을 증가시키는 방법이 필요하다.
상기 문제를 해결하기 위해 본 발명에서는 당전이 효소 UGT72E3/2 유전자, 페닐프로파노이드 합성 경로의 F5H 유전자 및 리그닌 합성 경로에 관여하는 유전자의 양성 조절 전사인자인 Myb58 유전자의 피라미딩을 이용한 시너지 효과에 의한 형질전환체의 시린진 생성을 정량적 HPLC 분석을 통해 측정하였다.
Myb58 유전자를 이용한 시너지 효과를 확인하기 위해 애기장대에서 리그닌 생합성 경로를 특이적으로 양성 조절하는 전사인자인 Myb58 유전자를 과발현하는 형질전환체를 제작하였다. Myb58 유전자는 F5H 유전자의 발현을 향상시킬 수 없으므로 UGT72E3/2와 F5H 유전자를 모두 과발현하는 형질전환체와 교배하여 F2 세대에서 Myb58, UGT72E3/2 및 F5H 유전자를 모두 과발현하는 형질전환체 라인을 선별하고 다음 세대에서 순종을 확보하였다. 이들 형질전환체의 잎과 뿌리에서 HPLC를 이용한 시린진의 합성 효율을 조사한 결과, UGT72E3/2, F5H 및 Myb58 유전자가 모두 과발현된 형질전환체의 잎에서 시린진의 생산량이 UGT72E3/2 및 F5H 유전자가 과발현된 형질전환체에 비해 8배, UGT72E3/2만 단독으로 과발현된 형질전환체에 비해서는 10배 증가하는 탁월한 효과를 확인하였다(도 12).
시린진 생성에 관련한 세 종류의 UGT72E3/2, F5H 및 Myb58 유전자의 시너지 효과에 의한 잎에서의 시린진의 효과적인 생산 결과는 유전자 수준에서의 분석 결과와 일치한다. Myb58 과발현에 의한 페닐프로파노이드 합성 경로에 관여하는 다양한 유전자의 발현을 증가시키고 Myb58에 의해서 조절 받지 않는 UGT72E3/2, F5H 유전자들을 별도로 과발현함으로써 형질전환체의 잎에서 시린진 생성량이 획기적으로 증가된다(도 14). 더욱이 상기 형질전환체의 잎에서의 시린진 생산량은 뿌리에서의 생산량보다도 약 2배 이상 증가한 것으로 나타났다. UGT72E3/2, F5H 및 Myb58 유전자의 과발현에 의한 시너지 효과로서 가장 이상적으로 뿌리에서의 시린진 생성이 2배 정도 감소하고 잎에서의 시린진 생성이 크게 증가하는 것을 확인하였고, 상기 방법으로 시린진을 대량 생산하는 식물 형질전환체를 완성하였다.

Claims (20)

  1. 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질.
  2. 제1항의 UGT72E3/2 단백질을 코딩하는 유전자.
  3. 제2항의 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터.
  4. 제3항의 재조합 벡터로 형질전환된 숙주세포.
  5. 제4항에 있어서, 상기 숙주세포는 식물세포인 것을 특징으로 하는 형질전환된 숙주세포.
  6. 제3항의 재조합 벡터로 식물세포를 형질전환시켜 UGT72E3/2 유전자를 과발현시키는 단계를 포함하는 야생형에 비해 식물체 내의 시린진(syringin) 합성을 증가시키는 방법.
  7. 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체.
  8. 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체.
  9. 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터, 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 6의 아미노산 서열로 이루어진 Myb58 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체.
  10. 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터, 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 8의 아미노산 서열로 이루어진 Myb63 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체.
  11. 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터 및 서열번호 10의 아미노산 서열로 이루어진 CHS(chalcone synthase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 형질전환되어 야생형에 비해 시린진 생산이 증가된 형질전환 식물체.
  12. (a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및
    (b) 상기 (a)단계의 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 야생형에 비해 시린진(syringin) 합성이 증가된 형질전환 식물체의 제조 방법.
  13. (a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (b) 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 F5H 단백질 과발현 형질전환 식물체를 제조하는 단계; 및
    (c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법.
  14. (a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (b) 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 F5H 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계;
    (d) 서열번호 6으로 이루어진 Myb58 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 Myb58 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (e) 상기 (c)단계의 선발된 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체와 상기 (d)단계의 Myb58 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질, F5H 단백질 및 Myb58 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법.
  15. (a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (b) 서열번호 4의 아미노산 서열로 이루어진 F5H(furulate 5-hydroxylase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 F5H 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 F5H 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계;
    (d) 서열번호 8의 아미노산 서열로 이루어진 Myb63 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 Myb63 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (e) 상기 (c)단계의 선발된 UGT72E3/2 단백질 및 F5H 단백질을 동시에 과발현하는 형질전환 식물체와 상기 (d)단계의 Myb63 단백질 과발현 형질전환 식물체를 교배하여 UGT72E3/2 단백질, F5H 단백질 및 Myb63 단백질을 동시에 과발현하는 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법.
  16. (a) 서열번호 2의 아미노산 서열로 이루어진 재조합 당전이 효소 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물체를 형질전환시켜 UGT72E3/2 단백질 과발현 형질전환 식물체를 제조하는 단계;
    (b) 서열번호 10의 아미노산 서열로 이루어진 CHS(chalcone synthase) 단백질을 코딩하는 유전자가 녹아웃(knock-out)된 식물체를 제조하는 단계; 및
    (c) 상기 (a)단계의 UGT72E3/2 단백질 과발현 형질전환 식물체와 상기 (b)단계의 CHS 단백질 코딩 유전자가 녹아웃된 식물체를 교배하여 UGT72E3/2 단백질을 과발현하고, CHS 단백질의 발현이 억제된 형질전환 식물체를 선발하는 단계를 포함하여 제조하는 것을 특징으로 하는 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체의 제조 방법.
  17. 제12항 내지 제16항 중 어느 한 항의 방법에 의해 제조된 야생형에 비해 시린진(syringin) 생산이 증가된 형질전환 식물체.
  18. 제17항에 있어서, 상기 식물체는 쌍자엽 식물인 것을 특징으로 하는 식물체.
  19. 제17항에 따른 형질전환 식물체의 종자.
  20. 서열번호 1의 염기서열로 이루어진 UGT72E3/2 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 유효성분으로 함유하는 식물체 내의 시린진(syringin) 합성 증가용 조성물.
PCT/KR2012/010856 2012-10-11 2012-12-13 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체 WO2014058104A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/435,445 US9644191B2 (en) 2012-10-11 2012-12-13 Method for producing transgenic plant with increase syringin production and plant produced by using the same
CN201280065997.8A CN104144604B (zh) 2012-10-11 2012-12-13 用于产生具有提高的丁香苷生成的转基因植物的方法及使用所述方法产生的植物

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020120112763A KR101399941B1 (ko) 2012-10-11 2012-10-11 식물체 내의 시린진 합성을 증가시키는 재조합 당전이 효소 단백질 코딩 유전자 및 이의 용도
KR10-2012-0112763 2012-10-11
KR1020120124906A KR101399946B1 (ko) 2012-11-06 2012-11-06 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체
KR10-2012-0124906 2012-11-06

Publications (1)

Publication Number Publication Date
WO2014058104A1 true WO2014058104A1 (ko) 2014-04-17

Family

ID=50477555

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/010856 WO2014058104A1 (ko) 2012-10-11 2012-12-13 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체

Country Status (3)

Country Link
US (1) US9644191B2 (ko)
CN (1) CN104144604B (ko)
WO (1) WO2014058104A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104829702B (zh) * 2015-05-14 2017-12-19 中国热带农业科学院橡胶研究所 一种橡胶树木质素合成调控相关蛋白HbMYB85及其编码基因与应用
CN111778258B (zh) * 2020-01-18 2022-09-16 西南科技大学 Myb140基因、构建的载体、表达的转基因烟草植株
CN116445519B (zh) * 2023-03-14 2023-10-24 皖西学院 一种糖基转移酶及其在生物合成丁香脂素葡萄糖苷中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100214883B1 (ko) * 1997-03-07 1999-08-02 박희준 간기능보호작용을 가지는 시린진의 약학적 조성물

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100214883B1 (ko) * 1997-03-07 1999-08-02 박희준 간기능보호작용을 가지는 시린진의 약학적 조성물

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI, GENBANK 11 June 2010 (2010-06-11), accession no. P_002866746.1 *
DATABASE NCBI, GENBANK 28 May 2011 (2011-05-28), accession no. P_198003.1 *
LANOT, A. ET AL.: "Redirection of flux through the phenylpropanoid pathway by increased glucosylation of soluble intermediates", PLANTA, vol. 228, no. 4, 18 June 2008 (2008-06-18), pages 609 - 616, XP019630360 *
LANOT, A. ET AL.: "The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana", THE PLANT JOURNAL, vol. 48, no. 2, 22 September 2006 (2006-09-22), pages 286 - 295 *
LIM, ENG-KIAT ET AL.: "Identification of glucosyltransferase genes involved in sinapate metabolism and lignin synthesis in Arabidopsis", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 6, 20 October 2000 (2000-10-20), pages 4344 - 4349, XP002172233, DOI: doi:10.1074/jbc.M007263200 *

Also Published As

Publication number Publication date
CN104144604B (zh) 2016-11-23
US9644191B2 (en) 2017-05-09
CN104144604A (zh) 2014-11-12
US20150252338A1 (en) 2015-09-10

Similar Documents

Publication Publication Date Title
Dong et al. Contribution of phenylpropanoid metabolism to plant development and plant–environment interactions
Zhu et al. CmMYB8 encodes an R2R3 MYB transcription factor which represses lignin and flavonoid synthesis in chrysanthemum
Blee et al. A lignin-specific peroxidase in tobacco whose antisense suppression leads to vascular tissue modification
DK2201121T3 (en) METHODS OF MANAGING PLANT SEED AND ORGANIZATION
Grunewald et al. The tapetal major facilitator NPF2. 8 is required for accumulation of flavonol glycosides on the pollen surface in Arabidopsis thaliana
Cui et al. ScGST3 and multiple R2R3-MYB transcription factors function in anthocyanin accumulation in Senecio cruentus
WO2014058104A1 (ko) 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체
WO2020085559A1 (ko) 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도
Zhou et al. Manipulating a Single Transcription Factor, Ant 1, Promotes Anthocyanin Accumulation in Barley Grains
KR101465692B1 (ko) AtbHLH113 유전자를 이용한 안토시아닌 생합성이 조절된 형질전환 식물체의 제조방법 및 그에 따른 식물체
WO2012148121A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ7 단백질과 그 유전자 및 이들의 용도
US20030126630A1 (en) Plant sterol reductases and uses thereof
BR112016008172B1 (pt) Método para modulação do crescimento de plantas
KR101399941B1 (ko) 식물체 내의 시린진 합성을 증가시키는 재조합 당전이 효소 단백질 코딩 유전자 및 이의 용도
WO2010110591A2 (ko) 환경 스트레스 유도성 프로모터 및 이의 용도
KR101399946B1 (ko) 시린진 생산이 증가된 형질전환 식물체의 제조 방법 및 그에 따른 식물체
KR102053089B1 (ko) 식물체 내의 코니페린 합성을 증가시키는 재조합 당전이 효소 단백질 코딩 유전자 및 이의 용도
WO2014209036A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도
WO2014209060A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg6 단백질과 그 유전자 및 이들의 용도
US8372616B2 (en) Homogentisic acid geranylgeranyl transerase polypeptide
KR102559326B1 (ko) 다중 유전자 발현 시스템을 이용한 코니페린 함량이 증가된 형질전환 식물체의 제조방법
US20060150268A1 (en) Plant-derived transferase genes
WO2016159560A1 (ko) 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 ＩｂＨＰＰＤ 유전자 및 이의 용도
EP2994479B1 (en) Modified expression of prolyl-4-hydroxylase in physcoitrella patens
KR102550242B1 (ko) 과잉면역반응 억제를 통한 생체중 및 시린진 생산량이 증대된 형질전환 식물체 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12886189

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14435445

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 12886189

Country of ref document: EP

Kind code of ref document: A1